Drug treatment for macular degeneration
By modulating the MMP2-DAMP-RAGE-sPLA2-II axis with specific inhibitors and activators, the compound addresses the complex role of MMPs in macular degeneration, effectively preventing and treating the condition and reducing drusen formation.
Patent Information
- Application Number
- PCT/US2025/024033
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-10
- Filing Date
- 2025-04-10
- Publication Date
- 2025-10-16
AI Technical Summary
Current treatments for macular degeneration and related macular dystrophies are inadequate, as they do not effectively address the complex role of matrix metalloproteinases (MMPs) in the pathophysiology of these conditions, leading to irreversible blindness.
A compound modulating the MMP2-DAMP-RAGE-sPLA2-II axis pathway is administered to regulate MMP activity, using activators or inhibitors such as MMP2 protein, RAGE inhibitors, and sPLA2-IIA inhibitors to treat macular degeneration.
Regulating MMP activity helps prevent and treat macular degeneration by reducing drusen formation and maintaining retinal health, thereby potentially slowing or reversing vision loss.
Smart Images

Figure US2025024033_16102025_PF_FP_ABST
Abstract
Description
[0001] TITLE OF THE INVENTION
[0002] Drug Treatment for Macular Degeneration
[0003] CROSS-REFERENCE TO RELATED APPLICATIONS
[0004] This application claims priority to, and benefit of, U.S. Provisional Application No. 63 / 632,123, filed April 10, 2024, which is hereby incorporated by reference in its entirety.
[0005] STATEMENT REGARDING GOVERNMENT SUPPORTED RESEARCH This invention was made with government support under EY028167 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0006] REFERENCE TO A SEQUENCE LISTING SUBMITTED AS AN XML FILE The present application hereby incorporates by reference the entire contents of the Sequence Listing contained in the XML file named “204606-0182-OOWO_SequenceListing.xml” which was created on April 8, 2025, and is 3,721 bytes in size.
[0007] BACKGROUND OF THE INVENTION
[0008] Age-related macular degeneration (AMD) and related macular dystrophies (MDs) like Sorsby’s fundus dystrophy (SFD), Doyne honeycomb macular dystrophy (DHRD) and autosomal dominant radial drusen (ADRD) show similar pathological manifestations and lead to irreversible blindness in affected adults (Capon et al., Ophthalmology. Dec 1989;96(12): 1769- 77; Marmorstein et al., Proc Natl Acad Set USA. Oct 1, 2002, 99(20): 13067-72; Fariss et al., Br J Ophthalmol. Nov 1998, 82(11): 1329-34). AMD / MDs show multi-tissue pathology in the eye with the primary disease manifestations localized to the retinal pigment epithelium (RPE)- choriocapillaris complex (McLeod et al., Invest Ophthalmol Vis Sci. Oct 2009, 50(10):4982-91). Furthermore, alterations of Bruch’s membrane, the extracellular matrix (ECM) underlying the RPE monolayer, are central to AMD / MD development (Bhutto et al., Mol Aspects Med. Aug 2012;33(4):295-317). Bruch’s membrane undergoes regulated turnover that involves protease- mediated degradation by matrix metalloproteinases (MMPs) and consistently several MMPs (e.g., MMP2, MMP3, MMP9) have been linked to AMD / MD pathophysiology (Nita et al., Med Sci Monit. 2014, 20: 1003-16; Alge-Priglinger et al., Invest Ophthalmol Vis Sci. Nov 2009, 50(11):5495-503; Hussain et al., Invest Ophthalmol Vis Sci. Jun 23, 2011 , 52(7)14459-66; Hongisto et al., J Pathol. October 2020, 252(2)1138-150).
[0009] Tissue inhibitor of metalloproteinase 3 (TIMP3) forms stable complexes with MMPs and is a negative regulator of several MMPs (e.g., MMP2, MMP3, MMP9) (Nagase et al., Cardiovasc Res . Feb 2006;69(3):562-73; Arpino et al., Matrix Biology . 2015;44-46:247-254). Genotype-agnostic proteomics and histopathologic studies have reliably shown increased levels of TIMP3 in Bruch’s membrane and drusen of AMD donor eyes (Kamei et al., Invest Ophthalmol Vis Sci. Sep 1999, 40(10)12367-75; Crabb et al., Proc Natl Acad Sei USA. Nov 12, 2002, 99(23)114682-7; Gourier et al., J Clin Med. May 04, 2015, 4(5)1874-83) and AMD patient- derived induced pluripotent stem cell RPE (iRPE) cultures (Senabouth et al., bioRxiv. 2021 :2021.08.19.457044). Similarly, increased levels of TIMP3 in RPE-Bruch’s membrane have been consistently documented in donor eyes and animal and cell culture models of AMD / MDs (Langton et al., Hum Mol Genet. Dec 1, 2005, 14(23)13579-86; Engel et al., Exp Eye Res. Feb 2022, 215: 108899; Senabouth et al., Nat Commun. Jul 26, 2022, 13(1)14233). Consistent with excess TIMP3 and consequently reduced activity of RPE-secreted MMPs (MMP2 / MMP9), ECM / Bruch’s membrane and drusen in relevant animal and cell culture models of MDs and AMD donor eyes have been reported to display reduced gelatinase (MMP2 / MMP9) activity (Leu et al., Exp Eye Res. Jan 2002;74(l): 141-54; Femandez-Godino et al., Hum Mol Genet. Oct 1, 2015, 24(19)15555-69). Consistently, collagen 4 (COL4), a major component of Bruch’s membrane that is proteolytically degraded by MMP2 and MMP9, aberrantly accumulates in AMD / MDs (Chong et al., Invest Ophthalmol Vis Sci. Mar 2000;41(3):898-902; Galloway et al., Proc Natl Acad Sci USA. Sep 26, 2017, 114(39):E8214-E8223; Sohn et al., Retina. Jan 2015, 35(1)148-57). However, in contrast to the aforementioned studies, increased MMP2 / MMP9 activity in wet-AMD is well-supported by cellular, genetic, and histopathologic studies (Bandy opadhyay et al., Invest Ophthalmol Vis Sci. Apr 2012, 53(4): 1953-61; Chau et al., Eye (Lond). Dec 2007, 21(12)11511-5; Hoffmann et al., Retina. Apr 2006, 26(4)1454-61; Steen et al., Invest Ophthalmol Vis Sci. Oct 1998, 39(11)12194-200; Lambert, The FASEB Journal, 17:2290- 2292). For example, MMP2 and MMP9 show prominent expression in choroidal neovascular membranes from wet-AMD patients. Similarly, mice lacking MMP2 and / or MMP9 were less prone to development of wet-AMD associated choroidal neovascularization (CNV) in a laser- induced model of CNV (Berglin et al., Investigative Ophthalmology & Visual Science 2003, 44(l):403; Lambert et al., The American Journal of Pathology 2002, 161 (4): 1247-1253).
[0010] Overall, consistent with optimal MMP(s) activity being necessary for matrix homeostasis and cell-matrix interaction, published literature supports a role of both decreased and increased levels of specific MMPs (e g., MMP2, MMP9) in AMD / MDs.
[0011] Thus, there is a need in the art for improved compositions and methods for treating and preventing macular degeneration. This invention satisfies this unmet need.
[0012] SUMMARY OF THE INVENTION
[0013] In one aspect, the present invention provides a compound of Formula (I), or a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof:
[0014] Formula (I) wherein
[0015] X is selected from the group consisting of N and CRX
[0016] Y is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;
[0017] Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.
[0018] L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenylene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;
[0019] R3and R4each represent mono to the maximum possible number of substitution;
[0020] Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NHiR3), -N(R5)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, 'S-alkyl, S(=O)2alkyl, -C(=O)NHR5, -C(=O)N(R5)2, -OC(=O)N(R5)2, -NHC(=O)NH(R5), -NHC(= O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R5)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R5is independently selected from the group consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
[0021] In Z represents -NH2. In some embodiments, the bonds between X and Y each represent ethylene. In some embodiments, R1represents -CH2Ph. In some embodiments, R2represents alkyl.
[0022] In some embodiments, the compound of Formula (I) is represented by Formula (II):
[0023] Formula (II) wherein L1represents NH or a single bond.
[0024] In some embodiments, the compound of Formula (I) is represented by Formula (III):
[0025] Formula (III) wherein L2represents NH or a single bond.
[0026] In some embodiments, the compound of Formula (I) is represented by one of the following structures:
[0027]
[0028] In one aspect, the present invention provides a method for treating macular degeneration or macular dystrophy in a subject, comprising administering to the subject a modulator of the MMP2-DAMP-RAGE-sPLA2-II axis pathway. In some embodiments, the modulator comprises at least one selected from the group consisting of: a. an activator of MMP2; b. an inhibitor of RAGE; and c. an inhibitor of sPLA2-IIA.
[0029] In some embodiments, the activator of MMP2 comprises one or more selected from the group consisting of MMP2 protein and a nucleic acid molecule encoding MMP2.
[0030] In some embodiments, the inhibitor of RAGE comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecule. In some embodiments, the inhibitor of RAGE comprises an antagonistic peptide comprising the amino acid sequence of ELKVLMEKEL (SEQ ID NO: 1). In some embodiments, the inhibitor of RAGE comprises one or more selected form the group consisting of FPS-ZM1, RBG01, RAGE203, RAGE208, RAGE229, and azeliragon.
[0031] In some embodiments, the inhibitor of sPLA2-IIA comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecule. In some embodiments, the inhibitor of sPLA2-IIA comprises is one or more selected from the group consisting of varespladib (LY315920), tanshinone I, sinapicacid, quinacrine, quercitrin, polydatin, KH064, KH067, GK241, AZD 2716, folipastatin, LY311727, YM-26734, luffariellolide, CAY10590, thioetheramide-PC, elemolic acid, BMS-181162, BMS-188184, thielocin A lp, thielocin B3, SB-203347, LY333013, and L 15920-morpholino-N-ethyl ester. In some embodiments, the inhibitor of sPLA2-IIA comprises a compound of Formula (I), or a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof:
[0032] Formula (I) wherein
[0033] X is selected from the group consisting of N and CRX
[0034] Y is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;
[0035] Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.
[0036] L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenylene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;
[0037] R3and R4each represent mono to the maximum possible number of substitution;
[0038] Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NHfR3), -N(R5)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, 'S-alkyl, S(=O)2alkyl, -C(=O)NHR5, -C(=O)N(R5)2, -OC(=O)N(R5)2, -NHC(=O)NH(R5), -NHC(= O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R5)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R5is independently selected from the group consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
[0039] In some embodiments, Z represents -NH2. In some embodiments, the bonds between X and Y each represent ethylene. In some embodiments, R1represents -CH2Ph. In some embodiments, R2represents alkyl. In some embodiments, the compound of Formula (I) is represented by Formula (II):
[0040] Formula (II) wherein L1represents NH or a single bond.
[0041] In some embodiments, the compound of Formula (I) is represented by Formula (III):
[0042] Formula (III) wherein L2represents NH or a single bond.
[0043] In some embodiments, the compound of Formula (I) is represented by one of the following structures:
[0044]
[0045] In some embodiments, the subject has age-related macular degeneration (AMD).
[0046] In some embodiments, the subject has a macular dystrophy selected from the group consisting of: Sorsby’s fundus dystrophy (SFD), Doyne honeycomb macular dystrophy (DHRD) and autosomal dominant radial drusen (ADRD).
[0047] BRIEF DESCRIPTION OF THE DRAWINGS
[0048] The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0049] Figure 1 depicts Western blot images of TIMP3 levels in the extracellular matrix (ECM) underlying control versus SFD iRPE at days 14, 30 and 90 of culture. TIMP3 levels were calculated relative to total cell count and are represented normalized to control sample. * p < 0.05, ** p< 0.01. n = 3-5 biological replicates. Data is presented as mean ± s.e.m.
[0050] Figure 2 depicts corresponding quantitative analyses of the Western blots presented in Figure 1. TIMP3 levels were calculated relative to total cell count and are represented normalized to control sample. * p < 0.05, ** p< 0.01. n = 3-5 biological replicates. Data is presented as mean ± s.e.m. Figure 3 depicts gelatin zymography images of total active MMP2 levels in the RPE- conditioned media (RPE-CM) collected from the basal chamber of control versus SFD iRPE cells at days 14, 30 and 90 in culture..
[0051] Figure 4 depicts the corresponding quantitative analyses of the data presented in Figure 3. Note that total active MMP2 levels was measured following activation with 2 mM / ?- aminophenylmercuric acetate (APMA). Furthermore, MMP2 activity was calculated relative to total protein quantified using SYPRO™ Ruby Protein blot stain. Data is represented as normalized to control. * p< 0.01, *** p<0.005. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0052] Figure 5 depicts transmission electron microscopy images showing absence of drusenlike deposits in day 30 SFD iRPE culture (top panel) but presence of sub-RPE drusen-like deposits (marked by white arrow, bottom panel) in day 90 SFD iRPE culture. Scale bar = 500 nm
[0053] Figure 6 depicts confocal microscopy images (top panel) and corresponding quantitative analyses of the count and area of co-localized APOE (green) and Nile Red (red) drusen deposits (on transwell membrane after removing RPE cells) beneath parallel cultures of day 90 control and SFD iRPE cells. Scale bar = 50 pm. Note the absence of DAPI-positive cells in the confocal images as RPE was removed prior to immunocytochemical analysis for drusen proteins on transwell membranes . ** p< 0.01. n = 3 biological replicates represented by three distinct colored data points. Data is presented as mean ± s.e.m.
[0054] Figure 7 is a schematic depicting the longitudinal changes in the levels of ECM TIMP3, activity of basally-secreted MMP2 activity and formation of drusen-like deposits at varying timepoints (Day 14, 30 and 90) in control versus SFD iRPE cultures.
[0055] Figure 8 depicts gelatin zymography images showing presence of pro-MMP2 and active MMP2 in basally-secreted RPE conditioned media (RPE-CM) collected from day 30 cultures of control and SFD iRPE cells. Note the absence of either pro-MMP9 or active MMP9 (92 and 82 kDa respectively) in day 30 gelatin zymograms of control and SFD iRPE samples. Note: Active MMP2 / 9 level was measured following activation with 1 mM / -amino phenylmercuric acetate (APMA).
[0056] Figure 9 depicts gelatin zymography images showing presence of pro-MMP2 and active MMP2 in basally-secreted RPE conditioned media (RPE-CM) collected from day 90 cultures of control and SFD iRPE cells. Note the absence of either pro-MMP9 or active MMP9 (92 and 82 kDa respectively) in day 90 gelatin zymograms of control and SFD iRPE samples. Note: Active MMP2 / 9 level was measured following activation with 1 mM / 2-amino phenylmercuric acetate (APMA).
[0057] Figure 10 is a table of MMP2 and TIMP3 expression analysis in RPE versus macrophages in published single-cell RNA-seq data.
[0058] Figure 11 is a schematic representation of the configuration of iRPE-macrophage (Mcp) co-culture (top panel) and iRPE-CC (bottom panel) that were utilized to evaluate the levels of basally-secreted MMP2 in control versus SFD cultures.
[0059] Figure 12 depicts gelatin zymography images showing levels of active MMP2 in the media collected from the basal chamber of control iRPE-macrophage (Mcp) versus SFD iRPE- macrophage (M(p) co-culture at day 3 of the co-culture.
[0060] Figure 13 presents the quantitative analyses of the data in Figure 12. *p<0.05. n = 4 biological replicates Data is presented as mean ± s.e.m.
[0061] Figure 14 depicts gelatin zymography images showing levels of active MMP2 in the media collected from the basal chamber of SFD iRPE-CC compared to control iRPE-CC at day 16 of culture. Note: Active MMP2 / 9 level was measured following activation with 1 mM p- amino phenylmercuric acetate (APMA).
[0062] Figure 15 presents the quantitative analyses of the data in Figure 14. *p<0.05, n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0063] Figure 16 depicts Western blot images of TIMP3 levels in the ECM underlying control versus DHRD and control versus AMD iRPE cells in day 30 cultures.
[0064] Figure 17 presents quantitative analyses of the Western blots in Figure 16. TIMP3 levels were calculated relative to total protein that was quantified using SYPRO1MRuby Protein blot stain. * p < 0.05. n = 3-6 biological replicates. Data is presented as mean ± s.e.m
[0065] Figure 18 presents gelatin zymography images of the levels of total active MMP2 in the RPE-CM collected from the basal chamber of control versus DHRD and control versus AMD iRPE cells at ~30 days of culture.
[0066] Figure 19 presents quantitative analyses of the gelatin zymography images of Figure 18. Note that total active MMP2 levels was measured following activation with 2 mM APMA.
[0067] Furthermore, MMP2 activity was calculated relative to total protein quantified using SYPRO™ Ruby Protein blot stain. Data is represented as normalized to control. * p < 0.05, *** p<0.005. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0068] Figure 20 depicts gelatin zymography images showing MMP2 activity in basally-secreted RPE conditioned media (RPE-CM) collected from day 14 cultures of control versus DHRD iRPE cells. Note that total active MMP2 levels was measured following activation with 1 mM >-amino phenylmercuric acetate (APMA).
[0069] Figure 21 depicts gelatin zymography images showing MMP2 activity in basally-secreted RPE conditioned media (RPE-CM) collected from day 14 cultures of control versus AMD iRPE cells. Note that total active MMP2 levels was measured following activation with 1 mM j>-amino phenylmercuric acetate (APMA).
[0070] Figure 22 depicts reverse zymography images showing TIMP3 activity in day 30 cultures of control versus SFD iRPE cells.
[0071] Figure 23 depicts reverse zymography images showing TIMP3 activity in day 30 cultures of control versus DHRD iRPE cells.
[0072] Figure 24 depicts reverse zymography images showing TIMP3 activity in day 30 cultures of control versus SFD AMD cells.
[0073] Figure 25 is a transmission electron microscopy image of day 30 DHRD iRPE culture showing absence of drusen-like deposits. Scale bar = 200 nm
[0074] Figure 26 depicts confocal microscopy images showing lack of co-localized APOE (green) and Nile Red (red) drusen deposits (on transwell membrane after removing RPE cells) in day 30 control and AMD iRPE cultures. Note: DAPI-positive cells are absent as RPE monolayer was removed prior to immunocytochemical analyses for drusen proteins on transwell membrane. Scale bar = 50 pm
[0075] Figure 27 is a transmission electron microscopy image of drusen-like deposits in day 90 DHRD iRPE culture. Scale bar = 200 nm
[0076] Figure 28 depicts confocal microscopy images (top panel) and corresponding quantitative analyses (bottom panel) showing count and area of APOE (green) and Nile Red (red) colocalized drusen deposits (on transwell membrane after removing RPE cells) beneath control versus AMD iRPE after ~90 days in culture. Note: The absence of DAPI-positive cells as RPE monolayer was removed prior to immunocytochemical analyses for drusen proteins on transwell membrane. Scale bar = 50 urn. *** p<0.005, n = 3 biological replicates represented by the three distinct colored data points. Data is presented as mean ± s.e.m.
[0077] Figure 29 depicts transmission electron microscopy (TEM) image showing drusen deposits (marked by white arrow) in aged (-day 90 in culture) AMD iRPE culture grown on transwell membrane (scale bar = 200 nm).
[0078] Figure 30 presents confocal microscopy images (left panel) and quantitative analyses (right panel) of the count and area of APOE (green) and Nile Red (red) co-localized drusen-like deposits (on transwell membrane after removing RPE cells) in control versus DHRD iRPE after -90 days in culture (scale bar = 50 p.m). Note: The absence of D API-positive cells since RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. ** p< 0.01, *** p<0.005, n = 3 biological replicates are represented by three distinct colors in plotted data points. Data is presented as mean ± s.e.m.
[0079] Figure 31 is a schematic showing the time course of ECM-TIMP3 accumulation, reduced MMP2 activity and presence of drusen-like deposits in DHRD and AMD iRPE cultures.
[0080] Figure 32 is a gelatin zymography image (top panel) and quantitative analyses (bottom panel) showing levels of active MMP2 in basally-secreted RPE-CM of untreated versus MMP2- II -treated cultures (5 p.M) at the 24-hour timepoint of treatment. Note: Total active MMP2 level was measured following activation with 4-Aminophenylmercuric Acetate (APMA). *p< 0.05. n = 3 biological replicates Data is presented as mean ± s.e.m
[0081] Figure 33 is a gelatin zymography image (top panel) and quantitative analyses (bottom panel) showing levels of active MMP2 in basal RPE-CM of untreated versus DOX-treated cultures (30 pM) at the 24-hour timepoint Note: Total active MMP2 level was measured following activation with 4-Aminophenylmercuric Acetate (APMA). *p< 0.05. n = 6 biological replicates. Data is presented as mean ± s.e.m. Data is presented as mean ± s.e.m.
[0082] Figure 34 is a quantitative analysis of the levels of RPE-secreted MMPs in basal RPE- CM of untreated versus MMP2-I1 -treated iRPE cultures (5 pM, daily) at the 48-hour timepoint. *** p<0.005. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0083] Figure 35 is a quantitative analysis of the levels of RPE-secreted MMPs in basal RPE- CM of untreated versus DOX-treated iRPE cultures (30 pM daily) at the 48-hour timepoint. *** p<0.005. n = 3 biological replicates. Data is presented as mean ± s.e.m. Figure 36 depicts Western blot images showing levels of PLA2G2A (sPLA2-TIA) in basally-secreted RPE-CM of untreated and bee venom-treated (10 pg / ml / 2 hrs) iRPE cultures.
[0084] Figure 37 presents a quantitative analysis of the data in Figure 36. *p< 0.05. n = 4 biological replicates. Data is presented as mean ± s.e.m.
[0085] Figure 38 presents the quantitative analyses showing levels of PGE2 in the basally- secreted RPE-CM of untreated versus bee-venom treated (10 pg / ml / 2 hrs) versus bee-venom treated (10 pg / ml / 2 hrs) and LY315920 (5 pM) supplemented iRPE cultures. *p< 0.05. n = 5-10 biological replicates. Data is presented as mean ± s.e.m.
[0086] Figure 39 depicts Western blot images (top) and corresponding quantification (bottom) showing levels of classic DAMP molecule (HMGB1) and PLA2G2A (sPLA2-IIA) in basally- secreted RPE conditioned media (RPE-CM) of untreated versus MMP2 inhibitor 1 (MMP2-I1)- treated (5 pM; daily for 6 days) iRPE cultures at day 3 (HMGB1) and day 6 (sPLA2-IIA) of treatment. Data is presented relative to total protein in the RPE-CM and was normalized to the untreated condition. Total protein in the RPE-CM was determined using SYPRO™ Ruby Protein blot stain. * p<0.05. n = 6 biological replicates. Data is presented as mean ± s.e.m.
[0087] Figure 40 depicts Western blot images showing levels of HMGB1 in basally-secreted RPE-CM of untreated and doxycycline (DOX)-treated (30 pM; daily for 6 days) iRPE cultures at day 3 of treatment.
[0088] Figure 41 presents a quantitative analysis of the data presented in Figure 40. *p< 0.05. n = 5-6 biological replicates. Data is presented as mean ± s.e.m.
[0089] Figure 42 depicts Western blot images showing RAGE and sPLA2-IIA levels in DOX- treated (30 pM; daily for 6 days) and Dox-treated and rage antagonistic peptide (RAP) supplemented iRPE cells compared to untreated iRPE cells.
[0090] Figure 43 presents a quantitative analysis of the data in Figure 42. * p<0.05. n = 3-5 biological replicates. Data is presented as mean ± s.e.m.
[0091] Figure 44 depicts a Western blot image (top) and corresponding quantification (bottom) showing RAGE levels in MMP2-I1 treated (5 pM; daily for 6 days) iRPE cells compared to untreated iRPE cells at day 6 of treatment. Data is presented relative to total protein and was normalized to untreated condition. Total protein in RPE cell lysate was determined using SYPRO™ Ruby Protein blot stain. * p<0.05. n = 4 biological replicates. Data is presented as mean ± s.e.m. Figure 45 depicts quantitative real time PCR analyses showing expression of complement pathway genes, C3 and CFB in MMP2-I1 treated (5 pM; daily for 6 days) iRPE cells compared to untreated iRPE cells at day 6 of treatment. 18S served as the housekeeping genes and data is presented relative to 18S and was normalized to untreated condition. * p< 0.05. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0092] Figure 46 depicts quantitative real-time PCR data showing expression of complement genes, complement component C3 (C3) and complement Factor B (CFB , in untreated versus DOX-treated (15 pM; daily for 10 days) iRPE cells. GAPDH served as the housekeeping control gene for data normalization. * p<0.05. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0093] Figure 47 depicts the transepithelial resistance (TER) measurement of untreated and MMP2-I1 treated (5 pM; daily for 6 days) cultures at baseline (day 0; prior to starting the treatment) and day 6 of MMP2-I1 treatment. The dashed lines represent the reported threshold of in vivo RPE TER. ** p<0.01. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0094] Figure 48 depicts a transepithelial resistance (TER) measurement of untreated versus DOX-treated (30 pM; daily for 6 days) iRPE cultures at baseline (day 0, prior to the start of treatment) and day 6 of treatment. The dashed lines (150 Q.cm'2) indicate reported TER of RPE in vivo. * p<0.05. n = 4-8 biological replicates. Data is presented as mean ± s.e.m.
[0095] Figure 49 is a transmission electron microscopy (TEM) image of an RPE section from MMP2-I1 treated iRPE culture showing presence of lipid deposits (white arrowheads) at day 14 of 5 pM daily treatment. Scale bar = 500 nm.
[0096] Figure 50 shows light microscopy images of Oil Red O positive neutral lipids in untreated versus MMP2-I1 treated (5 pM; daily for 14 days) iRPE cells.
[0097] Figure 51 presents the corresponding quantitative analyses of the data presented in Figure 50. Scale bar = 50 pm. n = 3 biological replicates. Data is presented as mean ± s.e.m
[0098] Figure 52 depicts confocal images of co-localized drusen deposits (on transwell membrane after removing RPE cells) containing Nile Red (red) positive neutral lipids and dru sen-resident proteins and, APOE (blue) and TIMP3 (green) beneath untreated versus DOX- treated (30 pM; daily for 6 days) iRPE cultures at day 6 of treatment (scale bar = 50 pm).
