Therapeutic adeno-associated virus using codon optimized nucleic acid encoding lamp2b

Abstract

Disclosed herein are codon-optimized nucleic acids encoding a LAMP2B polypeptide. Also disclosed are expression cassettes and expression vectors (e.g., recombinant AAV (rAAV) vectors) that contain the codon-optimized nucleic acids in expressible form. Methods for the treatment of Danon disease. A comprising administering expression vector comprising the codon-optimized nucleic acids (e.g., a recombinant AAV (rAAV) vector) are also disclosed.

Description

Aty. Dkt. No.046192-000118WOPT THERAPEUTIC ADENO-ASSOCIATED VIRUS USING CODON OPTIMIZED NUCLEIC ACID ENCODING LAMP2B CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This international application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application Nos 63 / 633,410 filed April 12, 2024; 63 / 666,567 filed July 1, 2024; and 63 / 746,601 filed January 17, 2025, the content of which is incorporated herein by reference in their entireties. FIELD OF THE INVENTION

[0002] The present invention relates to methods to treat Danon disease by administering adeno- associated virus (AAV) particles, virions and vectors for expression of a LAMP2B polypeptide, where the nucleic acid encoding LAMP2B is codon optimized. BACKGROUND

[0003] Danon disease is an X-linked dominant disease caused by mutations in the lysosome- associated membrane 2 (LAMP2) gene and is characterized by the clinical triad of cardiomyopathy, skeletal myopathy and intelectual disability (D’Souza R. et al (2023); Brambati M et al (2019)).

[0004] LAMP2 codes for three LAMP2 protein isoforms – LAMP2A, LAMP2B and LAMP2C. While most LAMP2 mutations affect al 3 isoforms, isoform-specific mutations in Danon have been reported only for LAMP2B which is expressed in the heart, skeletal tissue and the brain indicating that LAMP 2B deficiency is central to the pathogenesis of Danon (D’Souza R et al (2014). Within celular systems, LAMP2 is required for the fusion of autophagosomes and lysosomes – a crucial step for the degradation of celular waste (D’Souza R et al (2014) 4. Alcali R. et al (2021). Endo Y et al (2015)). Mutations in LAMP2 lead to deficiencies in the LAMP2 protein resulting in the disruption of autophagy and accumulation of vacuoles containing cytoplasmic and celular debris (autophagic vacuoles) (Zhai Y et al (2023)).

[0005] In males with Danon disease the onset of severe hypertrophic cardiomyopathy occurs in childhood-adolescence and mortality by the 2nd to 3rd decade of life. The current standard of care is heart transplant resulting in a high unmet medical need.

[0006] In vivo studies in a murine model of Danon showed dose-dependent restoration of LAMP2 and phenotypic rescue when treated with AAV9-LAMP2B (Manso et al (2020)). Results from the Phase I investigational study of AAV9-LAMP2B (RP-A501, see, e.g., Greenberg et al N Engl J Med (2025);392:972-983) in Danon patients demonstrated sustained improvement in LAMP-2B expression and improvement in cardiac symptoms. Initial efficacy readouts from this trial indicate that AAV gene therapy is an atractive approach for treatment of Danon, however the high dose of systemicaly administered AAV resulted in severe adverse events among subjects.Aty. Dkt. No.046192-000118WOPT SUMMARY OF THE INVENTION

[0007] The technology described herein relates generaly to gene therapy constructs, methods and composition, for the treatment of Danon disease.

[0008] In one aspect, described herein is a codon-optimized nucleic acid encoding a LAMP2B polypeptide, wherein the nucleic acid comprises the nucleic segememt (e.g., a nucleic sequence) set forth in any one of SEQ ID NOs 1-3, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

[0009] In some embodiments of any of the aspects described herein , the nucleic acid comprises the nucleotide sequence set forth in any one of SEQ ID NO: 1, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

[0010] In some embodiments of any of the aspects described herein, the nucleic acid comprises the nucleotide sequence set forth in any one of SEQ ID NO: 2, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

[0011] In some embodiments of any of the aspects described herein, the nucleic acid comprises the nucleotide sequence set forth in any one of SEQ ID NO: 3, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

[0012] In some embodiments of any of the aspects described herein, the encoded polypeptide is a LAMP2B polypeptide or a functional variant of the LAMP2B polypeptide having the amino acid sequence shown in SEQ ID NO: 9, or at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 9.