[0099] Figure 53 presents a quantitative analysis of the data in Figure 52. * p<0.05. n = 3 biological replicates. Data is presented as mean ± s.e.m. Figure 54 depicts TEM images of RPE sections from MMP2-I1 treated iRPE culture showing presence of drusen deposits (white arrowheads) at day 14 of 5 pM daily treatment. Scale bar = 500 nm.
[0100] Figure 55 depicts confocal images showing co-localization of drusen-resident proteins, sPLA2-IIA (green) and APOE (red) in drusen deposits (on transwell membrane after removing RPE cells) beneath untreated versus MMP2-I1 treated (5 pM; daily for 6 days) RPE cultures at day 6 of treatment. Scale bar = 50 pm. Note: The absence of DAPLpositive cells is because the RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane.
[0101] Figure 56 depicts quantitative analyses of the count and area of co-localized sPLA2-IIA (green) and APOE (red) positive drusen deposits in untreated versus MMP2-I1 treated (5 pM; daily for 6 days) iRPE cultures at day 6 of treatment. Data is presented normalized to count and area of untreated iRPE cultures. *** p<0.005. n = 3 biological replicates represented by three distinct colored data points.
[0102] Figure 57 depicts fluorescence microscopy images of Calcein-AM-stained live cells in untreated versus MMP2-I1 treated (5 pM; daily for 6 days) RPE cultures at baseline (day 0; prior to starting the treatment; top panel) and day 6 (bottom panel) of treatment. Scale bar = 50 pm.
[0103] Figure 58 depicts fluorescence images of Calcein-AM-stained live cells in untreated versus DOX-treated (30 pM; daily for 6 days) iRPE cultures at baseline (day 0; top panel) and day 6 (bottom panel) of treatment (scale bar = 50 pm).
[0104] Figure 59 depicts Western blot images showing levels of complement C3 in basally secreted RPE-CM of untreated versus DOX-treated (30 pM; daily for 6 days) versus DOX- treated (30 pM; daily for 6 days) and RAGE antagonist peptide (RAP) supplemented (5 pM; daily for 6 days) iRPE cultures.
[0105] Figure 60 presents the corresponding quantification for the blots of Figure 59. Data is presented normalized to Dox-treated cultures and was quantified relative to total protein in the RPE-CM of each sample. Total protein in RPE-CM was determined using determined using SYPRO™ Ruby Protein blot stain. * p<0.05, ** p<0.01. n = 4-6 biological replicates. Data is presented as mean ± s.e.m.
[0106] Figure 61 depicts TER measurement of DOX-treated (30 pM; daily for 6 days) versus DOX-treated (30 pM; daily for 6 days) and RAP supplemented (5 pM; daily for 6 days) iRPE cultures at baseline (day 0) and day 6 of treatments. Note that TER value remains unchanged in Dox treated cultures supplemented with RPA as opposed to only Dox treated cultures where TER reduces at day 6 compared to baseline. *** p<0.005. n = 3-5 biological replicates. Data is presented as mean ± s.e.m.
[0107] Figure 62 depicts Immunofluorescence images showing amount (count, area) of colocalized HMGB 1 (green), Nile Red (red) and APOE (blue) drusen deposits (on transwell membrane after removing RPE cells), beneath DOX-treated (30 pM; daily for 6 days) versus DOX-treated (30 pM; daily for 6 days) and RAP supplemented (5 pM; daily for 6 days) iRPE cultures at day 6 of treatment. Note: The absence of D API-positive cells is due to removal of RPE monolayer prior to staining for drusen proteins on transwell membrane.
[0108] Figure 63 presents the quantitative analyses of the data presented in Figure 62. Data is presented normalized to DOX-treated iRPE cultures. Scale bar = 50 pm. * p < 0.05; ** p < 0.01. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0109] Figure 64 depicts fluorescence images showing Calcein-AM-stained live cells at baseline (top panel) and day 6 (bottom panel) in DOX-treated (30 pM; daily for 6 days) versus DOX- treated (30 pM; daily for 6 days) and RAP supplemented (5 pM; daily for 6 days) iRPE cultures. Scale bar = 50 pm.
[0110] Figure 65 displays Western blot images showing levels of HMGB 1 and sPLA2-IIA in basally secreted RPE-CM of DOX-treated (30 pM; daily for 6 days) versus DOX-treated (30 pM; daily for 6 days) and MMP2 supplemented (150 nM; basally supplemented daily for 6 days) iRPE cultures at day 3 (HMGB1) and day 6 (sPLA2-IIA) of treatment respectively.
[0111] Figure 66 presents the quantitative analyses of the data presented in Figure 65. Data is presented normalized to DOX-treated cultures and quantified relative to total protein in the RPE- CM of each sample. Total protein in PRE-CM was determined using SPYRO™ Ruby Protein blot stain. * p<0.05. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0112] Figure 67 depicts TER measurement of DOX-treated (30 pM; daily for 6 days) versus DOX-treated (30 pM; daily for 6 days) and MMP2 supplemented (150 nM; basally supplemented daily for 6 days) iRPE cultures at baseline (day 0, before the start of treatment) and day 6 of treatment. The dashed lines mark the in vivo threshold of TER for RPE cells. Note that TER value remains unchanged in Dox+MMP2 supplemented cultures as opposed to only Dox treated cultures where TER reduces at day 6 compared to baseline. * p<0.05. n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0113] Figure 68 depicts immunofluorescence images showing amount (count, area) of colocalized TIMP3 (green), Nile Red (red) and APOE (blue) drusen deposits (on transwell membrane after removing RPE cells), beneath DOX-treated (30 pM; daily for 6 days) versus DOX-treated (30 pM; daily for 6 days) and MMP2 supplemented (150 nM; basally supplemented daily for 6 days) iRPE cultures at day 6 of treatment. Scale bar = 50 pm.
[0114] Figure 69 presents the corresponding quantification of the data presented in Figure 68. Data is presented normalized to DOX-treated iRPE cultures. Note: The absence of DAPI- positive cells is due to the fact that RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. *** p < 0.005. n= 3 biological replicates shown by three distinct colored data points. Data is presented as mean ± s.e.m.
[0115] Figure 70 depicts fluorescence microscopy images of Calcein-AM-stained live cells in DOX-treated (30 pM; daily for 6 days) versus DOX-treated (30 pM; daily for 6 days) and MMP2 supplemented (150 nM; basally supplemented daily for 6 days) iRPE cultures at baseline (day 0, before the start of treatment; top panel) and day 6 (bottom panel) of treatments. Scale bar = 50 pm.
[0116] Figure 71 depicts confocal images and quantitative analyses showing levels (count, area) of co-localized TIMP3 (green) and APOE (red) sub-RPE drusen deposits (on transwell membrane after removing RPE cells) in unsupplemented- versus MMP2-supplemented (150 nM; basally supplemented for 18h) in aged (>90 days in culture) SFD iRPE cultures. Data is presented normalized to unsupplemented SFD iRPE cultures. Note: The absence of D APIpositive cells since RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. Scale bar = 50 pm. * p<0.05; ** p<0.01. n = 3 biological replicates shown by three distinct colored data points. Data is presented as mean ± s.e.m
[0117] Figure 72 depicts confocal images and quantitative analyses showing amount (count, area) of co-localized TIMP3 (green) and APOE (red) drusen deposits (on transwell membrane after removing RPE cells) in day 90 DHRD iRPE cultures that were either unsupplemented- or MMP2-supplemented (150 nM; basally supplemented for 18 h). Data is presented normalized to unsupplemented DHRD iRPE cultures Note: The absence of DAPI-positive cells since RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. Scale bar = 50 pm. *** p < 0.005. n = 3 biological replicates shown by three distinct colored data points. Data is presented as mean ± s.e.m
[0118] Figure 73 depicts confocal images (c) and quantitative analyses (c’) of the count and area of co-localized sPLA2-IIA (green) / APOE (red) drusen deposits (on transwell membrane after removing RPE cells) in >90-day cultures of unsupplemented- versus MMP2-supplemented (150 nM; basally supplemented for 18 h) AMD iRPE cultures. Data is presented normalized to unsupplemented AMD iRPE cultures. Note: The absence of DAPI-positive cells since RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. Scale bar = 50 pm ** p<0.01. n = 3 biological replicates shown by three distinct colored data points. Data is presented as mean ± s.e.m.
[0119] Figure 74 depicts confocal images of co-localized APOE (green) and sPLA2-IIA (red) sub-RPE drusen deposits (on transwell membrane after removing RPE cells) in > day 90 unsupplemented- versus rage antagonist peptide (RAP)-supplemented (5 pM; daily for 14 days) SFD iRPE cultures. Scale bar = 50 pm.
[0120] Figure 75 depicts confocal images of co-localized APOE (green) and sPLA2-IIA (red) sub-RPE drusen deposits (on transwell membrane after removing RPE cells) in > day 90 unsupplemented- versus rage antagonist peptide (RAP)-supplemented (5 pM; daily for 14 days) DHRD iRPE cultures. Scale bar = 50 pm.
[0121] Figure 76 depicts confocal images of co-localized APOE (green) and sPLA2-IIA (red) sub-RPE drusen deposits (on transwell membrane after removing RPE cells) in > day 90 unsupplemented- versus rage antagonist peptide (RAP)-supplemented (5 pM; daily for 14 days) AMD iRPE cultures. Scale bar = 50 pm.
[0122] Figure 77 presents quantitative analyses of the data presented in Figure 74 through Figure 76. Note: The absence of DAPI-positive cells since RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. ** p<0.01 and *** p < 0.005. n = 3 biological replicates for each disease are represented by distinct colored data points. Data is presented as mean ± s.e.m.
[0123] Figure 78 depicts confocal images of > 90-day cultures showing amount (count, area) of co-localized APOE (green) and Nile Red (red) or APOE (green) and sPLA2-IIA (red) drusen deposits in unsupplemented versus sPLA2-IIA inhibitor-supplemented (5 pM; daily for 7 days) SFD iRPE. Note: The absence of D API-positive cells since RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. Scale bar = 50 pm.
[0124] Figure 79 depicts confocal images of > 90-day cultures showing amount (count, area) of co-localized APOE (green) and Nile Red (red) or APOE (green) and sPLA2-IIA (red) drusen deposits in unsupplemented versus sPLA2-IIA inhibitor-supplemented (5 pM; daily for 7 days) DHRD iRPE. Note: The absence of DAPI-positive cells since RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. Scale bar = 50 pm.
[0125] Figure 80 depicts confocal images of > 90-day cultures showing amount (count, area) of co-localized APOE (green) and Nile Red (red) or APOE (green) and sPLA2-IIA (red) drusen deposits in unsupplemented versus sPLA2-IIA inhibitor-supplemented (5 pM; daily for 7 days) AMD iRPE. Note: The absence of DAPI-positive cells since RPE monolayer was removed prior to immunostaining for drusen proteins on transwell membrane. Scale bar = 50 pm.
[0126] Figure 81 presents quantitative analyses of the data presented in Figure 78 through Figure 80. * p<0.05; ** p<0.01 and *** p < 0.005. n = 3 biological replicates for each disease are represented by distinct colored data points. Data is presented as mean ± s.e.m.
[0127] Figure 82 depicts confocal images showing levels of APOE (green), Nile Red (red) colocalized in parallel cultures of > day 90 untreated versus MMP2-supplemented (150 nM; supplemented basally for 18 hours) ADRD iRPE cultures. Note that drusen deposits were visualized after removing RPE cells on transwell membrane. Scale bar = 50 pm.
[0128] Figure 83 presents a quantitative analysis of the data in Figure 82. p* < 0.05, p*** p < 0.005. n = up to 3 biological replicates. Data is presented as mean ± s.e.m.
[0129] Figure 84 depicts confocal images showing levels of HMGB1 (green), Nile Red (red) colocalized drusen-like deposits in parallel cultures of > day 90 untreated versus MMP2- supplemented (150 nM; supplemented basally for 18 hours) ADRD iRPE cultures. Note that drusen deposits were visualized after removing RPE cells on transwell membrane. Scale bar = 50 pm.
[0130] Figure 85 presents a quantitative analysis of the data in Figure 84. p* < 0.05, p*** p < 0.005. n = up to 3 biological replicates. Data is presented as mean ± s.e.m.
[0131] Figure 86 depicts confocal images showing amount (count, area) of co-localized APOE (green) and sPLA2-IIA (red) drusen deposits (after removing RPE cells), beneath untreated versus RAP -treated (5 pM; daily for 14 days) ADRD iRPE cultures. Note that drusen deposits were visualized after removing RPE cells on transwell membrane. Scale bar = 50 pm.
[0132] Figure 87 presents a quantitative analysis of the data in Figure 86. * p < 0.05, ** p < 0.01, *** p < 0.005. n = up to 3 biological replicates. Data is presented as mean ± s.e.m.
[0133] Figure 88 depicts confocal images showing amount (count, area) of co-localized APOE (green) and Nile Red (red) drusen deposits (after removing RPE cells), beneath untreated versus sPLA2-IIA inhibitor (LY315920)-treated (5 pM; daily for 7 days) ADRD iRPE cultures. Note that drusen deposits were visualized after removing RPE cells on transwell membrane. Scale bar = 50 pm.
[0134] Figure 89 presents a quantitative analysis of the data in Figure 88. * p < 0.05, ** p < 0.01, *** p < 0.005. n = up to 3 biological replicates. Data is presented as mean ± s.e.m.
[0135] Figure 90 depicts a Western blot image showing TIMP3 levels in ECM underlying control versus ADRD iRPE cultures.
[0136] Figure 91 presents a quantitative analysis of the data in Figure 90. * p < 0.05, n = 3 biological replicates. Data is presented as mean ± s.e.m.
[0137] Figure 92 displays confocal images of donor tissue sections from an AMD patient (top panel) and normal adult (bottom panel) showing co-localization of HMGB1 (green) and APOE (red) in drusen underlying native human RPE cells. Scale bars = 50 pm. Note: Bruch’s membrane and RPE nuclei are denoted by a white arrow and arrowhead respectively.
[0138] Figure 93 displays confocal images of donor tissue sections from a Wet AMD patient (top panel) and normal adult (bottom panel) showing co-localization of sPLA2-IIA (green) and APOE (red) in drusen underlying native human RPE cells. Scale bars = 50 pm. Note: Bruch’s membrane and RPE nuclei are denoted by a white arrow and arrowhead respectively.
[0139] Figure 94 displays confocal images of donor tissue sections from an AMD patient (top panel) and normal adult (bottom panel) showing co-localization of (co-[2-carboxyethyl]pyrrole) CEP protein adducts (green) and APOE (red) in drusen underlying native human RPE cells. Scale bars = 50 pm. Note: Bruch’s membrane and RPE nuclei are denoted by a white arrow and arrowhead respectively.
[0140] Figure 95 depicts confocal images of a Dry AMD donor (top) and a normal donor (bottom) tissue sections showing localization of APOE (green) and PLA2G2A / sPLA2-IIA (red) RPE / drusen. RPE nuclei is demarcated by arrowhead and Bruch’s membrane location is indicated by an arrow in all images. Scale bar = 25 gm.
[0141] Figure 96 depicts Confocal images of a Dry AMD donor (top) and a normal donor (bottom) tissue sections showing localization of APOE (green) and PLA2G2A / sPLA2-IIA (red) RPE / drusen. RPE nuclei is demarcated by arrowhead and Bruch’s membrane location is indicated by an arrow in all images. Scale bar = 25 pm.
[0142] Figure 97 depicts Confocal images of a Wet AMD donor (top) and a normal donor (bottom) tissue sections showing localization of APOE (green) and PLA2G2A / sPLA2-IIA (red) RPE / drusen. RPE nuclei is demarcated by arrowhead and Bruch’s membrane location is indicated by an arrow in all images. Scale bar = 25 pm.
[0143] Figure 98 depicts Confocal images of a Wet AMD donor (top) and a normal donor (bottom) tissue sections showing localization of APOE (green) and PLA2G2A / sPLA2-IIA (red) RPE / drusen. RPE nuclei is demarcated by arrowhead and Bruch’s membrane location is indicated by an arrow in all images. Scale bar = 25 pm.
[0144] Figure 99 depicts Confocal images of an AMD donor tissue section showing localization of APOE (green) and PLA2G2A / sPLA2-IIA (red) RPE / drusen. RPE nuclei is demarcated by arrowhead and Bruch’s membrane location is indicated by an arrow in all images. Scale bar = 25 pm.
[0145] Figure 100 depicts Confocal images of a distinct AMD donor (top) and a normal donor (bottom) tissue sections showing localization of APOE (green) and PLA2G2A / sPLA2-IIA (red) RPE / drusen. RPE nuclei is demarcated by arrowhead and Bruch’s membrane location is indicated by an arrow in all images. Scale bar = 25 pm.
[0146] Figure 101 depicts confocal images showing co-localization of HMGB1 (green) and APOE (red) (top panel), sPLA2-IIA (green) and APOE (red) (middle panel), and CEP (green) with APOE (bottom panel) positive drusen-like deposits underlying > day 90 AMD iRPE cultures. Scale bars = 50 pm. Note: Bruch’s membrane and RPE nuclei are denoted by a white arrow and arrowhead respectively.
[0147] Figure 102 is a table of AMD and normal donor tissue used for immunohistochemistry.
[0148] Figure 103 depicts confocal images of in situ zymography (ISZ) measuring gelatinase activity in the RPE-Bruch’s membrane of wild-type versus Timp3KI mutmice. Bruch’s membrane is labeled with collagen 4 (COL4) antibody (red) and ISZ is shown in green. DAPI stained nuclei are shown in blue. Scale bars = 50 gm.
[0149] Figure 104 presents the quantitative analyses of the data presented in Figure 103. ** p < 0.01. n = 4 biological replicates are depicted by four distinct colored data points. Data is presented as mean ± s.e.m.
[0150] Figure 105 depicts a confocal image post- in situ zymography (ISZ) assay of wild-type mouse RPE-choroid sections showing gelatinase activity in the presence of DQ™ gelatin substrate Scale bar = 50 pm
[0151] Figure 106 depicts a confocal image post- in situ zymography (ISZ) assay of wild-type mouse RPE-choroid sections showing a lack of gelatinase activity in RPE-choroid sections incubated with both DQ™ gelatin substrate and an MMP inhibitor (1, 10 phenanthroline, bottom panel). Scale bar = 50 pm
[0152] Figure 107 depicts confocal images of gelatinase activity measured by ISZ in the choroid and RPE+ choroid of wild-type (WT) versus Timp3KI=mutmice. Note: RPE and Bruch’s membrane were demarcated using brightfield images and COL4 localization, respectively. RPE nuclei is demarcated by arrowhead and Bruch’s membrane location is indicated by an arow. Scale bar = 50 pm.
[0153] Figure 108 presents a quantitative analysis of the data presented in Figure 107. n = 4 biological replicates indicated by different colors. Data is presented as mean ± s.e.m.
[0154] Figure 109 depicts confocal and brightfield superimposed images post-immunostaining for PLA2G2A (sPLA2-IIA) of tissue sections from in Timp3Kl mutmice and an AMD donor . Note the pigmented RPE monolayer in both Timp3KI~mutmouse section and AMD donor tissue section. Bruch’s membrane is also labeled with collagen 4 (COL4) antibody (red)in Timp3KI~mutmice section. Note: Bruch’s membrane and RPE nuclei are denoted by a white arrow and arrowhead respectively.
[0155] Figure 110 depicts light microscopic images from 2 independent experiments showing vascular networks in parallel cultures of ichoriocapillaris (iCC) supplemented apically with RPE- CM derived from basal chamber of either untreated or MMP2-I1 (5 pM; daily for 6 days) treated control iRPE cultures. Note that both cultures received untreated control RPE-CM daily for 5-6 days till the formation of prominent vascular networks. Thereafter, one of the parallel cultures was switched to daily feeding of the MMP2-I1 RPE-CM cultures and the other cultures continued receiving untreated control RPE-CM till the end of the experiment at day 12-14. n= 2 independent experiments. Data is presented as mean ± s.e.m.
[0156] Figure 111 depicts a confocal image showing drusen-like deposits with presence of drusen-resident proteins APOE and complement complex C5b-9 in SFD iRPE sections. Scale bar = 25 pm.
[0157] Figure 112 depicts a confocal image showing drusen-like deposits with presence of drusen-resident proteins APOE and VTN in SFD iRPE sections. Scale bar = 25 pm.
[0158] Figure 113 depicts a confocal image showing drusen-like deposits with presence of drusen-resident proteins APOE and complement complex C5b-9 in AMD iRPE sections. Scale bar = 25 pm.
[0159] Figure 114 depicts a confocal image showing drusen-like deposits with presence of drusen-resident proteins APOE and VTN in AMD iRPE sections. Scale bar = 25 pm.
[0160] Figure 115 depicts a confocal image showing drusen-like deposits with presence of drusen-resident proteins APOE and TIMP3 in DHRD iRPE sections. Scale bar = 25 pm.
[0161] Figure 116 depicts a confocal image showing drusen-like deposits with presence of drusen-resident proteins APOE and CRY AB in DHRD iRPE sections. Scale bar = 25 pm.
[0162] Figure 117 depicts a confocal image confocal showing drusen-like deposits with colocalization of TIMP3 (green) and APOE (red) in an SFD iRPE section.
[0163] Figure 118 depicts a confocal image showing drusen-like deposits with co-localization of TIMP3 (green) and APOE (red) in a transwell membrane underlying SFD iRPE culture.
[0164] Figure 119 is a quantitative analyses of the count and area of co-localized TIMP3 and APOE positive in control versus SFD iRPE sections. Note that drusen deposits on transwell membrane were visualized after removing RPE cells.* p < 0.05. n = 3-7 biological replicates. Data is presented as mean ± s.e.m.
[0165] Figure 120 is a quantitative analyses of the count and area of co-localized TIMP3 and APOE positive in control versus transwell membranes underlying SFD iRPE cells. Note that drusen deposits were visualized after removing RPE cells. ** p < 0.01. n = 3-7 biological replicates. Biological replicates are represented by distinct colors in plotted data points. Data is presented as mean ± s.e.m.
[0166] Figure 121 is a table of primers used for screening of single nucleotide polymorphism (SNP) in CFH, ARMS2, HTRA1 and TIMP3 genes. Figure 122 is a table of single nucleotide polymorphism (SNP) analysis of ARMS2, CFH and HTRA1 and TIMP3 genes in Control, SFD, DHRD, ADRD and AMD iRPE lines.
[0167] Figure 123 depicts confocal microscopy images of Nile Red (Red, top), APOE (green, middle) and co-localization of Nile Red and APOE (bottom) drusen deposits in an induced pluripotent stem cell (iPSC) model of macular degeneration and dystrophy when untreated (left) or treated with PLG-00064 (right). Scale bar = 50 pm.
[0168] Figure 124 depicts quantitative analysis of the count (top), area (middle), and relative area (bottom) of co-localization of Nile Red and APOE from Figure 123, demonstrating a decrease in drusen deposits with PLG-00064 treatment, n = 3 biological replicates represented by three distinct colored data points. Data is presented as mean ± s.e.m.
[0169] DETAILED DESCRIPTION
[0170] In one aspect, the present disclosure is directed to compositions and methods for treating macular degeneration and / or macular dystrophy in a subject. In some embodiments, the methods comprise administering to the subject a modulator of the matrix metallopeptidase 2 (MMP2)- damage-associated molecular pattern molecule (DAMP)-receptor for advanced glycation endproducts (RAGE)-secretory phospholipase 2-IIA (sPLA2-IIA) axis pathway. In some embodiments, the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway modulator comprises one or more selected from the group consisting of an activator of MMP2, an inhibitor of RAGE, and an inhibitor of sPLA2-IIA. In some embodiments, the inhibitor of sPLA2-IIA is a compound of Formula (I) , or a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof:
[0171] Formula (I) wherein
[0172] X is selected from the group consisting of N and CRX Y is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;
[0173] Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.
[0174] L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenylene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;
[0175] R3and R4each represent mono to the maximum possible number of substitution;
[0176] Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NH(R5), -N(R5)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, 'S-alkyl, S(=O)2alkyl, -C(=O)NHR5, -C(=O)N(R5)2, -OC(=O)N(R5)2, -NHC(=O)NH(R5), -NHC(=O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R5)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R? is independently selected from the group consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
[0177] Definitions
[0178] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0179] As used herein, each of the following terms has the meaning associated with it in this section.
[0180] The articles “a” and “an” are used herein to refer to one or to more than one (z.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0181] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.
[0182] In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.
[0183] A disease or disorder is “alleviated” if the severity of a sign or symptom of the disease or disorder, the frequency with which such a sign or symptom is experienced by a patient, or both, is reduced.
[0184] The terms “patient,” “subject,” or “individual” are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In a non-limiting embodiment, the patient, subject or individual is a human.
[0185] As used herein, the term “pharmaceutical composition” refers to a mixture of at least one compound useful within the invention with a pharmaceutically acceptable carrier. The pharmaceutical composition facilitates administration of the compound to a patient or subject. Multiple techniques of administering a compound exist in the art including, but not limited to, intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary, and topical administration.
[0186] A “therapeutic” treatment is a treatment administered to a subject who exhibits signs or symptoms of pathology disease or disorder, for the purpose of diminishing or eliminating those signs or symptoms.
[0187] As used herein, the term “treatment” or “treating” is defined as the application or administration of a therapeutic agent, i.e., a compound of the invention (alone or in combination with another pharmaceutical agent), to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell from a patient (e.g., for diagnosis or ex vivo applications), who has a disease or disorder contemplated herein, a sign or symptom of a disease or disorder contemplated herein or the potential to develop a disease or disorder contemplated herein, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect a disease or disorder contemplated herein, the signs or symptoms of a disease or disorder contemplated herein or the potential to develop a disease or disorder contemplated herein. Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.
[0188] As used herein, the terms “effective amount,” “pharmaceutically effective amount" and “therapeutically effective amount” refer to a sufficient amount of an agent to provide the desired biological or physiologic result. That result may be reduction and / or alleviation of a sign, a symptom, or a cause of a disease or disorder, or any other desired alteration of a biological system. An appropriate effective amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
[0189] As used herein, the term “pharmaceutically acceptable” refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, i.e., the material may be administered to an individual without causing an undesirable biological effect or interacting in a deleterious manner with any of the components of the composition in which it is contained.
[0190] As used herein, the language “pharmaceutically acceptable salt” refers to a salt of the administered compound prepared from pharmaceutically acceptable non-toxic acids, including inorganic acids, organic acids, solvates, hydrates, or clathrates thereof. Examples of such inorganic acids are hydrochloric, hydrobromic, hydroiodic, nitric, sulfuric, phosphoric, acetic, hexafluorophosphoric, citric, gluconic, benzoic, propionic, butyric, sulfosalicylic, maleic, lauric, malic, fumaric, succinic, tartaric, amsonic, pamoic, p-tolunenesulfonic, and mesylic. Appropriate organic acids may be selected, for example, from aliphatic, aromatic, carboxylic and sulfonic classes of organic acids, examples of which are formic, acetic, propionic, succinic, camphorsulfonic, citric, fumaric, gluconic, isethionic, lactic, malic, mucic, tartaric, paratoluenesulfonic, glycolic, glucuronic, maleic, furoic, glutamic, benzoic, anthranilic, salicylic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, pantothenic, benzenesulfonic (besylate), stearic, sulfanilic, alginic, galacturonic, and the like. Furthermore, pharmaceutically acceptable salts include, by way of non-limiting example, alkaline earth metal salts (e.g., calcium or magnesium), alkali metal salts (e.g., sodium-dependent or potassium), and ammonium salts.
[0191] As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition, or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent, or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Typically, such constructs are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation, including the compound useful within the invention, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. As used herein, “pharmaceutically acceptable carrier” also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound useful within the invention and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions. The “pharmaceutically acceptable carrier” may further include a pharmaceutically acceptable salt of the compound useful within the invention. Other additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.
[0192] As used herein, the term “potency” refers to the dose needed to produce half the maximal response (ED50).
[0193] As used herein, the term “efficacy” refers to the maximal effect (Emax) achieved within an assay.
[0194] By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and / or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and / or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, such as a human.
[0195] The phrase “inhibit,” as used herein, means to reduce a molecule, a reaction, an interaction, a gene, an mRNA, and / or a protein’s expression, stability, function or activity by a measurable amount or to prevent entirely. Inhibitors are compounds that, e.g., bind to, partially or totally block stimulation, decrease, prevent, delay activation, inactivate, desensitize, or down regulate a protein, a gene, and an mRNA stability, expression, function and activity, e g., antagonists.
[0196] The phrase “activate,” as used herein, means to increase a molecule, a reaction, an interaction, a gene, an mRNA, and / or a protein’s expression, stability, function or activity by a measurable amount. Activators are compounds that, e g., bind to, increase stimulation, activate, sensitize, or upregulate a protein, a gene, and an mRNA stability, expression, function, and activity, e.g., agonists.
[0197] As used herein, “activity” includes physiological activity, binding affinity, and / or the enzymatic activity of a molecule.
[0198] As used herein, “MPP2” refers to matrix metalloproteinase 2.
[0199] As used herein, “DAMP” refers to damage-associated molecular pattern molecules.
[0200] As used herein, “RAGE” refers to receptor for advanced glycation end-products.
[0201] As used herein, “sPLA2-IIA” refers to secretory phospholipase 2-IIA.
[0202] As used herein, “associated” refers to coincidence with the development or manifestation of a disease, condition, or phenotype. Association may be due to, but is not limited to, genes responsible for housekeeping functions, those that are part of a pathway that is involved in a specific disease, condition, or phenotype and those that indirectly contribute to the manifestation of a disease, condition, or phenotype.
[0203] As used herein, the term “alkyl,” by itself or as part of another substituent means, unless otherwise stated, a straight or branched chain hydrocarbon having the number of carbon atoms designated (i.e. Ci-6 means one to six carbon atoms) and including straight, branched chain, or cyclic substituent groups. Examples include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, neopentyl, hexyl, and cyclopropylmethyl. As used herein, the term “substituted alkyl” means alkyl as defined above, substituted by one, two or three substituents selected from the group consisting of halogen, -OH, alkoxy, -NH2, amino, azido, -N(CH3)2, -C(=O)OH, trifluoromethyl, -C=N, -C(=O)O(Ci-C4)alkyl, -C(=0)NH2, -SO2NH2, -C(=NH)NH2, and -NO2. Examples of substituted alkyls include, but are not limited to, 2,2-difluoropropyl, 2-carboxy cyclopentyl and 3 -chloropropyl.
[0204] As used herein, the term “heteroalkyl” by itself or in combination with another term means, unless otherwise stated, a stable straight or branched chain alkyl group consisting of the stated number of carbon atoms and one or two heteroatoms selected from the group consisting of O, N, and S, and wherein the nitrogen and sulfur atoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quatemized. The heteroatom(s) may be placed at any position of the heteroalkyl group, including between the rest of the heteroalkyl group and the fragment to which it is attached, as well as attached to the most distal carbon atom in the heteroalkyl group. Examples include -O-CH2-CH2-CH3, -CH2-CH2-CH2-OH, -CH2-CH2-NH-CH3, -CH2-S-CH2-CH3, -CH2-CH2-S(=O)-CH3, and -CH2-CH2-S(=O)2-CH3. Up to two heteroatoms may be consecutive, such as, for example, -CH2-NH-O-CH3 or -CH2-CH2-S-S-CH .
[0205] “Alkylene” as used herein refers to a divalent hydrocarbyl group having the specified number of carbon atoms which can link two other groups together. Sometimes it refers to a group — (CH2)n — where n is 1-8, and preferably n is 1-4. Where specified, an alkylene can also be substituted by other groups and may include one or more degrees of unsaturation (i.e., an alkenylene or alkynylene moiety) or rings. The open valences of an alkylene need not be at opposite ends of the chain. Thus branched alkylene groups such as -CH(CH3)-, -CH2CH(CH3)-, and -C(CH3)2- are also included within the scope of the term ‘alkylenes’, as are cyclic groups such as cyclopropan- 1,1 -diyl and unsaturated groups such as ethylene (-CH=CH-) or propylene (-CH2-CH=CH-). Where an alkylene group is described as optionally substituted, the substituents include those typically present on alkyl groups as described herein. Examples of substituents include oxo, fluorine, chlorine, bromine, iodine, CN, -NH2, -OH, -NH(CH3), -N(CH3)2, -CH3, -CH2CH3, -CH(CH3)2, -CF3, -CH2CF3, -0CH3, -OCH2CH3, -OCH(CH3)2, -OCF3, -OCH2CF3, -S(=O)2-CH3, -C(=O)NH2, -C(=0)-NHCH3, -NHC(=0)NHCH3, -C(=O)CH3, -ON(O)2, or -C(=O)OH.
[0206] As used herein, heteroalkylene refers to an alkylene group as defined herein in which one or more of the carbon atoms is each independently replaced with the same or different heteroatom selected from O, S, N or C(O). In a preferred embodiment, heteroalkylene refers to an alkylene group as defined herein in which one or more of the carbon atoms is each replaced with an oxygen atom. In a preferred embodiment, heteroalkylene refers to an alkylene group as defined herein in which 1, 2, 3 or 4 of the carbon atoms is each replaced with an oxygen atom. Example of suitable C2-C6 heteroalkylene are -O-CH2, -O-CH2-CH2, -0-CH2-C(0), -O-CH2-C(O)-NH, -CH2-CH2-O-CH2-CH2, -O-CH2-CH2-O-CH2-CH2, -O-CH2-CH2-O-CH2-CH2-O-CH2-CH2, -O-CH2-CH2-(N-CH3)-CH2-CH2-O-CH2-CH2, -CH2-CH2-(N-CH3)-CH2-CH2, and -CH2-CH2-S-CH2-CH2.
[0207] As used herein, the term “alkoxy” employed alone or in combination with other terms means, unless otherwise stated, an alkyl group having the designated number of carbon atoms, as defined above, connected to the rest of the molecule via an oxygen atom, such as, for example, methoxy, ethoxy, 1 -propoxy, 2-propoxy (isopropoxy) and the higher homologs and isomers.
[0208] As used herein, the term “halo” or “halogen” alone or as part of another substituent means, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.
[0209] As used herein, the term “cycloalkyl” refers to a mono cyclic or polycyclic non-aromatic radical, wherein each of the atoms forming the ring (i.e., skeletal atoms) is a carbon atom. In some embodiments, the cycloalkyl group is saturated or partially unsaturated. In another embodiment, the cycloalkyl group is fused with an aromatic ring. Cycloalkyl groups include groups having from 3 to 10 ring atoms. Illustrative examples of cycloalkyl groups include, but are not limited to, the following moi eties:
[0210] Monocyclic cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Di cyclic cycloalkyls include, but are not limited to, tetrahydronaphthyl, indanyl, and tetrahydropentalene. Polycyclic cycloalkyls include adamantine and norbornane. The term cycloalkyl includes “unsaturated nonaromatic carbocyclyl” or “nonaromatic unsaturated carbocyclyl” groups, both of which refer to a nonaromatic carbocycle as defined herein, which contains at least one carbon double bond or one carbon triple bond.
[0211] As used herein, the term “heterocycloalkyl” or “heterocyclyl” refers to a heteroalicyclic group containing one to four ring heteroatoms each selected from O, S and N. In some embodiments, each heterocycloalkyl group has from 4 to 10 atoms in its ring system, with the proviso that the ring of said group does not contain two adjacent O or S atoms. In another embodiment, the heterocycloalkyl group is fused with an aromatic ring. In some embodiments, the nitrogen and sulfur heteroatoms may be optionally oxidized, and the nitrogen atom may be optionally quatemized. The heterocyclic system may be attached, unless otherwise stated, at any heteroatom or carbon atom that affords a stable structure. A heterocycle may be aromatic or nonaromatic in nature. In some embodiments, the heterocycle is a heteroaryl.
[0212] An example of a 3-membered heterocycloalkyl group includes, and is not limited to, aziridine. Examples of 4-membered heterocycloalkyl groups include, and are not limited to, azetidine and a beta lactam. Examples of 5-membered heterocycloalkyl groups include, and are not limited to, pyrrolidine, oxazolidine and thiazolidinedione. Examples of 6-membered heterocycloalkyl groups include, and are not limited to, piperidine, morpholine and piperazine. Other non-limiting examples of heterocycloalkyl groups are:
[0213]
[0214] Examples of non-aromatic heterocycles include monocyclic groups such as aziridine, oxirane, thiirane, azetidine, oxetane, thietane, pyrrolidine, pyrroline, pyrazolidine, imidazoline, dioxolane, sulfolane, 2, 3 -dihydrofuran, 2, 5 -dihydrofuran, tetrahydrofuran, thiophane, piperidine, 1,2,3,6-tetrahydropyridine, 1,4-dihydropyridine, piperazine, morpholine, thiomorpholine, pyran,
[0215] 2.3-dihydropyran, tetrahydropyran, 1,4-dioxane, 1,3-dioxane, homopiperazine, homopiperidine,
[0216] 1.3-dioxepane, 4,7-dihydro-l,3-dioxepin, and hexamethyleneoxide.
[0217] As used herein, the term “aromatic” refers to a carbocycle or heterocycle with one or more polyunsaturated rings and having aromatic character, i.e. having (4n + 2) delocalized it (pi) electrons, where n is an integer.
[0218] As used herein, the term “aryl,” employed alone or in combination with other terms, means, unless otherwise stated, a carbocyclic aromatic system containing one or more rings (typically one, two or three rings), wherein such rings may be attached together in a pendent manner, such as a biphenyl, or may be fused, such as naphthalene. Examples of aryl groups include phenyl, anthracyl, and naphthyl.
[0219] As used herein, the term “aryl-(Ci-C3)alkyl” means a functional group wherein a one- to three-carbon alkylene chain is attached to an aryl group, e.g., -CfbCfk-phenyl. In some embodiments, aryl-(Ci-C3)alkyl is aryl-CH2- or aryl-CH(CH3)-. The term “substituted aryl-(Ci-C3)alkyl” means an aryl-(Ci-C3)alkyl functional group in which the aryl group is substituted. Similarly, the term “heteroaryl-(Ci-C3)alkyl” means a functional group wherein a one to three carbon alkylene chain is attached to a heteroaryl group, e.g, -CHzCHz-pyridyl. The term “substituted heteroaryl-(Ci-C3)alkyl” means a heteroaryl-(Ci-C3)alkyl functional group in which the heteroaryl group is substituted.
[0220] As used herein, the term “heteroaryl” or “heteroaromatic” refers to a heterocycle having aromatic character. A polycyclic heteroaryl may include one or more rings that are partially saturated. Examples include the following moi eties:
[0221] Examples of heteroaryl groups also include pyridyl, pyrazinyl, pyrimidinyl (particularly 2- and 4-pyrimidinyl), pyridazinyl, thienyl, furyl, pyrrolyl (particularly 2-pyrrolyl), imidazolyl, thiazolyl, oxazolyl, pyrazolyl (particularly 3- and 5-pyrazolyl), isothiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,3,4-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,3,4-thiadiazolyl and 1,3,4-oxadiazolyl.
[0222] Examples of polycyclic heterocycles and heteroaryls include indolyl (particularly 3-, 4-, 5-, 6- and 7-indolyl), indolinyl, quinolyl, tetrahydroquinolyl, isoquinolyl (particularly 1- and 5 -isoquinolyl), 1,2,3,4-tetrahydroisoquinolyl, cinnolinyl, quinoxalinyl (particularly 2- and 5-quinoxalinyl), quinazolinyl, phthalazinyl, 1,8-naphthyridinyl, 1,4-benzodioxanyl, coumarin, dihydrocoumarin, 1,5-naphthyridinyl, benzofuryl (particularly 3-, 4-, 5-, 6- and 7-benzofuryl), 2,3-dihydrobenzofuryl, 1,2-benzisoxazolyl, benzothienyl (particularly 3-, 4-, 5-, 6-, and 7-benzothienyl), benzoxazolyl, benzothiazolyl (particularly 2-benzothiazolyl and 5-benzothiazolyl), purinyl, benzimidazolyl (particularly 2-benzimidazolyl), benzotriazolyl, thioxanthinyl, carbazolyl, carbolinyl, acridinyl, pyrrolizidinyl, and quinolizidinyl.
[0223] As used herein, the term “substituted” means that an atom or group of atoms has replaced hydrogen as the substituent attached to another group. The term “substituted” further refers to any level of substitution, namely mono-, di-, tri-, tetra-, or penta-substitution, where such substitution is permitted. The substituents are independently selected, and substitution may be at any chemically accessible position. In some embodiments, the substituents vary in number between one and four. In another embodiment, the substituents vary in number between one and three. In yet another embodiment, the substituents vary in number between one and two.
[0224] As used herein, the term “optionally substituted” means that the referenced group may be substituted or unsubstituted. In some embodiments, the referenced group is optionally substituted with zero substituents, i.e., the referenced group is unsubstituted. In another embodiment, the referenced group is optionally substituted with one or more additional group(s) individually and independently selected from groups described herein.
[0225] In some embodiments, the substituents are independently selected from the group consisting of oxo, halogen, -CN, -NHz, -OH, -NH(CH3), -N(CH3)2, alkyl (including straight chain, branched and / or unsaturated alkyl), substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, fluoroalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted alkoxy, fluoroalkoxy, -S-alkyl, S(=O)2alkyl, -C(=O)NH[substituted or unsubstituted alkyl, or substituted or unsubstituted phenyl], -C(=O)N[H or alkyl]?, - OC(=O)N[substituted or unsubstituted alkyl]2, -NHC(=O)NH[substituted or unsubstituted alkyl, or substituted or unsubstituted phenyl], -NHC(=O)alkyl, -Nfsubstituted or unsubstituted alkyl]C(=O)[substituted or unsubstituted alkyl], -NHC(=O)[substituted or unsubstituted alkyl], -C(OH)[substituted or unsubstituted alkyl]2, and -C(NH2)[substituted or unsubstituted alkyl]2. In another embodiment, by way of example, an optional substituent is selected from oxo, fluorine, chlorine, bromine, iodine, -CN, -NH2, -OH, -NH(CH3), -N(CH3)2, -CH3, -CH2CH3, -CH(CH3)2, -CF3, -CH2CF3, -0CH3, -OCH2CH3, -OCH(CH3)2, -OCF3, - OCH2CF3, -S(=O)2-CH3, -C(=O)NH2, -C(=O)-NHCH3, -NHC(=O)NHCH3, -C(=O)CH3, -ON(O)2, and -C(=O)OH. In yet one embodiment, the substituents are independently selected from the group consisting of C1-6 alkyl, -OH, C1-6 alkoxy, halo, amino, acetamido, oxo and nitro. In yet another embodiment, the substituents are independently selected from the group consisting of C1-6 alkyl, C1-6 alkoxy, halo, acetamido, and nitro. As used herein, where a substituent is an alkyl or alkoxy group, the carbon chain may be branched, straight or cyclic.
[0226] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0227] Compounds
[0228] The compounds of the present disclosure may be synthesized using techniques well- known in the art of organic synthesis. The starting materials and intermediates required for the synthesis may be obtained from commercial sources or synthesized according to methods known to those skilled in the art.
[0229] In one aspect, the present invention relates to a compound of Formula (I), or a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof:
[0230] Formula (I), wherein
[0231] X is selected from the group consisting of N and CRX
[0232] Y is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;
[0233] Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.
[0234] L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenylene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;
[0235] R3and R4each represent mono to the maximum possible number of substitution;
[0236] Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NH(R5), -N(R?)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, 'S-alkyl, S(=O)2alkyl, -C(=O)NHR5, -C(=O)N(R5)2, -OC(=O)N(R5)2, -NHC(=O)NH(R5), -NHC(=O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R5)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R5is independently selected from the group consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
[0237] In one embodiment, Z represents -NH2. In one embodiment, the bonds between X and Y each represent ethylene. In one embodiment, R1represents -CH2PI1. In one embodiment, R2represents alkyl.
[0238] In one embodiment, the compound of Formula (I) is represented by Formula (II):
[0239] Formula (II) wherein L1represents NH or a single bond.
[0240] In one embodiment, the compound of Formula (I) is represented by Formula (III): wherein L2represents NH or a single bond. In one embodiment, the compound of Formula (I) is represented by one of the following structures:
[0241] The compounds of the invention may possess one or more stereocenters, and each stereocenter may exist independently in either the R or S configuration. In some embodiments, compounds described herein are present in optically active or racemic forms. It is to be understood that the compounds described herein encompass racemic, optically-active, regioisomeric and stereoisomeric forms, or combinations thereof that possess the therapeutically useful properties described herein. Preparation of optically active forms is achieved in any suitable manner, including by way of non-limiting example, by resolution of the racemic form with recrystallization techniques, synthesis from optically-active starting materials, chiral synthesis, or chromatographic separation using a chiral stationary phase. In some embodiments, a mixture of one or more isomer is utilized as the therapeutic compound described herein. In another embodiment, compounds described herein contain one or more chiral centers. These compounds are prepared by any means, including stereoselective synthesis, enantioselective synthesis and / or separation of a mixture of enantiomers and / or diastereomers. Resolution of compounds and isomers thereof is achieved by any means including, by way of non-limiting example, chemical processes, enzymatic processes, fractional crystallization, distillation, and chromatography. The compounds described herein include the use of N-oxides (if appropriate), crystalline forms (also known as polymorphs), solvates, amorphous phases, and / or pharmaceutically acceptable salts of compounds having the structure of any compound of the invention, as well as metabolites and active metabolites of these compounds having the same type of activity. Solvates include water, ether (e.g., tetrahydrofuran, methyl tert-butyl ether) or alcohol (e.g., ethanol) solvates, acetates and the like. In some embodiments, the compounds described herein exist in solvated forms with pharmaceutically acceptable solvents such as water, and ethanol. In another embodiment, the compounds described herein exist in unsolvated form.
[0242] In some embodiments, the compounds of the invention may exist as tautomers. All tautomers are included within the scope of the compounds presented herein.
[0243] In some embodiments, compounds described herein are prepared as prodrugs. A “prodrug” refers to an agent that is converted into the parent drug in vivo. In some embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically, or therapeutically active form of the compound. In another embodiment, a prodrug is enzymatically metabolized by one or more steps or processes to the biologically, pharmaceutically, or therapeutically active form of the compound.
[0244] In some embodiments, sites on, for example, the aromatic ring portion of compounds of the invention are susceptible to various metabolic reactions. Incorporation of appropriate substituents on the aromatic ring structures may reduce, minimize, or eliminate this metabolic pathway. In some embodiments, the appropriate substituent to decrease or eliminate the susceptibility of the aromatic ring to metabolic reactions is, by way of example only, a deuterium, a halogen, or an alkyl group.
[0245] Compounds described herein also include isotopically-labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes suitable for inclusion in the compounds described herein include and are not limited to2H,3H,nC,13C,14C,36C1,18F,123I,125I,13N,15N,15O,17O,18O,32P, and35S. In some embodiments, isotopically-labeled compounds are useful in drug and / or substrate tissue distribution studies. In another embodiment, substitution with heavier isotopes such as deuterium affords greater metabolic stability (for example, increased in vivo half-life or reduced dosage requirements). In yet another embodiment, substitution with positron emitting isotopes, such asnC,18F,1?0 and13N, is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically-labeled reagent in place of the nonlabeled reagent otherwise employed.
[0246] In some embodiments, the compounds described herein are labeled by other means, including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.
[0247] The compounds described herein, and other related compounds having different substituents are synthesized using techniques and materials described herein and as described, for example, in Fieser & Fieser's Reagents for Organic Synthesis, Volumes 1-17 (John Wiley and Sons, 1991); Rodd's Chemistry of Carbon Compounds, Volumes 1-5 and Suppiementals (Elsevier Science Publishers, 1989); Organic Reactions, Volumes 1-40 (John Wiley and Sons, 1991), Larock's Comprehensive Organic Transformations (VCH Publishers Inc., 1989), March, Advanced Organic Chemistry 4thEd., (Wiley 1992); Carey & Sundberg, Advanced Organic Chemistry 4th Ed., Vols. A and B (Plenum 2000, 2001), and Green & Wuts, Protective Groups in Organic Synthesis 3rd Ed., (Wiley 1999) (all of which are incorporated by reference in their entirety). General methods for the preparation of compound as described herein are modified by the use of appropriate reagents and conditions, for the introduction of the various moieties found in the formula as provided herein.
[0248] Compounds described herein are synthesized using any suitable procedures starting from compounds that are available from commercial sources or are prepared using procedures described herein.
[0249] In some embodiments, reactive functional groups, such as hydroxyl, amino, imino, thio or carboxy groups, are protected in order to avoid their unwanted participation in reactions. Protecting groups are used to block some or all of the reactive moieties and prevent such groups from participating in chemical reactions until the protective group is removed. In another embodiment, each protective group is removable by a different means. Protective groups that are cleaved under totally disparate reaction conditions fulfill the requirement of differential removal.
[0250] In some embodiments, protective groups are removed by acid, base, reducing conditions (such as, for example, hydrogenolysis), and / or oxidative conditions. Groups such as trityl, dimethoxytrityl, acetal and t-butyldimethylsilyl are acid labile and are used to protect carboxy and hydroxy reactive moieties in the presence of amino groups protected with Cbz groups, which are removable by hydrogenolysis, and Fmoc groups, which are base labile. Carboxylic acid and hydroxy reactive moieties are blocked with base labile groups such as, but not limited to, methyl, ethyl, and acetyl, in the presence of amines that are blocked with acid labile groups, such as t- butyl carbamate, or with carbamates that are both acid and base stable but hydrolytically removable.
[0251] In some embodiments, carboxylic acid and hydroxy reactive moieties are blocked with hydrolytically removable protective groups such as the benzyl group, while amine groups capable of hydrogen bonding with acids are blocked with base labile groups such as Fmoc. Carboxylic acid reactive moieties are protected by conversion to simple ester compounds as exemplified herein, which include conversion to alkyl esters, or are blocked with oxidativelyremovable protective groups such as 2,4-dimethoxybenzyl, while co-existing amino groups are blocked with fluoride labile silyl carbamates.
[0252] Allyl blocking groups are useful in the presence of acid- and base- protecting groups since the former are stable and are subsequently removed by metal or pi-acid catalysts. For example, an allyl-blocked carboxylic acid is deprotected with a palladium-catalyzed reaction in the presence of acid labile t-butyl carbamate or base-labile acetate amine protecting groups. Yet another form of protecting group is a resin to which a compound or intermediate is attached. As long as the residue is attached to the resin, that functional group is blocked and does not react. Once released from the resin, the functional group is available to react.
[0253] Typically blocking / protecting groups may be selected from:
[0254]
[0255] Other protecting groups, plus a detailed description of techniques applicable to the creation of protecting groups and their removal are described in Greene & Wuts, Protective Groups in Organic Synthesis, 3rd Ed., John Wiley & Sons, New York, NY, 1999, and Kocienski, Protective Groups, Thieme Verlag, New York, NY, 1994, which are incorporated herein by reference for such disclosure.
[0256] Modulators
[0257] In various embodiments, the disclosure provides compositions for modulating the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. In some embodiments, a modulator of the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. In some embodiments, a modulator of the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is an inhibitor of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway.
[0258] Activators
[0259] In certain embodiments, the composition comprises an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. In one embodiment, the activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is any compound or molecule that increases the level, activity, or both of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. It will be understood by one skilled in the art, based upon the disclosure provided herein, that an increase in the level of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway encompasses the increase in one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway expression, including transcription, translation, or both. The skilled artisan will also appreciate, once armed with the teachings of the present invention, that an increase in the level of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway includes an increase in one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway activity (e.g., enzymatic activity, substrate binding activity, etc.). Thus, increasing the level or activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway includes, but is not limited to, increasing the amount of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway polypeptide, and increasing transcription, translation, or both, of a nucleic acid encoding one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway; and it also includes increasing any activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway polypeptide as well.
[0260] The increased level or activity of one or more molecules in the MMP2-DAMP-RAGE- sPLA2-IIA axis pathway can be assessed using a wide variety of methods, including those disclosed herein, as well as methods well-known in the art or to be developed in the future. That is, the routineer would appreciate, based upon the disclosure provided herein, that increasing the level or activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway can be readily assessed using methods that assess the level of a nucleic acid encoding one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway (e.g., mRNA), the level of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway polypeptide, and / or the level of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway activity in a biological sample obtained from a subject.