[0013] In some embodiments of any of the aspects described herein, the codon-optimized nucleic acid is comprised within a nucleic acid construct that further comprises viral or non viral sequence elements that facilitate integration and / or expression.

[0014] In one aspect, described herein is an expression cassete containing a codon-optimized nucleic acid as described herein, operably linked to a muscle-specific promoter.

[0015] In some embodiments of any of the aspects described herein, the muscle-specific promoter targets skeletal and cardiac muscle.

[0016] In some embodiments of any of the aspects described herein, the muscle-specific promoter targets cardiac muscle.

[0017] In some embodiments of any of the aspects described herein, the muscle-specific promoter targets skeletal muscle.

[0018] In some embodiments of any of the aspects described herein, the muscle-specific promoter comprises a nucleic acid sequence selected from the group consisting of SP0497, SP0498, SP0499, SP0500, SP0508, SP0509, SP0510, SP0511, SP0512, SP0513, SP0522, SP0524, Syn100, and Spc5- 12 and a nucleic acid having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.Aty. Dkt. No.046192-000118WOPT

[0019] In some embodiments of any of the aspects described herein, the expression cassete further comprises one or more additional regulatory elements and / or a poly A sequence.

[0020] In some embodiments of any of the aspects described herein, the one or more additional regulatory elements is selected from the group consisting of an enhancer, a 5’ untranslated region (5’UTR), an intron, a reverse RNA pol I terminator sequence, and combinations thereof.

[0021] In some embodiments of any of the aspects described herein, the intron is an IVS intron.

[0022] In some embodiments of any of the aspects described herein, the intron is an IVS intron comprising a nucleic acid sequence of SEQ ID NO: 7, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

[0023] In one aspect, described herein is a recombinant adeno-associated virus (rAAV) vector comprising in its genome an expression cassete as described herein. An expression cassete of the invention comprises codon-optimized nucleic acid encoding a LAMP2B polypeptide, wherein the nucleic acid comprises the nucleotide sequence set forth in any one of SEQ ID NOs 1-3, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto. The expression cassete of the invention further comprises a muscle specific promoter that is operably linked to codon optimized nucleic acids encoding LAMP2B polypeptide. The mucle specific promoter of the invention comprises a nucleic acid sequence selected from the group consisting of SP0497, SP0498, SP0499, SP0500, SP0508, SP0509, SP0510, SP0511, SP0512, SP0513, SP0522, SP0524, Syn100, and Spc5-12. The mucle specific promoter of the invention comprises a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the promoters selected from the group consisting of SP0497, SP0498, SP0499, SP0500, SP0508, SP0509, SP0510, SP0511, SP0512, SP0513, SP0522, SP0524, Syn100, and Spc5-12. The expression constructs of the invention further comprises regulatory elements such as intron sequences, UTR sequences and additionaly comprises poly A sequences.

[0024] In one aspect, described herein is a recombinant adeno-associated virus (rAAV) vector comprising in its genome: (a) 5’ and 3’ AAV inverted terminal repeats (ITR) sequences; and (b) located between the 5’ and 3’ ITRs, the expression cassete specified as described herein.

[0025] In some embodiments of any of the aspects described herein, the AAV genome further comprises at least one of: (a) a 5’ ITR; (b) an intron; (c) a poly A sequence; and (d) a 3’ ITR.

[0026] In some embodiments of any of the aspects described herein, the AAV genome comprises, in the 5’ to 3’ direction: (a) a 5’ ITR; (b) a muscle-specific promoter; (c) an intron; (d) a codon- optimized nucleic acid as described herein; (e) a poly A sequence; (f) a 3’ ITR.

[0027] In some embodiments of any of the aspects described herein, the intron is selected from the group consisting of an IVS sequence, a MVM sequence, a HBB2 sequence, an CMVIE intron sequence, a UBC intron sequence, and a SV40 sequence.

[0028] In some embodiments of any of the aspects described herein, at least one of the 5’ ITR orAty. Dkt. No.046192-000118WOPT 3’ITR comprises an insertion, deletion or substitution.

[0029] In some embodiments of any of the aspects described herein, one or more CpG islands in the ITR are removed.

[0030] In some embodiments of any of the aspects described herein, the poly A sequence is a ful length SV40 polyA sequence or HGF poly A sequence.

[0031] In some embodiments of any of the aspects described herein, poly A sequence is selected from SEQ ID NO: 8, or a nucleic acid sequence having at least 80% sequence identity thereto.