[0261] One of skill in the art will realize that in addition to activating one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway directly, diminishing the amount or activity of a molecule that itself diminishes the amount or activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway can serve to increase the amount or activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. Thus, an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway can include, but should not be construed as being limited to, a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecule. One of skill in the art would readily appreciate, based on the disclosure provided herein, that an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway encompasses a chemical compound that increases the level, enzymatic activity, or substrate binding activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. Additionally, an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway encompasses a chemically modified compound, and derivatives, as is well known to one of skill in the chemical arts.
[0262] The activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway compositions and methods of the invention that increase the level or activity (e.g., enzymatic activity, substrate binding activity, etc.) of one or more molecules in the MMP2- DAMP-RAGE-sPLA2-IIA axis pathway include antibodies. The antibodies of the invention include a variety of forms of antibodies including, for example, polyclonal antibodies, monoclonal antibodies, intracellular antibodies (“intrabodies”), Fv, Fab and F(ab)2, single chain antibodies (scFv), heavy chain antibodies (such as camelid antibodies), synthetic antibodies, chimeric antibodies, and humanized antibodies. In one embodiment, the antibody of the invention is an antibody that specifically binds to one or more molecules in the MMP2-DAMP- RAGE-sPLA2-IIA axis pathway.
[0263] Further, one of skill in the art would, when equipped with this disclosure and the methods exemplified herein, appreciate that an activator of one or more molecules in the MMP2-DAMP- RAGE-sPLA2-IIA axis pathway includes such activators as discovered in the future, as can be identified by well-known criteria in the art of pharmacology, such as the physiological results of activation of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway as described in detail herein and / or as known in the art. Therefore, the present invention is not limited in any way to any particular activator of one or more molecules in the MMP2-DAMP- RAGE-sPLA2-IIA axis pathway as exemplified or disclosed herein; rather, the invention encompasses those activators that would be understood by the routineer to be useful as are known in the art and as are discovered in the future.
[0264] Further methods of identifying and producing an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway are well known to those of ordinary skill in the art, including, but not limited, obtaining an activator from a naturally occurring source (e.g., Streptomyces sp., Pseudomonas sp., Stylotella aurantium, etc.). Alternatively, an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway can be synthesized chemically. Further, the routineer would appreciate, based upon the teachings provided herein, that an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway can be obtained from a recombinant organism. Compositions and methods for chemically synthesizing activators of one or more molecules in the MMP2-DAMP-RAGE- sPLA2-IIA axis pathway and for obtaining them from natural sources are well known in the art and are described in the art.
[0265] One of skill in the art will appreciate that an activator can be administered as a small molecule chemical, a protein, an antibody, a nucleic acid construct encoding a protein, or combinations thereof. Numerous vectors and other compositions and methods are well known for administering a protein or a nucleic acid construct encoding a protein to cells or tissues. Therefore, the invention includes a method of administering a protein or a nucleic acid encoding a protein that is an activator of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. (Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York; Ausubel et al., 1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).
[0266] One of skill in the art will realize that diminishing the amount or activity of a molecule that itself diminishes the amount or activity of one or more molecules in the MMP2-DAMP- RAGE-sPLA2-IIA axis pathway can serve to increase the amount or activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. Antisense oligonucleotides are DNA or RNA molecules that are complementary to some portion of a mRNA molecule. When present in a cell, antisense oligonucleotides hybridize to an existing mRNA molecule and inhibit translation into a gene product. Inhibiting the expression of a gene using an antisense oligonucleotide is well known in the art (Marcus-Sekura, 1988, Anal. Biochem. 172:289), as are methods of expressing an antisense oligonucleotide in a cell (Inoue, U.S. Pat. No. 5,190,931). The methods of the invention include the use of antisense oligonucleotide to diminish the amount of a molecule that causes a decrease in the amount or activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway, thereby increasing the amount or activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. Contemplated in the present invention are antisense oligonucleotides that are synthesized and provided to the cell by way of methods well known to those of ordinary skill in the art. As an example, an antisense oligonucleotide can be synthesized to be between about 10 and about 100 nucleotides long. In one embodiment, antisense oligonucleotide can be synthesized to be between about 15 and about 50 nucleotides long. The synthesis of nucleic acid molecules is well known in the art, as is the synthesis of modified antisense oligonucleotides to improve biological activity in comparison to unmodified antisense oligonucleotides (Tullis, 1991, U.S. Pat. No. 5,023,243).
[0267] Similarly, the expression of a gene may be inhibited by the hybridization of an antisense molecule to a promoter or other regulatory element of a gene, thereby affecting the transcription of the gene. Methods for the identification of a promoter or other regulatory element that interacts with a gene of interest are well known in the art, and include such methods as the yeast two hybrid system (Bartel and Fields, eds., In: The Yeast Two Hybrid System, Oxford University Press, Cary, N.C.).
[0268] Alternatively, inhibition of a gene expressing a protein that diminishes the level or activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway can be accomplished through the use of a ribozyme. Using ribozymes for inhibiting gene expression is well known to those of skill in the art (see, e.g., Cech et al., 1992, J. Biol. Chem. 267: 17479; Hampel et al., 1989, Biochemistry 28: 4929; Altman et al., U.S. Pat. No. 5,168,053). Ribozymes are catalytic RNA molecules with the ability to cleave other single- stranded RNA molecules. Ribozymes are known to be sequence specific, and can therefore be modified to recognize a specific nucleotide sequence (Cech, 1988, J. Amer. Med. Assn. 260:3030), allowing the selective cleavage of specific mRNA molecules. Given the nucleotide sequence of the molecule, one of ordinary skill in the art could synthesize an antisense oligonucleotide or ribozyme without undue experimentation, provided with the disclosure and references incorporated herein.
[0269] Inhibitors In one embodiment, the present invention provides a composition for regulating immune cell activation. In one embodiment, the present invention provides a composition for treating or preventing a disease or disorder associated with abnormal immune cell activation. In certain embodiments, the composition inhibits the expression, activity, or both of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway.
[0270] In one embodiment, the composition of the invention comprises an inhibitor of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. An inhibitor of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is any compound, molecule, or agent that reduces, inhibits, or prevents the function of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. For example, an inhibitor of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is any compound, molecule, or agent that reduces expression, activity, or both of one or more molecules in the MMP2-DAMP- RAGE-sPLA2-IIA axis pathway. In one embodiment, an inhibitor of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway comprises a nucleic acid, a peptide, a small molecule, an siRNA, a ribozyme, an antisense nucleic acid, an antagonist, an aptamer, a peptidomimetic, or any combination thereof.
[0271] Small molecule inhibitors
[0272] In various embodiments, the inhibitor is a small molecule. When the inhibitor is a small molecule, a small molecule may be obtained using standard methods known to the skilled artisan. Such methods include chemical organic synthesis or biological means. Biological means include purification from a biological source, recombinant synthesis and in vitro translation systems, using methods well known in the art. In one embodiment, a small molecule inhibitor of the invention comprises an organic molecule, inorganic molecule, biomolecule, synthetic molecule, and the like.
[0273] Combinatorial libraries of molecularly diverse chemical compounds potentially useful in treating a variety of diseases and conditions are well known in the art as are method of making the libraries. The method may use a variety of techniques well-known to the skilled artisan including solid phase synthesis, solution methods, parallel synthesis of single compounds, synthesis of chemical mixtures, rigid core structures, flexible linear sequences, deconvolution strategies, tagging techniques, and generating unbiased molecular landscapes for lead discovery vs. biased structures for lead development.
[0274] In a general method for small library synthesis, an activated core molecule is condensed with a number of building blocks, resulting in a combinatorial library of covalently linked, corebuilding block ensembles. The shape and rigidity of the core determines the orientation of the building blocks in shape space. The libraries can be biased by changing the core, linkage, or building blocks to target a characterized biological structure (“focused libraries”) or synthesized with less structural bias using flexible cores.
[0275] The small molecule and small molecule compounds described herein may be present as salts even if salts are not depicted and it is understood that the invention embraces all salts and solvates of the inhibitors depicted here, as well as the non-salt and non-solvate form of the inhibitors, as is well understood by the skilled artisan. In some embodiments, the salts of the inhibitors of the invention are pharmaceutically acceptable salts.
[0276] Where tautomeric forms may be present for any of the inhibitors described herein, each and every tautomeric form is intended to be included in the present invention, even though only one or some of the tautomeric forms may be explicitly depicted. For example, when a 2- hydroxypyridyl moiety is depicted, the corresponding 2-pyridone tautomer is also intended.
[0277] The invention also includes any or all of the stereochemical forms, including any enantiomeric or diastereomeric forms of the inhibitors described. The recitation of the structure or name herein is intended to embrace all possible stereoisomers of inhibitors depicted. All forms of the inhibitors are also embraced by the invention, such as crystalline or non-crystalline forms of the inhibitors. Compositions comprising an inhibitor of the invention are also intended, such as a composition of substantially pure inhibitor, including a specific stereochemical form thereof, or a composition comprising mixtures of inhibitors of the invention in any ratio, including two or more stereochemical forms, such as in a racemic or non-racemic mixture.
[0278] In one embodiment, the small molecule inhibitor of the invention comprises an analog or derivative of an inhibitor described herein.
[0279] In one embodiment, the small molecules described herein are candidates for derivatization. As such, in certain instances, the analogs of the small molecules described herein that have modulated potency, selectivity, and solubility are included herein and provide useful leads for drug discovery and drug development. Thus, in certain instances, during optimization new analogs are designed considering issues of drug delivery, metabolism, novelty, and safety.
[0280] In some instances, small molecule inhibitors described herein are derivatized / analoged as is well known in the art of combinatorial and medicinal chemistry. The analogs or derivatives can be prepared by adding and / or substituting functional groups at various locations. As such, the small molecules described herein can be converted into derivatives / analogs using well known chemical synthesis procedures. For example, all of the hydrogen atoms or substituents can be selectively modified to generate new analogs. Also, the linking atoms or groups can be modified into longer or shorter linkers with carbon backbones or hetero atoms. Also, the ring groups can be changed so as to have a different number of atoms in the ring and / or to include hetero atoms. Moreover, aromatics can be converted to cyclic rings, and vice versa. For example, the rings may be from 5-7 atoms, and may be homocycles or heterocycles.
[0281] As used herein, the term “analog,” “analogue,” or “derivative” is meant to refer to a chemical compound or molecule made from a parent compound or molecule by one or more chemical reactions. As such, an analog can be a structure having a structure similar to that of the small molecule inhibitors described herein or can be based on a scaffold of a small molecule inhibitor described herein, but differing from it in respect to certain components or structural makeup, which may have a similar or opposite action metabolically. An analog or derivative of any of a small molecule inhibitor in accordance with the present invention can be used to reduce skin pigmentation.
[0282] In one embodiment, the small molecule inhibitors described herein can independently be derivatized / analoged by modifying hydrogen groups independently from each other into other substituents. That is, each atom on each molecule can be independently modified with respect to the other atoms on the same molecule. Any traditional modification for producing a derivative / analog can be used. For example, the atoms and substituents can be independently comprised of hydrogen, an alkyl, aliphatic, straight chain aliphatic, aliphatic having a chain hetero atom, branched aliphatic, substituted aliphatic, cyclic aliphatic, heterocyclic aliphatic having one or more hetero atoms, aromatic, heteroaromatic, polyaromatic, polyamino acids, peptides, polypeptides, combinations thereof, halogens, halo-substituted aliphatics, and the like. Additionally, any ring group on a compound can be derivatized to increase and / or decrease ring size as well as change the backbone atoms to carbon atoms or hetero atoms.
[0283] Nucleic acid inhibitors
[0284] In other related aspects, the invention includes an isolated nucleic acid. In some instances, the inhibitor is an siRNA, shRNA or antisense molecule, which inhibits one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. In one embodiment, the nucleic acid comprises a promoter / regulatory sequence such that the nucleic acid is capable of directing expression of the nucleic acid. Thus, the invention encompasses expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York) and as described elsewhere herein.
[0285] In another aspect of the invention, one or more molecules in the MMP2-DAMP-RAGE- sPLA2-IIA axis pathway, can be inhibited by way of inactivating and / or sequestering one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. As such, inhibiting the activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway can be accomplished by using a transdominant negative mutant.
[0286] In one embodiment, siRNA or shRNA is used to decrease the level of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway protein. RNA interference (RNAi) is a phenomenon in which the introduction of double-stranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. In the cell, long dsRNAs are cleaved into short 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease known as Dicer. The siRNAs subsequently assemble with protein components into an RNA-induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. See, for example, U.S. Patent No. 6,506,559; Fire et al., 1998, Nature 391(19):306-311 ; Timmons et al., 1998, Nature 395:854; Montgomery et al., 1998, TIG 14 (7):255-258; David R. Engelke, Ed., RNA Interference (RNAi) Nuts & Bolts of RNAi Technology, DNA Press, Eagleville, PA (2003); and Gregory J. Hannon, Ed., RNAi A Guide to Gene Silencing, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2003). Soutschek et al. (2004, Nature 432: 173-178) describe a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G / C content, C / T content at the termini, Tm and the nucleotide content of the 3’ overhang. See, for instance, Schwartz et al., 2003, Cell, 115: 199-208 and Khvorova et al., 2003, Cell 115:209-216. Therefore, the present invention also includes methods of decreasing levels of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway using RNAi technology.
[0287] In another aspect, the invention includes a vector comprising an siRNA or antisense polynucleotide. In one embodiment, the siRNA or antisense polynucleotide is capable of inhibiting the expression of a target polypeptide, wherein the target polypeptide is selected from the group consisting of p21 and telomerase. The incorporation of a desired polynucleotide into a vector and the choice of vectors is well-known in the art as described in, for example, Sambrook et al. (2012), and in Ausubel et al. (1997), and elsewhere herein.
[0288] In certain embodiments, the expression vectors described herein encode a short hairpin RNA (shRNA) inhibitor. shRNA inhibitors are well known in the art and are directed against the mRNA of a target, thereby decreasing the expression of the target. In certain embodiments, the encoded shRNA is expressed by a cell, and is then processed into siRNA. For example, in certain instances, the cell possesses native enzymes (e.g., dicer) that cleaves the shRNA to form siRNA.
[0289] The siRNA, shRNA, or antisense polynucleotide can be cloned into a number of types of vectors as described elsewhere herein. For expression of the siRNA or antisense polynucleotide, at least one module in each promoter functions to position the start site for RNA synthesis.
[0290] In order to assess the expression of the siRNA, shRNA, or antisense polynucleotide, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected using a viral vector. In other embodiments, the selectable marker may be carried on a separate piece of DNA and used in a cotransfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are known in the art and include, for example, antibiotic-resistance genes, such as neomycin resistance and the like. Therefore, in another aspect, the invention relates to a vector, comprising the nucleotide sequence of the invention or the construct of the invention. The choice of the vector will depend on the host cell in which it is to be subsequently introduced. In a particular embodiment, the vector of the invention is an expression vector. Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. In specific embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector and a mammalian cell vector. Prokaryote- and / or eukaryote-vector based systems can be employed for use with the present invention to produce polynucleotides, or their cognate polypeptides. Many such systems are commercially and widely available.
[0291] Further, the expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2012), and in Ausubel et al. (1997), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No. 6,326,193.
[0292] By way of illustration, the vector in which the nucleic acid sequence is introduced can be a plasmid which is or is not integrated in the genome of a host cell when it is introduced in the cell. Illustrative, non-limiting examples of vectors in which the nucleotide sequence of the invention or the gene construct of the invention can be inserted include a tet-on inducible vector for expression in eukaryote cells.
[0293] The vector may be obtained by conventional methods known by persons skilled in the art (Sambrook et al., 2012). In a particular embodiment, the vector is a vector useful for transforming animal cells.
[0294] In one embodiment, the recombinant expression vectors may also contain nucleic acid molecules which encode a peptide or peptidomimetic inhibitor of invention, described elsewhere herein.
[0295] A promoter may be one naturally associated with a gene or polynucleotide sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and / or exon. Such a promoter can be referred to as “endogenous.” Similarly, an enhancer may be one naturally associated with a polynucleotide sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a polynucleotide sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a polynucleotide sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not “naturally occurring,” i.e., containing different elements of different transcriptional regulatory regions, and / or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and / or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (U.S. Patent 4,683,202, U.S. Patent 5,928,906). Furthermore, it is contemplated the control sequences that direct transcription and / or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
[0296] Naturally, it will be important to employ a promoter and / or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know how to use promoters, enhancers, and cell type combinations for protein expression, for example, see Sambrook et al. (2012). The promoters employed may be constitutive, tissue-specific, inducible, and / or useful under the appropriate conditions to direct high-level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and / or peptides. The promoter may be heterologous or endogenous.
[0297] The recombinant expression vectors may also contain a selectable marker gene which facilitates the selection of transformed or transfected host cells. Suitable selectable marker genes are genes encoding proteins such as G418 and hygromycin which confer resistance to certain drugs, P-galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin, for example, IgG. The selectable markers may be introduced on a separate vector from the nucleic acid of interest. Following the generation of the siRNA polynucleotide, a skilled artisan will understand that the siRNA polynucleotide will have certain characteristics that can be modified to improve the siRNA as a therapeutic compound. Therefore, the siRNA polynucleotide may be further designed to resist degradation by modifying it to include phosphorothioate, or other linkages, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphorami date, phosphate esters, and the like (see, e.g., Agrwal et al., 1987, Tetrahedron Lett. 28:3539-3542; Stec et al., 1985 Tetrahedron Lett. 26:2191-2194; Moody et al., 1989 Nucleic Acids Res. 12:4769-4782; Eckstein, 1989 Trends Biol. Sci. 14:97-100; Stein, In: Oligodeoxynucleotides. Antisense Inhibitors of Gene Expression, Cohen, ed., Macmillan Press, London, pp. 97-117 (1989)).
[0298] Any polynucleotide may be further modified to increase its stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and / or 3' ends; the use of phosphorothioate or 2' O-methyl rather than phosphodiester linkages in the backbone; and / or the inclusion of nontraditional bases such as inosine, queosine, and wybutosine and the like, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine, and uridine.
[0299] In one embodiment of the invention, an antisense nucleic acid sequence which is expressed by a plasmid vector is used to inhibit expression of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. The antisense expressing vector is used to transfect a mammalian cell or the mammal itself, thereby causing reduced endogenous expression of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway.
[0300] Antisense molecules and their use for inhibiting gene expression are well known in the art (see, e.g., Cohen, 1989, In: Oligodeoxyribonucleotides, Antisense Inhibitors of Gene Expression, CRC Press). Antisense nucleic acids are DNA or RNA molecules that are complementary, as that term is defined elsewhere herein, to at least a portion of a specific mRNA molecule (Weintraub, 1990, Scientific American 262:40). In the cell, antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule thereby inhibiting the translation of genes.
[0301] The use of antisense methods to inhibit the translation of genes is known in the art, and is described, for example, in Marcus-Sakura (1988, Anal. Biochem. 172:289). Such antisense molecules may be provided to the cell via genetic expression using DNA encoding the antisense molecule as taught by Inoue, 1993, U.S. Patent No. 5,190,931. Alternatively, antisense molecules of the invention may be made synthetically and then provided to the cell. In one embodiment, antisense oligomers may have between about 10 to about 30 nucleotides. In one embodiment, antisense oligomers may have about 15 nucleotides. In one embodiment, antisense oligomers having 10-30 nucleotides are easily synthesized and introduced into a target cell. Synthetic antisense molecules contemplated by the invention include oligonucleotide derivatives known in the art which have improved biological activity compared to unmodified oligonucleotides (see U.S. Patent No. 5,023,243).
[0302] In one embodiment of the invention, a ribozyme is used to inhibit one or more molecules in the MMP2-D MP-RAGE-sPLA2-IIA axis pathway protein expression. Ribozymes useful for inhibiting the expression of a target molecule may be designed by incorporating target sequences into the basic ribozyme structure which are complementary, for example, to the mRNA sequence encoding one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. Ribozymes targeting one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway, may be synthesized using commercially available reagents (Applied Biosystems, Inc., Foster City, CA) or they may be genetically expressed from DNA encoding them.
[0303] In one embodiment, the inhibitor of one or more molecules in the MMP2-DAMP-RAGE- sPLA2-IIA axis pathway may comprise one or more components of a CRISPR-Cas system, where a guide RNA (gRNA) targeted to a gene encoding one or more molecules in the MMP2- DAMP-RAGE-sPLA2-IIA axis pathway, and a CRISPR-associated (Cas) peptide form a complex to induce mutations within the targeted gene. In one embodiment, the inhibitor comprises a gRNA or a nucleic acid molecule encoding a gRNA. In one embodiment, the inhibitor comprises a Cas peptide or a nucleic acid molecule encoding a Cas peptide.
[0304] Polypeptide inhibitors
[0305] In other related aspects, the invention includes an isolated peptide inhibitor that inhibits one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. For example, in one embodiment, the peptide inhibitor of the invention inhibits one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway directly by binding to one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway thereby preventing the normal functional activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. In another embodiment, the peptide inhibitor of the invention inhibits one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway by competing with one or more endogenous molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. In yet another embodiment, the peptide inhibitor of the invention inhibits the activity of one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway by acting as a transdominant negative mutant.
[0306] The variants of the polypeptides according to the present invention may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which there are one or more modified amino acid residues, e.g., residues that are modified by the attachment of substituent groups, (iii) one in which the polypeptide is an alternative splice variant of the polypeptide of the present invention, (iv) fragments of the polypeptides and / or (v) one in which the polypeptide is fused with another polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification (for example, His-tag) or for detection (for example, Sv5 epitope tag). The fragments include polypeptides generated via proteolytic cleavage (including multi-site proteolysis) of an original sequence. Variants may be post-translationally, or chemically modified. Such variants are deemed to be within the scope of those skilled in the art from the teaching herein.
[0307] Antibody inhibitors
[0308] The invention also contemplates an inhibitor of one or more molecules in the MMP2- DAMP-RAGE-sPLA2-IIA axis pathway comprising an antibody, or antibody fragment, specific for one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway. That is, the antibody can inhibit one or more molecules in the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway to provide a beneficial effect.
[0309] The antibodies may be intact monoclonal or polyclonal antibodies, and immunologically active fragments (e.g., a Fab or (Fab)2 fragment), an antibody heavy chain, an antibody light chain, humanized antibodies, a genetically engineered single chain Fv molecule (Ladner et al, U.S. Pat. No. 4,946,778), or a chimeric antibody, for example, an antibody which contains the binding specificity of a murine antibody, but in which the remaining portions are of human origin. Antibodies including monoclonal and polyclonal antibodies, fragments and chimeras, may be prepared using methods known to those skilled in the art. Antibodies can be prepared using intact polypeptides or fragments containing an immunizing antigen of interest. The polypeptide or oligopeptide used to immunize an animal may be obtained from the translation of RNA or synthesized chemically and can be conjugated to a carrier protein, if desired. Suitable carriers that may be chemically coupled to peptides include bovine serum albumin and thyroglobulin, keyhole limpet hemocyanin. The coupled polypeptide may then be used to immunize the animal (e.g., a mouse, a rat, or a rabbit).
[0310] Methods
[0311] In some embodiments, the disclosure provides methods of treating macular degeneration and / or macular dystrophy in a subject. In some embodiments, the method comprises the step of administering to the subject a composition comprising a modulator of the MMP2-DAMP- RAGE-sPLA2-IIA axis pathway.
[0312] In some embodiments, the modulator of the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is a modulator of MMP2. In some embodiments, the modulator of MMP2 is an activator of MMP2. In some embodiments, the activator of MMP2 is one or more selected from the group consisting of MMP2 protein, an MMP2 precursor peptide, and a nucleic acid molecule encoding MMP2.
[0313] In some embodiments, the modulator of the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is a modulator of one or more DAMP molecules. In some embodiments, the modulator of DAMP is an inhibitor of DAMP molecules. In some embodiments, the inhibitor of DAMP molecules comprises an inhibitor of one or more selected from the group consisting of SI 00 proteins, amyloid , high mobility group box 1 (HMGB1), advanced glycation end products (AGEs), heat shock proteins, histones, quinolinic acid, and mitochondrial transcription factor A (TFAM). In some embodiments, the S100 protein is S100A6. In some embodiments, the inhibitor of DAMP molecules comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecules. In some embodiments, the inhibitor of DAMP molecules is selected from the group consisting of anti-HMGBl antibody, anti-SlOO antibody, anti -amyloid 0 antibody, anti-TFAM antibody, soluble RAGE (sRAGE), glycyrrhizin, ethyl pyruvate, carbenoxolone, tanshinone I, tanshinone IIA, ciyptotanshinone, tanshinone IIA sulfonate, epigallocatechin-3-gallate, quercetin, lycopene, nafamostat, gabexate, sivelestat, atorvastatin, simvastatin, methotrexate, paquinimod, and cromolyn.
[0314] In some embodiments, the modulator of the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is a modulator of RAGE. In some embodiments, the modulator of RAGE is an inhibitor of RAGE. In some embodiments, the inhibitor of RAGE comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecules. In some embodiments, the inhibitor of RAGE is one or more selected from the group consisting of FPS-ZM1, anti-RAGE antibody (e.g., RBG01), RAGE antagonist peptide (RAP; ELKVLMEKEL, SEQ ID NO:1), azeliragon, RAGE203, RAGE208, RAGE229, TTP488, GM-1111, 4, 6-di substituted 2-aminopyrimidines, 4-fluorophenoxy analogs, TTP-3000, and low-molecular weight heparin.
[0315] In some embodiments, the modulator of the MMP2-DAMP-RAGE-sPLA2-IIA axis pathway is a modulator of sPLA2-IIA. In some embodiments, the modulator of RAGE is an inhibitor of sPLA2-IIA. In some embodiments, the inhibitor of sPLA2-IIA comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecules. In some embodiments, the inhibitor of sPLA2-IIA is one or more selected from the group consisting of anti-sPLA2-IIA antibody, varespladib (LY315920), tanshinone I, sinapicacid, quinacrine, quercitrin, polydatin, KI 1064, KH067, GK241, AZD 2716, folipastatin, LY311727, YM-26734, luffariellolide, CAY10590, thioetheramide-PC, elemolic acid, BMS-181162, BMS-188I84, thielocin Alp, thielocin B3, SB- 203347, LY333013, L315920-morpholino-N-ethyl ester, daniluromer, dexamethasone, and CHEC-9 (CHEASAAQC). In some embodiments, the inhibitor of sPLA2-IIA is a compound of Formula (I), a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof:
[0316]
[0317] Formula (I) wherein
[0318] X is selected from the group consisting of N and CRX
[0319] Y is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;
[0320] Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.