[0032] In some embodiments of any of the aspects described herein, the rAAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or a rational polyploid AAV vector.

[0033] In some embodiments of any of the aspects described herein, the rAAV vector comprises a rational haploid capsid, a mosaic AAV capsid, a chemicaly modified AAV capsid, or a AAV capsid from any AAV serotypes known in the art.

[0034] In some embodiments of any of the aspects described herein, the rAAV capsid is a capsid from an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9- PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6i, AAV1P5i, AAV4A1i, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2i, AAVS10P1i, AAV JEA, AAV23xA P2i, AAVDJ P2i, AAV 2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAV2.5G9, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A. In some embodiments of any of the aspects described herein, the rAAV capsid is not AAV9.

[0035] In one aspect, described herein is a pharmaceutical composition comprising an rAAV vector as described herein in a pharmaceuticaly acceptable carrier.

[0036] In one aspect, described herein is a method for treating a subject in need of LAMP2B, the method comprising administering rAAV vectors as described herein or a pharmaceutical composition as described herein, or an expression cassete as described herein or a codon-optimized nucleic acid as described herein, to the subject.

[0037] In one aspect, described herein is a method for treating danon disease, the method comprising administering rAAV vectors as described herein or a pharmaceutical composition as described herein, or an expression cassete as described herein or a codon-optimized nucleic acid as described herein, to the subject.

[0038] In some embodiments of any of the aspects described herein, administering to the subject is by systemic administration.

[0039] In some embodiments of any of the aspects described herein, the systemic administration is by intravenous administration.

[0040] In some embodiments of any of the aspects described herein, administering to the subject is by local administration.Aty. Dkt. No.046192-000118WOPT

[0041] In some embodiments of any of the aspects described herein, the local administration is by injection to the heart or by intracoronary administration.

[0042] In some embodiments of any of the aspects described herein, the rAAV vector is administered at a dosage range of between 1.0E10 vg to 5.0E14vg.

[0043] In one aspect, described herein is a use of a rAAV vector in the preparation of a medicament for treating subject in need of LAMP2B, the medicament comprising an rAAV vector as described herein.

[0044] In one aspect, described herein is a use of a rAAV vector in the preparation of a medicament for treating danon disease, the medicament comprising an rAAV vector as described herein.

[0045] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 1, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

[0046] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 1, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

[0047] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 1, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

[0048] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 2, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

[0049] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 2, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

[0050] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 2, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

[0051] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 3, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

[0052] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 3, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

[0053] In one aspect, described herein is an expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 3, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

[0054] In one aspect, described herein is a recombinant adeno-associated virus (rAAV) vectorAty. Dkt. No.046192-000118WOPT comprising in its genome an expression cassete as described herein.

[0055] In one aspect, described herein is an expression cassete comprising spc5-12 promoter sequence, wherein the expression cassete is used to treat Danon disease.

[0056] In one aspect, described herein is an expression cassete comprising SP0524 promoter sequence, wherein the expression cassete is used to treat Danon disease.

[0057] In one aspect, described herein is an expression cassete comprising any of the nucleic acid sequences selected from the group consisting of SEQ ID NO:s 60, 61, 63, 79, 81 and 82, or a sequence having at least 80% sequence identity thereto.

[0058] In some embodiments of any of the aspects, the expression cassete further comprises nucleic acid sequence as set forth by SEQ ID NO: 1-3, each of which encode a LAMP2B polypeptide sequence.

[0059] In some embodiments of any of the aspects described herein, the expression cassete further comprises an intron sequence, wherein the intron is selected from the group consisting of an IVS intron sequence, a MVM sequence, a HBB2 sequence, an CMVIE intron sequence, a UBC intron sequence, and a SV40 sequence.

[0060] In some embodiments of any of the aspects described herein, the expression cassete further comprises a poly A sequence.

[0061] In some embodiments of any of the aspects described herein, the expression cassete is delivered to a subject in need thereof by using a non-viral vector.

[0062] In some embodiments of any of the aspects described herein, the expression cassete is delivered to a subject in need thereof by using a viral vector.

[0063] In some embodiments of any of the aspects described herein, the viral vector is a recombinant adeno associated virus (rAAV) vector.

[0064] In some embodiments of any of the aspects, the viral vector is an AAV2i8 vector.

[0065] Another aspect provided herein describes a transgenic mouse that does not produce Lamp2 polyeptide or functional form thereof, e.g., Lamp2B polypeptide or functional form thereof, the transgenic mouse’s cels comprising deletions of exons 2-6 of the Lamp2 gene, and a premature stop codon upstream of exon 7 of the Lamp2 gene.