[0321] L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenylene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;
[0322] R3and R4each represent mono to the maximum possible number of substitution;
[0323] Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NH(R5), -N(R3)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, 'S-alkyl, S(=O)2alkyl, -C(=O)NHR5, -C(=O)N(R5)2, -OC(=O)N(R5)2, -NHC(=O)NH(R5), -NHC(=O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R3)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R5is independently selected from the group consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
[0324] In some embodiments, the inhibitor of sPLA2-IIA is a compound of Formula (II):
[0325]
[0326] Formula (II) wherein L1represents NH or a single bond.
[0327] In some embodiments, the inhibitor of sPLA2-IIA is a compound of Formula (III): wherein L2represents NH or a single bond.
[0328] In some embodiments, the inhibitor of sPLA2-IIA is a compound selected from the group consisting of In some embodiments, the subject has macular degeneration. In some embodiments, the macular degeneration is age-related macular degeneration (AMD). In some embodiments, the subject has Wet AMD. In some embodiments, the subject has Dry AMD.
[0329] In some embodiments, the subject has macular dystrophy. In some embodiments, the macular dystrophy is selected from the group consisting of Sorsby’s fundus dystrophy (SFD), Doyne honeycomb macular dystrophy (DHRD) and autosomal dominant radial drusen (ADRD).
[0330] Administration / Dosage / Formulations
[0331] The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations may be administered to the subject either before or after the onset of a disease or infection. Further, several divided dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.
[0332] Administration of the compositions of the present invention to a patient or subject, such as a mammal, (e.g., human), may be carried out using known procedures, at dosages and for periods of time effective to treat the disease or infection in the patient. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the subject; the age, sex, and weight of the subject; and the ability of the therapeutic compound to treat a disease in the subject. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily. In another example, the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range for a therapeutic compound of the invention is from about 1 mg / kg to about 5,000 mg / kg of body weight / per day. One of ordinary skill in the art would be able to assess the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.
[0333] Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without generating excessive side effects in the subject. In particular, the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds, or materials used in combination with the compound, the age, sex, weight, condition, general health, and prior medical history of the subject being treated, and like factors well, known in the medical arts.
[0334] A medical professional, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start with a dosage of the compound of the invention in the pharmaceutical composition at a level that is lower than the level required to achieve the desired therapeutic effect, and then increase the dosage over time until the desired effect is achieved.
[0335] In particular embodiments, it is advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. “Dosage unit form” as used herein refers to a physically discrete unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect, in association with the required pharmaceutical vehicle. The dosage unit forms of the invention can be selected based upon (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic compound for the treatment of a disease or infection in a patient.
[0336] In some embodiments, the compositions of the invention are formulated using one or more pharmaceutically acceptable excipients or carriers. In some embodiments, the pharmaceutical compositions of the invention comprise a therapeutically effective amount of a compound of the invention and a pharmaceutically acceptable carrier.
[0337] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), vegetable oils, and suitable mixtures thereof. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In some embodiments, it is useful to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions can be achieved by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin. In some embodiments, the pharmaceutically acceptable carrier is DMSO, alone or in combination with other carriers.
[0338] The therapeutically effective amount or dose of a compound of the present invention depends on the age, sex and weight of the subject, the current medical condition of the subject and the severity of the disease in the subject being treated. The skilled artisan is able to determine appropriate doses depending on these and other factors.
[0339] The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses.
[0340] Doses of the compound of the invention for administration may be in the range of from about 1 pg to about 10,000 mg, from about 20 pg to about 9,500 mg, from about 40 pg to about 9,000 mg, from about 75 pg to about 8,500 mg, from about 150 pg to about 7,500 mg, from about 200 pg to about 7,000 mg, from about 3050 pg to about 6,000 mg, from about 500 pg to about 5,000 mg, from about 750 pg to about 4,000 mg, from about 1 mg to about 3,000 mg, from about 10 mg to about 2,500 mg, from about 20 mg to about 2,000 mg, from about 25 mg to about 1,500 mg, from about 30 mg to about 1,000 mg, from about 40 mg to about 900 mg, from about 50 mg to about 800 mg, from about 60 mg to about 750 mg, from about 70 mg to about 600 mg, from about 80 mg to about 500 mg, and any and all whole or partial increments therebetween.
[0341] In some embodiments, the dose of a compound of the invention is from about 1 mg to about 2,500 mg. In some embodiments, a dose of a compound of the invention used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, the dosage of a second compound as described elsewhere herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.
[0342] The compounds for use in the method of the invention may be formulated in unit dosage form. The term “unit dosage form” refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.
[0343] In some embodiments, the compositions of the invention are administered to the subject from about one to about five times per day or more. In various embodiments, the compositions of the invention are administered to the subject, 1-7 times per day, 1-7 times every two days, 1-7 times every 3 days, 1-7 times every week, 1-7 times every two weeks, and 1-7 times per month. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the invention will vary from individual to individual depending on many factors including, but not limited to, age, the disease or disorder to be treated, the severity of the disease or disorder to be treated, gender, overall health, and other factors. Thus, the invention should not be construed to be limited to any particular dosing regime and the precise dosage and composition to be administered to any subject is determined by the medical professional taking all other factors about the subject into account.
[0344] In the case wherein the subject’s status does improve, upon the doctor’s discretion the administration of the inhibitor of the invention is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-l 00%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. Once improvement of the subject’s condition has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, may be reduced to a level at which the improved disease is retained. In some embodiments, a subject may require intermittent treatment on a long-term basis, or upon any recurrence of the disease or disorder.
[0345] Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LDso (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized.
[0346] In some embodiments, the present invention is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound of the invention, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat or prevent a disease or infection in a patient.
[0347] Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and / or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents.
[0348] Routes of administration of any of the compositions of the invention include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual, or topical. The compounds for use in the invention may be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intratumoral, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
[0349] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for parenteral administration and the like. It should be understood that the formulations and compositions that would be useful in the present invention are not limited to the particular formulations and compositions that are described herein.
[0350] Oral Administration
[0351] For oral administration, suitable forms include tablets, dragees, liquids, drops, suppositories, or capsules, caplets, and gel caps. The compositions formulated for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutical excipients that are suitable for the manufacture of tablets. Such excipients include, for example, an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated, or they may be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.
[0352] For oral administration, the compounds of the invention may be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropylmethylcellulose); fdlers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OPADRY™ film coating systems available from Colorcon, West Point, Pa. (e.g., OPADRY™ OY Type, OYC Type, Organic Enteric OY-P Type, Aqueous Enteric OY-A Type, OY-PM Type and OPADRY™ White, 32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups, or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, or ethyl alcohol); and preservatives (e.g., methyl or propyl p-hydroxy benzoates or sorbic acid).
[0353] Granulating techniques are well known in the pharmaceutical art for modifying starting powders or other particulate materials of an active ingredient. The powders are typically mixed with a binder material into larger permanent free-flowing agglomerates or granules referred to as a “granulation.” For example, solvent-using “wet” granulation processes are generally characterized in that the powders are combined with a binder material and moistened with water or an organic solvent under conditions resulting in the formation of a wet granulated mass from which the solvent must then be evaporated.
[0354] Melt granulation involves the use of materials that are solid or semi-solid at room temperature (i.e., having a relatively low softening or melting point range) to promote granulation of powdered or other materials, essentially in the absence of added water or other liquid solvents. The low melting solids, when heated to a temperature in the melting point range, liquefy to act as a binder or granulating medium. The liquefied solid spreads itself over the surface of powdered materials with which it is contacted, and on cooling, forms a solid granulated mass in which the initial materials are bound together. The resulting melt granulation may then be provided to a tablet press or be encapsulated for preparing the oral dosage form. Melt granulation improves the dissolution rate and bioavailability of an active (i.e., drug) by forming a solid dispersion or solid solution.
[0355] U.S. Patent No. 5,169,645 discloses directly compressible wax-containing granules having improved flow properties. The granules are obtained when waxes are admixed in the melt with certain flow improving additives, followed by cooling and granulation of the admixture. In certain embodiments, only the wax itself melts in the melt combination of the wax(es) and additives(s), and in other cases both the wax(es) and the additives(s) melt.
[0356] The present invention also includes a multi-layer tablet comprising a layer providing for the delayed release of one or more compounds of the invention, and a further layer providing for the immediate release of a medication for treatment of G-protein receptor-related diseases or disorders. Using a wax / pH-sensitive polymer mix, a gastric insoluble composition may be obtained in which the active ingredient is entrapped, ensuring its delayed release.
[0357] Parenteral Administration
[0358] For parenteral administration, the compounds of the invention may be formulated for injection or infusion, for example, intravenous, intramuscular, or subcutaneous injection or infusion, or for administration in a bolus dose and / or continuous infusion. Suspensions, solutions, or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and / or dispersing agents may be used.
[0359] Controlled Release Formulations
[0360] In some embodiments, the formulations of the present invention may be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release, and pulsatile release formulations.
[0361] The term sustained release refers to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a day, a week, or a month or more and should be a release which is longer than the same amount of agent administered in bolus form. The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.
[0362] For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use the method of the invention may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation.
[0363] In some embodiments of the invention, the compounds of the invention are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.
[0364] The term pulsatile release refers to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration. The term immediate release refers to a drug formulation that provides for release of the drug immediately after drug administration.
[0365] As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.
[0366] As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration.
[0367] Those skilled in the art recognize, or are able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this invention and covered by the claims appended hereto. For example, it should be understood that modifications in reaction conditions, including but not limited to reaction times, reaction size / volume, and experimental reagents, such as solvents, catalysts, pressures, atmospheric conditions, e.g., nitrogen atmosphere, and reducing / oxidizing agents, with art-recognized alternatives and using no more than routine experimentation, are within the scope of the present application.
[0368] Additional dosage forms of this invention include dosage forms as described in U.S. Patents Nos. 6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms of this invention also include dosage forms as described in U.S. Patent Applications Nos. 20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms of this invention also include dosage forms as described in PCT Applications Nos. WO 03 / 35041; WO 03 / 35040; WO 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757.
[0369] EMBODIMENTS
[0370] Embodiment 1 is a compound of Formula (I), or a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof: Formula (I) wherein
[0371] X is selected from the group consisting of N and CRX
[0372] Y is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;
[0373] Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.
[0374] L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenyl ene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;
[0375] R3and R4each represent mono to the maximum possible number of substitution;
[0376] Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NH(R5), -N(R3)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, 'S-alkyl, O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R5)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R5is independently selected from the group consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
[0377] Embodiment 2 is the compound of embodiment 1, wherein Z represents -NH2.
[0378] Embodiment 3 is the compound of embodiment 1 or 2, wherein the bonds between X and Y each represent ethylene.
[0379] Embodiment 4 is the compound of any one of embodiments 1-3, wherein R1represents -
[0380] CH2Ph. Embodiment 5 is the compound of any one of embodiments 1 -4, wherein R2represents alkyl.
[0381] Embodiment 6 is the compound of embodiment 1, wherein the compound of Formula (I) is represented by Formula (II):
[0382] Formula (II) wherein L1represents NH or a single bond.
[0383] Embodiment 7 is the compound of any one of embodiments 1-6, wherein the compound of Formula (I) is represented by Formula (III): wherein L2represents NH or a single bond.
[0384] Embodiment 8 is the compound of any one of embodiments 1-7, wherein the compound of Formula (I) is represented by one of the following structures:
[0385]
[0386] Embodiment 9 is a method for treating macular degeneration or macular dystrophy in a subject, comprising administering to the subject a modulator of the MMP2-DAMP-RAGE- sPLA2-II axis pathway.
[0387] Embodiment 10 is the method of 9, wherein the modulator comprises at least one selected from the group consisting of: a. an activator of MMP2; b. an inhibitor of RAGE; and c. an inhibitor of sPLA2-IIA.
[0388] Embodiment 11 is the method of embodiment 10, wherein the activator of MMP2 comprises one or more selected from the group consisting of MMP2 protein and a nucleic acid molecule encoding MMP2.
[0389] Embodiment 12 is the method of embodiment 10 or 11, wherein the inhibitor of RAGE comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecule.
[0390] Embodiment 13 is the method of any one of embodiments 10-12, wherein the inhibitor of RAGE comprises an antagonistic peptide comprising the amino acid sequence of ELKVLMEKEL (SEQ ID NO: 1).
[0391] Embodiment 14 is the method of any one of embodiments 10-13, wherein the inhibitor of RAGE comprises one or more selected form the group consisting of FPS-ZM1, RBGO1, RAGE203, RAGE208, RAGE229, azeliragon, TTP488, GM-1111, 4,6-disubstutuded 2- aminopyrimidines, 4-fluorophenoxy analogs, TTP-3000, and low-molecular weight heparin. Embodiment 15 is the method of any one of embodiments 10-14, wherein the inhibitor of sPLA2-IIA comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecule.
[0392] Embodiment 16 is the method of any one of embodiments 10-15, wherein the inhibitor of sPLA2-IIA comprises is one or more selected from the group consisting of varespladib (LY315920), tanshinone I, sinapicacid, quinacrine, quercitrin, polydatin, KH064, KH067, GK241, AZD 2716, folipastatin, LY311727, YM-26734, luffariellolide, CAY10590, thioetheramide-PC, elemolic acid, BMS-181162, BMS-188184, thielocin Alp, thielocin B3, SB- 203347, LY333013, L315920-morpholino-N-ethyl ester, daniluromer, dexamethasone, and CHEC-9 (CHE A S AQC ) .
[0393] Embodiment 17 is the method of any one of embodiments 10-16 wherein the inhibitor of SPLA2-IIA comprises a compound of Formula (I), or a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof:
[0394] Formula (I) wherein
[0395] X is selected from the group consisting of N and CRX
[0396] Y is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;
[0397] Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.
[0398] L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenylene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;
[0399] R3and R4each represent mono to the maximum possible number of substitution;
[0400] Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NH(R5), -N(R5)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, 'S-alkyl, S(=O)2alkyl, -C(=O)NHR5, -C(=O)N(R5)2, -OC(=O)N(R5)2, -NHC(=O)NH(R5), -NHC(= O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R5)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R3is independently selected from the group consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
[0401] Embodiment 18 is the method of embodiment 17, wherein Z represents -NH2.
[0402] Embodiment 19 is the method of embodiments 17 or 18, wherein the bonds between X and Y each represent ethylene.
[0403] Embodiment 20 is the method of embodiments 17-19, wherein R1represents -CH2PI1. Embodiment 21 is the method of embodiments 17-21, wherein R2represents alkyl. Embodiment 22 is the method of embodiment 17, wherein the compound of Formula (I) is represented by Formula (II):
[0404] Formula (II) wherein L1represents NH or a single bond.
[0405] Embodiment 23 is the method of embodiments 17-22, wherein the compound of Formula (I) is represented by Formula (III):
[0406]
[0407] Formula (III) wherein L2represents NH or a single bond.
[0408] Embodiment 24 is the method of embodiments 17-23, wherein the compound of Formula
[0409] (I) is represented by one of the following structures:
[0410] Embodiment 25 is the method of embodiments 9-24, wherein the subject has age-related macular degeneration (AMD).
[0411] Embodiment 26 is the method of embodiments 9-24, wherein the subject has a macular dystrophy selected from the group consisting of: Sorsby’s fundus dystrophy (SFD), Doyne honeycomb macular dystrophy (DHRD) and autosomal dominant radial drusen (ADRD).
[0412] EXPERIMENTAL EXAMPLES The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0413] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples, therefore, specifically point out certain embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
[0414] Example 1 : iPSC-based disease modeling studies reveal common mechanistic defect and potential therapies for AMD and related macular dystrophies.
[0415] Age-related macular degeneration (AMD) and related macular dystrophies (MDs) primarily affect the retinal pigment epithelium (RPE) in the eye. A primary hallmark of AMD / MDs that drives later stage pathologies of maculopathies is drusen. However, how drusen forms and accumulates is not known. Reduced activity of RPE-secreted matrix metalloproteinase 2 (MMP2) contributes to drusen accumulation in multiple maculopathies in a genotype-agnostic manner. Specifically, reduced levels of RPE-secreted MMP2 promotes several pro-maculopathy changes including drusen by promoting sterile inflammation and impaired lipid homeostasis via damage-associated molecular pattern molecule (DAMP)-mediated activation of receptor for advanced glycation end-products (RAGE) and consequently increased secretory phospholipase 2-IIA (sPLA2-IIA) levels. Therapeutically, RPE-specific MMP2 supplementation, RAGE antagonistic peptide and a small molecule inhibitor of sPLA2-IIA ameliorated drusen accumulation in iPSC model(s) of AMD and 3 distinct MDs. Altogether, the data suggest a causal role of MMP2-DAMP-RAGE-sPLA2-IIA axis in macular degeneration and pharmacologically target the disease phenotype in patient-relevant iPSC model(s) of AMD / MDs.
[0416] It is plausible that both decreased and increased MMP2 / MMP9 activity independently contribute to disease pathology in AMD / MDs. For example, it is feasible that decreased MMP2 / MMP9 levels contribute to drusen and Bruch’s membrane thickening in early AMD / MDs, but increased MMP2 / MMP9 activity contributes to development of CNV. Yet another possibility is that there are spatial and / or spatiotemporal changes in MMP2 / MMP9 activity in AMD / MDs. In summary, there is ample evidence of MMP2 / MMP9 dysregulation in AMD / MDs; but despite substantial prior research, the precise mechanism(s) by which MMP2 / MMP9 contribute to pro-maculopathy cellular changes in AMD / MDs has not been established. This is partly because existing animal model(s) of AMD / MDs do not recapitulate the human disease pathology. Similarly, evaluation of human donor eyes has been limited in providing a snapshot of MMP2 / MMP9 level s / activity at the end-stage disease.
[0417] Human iPSCs provide another platform to study diseases in patient’s own cells. In fact, studies have utilized the ability to selectively differentiate iPSCs to disease-relevant individual cell type(s) (e.g., RPE) to clearly demonstrate an independent role of primary RPE dysfunction in promoting cardinal features of AMD / MD afflicted eyes like drusen, ECM accumulation, choriocapillaris (CC) atrophy and CNV-like pathology (Manian et al., Cell Stem Cell. May 6, 2021, 28(5):978; Sharma et al., Nat Commun. Dec 15, 2021, 12(1):7293; Song et al., Nat Methods. Jan 2023, 20(1): 149-161). Furthermore, the unique longitudinal real-time access to the cell / tissue during disease pathology development in the iPSC model system is conducive for determining primary versus secondary pathological changes in complex diseases like AMD / MDs. It is also noteworthy that the iRPE can be cultured for an extended time providing an adequate timeframe to mimic and modulate aspects of disease-associated pathology (Dalvi et al., Cell Death Discov . 2019, 5:96; Tang et al., Commun Biol. Feb 5, 2021, 4(1): 161).
[0418] In this study, iPSC-based disease modeling studies are used to demonstrate that sub-RPE TIMP3 accumulation and subsequently decreased activity of a TIMP3 -target matrix metalloproteinase (MMP2) is independently sufficient to instigate AMD / MD relevant pro- maculopathy changes. Mechanistically, the data indicates that reduced activity of RPE-secreted MMP2 contributes to drusen biogenesis, impaired RPE barrier integrity and RPE atrophy by promoting sterile inflammation and impaired lipid homeostasis via damage associated molecular pattern (DAMP)-mediated receptor for advanced glycation end-products (RAGE) activation and secretory phospholipase 2-IIA (sPLA2-IIA) facilitated lipoprotein modification. Ultimately, from a therapeutic standpoint, RPE-specific MMP2 supplementation and small molecule inhibitors of RAGE and sPLA2-IIA serve as potential therapeutic targets for multiple maculopathies including AMD and 3 related MDs SFD, DHRD and ADRD. Results
[0419] Sub-RPE accumulation of TIMP3 and decreased activity of RPE-secreted MMP2 precede drusen biogenesis in iPSC model(s) of AMD / MDs.
[0420] TIMP3 is an ECM regulating protein that is primarily synthesized by RPE cells in the retina / eye (Ruiz et al., Biochem Biophys Res Commun. Sep 13, 1996, 226(2):467-74; Della et al., Invest Ophthalmol Vis Set. Aug 1996, 37(9): 1921-4). Furthermore, TIMP3 secreted by RPE cells is deposited into the underlying Bruch’s membrane and plays an important role in regulation of ECM turnover. Histopathological and proteomics analyses of AMD / MD donor eyes have consistently shown sub-RPE accumulation of TIMP3 in Bruch’s membrane and drusen. Similarly, TIMP3 accumulates in the ECM underlying “aged” (-10-12 weeks in culture) SFD iRPE cultures.
[0421] To determine whether sub-RPE TIMP3 accumulation precedes drusen biogenesis longitudinal analysis of TIMP3 levels was performed in control versus SFD iRPE-ECM at varying timepoints in culture (Day 14, 30 and 90) (Figure 1 and Figure 2). Western blot analyses showed no changes in TIMP3 levels at day 14 in the basally-deposited ECM of control versus SFD iRPE cultures. However, both day 30 and day 90 SFD iRPE cultures showed increased TIMP3 levels in the basally-deposited ECM, when compared to parallel cultures of control iRPE cells (Figure 1 and Figure 2).
[0422] Mutation in TIMP3 are causal in SFD and given that TIMP3 is a known negative regulator of gelatinase (MMP2 / MMP9) activity, MMP2 activity was analyzed longitudinally in basally secreted RPE-conditioned media (RPE-CM) of control versus SFD iRPE cultures. Prior to increased TIMP3 accumulation (day 14; Figure 1 and Figure 2), gelatin zymography analyses showed no difference in MMP2 activity in day 14 SFD iRPE cultures when compared to parallel cultures of control iRPE cultures (Figure 3 and Figure 4). Furthermore, consistent with TIMP3 regulating MMP2 levels in SFD iRPE cultures, basally secreted SFD iRPE-CM showed reduced MMP2 activity compared to basally secreted control iRPE-CM at days 30 and 90 (Figure 3 and Figure 4). Note that the timepoints of increased sub-RPE TIMP3 accumulation and decreased MMP2 activity are concordant in SFD iRPE cultures (Figure 1 and Figure 2). In addition, transmission electron microscopy (TEM) analyses showed that SFD iRPE cultures lacked drusen-like deposits at day 30 (Figure 5) (Galloway et al., Proc Natl Acad Set USA. Sep 06, 2017), the earliest timepoint (day 30) of TIMP3-ECM accumulation (Figure 1 and Figure 2) and reduced MMP2 activity (Figure 3 and Figure 4). However, TEM and immunocytochemical analyses showed presence of drusen-like deposits in day 90 SFD iRPE cultures that contained drusen resident protein (APOE) and Nile red positive neural lipids (Figure 5 and Figure 6). Note that although some drusen-like deposits were observed = day 90 control iRPE cultures, the amount (count, area) of co-localized APOE-Nile Red positive sub-RPE deposits was higher in SFD iRPE cultures (Figure 5 and Figure 6).
[0423] Overall, longitudinal analyses showed that the initial timepoint of increased TIMP3-ECM accumulation and decreased MMP2 activity (Day 30) coincide in SFD iRPE cultures and precede drusen accumulation in Day 90 cultures (Figure 7). Note that MMP9 activity was not assessed in control versus SFD iRPE cultures, as both young (day 30) and aged (day 90) control and patient-derived iRPE cultures did not show measurable MMP9 activity (Figure 8 and Figure 9). This is consistent with other published studies that show pre-dominant secretion of MMP2 by RPE cells despite mRNA expression of other MMPs (e.g., MMP1, MMP3, MMP9) by RPE cells (Greene et al., J Ocul Pharmacol Ther. Apr 2017, 33(3): 132-140 Juuti-Uusitalo et al., / nve Ophthalmol Vis Sci. Oct 2015, 56(11):6265-74; Eichler et al., Invest Ophthalmol Vis Sci. Aug 2002, 43(8):2767-73).
[0424] Apart from RPE cells, other cell type(s) in the in vivo RPE-choroid complex, prominently macrophages also secrete TIMP3 and MMP2 (Webster et al., J Leukoc Biol. Nov 2006, 80(5): 1052-66; Smookler et al., J Immunol. Jan 2006, 176(2):721-5). Therefore, to further understand the consequence of increased levels of TIMP3 for MMP2 regulation in the RPE- choroid complex, TIMP3 and MMP2 levels were compared in RPE versus choroidal macrophages using two published single-cell-RNA-seq datasets (Voigt et al., Proc Natl Acad Sci USA. Nov 26, 2019, 116(48):24100-24107; Collin et al., Hum Mol Genet. May 05, 2023, 32(10): 1698-1710). Although the expression ofMMP2 was similar between RPE and macrophages in both single-cell-RNA-seq data sets, TIMP3 level was several folds higher in the RPE compared to the macrophages in both datasets (Figure 10). This is of significance as TIMP3 accumulates preferentially beneath the RPE in SFD and similar maculopathies (e.g., AMD, DHRD) (Tymms et al., Clin Exp Optom. Jul-Aug 1999, 82(4): 124-129; Fu et al., Hum Mol Genet. Oct 2007, 16(20) :2411-22), and therefore reduced activity of MMP2 in the RPE-CC in AMD / MDs is likely a direct consequence of increased sub-RPE TIMP3 accumulation.
[0425] In a subset of experiments, to evaluate the direct impact of macrophages on basally secreted MMP2 levels by RPE cells, control and SFD iRPE were co-cultured with THP1 -derived macrophages. To mimic the spatial orientation of RPE with respect to choroidal macrophages in these co-culture experiments, RPE cells on transwells were co-cultured on top of THP1 -derived macrophages in 24 wells (see schematic, Figure. 11). Similar to SFD iRPE monoculture (Figure 3 and Figure 4), SFD iRPE-macrophage co-cultures showed reduced activity of basally secreted MMP2 when compared to parallel cultures of control iRPE-macrophage co-cultures (Figure 12 and Figure 13). Furthermore, zymographic analyses of basally secreted MMP2 activity in the comprehensive iRPE-choriocapillaris (iRPE-CC) mimetic (Manian et al., Cell Stem Cell. 05 06 2021;28(5): 846-862. e8) showed decreased levels of basally-secreted active MMP2 in SFD iRPE- CC cultures compared to control iRPE-CC cultures (Figure 14 and Figure 15).
[0426] Apart from SFD, a disease directly caused by mutations in TIMP3, increased TIMP3 accumulation has been linked to both DHRD and AMD. Therefore, it was next investigated whether increased TIMP3-ECM accumulation and decreased MMP2 activity preceded drusen biogenesis in DHRD / AMD. Western blot and gelatin zymography analyses showed that similar to SFD iRPE-cultures (Figure 1 through Figure 4), i) TIMP3 levels were increased in the iRPE- ECM (Figure 16 and Figure 17) and ii) MMP2 activity were decreased in the basally secreted RPE-CM (Figure 18 and Figure 19) of both DHRD and AMD iRPE cultures at day 30 when compared to parallel cultures of control iRPE cells. Also, similar to SFD iRPE cultures (Figure 1 through Figure 4), gelatin zymography analyses revealed no downregulation of MMP2 activity in day 14 AMD and DHRD iRPE cultures (Figure 20 and Figure 21), prior to increased TIMP3- ECM accumulation at day 30 (Figure 16 and Figure 17). Note that because MMP2 regulation by TIMP3 is a function of both TIMP3 protein and TIMP3 activity, reverse zymography analysis was also used, confirming that TIMP3 activity was not decreased in SFD, DHRD and AMD iRPE cells compared to control iRPE cells (Figure 22 through Figure 24) Ultimately, similar to SFD iRPE cultures, longitudinal TEM and immunocytochemical analysis showed lack of sub- RPE deposits in DHRD and AMD iRPE cultures at day 30 (Figure 25 and Figure 26) but presence of drusen-like deposits in day 90 DHRD and AMD iRPE cultures (Figure 27 through Figure 29). Furthermore, quantitative analyses showed increased amount (count, area) of APOE- Nile red co-localized sub-RPE deposits in day 90 DHRD and AMD iRPE cultures compared to parallel cultures of control iRPE cells (Figure 27, Figure 28, and Figure 30). Put together, increased ECM accumulation of TIMP3 and decreased activity of RPE-secreted MMP2, precede presence of drusen like deposits in DHRD and AMD iRPE cultures (Figure 31).
[0427] Overall, longitudinal analyses of iRPE cultures from multiple maculopathies, including an MD with TIMP3 mutation (SFD), MDs lacking TIMP3 mutation DHRD and AMD, showed perturbation in TIMP3-MMP2 axis, prior to drusen biogenesis.
[0428] Pharmacological inhibition of MMP2 activity in control iRPE cultures is sufficient to initiate pro-maculopathy cellular events via perturbation of DAMP-RAGE and sPLA2-IIA axis.
[0429] Although longitudinal analysis of AMD / MD iRPE cultures (Figure 1 through Figure 3 1J showed that decreased MMP2 levels precede drusen in multiple maculopathies, these experiments did not define the independent role of decreased MMP2 activity in initiating pro- maculopathy cellular changes. To directly link decreased activity of RPE-secreted MMP2 and pro-maculopathy changes, control iRPE cultures were treated daily (for up to 2 weeks) with either i) a specific competitive inhibitor of MMP2 that affects MMP2 activity, MMP2-inhibitor 1 (MMP2-I1) (Berton et al., J Biol Chem. Jun 8 2001;276(23):20458-65) or ii) doxycycline (DOX), a broad spectrum MMP inhibitor that has been shown to transcriptionally regulate MMP2 levels in multiple cell types (Liu et al., Journal of vascular surgery. Dec 2003, 38(6): 1376-83; Samartzis et al., Reproductive biology and endocrinology : RB&E. Apr 13, 2019, 17(1):38).
[0430] Gelatin zymography analyses showed that both MMP2-I1 (5 pM) and Dox (30 pM) treatment led to reduced MMP2 activity in the basally-secreted RPE-CM of control iRPE cells (Figure 32 and Figure 33). However, consistent with MMP2-I1 being a competitive inhibitor of MMP2 activity, quantitative analyses of basally secreted RPE-CM showed similar protein levels of MMP2 in parallel cultures of untreated versus MMP2-I1 -treated control iRPE cells (Figure 34). In contrast, Dox (30 pM) treatment led to both reduced MMP2 protein levels and MMP2 activity in basally secreted RPE-CM of Dox-treated control iRPE cells compared to parallel cultures of untreated control iRPE cells (Figure 35). Notably, consistent with specific inhibition of MMP2 level s / activity, protein levels of other RPE secreted MMPs were similar in untreated versus MMP2-I1 -treated control iRPE cells and untreated versus Dox -treated control iRPE cells (Figure 34 and Figure 35 /
[0431] Several DAMPs (e.g., HMGB1, S100A6) are proteolytic substrates of MMP2 (Manicone et al., Semin Cell Dev Biol. Feb 2008, 19(1 ):34-41 ; Chelladurai et al., Eur Respir J. Sep 2012, 40(3):766-82). Furthermore, elevated HMGB1 can lead to impaired lipid / cholesterol metabolism and sterile inflammation, including via regulation of PLA2G2A (sPLA2-IIA) activity and thereby generation of inflammatory bioactive lipid mediator prostaglandin E2 (PGE2) (Jaulmes et al., FASEB J. Aug 2006;, 0(10): 1727-9; Sims et al., Annu Rev Immunol. 2010, 28:367-88; Song et al., Neural Regen Res. Sep 2021, 16(9): 1848- 1855). To directly link elevated sPLA2-IIA activity to sterile inflammation and impaired lipid homeostasis in RPE cells, iRPE cultures were supplemented with bee venom, that has previously been shown to upregulate PLA2G2A (sPLA2- IIA) levels in other cell type(s) (Beck et al., J Biol Chem. Aug 08, 2003, 278(32):29799-812). Consistently, control iRPE cells exposed to bee venom (10 pg / ml, 2 h) showed increased PLA2G2A (sPLA2-IIA) levels compared to untreated iRPE cells (Figure 36 and Figure 37). Furthermore, compared to untreated iRPE cells, bee venom-treated iRPE cells showed increased levels of PGE2 (Figure 38). In addition, a small molecule inhibitor of sPLA2-IIA, LY315920 (5 pM) was able to counteract elevated PGE2 levels in bee venom-treated iRPE cultures (Figure 38); thus, directly linking increased sPLA2-IIA activity to inflammation and lipid homeostasis in RPE cells.
[0432] The next hypothesis investigated was that MMP2 inhibition in iRPE cell leads to sterile inflammation and impaired lipid homeostasis, including altered sPLA2-IIA activity, via regulation of DAMP (HMGB1) levels. Western blot analyses showed elevated levels of extracellular HMGB1 and sPLA2-IIA in the basally-secreted RPE-CM of MMP2-I1 -treated iRPE cultures (5 pM, supplemented daily for 6 days) and DOX-treated iRPE cultures (30 pM, supplemented daily for 6 days) compared to parallel cultures of untreated iRPE cells (daily media change of basal media) (Figure 39 to 43). RAGE is the primary receptor for HMGB1 (Sparvero et al., Journal of Translational Medicine . March 17, 2009, 7(1): 17; Behl et al., Mol Biol Rep. Feb 2021, 48(2): 1869-1881) and consistently increased RAGE levels were seen in MMP2-I1 -treated and DOX-treated iRPE cells by quantitative Western blot analyses (Figure 42 to 44). Further, establishing a direct relationship between elevated DAMP (HMGB1) and increased RAGE levels, RAGE levels were counteracted by supplementation of DOX-treated iRPE cells with a rage antagonistic peptide (RAP, 5 pM) that specifically targets DAMP (HMGBl)-mediated RAGE activation (https: / / www. rndsystems. com / products / rageantagonist- peptide_ 6259# product- details) (Figure 42 and Figure 43). Similarly, showing a direct role of HMGB1 -mediated RAGE activation in modulating PLA2G2A / sPLA2-IIA levels in RPE cells, elevated PLA2G2A / sPLA2-IIA levels in DOX-treated iRPE cells were counteracted by RAGE antagonist peptide (RAP, 5 pM) supplementation (Figure 42 and Figure 43).
[0433] Also, consistent with a role of MMP2-HMGB1-RAGE axis mediated sterile inflammation, RAGE upregulation was followed by increased expression of key complement pathway genes, C3 and CFB (Figure 45 and Figure 46), impaired epithelial barrier integrity as measured transepithelial resistance (TER) (Figure 47 and Figure 48) in MMP2-I1 -treated and DOX-treated iRPE cells compared to parallel cultures of untreated iRPE cells. Similarly, consistent with perturbed lipid homeostasis, TEM analyses showed lipid droplets in MMP2-I1 treated cultures (Figure 49). Furthermore, oil-red-0 and Nile-Red staining showed increased levels of neutral lipids in the RPE and drusen of MMP2-I1 -treated and DOX-treated iRPE cultures compared to untreated iRPE cultures (Figure 50 through Figure 53). Ultimately, TEM and immunocytochemical analyses of MMP2-I1 -treated and DOX-treated iRPE cultures showed AMD / MD associated pathological changes, including presence and higher abundance (count, area) of sub-RPE deposits enriched in drusen resident proteins (APOE, TIMP3), Nile-Red positive neutral lipids and sPLA2-IIA (Figure 52 through Figure 56), and RPE cell loss (Figure 57 and Figure 58).
[0434] Directly linking DAMP -RAGE axis to sterile inflammation, and AMD / MD pathology, inhibition of DAMP -mediated RAGE activation using RAP (5 pM, daily supplementation for 6 days) was sufficient to counteract complement activation as measured by C3 levels in basally- secreted RPE-CM (Figure 59 and Figure 60 / and ameliorate AMD / MD associated pathological alterations, namely impaired barrier integrity (Figure 61), count and area of protein-lipid containing drusen-like deposits (Figure 62 and Figure 63), and RPE cell death (Figure 64) in DOX-treated iRPE cultures. Note that directly linking DAMP -mediated RAGE activation to impaired lipid homeostasis in DOX-treated iRPE cultures, levels of Nile-red positive neutral lipids and sPLA2-IIA were reduced in the drusen deposits and RPE cells of RAP-supplemented and DOX-treated iRPE cultures when compared to DOX-treated iRPE cultures (Figure 42, Figure 43, Figure 62, and Figure 63).
[0435] Finally, given that DOX is a broad spectrum MMP inhibitor and can regulate several AMD / MD associated cellular pathways including inflammation and angiogenesis, the direct role of reduced MMP2 activity was also investigated in promoting pro-maculopathy changes in DOX-treated iRPE culture. Directly linking DOX-induced MMP2-inhibition to sterile inflammation in iRPE cells, exogenous supplementation of recombinant active MMP2 in the basal media (150 nM, daily for 6 days) led to reduced levels of basally-secreted HMGB1 and sPLA2-IIA in Dox-treated iRPE cultures (Figure 65 and Figure 66). Similarly, like RAP, MMP2 supplementation reversed several pro-maculopathy changes, including impaired barrier integrity as measured by TER (Figure 67), abundance (count, area) of TIMP3, Nile Red and APOE positive drusen-like deposits (Figure 68 and Figure 69), and RPE cell death (Figure 70) in DOX- treated iRPE cultures.
[0436] Altogether, using disease modeling studies, it is shown that reduced levels and activity of RPE-secreted MMP2 is independently sufficient for promoting pro-maculopathy cellular events via perturbation of DAMP-RAGE-sPLA2-IIA axis.
[0437] Targeting MMP2-DAMP-RAGE-sPLA2-IIA axis ameliorates drusen deposition in AMD / MD iPSC model(s).
[0438] Disease modeling studies utilizing control iRPE cells (Figure 36 through Figure 70) showed that reduced activity of RPE-secreted MMP2 and consequently perturbation of MMP mediated DAMP -RAGE and sPLA2-IIA signaling was independently sufficient to promote pro- maculopathy cellular changes in control iRPE cells. Next, it was investigated whether modulation of MMP2-DAMP-RAGE-sPLA2-IIA axis could target drusen in aged (= day 90 ) AMD / MD iRPE cultures. To evaluate the impact of exogenous MMP2 supplementation on maculopathy-relevant phenotype(s) in AMD / MD iPSC model(s), AMD / MD iRPE cultures were basally supplemented with recombinant active MMP2 (150 nM / 18 hours). Basal supplementation of -day 90 AMD / MD iRPE cultures with MMP2 led to decreased count and area of TIMP3-APOE positive and sPLA2-IIA-APOE positive drusen-like deposits in iRPE cultures of multiple maculopathies, SFD (Figure 71), DHRD (Figure 72) and AMD (Figure 73).
[0439] From the perspective of pharmacologically targeting AMD / MDs, daily supplementation of AMD / MD iRPE cultures with rage antagonistic peptide or RAP (5 pM, 14 days) targeting D AMP-mediated RAGE activation reduced count and area of drusen-like deposits containing APOE and sPLA2-IIA in SFD, DHRD and AMD iRPE cultures (Figure 74 through Figure 77). Also, directly linking MMP2-D AMP-RAGE axis to sPLA2-IIA activation in iRPE models of AMD / MDs, RAP that targets DAMP-mediated RAGE activation led to reduced levels of sPLA2- IIA in SFD, DHRD and AMD iRPE cultures (Figure 74 through Figure 77). Similarly, showing a causal role of sPLA2-IIA in drusen accumulation, a small molecule inhibitor of sPLA2-IIA, LY315920, (5 pM, 7 days), decreased the count and area of APOE-Nile Red and APOE-sPLA2- IIA positive drusen-like deposits in SFD, DHRD and AMD iRPE cultures (Figure 78 through Figure 81).
[0440] The experiments on SFD / DHRD / AMD iRPE cultures (Figure 71 through Figure 81) demonstrated that targeting MMP2-DAMP-RAGE-sPLA2-IIA axis using either exogenous MMP2 supplementation, RAP or sPLA2-IIA inhibitor can target drusen build-up in AMD / MDs linked to mutations / alterations in MMP2 regulating genes / proteins, TIMP3 (AMD, SFD) and EFEMP1 (DHRD). To further assess the broad applicability of exogenous MMP2 supplementation to target drusen in macular degeneration, iRPE cultures from patients with ADRD that harbor an unidentified genetic defect were utilized. Note that “aged” (^ day 90) ADRD iRPE cultures display drusen-like deposits (Figure 82 through Figure 89). Furthermore, ADRD iPSCs do not harbor mutations in TIMP 3 / EFEMP 1. Remarkably, similar to SFD, DHRD and AMD iRPE cultures (Figure 71 through Figure 81) and consistent with reduced MMP2 activity and consequently perturbation in MMP-DAMP-RAGE-sPLA2-IIA axis contributing to drusen pathology in ADRD iPSC-RPE cultures, i) MMP2-substrate, DAMP (HMGB1) and sPLA2-IIA were present in sub-RPE deposits underlying ADRD iRPE cultures (Figure 82 through Figure 87), and ii) MMP2 supplementation (150 nM / 18 hours) of = day 90 ADRD iRPE culture led to reduced count and area of drusen-like deposits containing APOE and HMGB1 (Figure 82 and Figure 83) and APOE and sPLA2-IIA (Figure 84 and Figure 85). Similarly, small molecules targeting RAGE activation (RAP; 5 pM, 14 days) and sPLA2-IIA activity (LY315920; 5 pM, 14 days) were able to ameliorate the count and area of drusen-like deposits containing APOE and sPLA2-IIA (Figure 86 and Figure 87) or APOE and Nile-Red (Figure 88 and Figure 89) in ADRD iRPE cultures. Furthermore, analysis of ECM extracts from control versus ADRD iRPE cultures revealed that similar to, SFD, DHRD and AMD iRPE cultures, ADRD iRPE-ECM contains higher levels of TIMP3 (Figure 90 and Figure 91), suggesting that elevated TIMP3 levels contribute to perturbation of MMP2-DAMP-RAGE-sPLA2-IIA axis in several maculopathies independent of genetic defect.
[0441] Overall, results on AMD and MD (SFD, DHRD and ADRD) iRPE models showed that RPE-specific MMP2 supplementation and pharmacological targeting of DAMP-RAGE-sPLA2- IIA axis can ameliorate drusen-like deposits in iRPE models of multiple maculopathies and provide potential small molecule therapeutics for AMD / MDs.
[0442] Linking AMD / MD iPSC model data to AMD donor eyes and an animal model of MD.
[0443] Although increased levels of TIMP3 and reduced gelatinase (MMP2 / MMP9) activity have been consistently reported in RPE-Bruch’s membrane and drusen of AMD donor eyes (Leu et al., Exp Eye Res 2002, 74(1): 141-154), levels of DAMPs and sPLA2-IIA in AMD donor drusen have not been evaluated. Immunohistochemical analyses of drusen showed presence of sPLA2-IIA, HMGB1 and CEP (co-[2-carboxy ethyl] pyrrole)-adducts in both AMD donor drusen (Figure 92 through Figure 100) and AMD iRPE drusen (Figure 101) and support the possibility that MMP2-DAMP-PLA2G2A axis contributes to inflammation in AMD. Note that of the 6 AMD (2: dry AMD, 2: wet AMD and 2 unspecified) and 5 normal donor eye sections, none of the normal (minimal reactivity in 1 donor who was 59 years old so potentially could have developed macular degeneration later on) but all AMD sections showed presence of PLA2G2A in drusen (Figure 93, Figure 95 through Figure 100, and Figure 102).
[0444] Timp3 knock-in mutant (Timp3KI'mut) mice (Timp3SI79C / sl79C', referenced in older literature as Timp3sli6C / SI56C') (Weber et al., Invest Ophthalmol Vis Sci. Aug 2002, 43(8):2732-4; Anand- Apte et al., J Neurosci Res. Jan 2019, 97(l):88-97), that harbor an SFD associated Timp3 mutation, have been previously utilized to study SFD pathology and role of TIMP3 dysfunction in macular degeneration. However, Timp3kI~mutmice do not develop macular degeneration pathology despite showing increased accumulation of TIMP3. Furthermore, unlike the SFD iRPE model (Figure 1 through Figure 7), zymography analysis of the comprehensive retina and RPE-choriocapil laris complex has not shown decreased gelatinase activity (Qi et al., Scientific reports. Nov 22, 2019, 9(1): 17429). To resolve the conflicting data on MMP2 activity in the SFD iRPE model and Timp3kI~mutmice, spatial analysis of MMP2 activity in the RPE-choroid of age- and sex-matched wild-type (WT) versus Timp3KI~mutmice was performed utilizing in situ zymography (ISZ) (Figure 103 through Figure 108). Timp3K nmtmice display reduced gelatinase activity in the RPE-Bruch’s membrane, but not comprehensive RPE-choroid of Timp3Kkmutmice (Figure 103 through Figure 108). Furthermore, immunostaining analyses confirmed that Timp3K1~ mutmjce onC57BL / 6J background used in this study lack Pla2g2a and therefore sPLA2-IIA activity (Figure 109). The lack of PLA2G2A (sPLA2-IIA) activity potentially explains the absence of SFD pathology (drusen, CNV) in Timp3KI mutmice as opposed to the SFD iPSC model (Manian et al., Cell Stem Cell. May 6, 2021, 28(5):846-862 e8) (Figure 5 through Figure 7). Note that reduced activity of RPE-secreted MMP2 was independently sufficient to cause drusen in “PLA2G2A expressing” iRPE cells (Figure 36 through Figure 58). Similarly, supplementing control ichoriocapillaris (iCC) cultures (daily for 6 days) with basally-secreted RPE-CM from MMP2-I1 -treated control iRPE cells (that express increased PLA2G2A) led to CC atrophy (Figure 110).
[0445] Overall, immunohistochemical analysis of AMD and normal donor eyes (Figure 92 through Figure 100) and ISZ analyses of an SFD mouse model (Timp3KI~mutmice) (Figure 103, Figure 104, Figure 107, and Figure 108) is consistent with a causal role of MMP2-DAMP- RAGE-sPLA2-IIA axis in AMD / MDs and likely explains the lack of human SFD disease pathology in Timp3KI~mutmice.
[0446] Discussion iPSC technology has provided a unique platform to investigate disease pathobiology in patient-relevant cell models. Several studies have now shown that iPSC-derived retinal cell models, retinal organoids(Gao et al., Cront Cell Dev Biol. 2020, 8: 128; Lane et al., Stem Cell Reports. Jul 14, 2020, 15(l):67-79; Deng et al., Stem Cell Reports. Apr 10, 2018, 10(4):1267- 1281), iRPE (Singh et al., HumMol Genet. Feb 1, 2013, 22(3):593-607) and more recently iRPE-CC (Dalvi et al., Cell Stem Cell. Mar 02, 2023, 30(3):243-245), can faithfully recapitulate important pathological aspects of retinal degenerative diseases. With regard to AMD / MDs, central pathological features of the human disease, namely drusen, ECM accumulation, choriocapillaris atrophy and CNV have now been reported in the iPSC model system. Furthermore, it has been shown that cell autonomous iRPE dysfunction is independently sufficient to drive both RPE-associated (drusen, ECM accumulation) and vascular-linked (choriocapillaris atrophy, CNV) pathologies of AMD / MDs. However, temporal dissection of molecular and cellular events within iRPE monolayer and its consequence for AMD / MD disease pathology development has been lacking.
[0447] Here, iRPE was utilized from patients with multiple maculopathies (SFD, DHRD, AMD and ADRD) to identify a causal role of MMP2-DAMP-RAGE-sPLA2-IIA axis in initiating pro- maculopathy cellular events. Reduced activity of gelatinases (MMP2, MMP9) has been directly linked to other inflammatory conditions, including arthritis and atherosclerosis (Hardy et al., Am J Physiol Heart Circ Physiol. 11 01 2018;315(5):H1332-H1340; Martignetti et al., Nat Genet. Jul 2001, 28(3):261-5; Li et a\ , Immunol Invest. 2015, 44(7):603-15). Studies on Mmp2 deficient mice have shown evidence of inflammation (Fingleton, Biochim Biophys Acta Mol Cell Res. Nov 2017, 1864(11 Pt A):2036-2042; Sarker et al., Front Physiol. 2020, 11 :568718). Increased inflammation due XoMmp2 deficiency is not surprising given that apart from ECM components, several pro-inflammatory cytokines (e.g., IL-ip, GROalpha) and DAMPs (e.g., HMGB1, decorin, biglycan) are proteolytic substrates of MMP2. In agreement, pharmacological inhibition of MMP2 in control iRPE cells led to elevated levels of MMP2-cleaved DAMP, HMGB1, and consequently increased levels of RAGE, sPLA2-IIA and complement pathway proteins, C3 and CFB (Figure 20 through Figure 24, Figure 29, Figure 30, and Figure 32 through Figure 70).
[0448] The particular focus on MMP2, a gelatinase, in the current study was because genotype agnostic evaluation has shown reduced activity of gelatinases in both drusen and Bruch’s membrane of AMD donor eyes. Furthermore, gelatinases (MMP2, MMP9) favorably degrade basement membrane constituents like COL4 (whose levels are consistently increased in both AMD / MDs Bruch’s membrane. Notably, similar to data shown here (Figure 8 and Figure 9), other published studies have consistently shown that MMP2 is the primary gelatinase secreted by RPE cells. Similarly, levels of active MMP2 are significantly higher than the levels of active MMP9 in Bruch’s membrane of human donor eyes that remarkably also do not show any presence of either active MMP1 or active MMP3 (Guo et al., Invest Ophthalmol Vis Sci. Oct 1999, 40(11):2676-82).
[0449] Mechanistically reduced levels of RPE-secreted MMP2 are sufficient for development of several AMD associated pathological changes. Specifically, reduced proteolytic activity of RPE- secreted MMP2 directly leads to impaired ECM turnover and consequently Bruch’s membrane thickening. Furthermore, HMGB1, a damage associated molecular pattern (DAMP) molecule, is a proteolytic substrate of MMP2 (https: / / www. ebi. ac. uk / merops / cgi- bin / substrates? id= M10.003) and therefore reduced activity of RPE-secreted MMP2 directly leads to increased levels of extracellular HMGB1 in iRPE cultures (Figure 36 through Figure 58). RAGE is the primary receptor for HMGB 1 (Sparvero et al., J Transl Med. Mar 17, 2009, 7: 17) and accordingly increased levels of HMGB 1 and thereby RAGE activation leads to pro-inflammatory signaling with upregulation of key complement pathway genes (C3, and CFB) and increased complement C3 levels, elevated PLA2G2A / sPLA2-IIA and thereby elevated PGE2 levels, and ultimately drusen, reduced transepithelial resistance and RPE cell loss (Figure 36 through Figure 70). A critical role of HMGB1-RAGE axis in modulating sterile inflammation including complement activation and dysregulated lipid metabolism including via modulating sPLA2-IIA levels is also supported by published data in other cell type(s) (Snelson et al., hit J Mol Sci. Feb 03, 2022, 23(3); Wolfson et al., Microvasc Res. Mar 2011, 81(2): 189-97; Posch et al., J Allerg) Clin Immunol. Jun 2021, 147(6):2083-2097.e6; Zhao et al., J Cell Mol Med. Dec 2018, 22(12):6087-6098).
[0450] To alleviate the concern about the potential impact of reduction in MMP2 activity on levels of other MMPs, unaltered levels of RPE- secreted MMP2 post-MMP2 inhibition were confirmed (Figure 20 through Figure 24, Figure 29, Figure 30, and Figure 32 through Figure 35). Note that although the levels of other RPE-secreted MMPs were unchanged after pharmacological MMP2 inhibition (Figure 20 through Figure 24, Figure 29, Figure 30, and Figure 32 through Figure 35), increased TIMP3 accumulation was seen in drusen-like deposits in control iRPE cells post-MMP2 reduction in control iRPE cells (Figure 36 through Figure 38, Figure 40 through Figure 43, Figure 46, Figure 48, Figure 52, Figure 53, and Figure 58). It is plausible that there is a positive feedback loop between TIMP3 and MMP2 activity. For example, MMP2 activity could regulate TIMP3 levels either by modulation of other pathways (e g., oxidative stress) or directly by cleaving TIMP3. In support of the latter postulation, Interestingly, in silico analyses using Procleave software (https: / / procleave, ere. monash. edu / ) predicted potential substrate cleavage sites for TIMP3 specific for MMP2 suggesting that TIMP3 could possibly also be a substrate of MMP2 (Li et al., Genomics Proteomics Bioinformatics. Feb 2020, 18(1): 52-64). Similarly, other TIMPs have been shown to be proteolytic substrates of MMPs (Kapoor J Cancer Res Ther. Jan-Mar 2016, 12(l):28-35). From the perspective of RPE (patho)physiology, it would be of interest to further understand the regulation of TIMP3 levels and activity by RPE-secreted MMPs.
[0451] It is also noteworthy that several pro-maculopathy changes (e.g., drusen, impaired barrier integrity and RPE cell death) occurred within 6 days of pharmacological MMP2 inhibition in control iRPE cells (Figure 36 through Figure 70). In contrast, AMD, and MD (SFD, DHRD) iRPE cultures that displayed reduced MMP2 activity at day 30 in culture, showed evidence of drusen deposits after aging the cultures for ~90 days (Figure 1 through Figure 7, Figure 16 through Figure 19, Figure 25 through Figure 28, and Figure 31). The accelerated formation of the drusen phenotype and other pro-maculopathy changes can possibly be accounted to increased potency of pharmacologically inhibiting RPE-secreted MMP2 using MMP2-Iland Dox. In fact, exogenous supplementation of active MMP2 in Dox-treated iRPE cultures prevented the development of pro-maculopathy changes, directly linking MMP2 inhibition to pathological manifestations in this model (Figure 59 through Figure 70).
[0452] Importantly, DOX, a tetracycline antibiotic currently in clinical trials for advanced AMD (NCTO 1782989), can promote several pro-maculopathy cellular changes due to specific inhibition of MMP2 in RPE cells (Figure 20 through Figure 24, Figure 29, Figure 30, Figure 32 through Figure 38, Figure 40 through Figure 43, Figure 46, Figure 48, Figure 52, Figure 53, and Figure 58 through Figure 70). In fact, DOX, and a similar tetracycline antibiotic (minocycline) were / are being pursued in other relevant inflammatory diseases, like Alzheimer’s and atherosclerosis. However, a completed clinical trial did not observe beneficial effect of minocycline in Alzheimer’s (Howard et al., JAMA Neurol. February 1, 2020, 77(2): 164-174). Notably, failure of minocycline for Alzheimer’s was attributed to minocycline being a potent inhibitor of another gelatinase, MMP9 (Granzotto et al., JAMA Neurol. August 1, 2020, 77(8): 1037-1038). Similarly, DOX elicits joint / cardiac inflammation (Berry et al., J Am Heart Assoc. Mar 27, 2015, 4(4)) and a phase 3 clinical trial for MMP inhibitors had to be halted (Coussens et al., Science. Mar 29, 2002, 295(5564):2387-92). Furthermore, both in vivo and in vitro studies have shown detrimental consequences of minocycline for RPE and retinal homeostasis (Xu et al., Exp Eye Res. January 2020, 190:107887; Hollbom et al., Invest Ophthalmol Vis Sci. May 2010, 51(5):2721-9). Although the consequence of orally administered DOX / minocycline for RPE-secreted MMP2 / MMP9 activity is unknown, abnormal pigment clumping and drusen have been reported after minocycline treatment (Wilson et al., JAMA Ophthalmol. Nov 2015, 133(11): 1360-2; Jung et al., Ophthalmic Surg Lasers Imaging Retina. Apr 01, 2016, 47(4):356-61; Bradfield et al., Arch Ophthalmol. Jan 2003, 121(1): 144-5). Overall, these results caution against the use of tetracycline antibiotics for AMD / MDs and support further investigation of pathological consequences of gelatinase (MMP2 / MMP9) inhibition in AMD / MDs.
[0453] Although systematic evaluation of spatial changes in the activity of gelatinases (MMP2 / MMP9) in AMD are limited, highlighting the need for understanding spatially restricted changes in maculopathies, a recent study showed spatial HTRA1 changes in AMD donor eyes (Williams et al., Proc Natl Acad Sci USA. Jul 27, 2021, 118(30)). Specifically, HTRA1 mRNA levels were reduced in RPE but not neural retina or choroid derived from human donors with homozygous risk at the 10q26 locus. Similarly, a recent paper highlighted a pathogenic role of spatial VEGF-A level changes in an iRPE-CC model of AMD. In this study, utilizing iRPE from patients with multiple maculopathies, it was shown that reduced activity of RPE-secreted MMP2 contributes to sterile inflammation and drusen accumulation in AMD / MDs (Figure 71 through Figure 91). Furthermore, to address the discrepancy between the present data and previously published studies that show either increased or unaltered MMP2 activity in the RPE-choroid in AMD / MDs, spatial characterization of MMP2 activity in the SFD iPSC model and mouse model (Timp3;""!' mice) was performed. It is noteworthy that consistent with the SFD iRPE monocultures, Timp3KI mutmice displayed reduced gelatinase activity in the RPE-Bruch’s membrane compared to age- and sex-matched WT (Figure 92 through Figure 94, Figure 101, Figure 103, Figure 104, Figure 109, and Figure 110). However, gelatinase activity was similar in the RPE-choroid of WT versus Timp3KI~mutmice likely due to unaltered activity of TIMP3 and consequently MMP2 in the choroid (Figure 95 through 100 and Figure 105 through Figure 108).
[0454] It is noteworthy that despite reduced gelatinase activity in the RPE-Bruch’s membrane (Figure 92 through Figure 94, Figure 101, Figure 103, Figure 104, Figure 109, and Figure 110), Timp3KI~n"“ mice fail to mimic the human disease pathology of drusen, choriocapillaris atrophy and CNV that is recapitulated in the SFD iPSC model (Manian, K. V., et al., Cell Stem Cell. May 6, 2021, 28(5): 846-862 e8) (Figure 1 through 7, Figure 92 through Figure 94, Figure 101, Figure 103, Figure 104, Figure 109, and Figure 110). Similarly, in contrast to the iPSC model data (Figure 36 through Figure 58, Figure 92 through Figure 94, Figure 101, Figure 103, Figure 104, Figure 109, and Figure 110), previous studies in mice have not shown any retinal pathology following reduction / absence of MMP2 in vivo. However, a crucial molecule, sPLA2-IIA, linking MMP2 to inflammation and dysregulated lipid metabolism is absent in several inbred strains of mice including the C57BL / 6J and 129 / Sv mouse strains, that have been extensively used for developing AMD / MD mouse model(s), including the limp 3KI mutmice (Figure 92 through Figure 94, Figure 101, Figure 103, Figure 104, Figure 109, and Figure 110). Specifically, C57BL / 6J and 129 / Sv mice have a natural disruption in Pla2g2a gene and therefore are PLA2G2A (sPLA2- IIA) deficient (Kennedy et al., J Biol Chem. Sep 22, 1995, 270(38):22378-85) (Figure 92 through Figure 94, Figure 101, Figure 103, Figure 104, Figure 109, and Figure 110). Based on this data, it is plausible that in the presence of functional PLA2G2A, Timp3KI m,ltmice that display reduced MMP2 activity in RPE-Bruch’s membrane will develop macular degeneration. In fact, a similar phenomenon has been reported in other diseases where expression of human PLA2G2A has elicited phenotypic manifestations of cancer, metabolic disorders, and inflammatory diseases in mice (Murakami et al., Biochimie. Jun 2010, 92(6): 561 -82; Blache et al., FASEB J. Feb 2012, 26(2):927-37; Kuefner et al., FASEB J. January 2019, 33(l):738-749; Sharma et al., Biochem Biophys Res Commun. Jan 31, 2014, 444(l):56-62). Furthermore, BALB / c mice, one of the few common strains that express Pla2g2a, have recently been shown to develop AMD-associated drusen, and CNV (Xu et al., Am J Pathol. October 2021, 191 (10): 1787-1804). Overall, these data provide a potential explanation for why widely used mouse model(s) of AMD / MDs have thus far been limited in their ability to recapitulate the human disease phenotype.
[0455] Concordant with the data shown here, a few published studies on human donor eyes and iPSC models that have previously evaluated gelatinase activity, support decreased express! on / activity of RPE-secreted MMP2 in AMD / MDs. In addition, reduced activity of RPE- secreted MMP2 coincided with the timepoint of sub-RPE TIMP3 accumulation and preceded drusen buildup in multiple maculopathies including AMD (Figure 1 through Figure 9, Figure 11 through Figure 19, Figure 25 through Figure 28, and Figure 31). Together, these data support the likelihood that excess accumulation of TIMP3 beneath RPE cells, a well-established pathological feature of AMD / MDs and consequently reduced activity of RPE-secreted MMP2, DAMP- mediated RAGE activation, and sPLA2-IIA facilitated lipoprotein modification contribute to inflammation and subsequently drusen and advanced disease phenotypes (geographic atrophy and CNV) in multiple maculopathies.
[0456] In summary, iPSC-based disease modeling studies were used to i) show a causal role of MMP2-DAMP-RAGE-PLA2G2A axis in AMD / MDs and it) pharmacologically target drusen in patient-relevant iPSC models of 4 distinct maculopathies. Ultimately, utilizing small molecules to target drusen, a key driver of late-stage AMD / MD pathologies, bodes well for successful drugbased therapy of these blinding diseases.
[0457] One should note that this study did not investigate the causal role of PLA2G2A in mouse models of AMD / MDs, including CfhE mice, Sod I mice and Timp3KI mutmice (Coffey et al., Proc Natl Acad Set USA. Oct 16, 2007, 104(42)46651-6; Ramkumar et al., Prog Retin Eye Res. May 2010, 29(3): 169-90; Imamura et al., Proc Natl Acad Sci USA. Jul 25, 2006, 103(30): 11282-7). A major challenge validating the hypothesis in vivo is the lack of relevant models from the perspective of the proposed mechanistic defect. Notably, sPLA2-IIA, a crucial enzyme linking MMP2 to inflammation and dysregulated lipid metabolism in the iPSC studies is absent in several inbred strains of mice including the C57BL / 6 and 129 / Sv that have been extensively used for developing mouse model(s) of macular degeneration including the Cftr / ~ mice, Sodl / ' mice and Timp3KI mntmice. Therefore, this important question would require generating transgenic mice that harbor AMD / MD-relevant mutations and express PLA2G2A and will be pursued in future studies. Note that the lack of in vivo model and consideration of the involvement of distinct genetic factors in AMD / MD pathogenesis was the primary reason that patient lines from multiple diseases were used, including 1) SFD, an MD caused directly by TIMP3 mutation; 2) DHRD, an MD caused by mutation in another extracellular matrix regulating gene (EFE P7); 3) ADRD, an MD with no known genetic defect in the affected patients (note that the presence of common MD mutations from the affected patient iPSCs was excluded); and 4) three distinct AMD iPSC lines without consideration of genetic defect. Overall, in the absence of a relevant mouse model to corroborate the role of sPLA2-IIA in macular degeneration, a suitable human model system incorporating multiple patient lines was utilized to confirm the role of MMP2 in AMD / MDs.
[0458] Materials and Methods
[0459] Donor tissue procurement and iPSC subject details
[0460] The death to preservation time for donor eyes from eye bank was limited to < 8 hours. Fibroblasts from two SFD patients (S204C mutation in TIMP3), two DHRD patients (R345W mutation in EFEMP / ), one ADRD patient (unidentified mutation; no mutation in TIMP3 or EFEMP 1) and three healthy subjects (sibling control, isogenic gene corrected line, unrelated individual) were expanded and subsequently reprogrammed to obtain iPSCs. iPSCs from 3 age- and sex-matched normal subjects (no macular degeneration) and AMD patients with geographic atrophy that showed elevated levels of TIMP3 were also used. Note that confounding genetic variables (mutations in CFH, ARMS2, HTRA1 and SFD-associated TIMP3 mutations) were ruled out using PCR analysis as described (Xu et al., Mol Vis. Jul 28, 2008, 14: 1373-81). iPSCs Differentiation to endothelial cells (iECs), mesenchymal stem cells (iMSCs) and RPE iPSCs were differentiated to ECs, MSCs and RPE as previously described (Vodyanik et al., Cell Stem Cell. Dec 3, 2010, 7(6):718-29). Briefly, for differentiation of control iPSCs into ECs, iPSCs were first maintained on Matrigel in mTeSR and subsequently after two passages, the iPSCs were switched to E8BA (E8 media, with BMP4 at 5 ng / ml, and Activin at 25 ng / ml). This was followed by switching the media to E7i; E6 media (Gibco, ThermoFisher Scientific), 5 mM SB431542 (Miltenyi Biotec, MD, USA) and 10 ng / mL bFGF (PeproTech) on day 2. On day 4, MACS® magnetic separator (Miltenyi Biotec) was used to isolate CD3 U cells. CD31+ECs were then maintained in E7v media (E6 media (Gibco, ThermoFisher Scientific) supplemented with 10 ng / mL bFGF (PeproTech) and 50 ng / mL VEGF165 (PeproTech) at P0. For subsequent passages, iECs were maintained in VascuLife® media (Lifeline Cell Technology, MD, USA).
[0461] For MSC differentiation from control iPSCs, previously established protocol was followed. Briefly, iPSCs were co-cultured with OP9 cells followed by MACS® sorting to remove OP9 cells (CD29’positive cells). The remaining population of differentiated iPSCs was then cultured in methylcellulose semi-solid medium containing 40% ES cult (Stem Cell Technologies, BC, Canada), StemSpan™ serum-free expansion media (25% Stem Cell Technologies), 10% BIT 9500 supplement (Stem Cell Technologies), 1 : 100 Glutamax (Gibco, ThermoFisher Scientific), 1: 1000 EX-CYTE® supplement (Millipore Sigma, MA, USA), 100 mM monothioglycerol, 50 mg / mL ascorbic acid and 10 ng / mL hPDGF-BB) for 12 days. The following day, colonies with spherical morphology were isolated and plated on plates coated with collagen. These cultures were maintained in fibroblast media constituting of DMEM (Gibco, ThermoFisher Scientific), 20% heat-inactivated fetal bovine serum or FBS (Gibco, ThermoFisher Scientific), MEM nonessential amino acids (NEAAs) (Gibco, ThermoFisher Scientific) sodium pyruvate, penicillin, and streptomycin. iMSCs were also maintained in the aforementioned fibroblast media post-passaging.
[0462] For differentiation of control and patient iPSC lines (SFD, DHRD, AMD and ADRD) into iRPE, a previously described protocol was utilized (Singh et al., Invest Ophthalmol Vis Set. Oct 17, 2013, 54(10):6767-78; Meyer et al., Proc Nat! Acad Sci USA. Sep 29, 2009, 106(39): 16698-703). Briefly, colonies of iPSC were first dissociated and then cultured as free- floating embryoid bodies (EBs). On day 6, EBs were plated onto laminin-coated 6 well plates and subsequently cultured in neural induction medium (NIM: DMEM / F12 (Gibco, ThermoFisher Scientific) containing 1% MEM-NEAA (Gibco, ThermoFisher Scientific), 1% Glutamax (Gibco, ThermoFisher Scientific), 1% N2 Supplement (Gibco, ThermoFisher Scientific) and 2 mg / mL heparin). At day 14, NIM was switched to retinal differentiation medium (RDM) containing 70% DMEM (Gibco, ThermoFisher Scientific), 30% F-12 (Gibco), 2% B-27 supplement without Vitamin A (Gibco, ThermoFisher Scientific) and 1% (v / v) Gibco™ Antibiotic- Antimycotic (ThermoFisher Scientific). Patches of RPE were dissected from the differentiated iPSC cultures maintained in RDM ~>day 60 timepoint. Dissected iRPE were dissociated with 0.05% Trypsin- EDTA (Gibco, ThermoFisher Scientific) and plated onto laminin-coated (Gibco, ThermoFisher Scientific) 24-well plates and cultured in RDM media that contained 2% FBS until they formed a confluent monolayer. At this timepoint media was switched to RDM without FBS. Both control and patient iRPE cultures were matured for at least 60-90 days and then passaged onto 24-well plates for passage (Pl) RPE monolayers. Pl iRPE monolayers on 24-well plates were subsequently passaged onto either ThinCert® (ThinCerts, Greiner Bio-One, NC, USA) or Corning® Transwell inserts (Corning, NY, USA) or 24-well plates to obtain mature monolayers of P2 iRPE cells. Parallel age-matched (age in culture) control and patient iRPE monolayers were used in all experiments.
[0463] Co-culture of iRPE and macrophages
[0464] THP-1 cell line was purchased from the American Type Culture Collection (ATCC, USA), and cultured in a T-25 flask at 37 °C under 5% COsin RPMI 1640 medium (ThermoFisher Scientific) and supplemented with 10% heat-inactivated fetal bovine serum (Life Technologies, USA) and 1% penicillin / streptomycin (Life Technologies, USA). As previously described (Liu et al., PLoS One. 2023, 18(7):e0286056; Starr et al., PLoS One. 2018, 13(3):e0193601), for macrophage differentiation, THP-1 cells were seeded at 1 x 105cells in 24 wells and cultured in the presence of 100 ng / ml phorbol 12-myristate 13-acetate (PMA, Sigma- Aldrich) for 48 hours. After 48 hours, cells were maintained in RPMI 1640 media without PMA.
[0465] For co-culturing iRPE with macrophages, mature monolayers of control and SFD iRPE (~ day 90 in culture) on transwell inserts were placed on top of THP-1 -derived macrophages in 24-well plates. After 3 days of co-culture, conditioned media from the basal side was collected and used for MMP2 gelatin zymography analysis. MMP2-specific inhibitor (MMP2-I1) and Doxycycline (DOX) treatment of control iRPE cultures
[0466] Control iRPE cultures on transwell inserts with TER > 150 Q. cm'2were treated apically for a period of 6 days with either MMP2-I1 (Cayman Chemicals, Michigan, EISA) at a concentration of 5 pM or doxycycline (DOX, Tocris, Minnesota, USA) at a concentration of 30 pM. RPE cells were treated daily for both MMP2-I1 -treated or DOX-treated and matched untreated control iRPE cultures. Untreated wells were fed routine culture media with daily media change served as controls in these experiments. RPE-CM from untreated and MMP2-I1 and DOX treated cultures was collected at the 24-hour, 72 hour and 6 days timepoint and stored in - 80 °C until further use. Note that the selected doses of MMP2-I1 (5 pM) and Dox (30 pM) were based on published literature and dose-response studies in the laboratory that showed that MMP2-I1 (5 pM) and Dox (30 pM) were the maximal effective concentration of these drugs in reducing MMP2 levels / activity in RPE cultures without adverse effects.
[0467] MMP2 supplementation of iRPE cultures iRPE cultures on transwell inserts with TER of >150 Q.cm'2were either supplemented basally with 150 nM human recombinant active MMP2 (PeproTech, New Jersey, USA) for a period of 18 hours or 6 days. Parallel untreated iRPE cultures fed only with routine culture media (RDM) and served as controls in these experiments.
[0468] Rage antagonist peptide (RAP) and sPLA2-IIA inhibitor treatments of iRPE cultures iRPE cultures on transwell inserts or 24-well plates were apically supplemented daily with either 5 p M of RAP (Tocris chemicals, MN, USA) for a period of 14 days or 5 p M of LY315920 (Varespladib, Selleck Chemicals, TX, USA), a small molecule inhibitor of sPLA2- IIA for a period of 7 days. Note that the selected doses of RAP (5 pM) and LY315920 (5 pM) were based on either published literature (Norris et al., Proc Natl Acad Sci USA. Sep 02, 2014, 111(35): 12746-51; Thwin et al., Arthritis Res Ther. 2009, 11(5):R138); Arumugam et al., Clin Cancer Res. Aug 15, 2012, 18(16):4356-64) and / or dose-response studies in the laboratory that showed that RAP (5 pM) and LY315920 (5 pM) were the maximal effective concentration of these drugs in reducing RAGE and sPLA2-IIA levels in RPE cultures without adverse effects. Parallel cultures of un suppl emen ted iRPE cultures fed with routine culture media RDM daily served as controls in these experiments.
[0469] Bee-venom treatment of control iRPE cultures
[0470] Control iRPE cultures cultured on 24-well plates were either treated with 10 pg / ml of bee venom (cat# 765016, Cayman Chemicals, Michigan, USA) for 2h or bee-venom (10 pg / ml) in conjunction with a small molecule inhibitor of sPLA2-IIA, LY315920 (5 pM). Parallel cultures of unsupplemented iRPE cultures fed with routine culture media RDM daily served as controls in these experiments.
[0471] Gelatin and reverse zymography
[0472] MMP2 activity was analyzed by performing gelatin zymography using RPE-CM collected from the basal chamber of control and patient (SFD, DHRD and AMD) iRPE cultures seeded on transwell inserts. In a subset of experiments, RPE-CM collected from basal chamber of control vs SFD patient iRPE -macrophage co-cultures and control vs SFD iRPE-CC cultures was also analyzed for MMP2 activity using gelatin zymography. Parallel samples of RPE-CM were either treated with 0.1 M NaOH or 2 mM p-aminophenylmercuric acetate (APMA) at 37 °C for 2 hours to evaluate the total active MMP2 levels. Note that APMA convert the pro-enzyme form ofMMP2 into its active form (Toth et al., Methods Mol Biol . 2012, 878: 121-35). The untreated (NAOH) and APMA-treated samples were then mixed with 6X non-reducing sample buffer and ran on 12.5% polyacrylamide gels with 2.5 mg / ml of gelatin at 150V for -2 hours. The gels were then washed in 2.5% Triton X-100 (Fisher BioReagents) solution at RT on a shaker for 30 minutes before transferring to an incubation buffer (6.06 g Tris-HCL, 1.47 g CaCE, 2.92 g NaCl, pH 7.6) on a shaker at 37 °C for 18-24 hours. Following this, the gels were briefly washed in a destaining solution (1:3:6 glacial acetic acid: methanol: water) and stained with Coomassie Blue R-250 staining solution (Bio-Rad) at RT for 2 hours on a shaker. This was followed by destaining and imaging on Azure C500 imaging system (Azure Biosystems, Dublin, CA, USA).
[0473] For reverse zymography experiments, equal amounts of non-reduced iRPE protein samples (isolated from -Day 30 iRPE pellets) were loaded onto 12.5% polyacrylamide gels with 12 mg / ml of gelatin and 0.13 pg / ml of active MMP2 (PeproTech) as source of MMPs. The gels were allowed to run at 150V for 2 hours followed by washing in 2.5% Triton X-100 solution at RT on a shaker for 30 minutes. Similar to the zymography gels, reverse zymography gels were also transferred to the incubation buffer and allowed to shake at 37 °C for 18-24 hours. After 24- hour incubation, the gels were briefly washed in destaining solution followed by staining with Coomassie Blue R-250 solution (Bio-Rad) at RT for 2 hours on a shaker. This was followed by destaining and imaging of the gel on Azure C500 imaging system. Image Studio Lite version 5.2 and Microsoft Excel were used for analyses of both the zymography and reverse zymography gels.
[0474] Transepithelial resistance (TER) measurement
[0475] TER of iRPE cultures grown on transwell inserts was recorded using an EV0M2 voltohm meter in accordance with the manufacturer’s instructions (World Precision Instruments, Sarasota, FL). For every TER recording experiment, an empty transwell insert containing RDM alone served as the blank recording. Blank subtracted TER measurements are reported as Q*cm’2>reflecting resistance per unit area.
[0476] MMP / TIMP Multiplex Array
[0477] Basal RPE-CM from iRPE cultures on transwell membrane inserts were analyzed using the Human MMP / TIMP Multiplex Array (Eve Technologies; pay for service). The Array can detect the following biomarkers, MMP1, MMP2, MMP3, MMP7, MMP8, MMP9, MMP10, MMP11 and MMP12.
[0478] Transmission Electron Microscopy iRPE monolayers cultured on transwell inserts were fixed in a fixative containing 2.5% glutaraldehyde and 4% PFA in 0.1 M sodium cacodylate and processed as previously described. Briefly, fixed iRPE transwell inserts were embedded in epoxy resin, and 60-nm-thick sections were cut at 10-pm-depth advancements into the sample. Subsequently, iRPE sections were imaged using a transmission electron microscope (7650 Analytical transmission electron microscope; Hitachi). Protein isolation of RPE pellets and concentration of RPE conditioned media for Western blotting
[0479] Protein from iRPE pellets was isolated with Pierce® RIPA buffer (ThermoFisher Scientific) containing protease inhibitor cocktail (1 :100) (Sigma-Aldrich, MO, USA). Protein quantification was performed using Bio-Rad DC Protein Assay Kit (Bio-Rad) following manufacturer’s protocol. RPE-CM was collected from the basal chamber of transwell inserts. The media was concentrated using Amicon® Ultra centrifugal filters 3K (Millipore Sigma) following manufacturer’s instructions.
[0480] Isolation of extracellular matrix (ECM) from iRPE cultures for Western blotting
[0481] ECM was isolated from underneath iRPE cultures using a previously described protocol. Briefly iRPE monolayers on transwell membranes or 24-well plates was removed non- enzymatically and incubated in 10 mM EDTA in lx PBS at 37 °C for up to 60 minutes in 20 minutes intervals. After complete removal of iRPE, the transwell membrane / 24 well plate was incubated in ECM isolation buffer (1% SDS and 10% glycerol in Tris buffer (pH 6.8)] with protease inhibitor cocktail (Sigma-Aldrich, MO, USA) for 30 minutes at 37 °C. ECM extract isolated from iRPE cultures was either acetone precipitated or stored in -80 °C until ready to be used for Western blotting.
[0482] Western blotting
[0483] Equal amount of iRPE protein pellets, equal volumes of concentrated RPE-CM or acetone precipitated ECM samples were diluted in 2x (iRPE, RPE-CM) or 4X (ECM) Laemmli reducing buffer (Bio-Rad) and heated at 90°C for 5 minutes. Denatured protein samples were then resolved on 4-20% Tris-HCl gradient gels (Bio-Rad) and subsequently transferred onto low fluorescence polyvinylidene difluoride (PVDF) membranes (Bio-Rad) as previously described (Galloway et al., Invest Ophthalmol Vis Sci. Jun 1, 2018, 59(7):2792-2800). Prior to analyzing levels of specific proteins using antibodies, total protein levels on the PVDF membranes posttransfer were evaluated using SYPRO™ Ruby protein blot stain (Thermo Fisher Scientific) using the manufacturer’s instructions. Briefly, the PVDF membranes were immersed in 7% acetic acid, 10% methanol and incubated at RT on a shaker for 15 minutes. The membranes were then washed with deionized water 4 times for 5 minutes each. Following this, the membranes were then immersed in SYPRO Ruby protein blot reagent for 15 minutes at RT on a shaker. The SYPRO Ruby stained blots were then rinsed with deionized water 2-3 times for 1 minute each and then visualized UV illumination on Azure C500 imaging system. Total protein levels based on SYPRO™ Ruby stain intensity was calculated using Image Studio Lite version 5.2 and Microsoft Excel.
[0484] For evaluating the levels of specific proteins, the PVDF membranes post- SYPRO Ruby staining were blocked in either 5% dry milk in 1X-PBS or Li-Cor Odyssey Blocking Buffer (Li- Cor, Nebraska, USA) for 1 hour on a shaker at RT. This was followed by 4 washes in PBS and an overnight incubation in primary antibodies at 4°C. The primary antibodies were diluted in Intercept Antibody Diluent (Li-Cor, USA) and included: TIMP3 (1 :500), HMGB1 (1 :500), RAGE (Abeam, ab 37647 1:500 or Santa Cruz Biotechnology sc365154 1 :250), sPLA2-IIA (1 :500) and C3 (1 :500, A205, Quidel, California, USA). The following day, the PVDF membrane was washed 4 times in PBS-Tween (0.1%) followed by incubation in host-specific peroxidase-conjugated secondary antibodies (1 : 10,000, Azure Biosystems) for 1 hour on a shaker at RT. This was followed by 4 washes in PBS-Tween (0.1%) and finally 4 washes in 1 * PBS. The membranes were developed using Radiance Plus Chemiluminescence Kit (Azure Biosystems) or Clarity Max™ Western ECL substrate (Bio-Rad) and then visualized using Azure C500 imaging system. Quantitative analyses of the Western blot data were carried out using Image Studio Lite version 5.2 and Microsoft Excel.
[0485] Prostaglandin E2 (PGE2) Assay
[0486] Conditioned media collected from untreated, bee-venom treated or combination of beevenom and LY315920-treated control iRPE cultures was concentrated using Amicon® Ultra centrifugal filters 3K (Millipore Sigma) following manufacturer’s instructions. Concentrated conditioned media was used to measure PGE2 levels using a Prostaglandin E2 Parameter Assay Kit (KGE004B, R&D Systems) following manufacturer’s instructions.
[0487] Oil Red O staining of iRPE cultures
[0488] Untreated and MMP2-I1 treated control iRPE cultures on transwell inserts stained with Oil Red O using a commercially available kit (MAKI 94, Sigma Aldrich) following manufacturer’s instructions. Briefly, the iRPE containing transwell membranes were fixed with 10% formalin (provided in the kit) for Ih. This was followed by washing the cells with water 2 times and incubating in 60% isopropanol for 5 minutes. The membranes were then stained with freshly made Oil Red O solution for 30 minutes followed by multiple washes with distilled water to remove any excess stain. Cells were then stained with hematoxylin (provided in the kit) and this procedure was also followed by washes with distilled water. The membranes were subsequently mounted on slides and imaged using Keyence BZ-X800 Epifluorescence Microscope.
[0489] RNA isolation and quantitative real-time RT-PCR analysis
[0490] Total RNA was isolated from iRPE cells using QiaShredder and the RNAeasy micro kit (Qiagen, Germantown, MD) following manufacturer’s instructions. Note that an additional step of on-column DNase digestion was also included during RNA isolation. RNA was then utilized to synthesize cDNA using i Script reverse transcriptase kit (BioRad) following the manufacturer’s instructions. Quantitative real-time PCR was subsequently performed using previously published primers for C3 and CFB and GAPDH genes, and 18S specific primers (forward: CTGAGAAACGGCTACCACATC (SEQ ID NO:2), 18S Reverse: GCCTCGAAAGAGTCCTGTATTG (SEQ ID NO:3)) using SYBR Green (BioRad) and CFX- Connect Real Time System cycler (BioRad). GAPDH or 18S served as a loading control for gene expression analyses with gene expression calculated relative to 18S / GAPDH followed by normalization to untreated samples in each individual experiments. Data was analyzed using the Biorad CFX Manager 3.1 software and Microsoft Excel.
[0491] Immunohistochemistry and immunocytochemistry
[0492] Immunocytochemical analysis of iRPE section. Aged iRPE cultures grown as monolayers either on transwell membrane inserts and / or non-permeable plastic support were fixed at room temperature in paraformaldehyde (4%) for 30 minutes and then processed for cryosection or paraffm-embedding. For cryosections, fixed iRPE were washed two times in PBS for 5 minutes and then incubated in increasing sucrose density solutions; 10% sucrose (1 hour), 20% sucrose (1 hour) and 30% sucrose (overnight at 4 °C). The iRPE samples were then embedded in tissue freezing medium (TFM) (Triangle Biomedical Sciences, Durham, NC) for snap freezing and subsequently sectioned at 14 nm thickness on CRYOSTAR NX50. The iRPE cryosections were stored at -80 °C prior to use.
[0493] For paraffin sectioning of fixed iRPE samples, a previously described protocol was followed. Briefly, fixed iRPE samples were dehydrated by consecutive 30 minutes incubation in 70%, 95% and 100% ethanol, followed by an overnight incubation in 100% ethanol. The following day, samples were incubated in xylene, prior to paraffin embedding under vacuum. Paraffin blocks were sectioned at 14 pm thickness using HM 310 microtome (Microm, Walldorf, Germany). Furthermore, like frozen iRPE sections, paraffin iRPE sections were either used directly for immunocytochemical analysis or stored at 4 °C prior to further use. Prior to staining, slides with paraffin-embedded sections were heated at 65 °C for 15 minutes then allowed to cool at RT. The slides were then incubated in xylene twice for ten minutes each to allow for deparaffinization. Rehydration of sections was done by successive washes in 100%, 95% and 70% ethanol, twice each for 3 minutes and then a final wash in ddFEO for 3 minutes. Slides were then incubated in 10 mM sodium citrate buffer pH 6.0 at ~95 °C for 30 minutes for antigen retrieval.
[0494] In a subset of experiments, to stain for serum-derived proteins in iRPE drusen, AMD / MD iRPE cultures were treated for 6 days with human serum as described previously. Briefly, mature AMD / MD iRPE cultures seeded on transwell inserts or 24-well plates were treated daily apically with 10% human serum followed by fixing with 4% PFA and used for sample processing either for paraffin embedding or frozen sectioning.
[0495] Immunostaining of the frozen and paraffin-embedded sections was performed following previously described protocols. Briefly, sections were blocked / permeabilized for 1 hour at room temperature (RT) in l x blocking solution containing normal donkey serum (10%) (ImmunoReagents Inc., Raleigh, NC), Triton X-100 (0.1%) (Fisher BioReagents) inlX PBS. Subsequently, slides were incubated in protein-specific primary antibody solution in 0.5 x blocking buffer overnight at 4 °C. The next day, samples were washed in PBS-TX (2X) and incubated in host-appropriate secondary antibody for 1 hour at RT. This was followed by washes in PBS-TX (2X) and 20 minutes incubation in Hoechst 33342 in PBS (1 :1000, Life Technologies) and mounting in Prolong Gold (Life Technologies). Slides were subsequently cover slipped and imaged using confocal microscopes (LSM 510 META, Zeiss, Thornwood, NY, USA; Nikon Eclipse Ti2 Al HD25 / AIR HD25, Nikon, New York, USA). Images were captured using Zen 2009 software (Zeiss) and NTS Elements software (Nikon) and analyzed further using Image J software (NIH).
[0496] Primary antibodies used for immunocytochemical analysis included: APOE (Millipore Sigma, ab947 1 :200), HMGB1 (Novus Biologicals NB 100-2322, 1 : 100), TIMP3 (Millipore Sigma MAB3318, 1 :75), omega-(2-carboxyethyl)pyrrole (CEP) (1 : 100), sPLA2 -Ila (Abeam, ab23705 1 : 100), VTN (Abeam, ab45139, 1 : 100), C5b-9 (Abeam, ab55811, 1 : 100), CRYAB (Enzo LifeSciences, ADI-SPA-223-F, 1 :100). All secondary antibodies used in this study were Alexa-conjugated (Life Technologies, CA, USA) and used at a concentration of 1 :500. To visualize neutral lipids, Nile Red stain (1 :200, Molecular Probes, Eugene, OR, USA) was used in conjunction with antibody staining in specific experiments.
[0497] Immunostainins of iRPE-ECM on transwell membrane. To stain for drusen underneath the monolayers of control, SFD, DHRD, ADRD and AMD iRPE cultures grown either on transwell inserts or 24-well plates, RPE was incubated with 0.05% trypsin-EDTA (Gibco) for up to 30 minutes with 15 minutes interval at 37 °C. After removal of the RPE, the transwell membrane was fixed in 4% PFA for 30 minutes at RT. This approach was used to visualize drusen deposits beneath the RPE monolayer without any confounding variables, like presence of RPE nuclei. The procedure for blocking, primary antibody and secondary antibody was as described previously (see: immunocytochemical analysis of iRPE section}. Primary antibodies used for immunocytochemical analysis of iRPE-ECM included: APOE (1 :200), HMGB 1 (1: 100), TIMP3 (1 :75) and sPLA2-IIa (1 : 100). All secondary antibodies used in this study were Alexa- conjugated (Life Technologies) and used at a concentration of 1 :500.
[0498] Immunohistochemical analysis of human donor tissue section. The sections were paraffin embedded and were processed as previously described (see immunocytochemical analysis of iRPE section}. Post-staining, the slides were incubated in TrueBlack® Lipofuscin Autofluorescence Quencher (Biotium, CA, USA cat# 23007) following the company’s instructions. Briefly, the stained slides were incubated with 1* concentration of TrueBlack® (diluted with 70% ethanol) for 1 minute. The slides were then rinsed three times with 1 * PBS and coverslipped with Prolong gold mounting medium prior to confocal imaging with either Zeiss or Nikon Ti2 confocal microscopes. Primary antibodies used for immunocytochemical analysis included: APOE (1:200), HMGB1 (1: 100), omega-(2-carboxyethyl)pyrrole (CEP) (1 : 100) and sPLA2-IIa (1 : 100). All secondary antibodies used in this study were Alexa- conjugated (Life Technologies) and used at a concentration of 1 : 500.
[0499] In situ zymography (ISZ) and immunohistochemical analysis of mouse tissue section Mice eyes were enucleated and fixed for 24 hours in a zinc-buffered fixature (ZBF) containing 36.7 mM ZnC12, 27.3 mM ZnAc2 x 2H2O, and 0.63 mM CaAc2 in 0.1 M Tris, pH 7.4. ZBF helps in preserving gelatinase activity along with tissue morphology (Hadler-Olsen et al., J Histochem Cytochem. Jan 2010, 58(1 ) :29-39). The ZBF-fixed eyes were incubated at 4 °C in 10% sucrose overnight, 20% sucrose overnight and 30% sucrose for 2-3 days. The eyes were then embedded TFM and sectioned at 14 pm thickness before staining for gelatinase activity using a commercially available kit, EnzChek™ Gelatinase / Collagenase Assay Kit (ThermoFisher Scientific). Specifically, the slides were incubated in 100 pg / ml of DQ™ gelatin diluted in lx reaction buffer (provided in the kit) for 1.5 hours at RT. Following this, the slides were washed in 1 x PBS and then blocked / permeabilized at RT in 10% NDS (ImmunoReagents Inc., Raleigh, NC) in 1 x PBS-TX for 1.5 hours. A subset of sections were then incubated overnight at 4 °C in rabbit-anti-COL4 primary antibody (Abeam, ab 19808, 1:200) solution or in sheep anti-PLA2G2A (R&D systems, AF4925, 1 :50) in 0.5x blocking buffer. Subsequently, the slides were washed twice in lx PBS and incubated in donkey-anti rabbit secondary antibody for 2 hours at RT again followed by 3 washes in 1 x PBS and 20 minutes incubation in Hoechst 33342 in PBS (1 : 1000, Life Technologies). The slides were coverslipped using Prolong Gold and imaged using Zeiss confocal microscope using Zen 2009 software (Zeiss).
[0500] To validate the use of this ISZ protocol for measuring gelatinase activity in the RPE- choroid tissue, in a subset of experiments RPE-choroid sections were incubated with both DQ™ gelatin (100 pg / ml) along with a known MMP inhibitor (also provided in the kit) 1, 10- phenanthroline at concentration of 0.1 mM (Figure 105 and Figure 106).
[0501] Quantification of drusen deposits (count, area)
[0502] Fiji-ImageJ was used to quantify the count and area of drusen-like deposits. Raw image files were opened in Fiji and z-stack images were converted to maximum Intensity Projection to yield a single composite image. This image was converted to the RGB format and then converted to an 8-bit image. This was followed by setting an intensity threshold and then reconverting the image to a binary form that is necessary for use of the analyze particles option in Fiji-ImageJ. Count and area measurements were performed on deposits that showed co-localization for drusen-resident proteins (AP0E / TIMP3), neutral lipids (Nile Red), DAMP (HMGB1) and / or sPLA2-IIA. Co-localized drusen deposits (count / area) was measured either per length of the iRPE section or per viewing area (transwell membrane) and is either reported normalized to control / untreated conditions. Note that for each individual experiment, a total of 5-6 independent viewing fields were analyzed for quantifying drusen deposit in each condition (e.g., control versus AMD and untreated versus treated). Furthermore, at least 3 independent experiments utilizing distinct biological replicates for each condition were performed for every drusen analyses (count / area) experiment.
[0503] To validate drusen in the iPSC model, the presence of additional drusen markers was shown (C5b-9, C3, CRYAB, TIMP3 and VTN) in iPSC AMD / MD iRPE cultures (Figure 111 through Figure 118). In addition, to validate, use of transwell membrane for drusen deposition evaluation, the count and area of TIMP3 / AP0E co-localized sub-RPE deposits were compared in iRPE sections versus transwell membranes from control versus SFD iRPE cultures (Figure 117 through Figure 120).
[0504] Quantification of ISZ activity mice sections
[0505] Brightfield images and confocal images with ISZ (green) and COL4 (red) were overlapped to form a composite image. The composite images were used to select the region for marking the RPE-Bruch’s membrane and choroid regions using the freehand selection option in Fiji. The pigmented RPE and COL4 localization was used to demarcate the RPE-Bruch’s membrane region, while the pigmented choroid underneath the COL4-labeled Bruch’s membrane was utilized to select the choroid region. The selected (RPE, choroid, RPE+choroid) regions were added to ROI manager and then analyzed for intensity density using the analyze option in Fiji. Note that for each individual experiment, a total of 5-6 independent viewing fields were analyzed for quantitative ISZ analyses. Furthermore, at least 3 independent experiments were performed with each individual experiment utilizing distinct biological replicates.
[0506] Generation of iPSC-derived choriocapillaris tissue mimetic iPSC-derived choriocapillaris tissue mimetic was generated as previously described. Briefly, -25,000 iPSC-derived mesenchymal stem cells (iMSCs) were seeded onto 24-well Transwell insert surface overnight. The following day, iPSC-derived endothelial cells (iECs) (1.5 x 105) were encapsulated into poly(ethylene glycol) (PEG) hydrogels prepared as previously described on top of the iMSC monolayer in transwell inserts. For generating iRPE-CC, control or SFD iRPE cells ( 2.5 x 1CP ) were seeded on the apical side of ECs encapsulated PEG hydrogels on top of the MSC monolayer on transwell inserts as described previously. Parallel cultures of control and SFD iRPE-CC cultures were fed with VascuLife® (Lifeline Cell Technologies) basally and RPE growth media apically.
[0507] In experiments comparing the impact of basally-secreted RPE-CM from control (untreated) versus MMP2-I1 treated control iRPE cultures, iCC mimetic hydrogels immediately post-assembly were treated with control iRPE-CM apically. Subsequently, when prominent vasculature was formed in the hydrogels (5-6 days), one of the hydrogel sets was fed RPE-CM from MMP2-I1 treated iRPE cultures (from Day 6-14), while the other continued to be fed with RPE-CM from untreated iRPE cultures. Light microscopy images were taken at intervals to monitor the fate of the vasculature.
[0508] Genotyping of ARMS2, CFH, HTRA1, and TIMP3 genes
[0509] Genomic DNA was extracted from the iRPE cell pellets (all control and AMD / MD lines used in the study) using a commercially available genomic DNA extraction and purification kit (ZymoResearch, CA, USA). Polymerase chain reaction (PCR) utilizing published primer sequences (Figure 121) followed by allele-specific restriction enzyme digestion, as previously described, was used to assess CFH (rsl061170), ARMS2 (rsl0490924), HTRA1 (rsl 1200638) SNPs. Post-PCR, restriction digestion was performed at 65 °C for 3 hours for (MluCI for CFH Y402H) and 37 °C for 3 hours for (PvuII for ARMS2 and EagI for HTRA !). Samples were electrophoresed on a 2% (w / v) agarose gel with 0.5 pg / ml ethidium bromide. Genotypes were determined based on the restriction pattern. The results of the genotyping screening of CFH (rsl061170), ARMS2 (rsl0490924), HTRA1 (rsl 1200638) for all control and AMD / MD lines are listed in Figure 122.
[0510] For detecting disease-associated TIMP3 SNPs (rs9621532, rs713685), allele specific primers (WT versus mutant) were designed by selecting the mutation sites (Little, Curr Protoc Hum Genet. May 2001, Chapter 9:Unit 9 8). Detecting of a PCR product from using only WT primer was considered to not have the SNP, whereas detection of a PCR product with only the mutant primer meant both the alleles had the mutation. Also, when an amplification product was detected using both WT and mutant primers, the lines were considered as heterozygotes. For PCR analysis of SFD-associated TIMP3 mutation (S20-fC), PCR was done with primers listed in Figure 121 followed by restriction enzyme digestion. For restriction digestion, the amplified 547 bp products were analyzed by restriction enzyme digestion with Nsil according to the manufacturer’s protocol (New England Biolabs, Cat # R3127S). Genotypes were determined based on the restriction pattern.
[0511] All the primers used for genotype screening are listed in Figure 121. Furthermore, the results of the genotyping screening of TIMP3 (rs9621532), TIMP3 (rs713685), for control and AMD / MD lines used in this study are provided in Figure 122.
[0512] Experimental Set-up and Statistical Analyses
[0513] Parallel age-matched cultures (e.g., control versus patient; untreated versus treated) were used in all experiments and each individual experiment was carried out at least in triplicates unless otherwise stated. In addition, five distinct controls, two SFD, 2 DHRD, 3 AMD and one ADRD iRPE lines were used in the experiments. In addition, up to two distinct clones per control and patient iPSC line were used in each experiment. The data throughout the manuscript is relative to either total protein (SYPRO™ blot stain) or cell number and normalized to either control or untreated samples from the experiment. All data are presented as mean ± SEM. Statistical significance was determined using unpaired t-test analyses using Microsoft Excel and GraphPad Prism software.
[0514] Example 2; Novel sPLA2-IIA Inhibitors for Treatment of Macular Degeneration and Macular Dystrophy
[0515] In order to treat macular degeneration and macular dystrophy, a potent, selective, and bioavailable modulator of the MPP2-DAMP-RAGE-sPLA2-IIA axis pathway is needed. To this end, given the successful reduction of drusen-like deposits in Example 1, a novel small molecule inhibitor of sPLA2-IIA was developed (PLG-00064).
[0516]
[0517] (PLG-00064)
[0518] The activity of PLG-00064 was examined in an induced pluripotent stem cell (iPSC) model of macular degeneration and dystrophy. In this model, cells that were left untreated developed significant deposits of APOE co-localizing with Nile Red (Figure 123). Addition of PLG-00064, however, significantly reduced the number of APOE / Nile Red co-localization spots, the total area of co-localization, and the percent area relative to total cell area (Figure 124). The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
Claims
CLAIMSWhat is claimed is:
1. A compound of Formula (I), or a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof:whereinX is selected from the group consisting of N and CRXY is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenylene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;R3and R4each represent mono to the maximum possible number of substitution;Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NH(R5), -N(R5)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, 'S-alkyl, S(=O)2alkyl, -C(=O)NHR5, -C(=O)N(R5)2, -OC(=O)N(R5)2, -NHC(=O)NH(R5), -NHC(= O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R5)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R3is independently selected from thegroup consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
2. The compound of claim 1, wherein Z represents -NH2.
3. The compound of claim 1, wherein the bonds between X and Y each represent ethylene.
4. The compound of claim 1, wherein R1represents -CH2PI1.
5. The compound of claim 1, wherein R2represents alkyl.
6. The compound of claim 1, wherein the compound of Formula (I) is represented byFormula (II):Formula (II) wherein L1represents NH or a single bond.
7. The compound of claim 1, wherein the compound of Formula (I) is represented byFormula (III):Formula (III) wherein L2represents NH or a single bond.
8. The compound of claim 1, wherein the compound of Formula (I) is represented by one of the following structures:
9. A method for treating macular degeneration or macular dystrophy in a subject, comprising administering to the subject a modulator of the MMP2-DAMP-RAGE-sPLA2-II axis pathway.
10. The method of claim 9, wherein the modulator comprises at least one selected from the group consisting of: a. an activator of MMP2; b. an inhibitor of RAGE; and c. an inhibitor of sPLA2-IIA.11 . The method of claim 10, wherein the activator of MMP2 comprises one or more selected from the group consisting of MMP2 protein and a nucleic acid molecule encoding MMP2.
12. The method of claim 10, wherein the inhibitor of RAGE comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecule.
13. The method of claim 12, wherein the inhibitor of RAGE comprises an antagonistic peptide comprising the amino acid sequence of ELKVLMEKEL (SEQ ID NO: 1).
14. The method of claim 12, wherein the inhibitor of RAGE comprises one or more selected form the group consisting of FPS-ZM1, RBGO1, RAGE203, RAGE208, RAGE229, azeliragon, TTP488, GM-1111, 4,6-disubstutuded 2-aminopyrimidines, 4-fluorophenoxy analogs, TTP-3000, and low-molecular weight heparin.
15. The method of claim 10, wherein the inhibitor of sPLA2-IIA comprises at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomimetic, an antibody, an antibody fragment, a ribozyme, a small molecule chemical compound, a short hairpin RNA, RNAi, siRNA, miRNA, an antisense nucleic acid molecule, or a nucleic acid encoding an antisense nucleic acid molecule.
16. The method of claim 15, wherein the inhibitor of sPLA2-IIA comprises is one or more selected from the group consisting of varespladib (LY315920), tanshinone I, sinapicacid, quinacrine, quercitrin, polydatin, KH064, KH067, GK241, AZD 2716, folipastatin, LY311727, YM-26734, luffariellolide, CAY10590, thioetheramide-PC, elemolic acid, BMS-181162, BMS- 188184, thielocin Aip, thielocin B3, SB-203347, LY333013, L315920-morpholino-N-ethyl ester, daniluromer, dexamethasone, and CHEC-9 (CHEASAAQC).
17. The method of claim 15, wherein the inhibitor of sPLA2-IIA comprises a compound of Formula (I), or a derivative, prodrug, or pharmaceutically acceptable salt or solvate thereof:Formula (I) whereinX is selected from the group consisting of N and CRXY is selected from the group consisting of S, S(O), and S(O)2 the bonds between X and Y are independently ethylene or vinylene;Z is selected from the group consisting of -OH, -ORZ, -NH2, -NHRZ, and -N(RZ)2.L is a linking group selected from the group consisting of alkylene, cycloalkylene, heteroalkylene, heterocycloalkylene, alkenylene, alkynylene, arylene, heteroarylene, silyl, amine, amide, ester, ether, carbonyl, carbamate, sulfamate, sulfonic ester, sulfoximine, sulfonamide, thioether, thioester, disulfide, hydrazine, urea, thiourea, phosphate, phosphonate ester, poly(alkyl ether), heteroatom, and combinations thereof;R3and R4each represent mono to the maximum possible number of substitution;Rx, Rz, R1, R2, R3, and R4are independently selected from the group consisting of hydrogen, deuterium, halogen, -CN, -NH2, -OH, -NH(R5), -N(R?)2, aryl, heteroaryl, alkyl, cycloalkyl, heterocycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, S-alkyl, S(=O)2alkyl, -C(=O)NHR5, -C(=O)N(R5)2, -OC(=O)N(R5)2, -NHC(=O)NH(R5), -NHC(= O)alkyl, -N(R5)C(=O)(R5), -NHC(=O)(R5), -C(OH) (R5)2, -C(NH2)(R5)2, and combinations thereof; wherein each occurrence of R5is independently selected from the group consisting of hydrogen, deuterium, alkyl, heteroaryl, aryl, and combinations thereof.
18. The method of claim 17, wherein Z represents -NH2.
19. The method of claim 17, wherein the bonds between X and Y each represent ethylene.
20. The method of claim 17, wherein R1represents -CFFPh.
21. The method of claim 17, wherein R2represents alkyl.
22. The method of claim 17, wherein the compound of Formula (I) is represented byFormula (II):Formula (II) wherein L1represents NH or a single bond.
23. The method of claim 17, wherein the compound of Formula (I) is represented by Formula (III):Formula (III) wherein L2represents NH or a single bond.
24. The method of claim 17, wherein the compound of Formula (I) is represented by one of the following structures:
25. The method of claim 9, wherein the subject has age-related macular degeneration (AMD).
26. The method of claim 9, wherein the subject has a macular dystrophy selected from the group consisting of: Sorsby’s fundus dystrophy (SFD), Doyne honeycomb macular dystrophy (DHRD) and autosomal dominant radial drusen (ADRD).
Citation Information
Patent Citations
Extending the duration of drug release within the stomach during the fed mode
US20020051820A1
Extending the duration of drug release within the stomach during the fed mode
US20030039688A1
Pharmacological inducement of the fed mode for enhanced drug administration to the stomach
US20030044466A1
Optimal polymer mixtures for gastric retentive tablets
US20030104053A1
Shell-and-core dosage form approaching zero-order drug release
US20030104062A1