[0066] In some embodiments of any of the aspects, the premature stop codon results in an out-of- frame shift of exons 7-9 of the Lamp2 gene. In some embodiments of any of the aspects, the premature stop codon results in nonsense-mediated mRNA decay of the Lamp2 gene.

[0067] In some embodiments of any of the aspects, the transgenic mouse exhibits a complete loss of the Lamp2 gene or protein expression. Thus, the transgenic mouse can serve as a mouse model to assess diseases or disorders resulting fom loss of Lamp2, e.g., a Danon disease transgenic mouse model.

[0068] Another aspect provided herein describes a method of making a transgenic mouse with having no expression of Lamp2, for example, a method of making transgenic mouse having a genome thatAty. Dkt. No.046192-000118WOPT cannot express Lamp2 gene or a functional form thereof, the method comprising contacting a mouse embryo or a plurality of mouse embryonic cels or a mouse embryonic cel with at least one sgRNAsthat target exons 1 and 6 of the Lamp2 gene, and a Cas nuclease. The transgenic mice disclosed herein does not produce Lamp2B polypeptide or a functional form thereof.

[0069] In some embodiments of any of the aspects, the contacting is performed by electroporation or by via a viral vector or non-viral vector.

[0070] The viral vector of any of the aspect described herein of the invention is a cardiotropic AAV vector. The viral vector of any of the aspect described herein is a AAV2i8 vector. The AAV2i8 vector can be used to encapsidate any Lamp2B nucleic acid that is discussed in the invention or is known in the art.

[0071] In some embodiments of any of the aspects, the mouse embryo is a C57BL / 6J mouse embryo.

[0072] In some embodiments of any of the aspects, the at least one sgRNA is selected from TAGTCGATCCTTGATGCGGA (SEQ ID NO: 119) and AACAGTGGTAGGTGTATGCG (SEQ ID NO: 120).

[0073] In some embodiments of any of the aspects, the contacted mouse embryos are implanted in pseudopregnant recipient female mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] FIGs 1A and 1B shows intron designed and selection. FIG.1A shows schematic and table describing principal structural components of the exemplary construct of the invention . FIG 1B show optimal designed and selected intron to drive high expression of transgene protein without other non- self-proteins. SV40 poly A was used as a strong bi-directional terminator to prevent 3’^5’ transcript and double-stranded RNA formation.

[0075] FIG.2 show schematic of assay to identify vector of interest. Twenty-five constructs with diferent combinations of elements were designed and packaged into AAV 2i8, see, e.g., SEQ ID NOs 59-82. Schema for down-selection strategy in wild type mice, see methods for study protocol (Studies 3-5).

[0076] FIG.3 shows LAMP2B protein expression normalized to total protein in heart. Bar graph shows signal intensity of indicated construct. LAMP2B protein expression is high in some constructs (Syn1002prob, Syn1007pref, Syn1007prob, SP524 cDNA) and low to medium in others including control constructs (Syn100 RS5 and RS10). The terms ‘prob’, and ‘pref’ indicate codon optimized LAMP2B coding sequences, also referred to as coding sequence variants. cDNA or LAMP2B cDNA refered to as wild type LAMP2B coding sequence. Asterisks indicate selected constructs. Blue bars indicate control prior art coding sequence in the context of Syn100 promoter (Syn100 RS5) and ITR- ITR prior art construct (RS10). A new construct was designed by combining SP524 with the 7prob coding sequence variant. Additionaly, other constructs with SPc5-12 promoter and Syn100 in combination with 7prob coding sequence was designed.Aty. Dkt. No.046192-000118WOPT

[0077] FIG.4 shows recovered genome copies / ug DNA from heart for indicated construct. Asterisks indicate selected constructs. Blue bars indicate control coding sequence in the context of Syn100 promoter (Syn100 RS5) and control ITR-ITR construct (RS10). Recovered vector genomes are similar among al the groups indicating uniform transduction of the administered vector.

[0078] FIG.5 shows RNA expression in heart measured as copies / ug RNA for indicated construct. Asterisks indicate selected constructs. Blue bars indicate control coding sequence in the context of Syn100 promoter (Syn100 RS5) and control ITR-ITR construct (RS10). RNA expression is mostly uniform among the different groups. Notably some constructs (example: Syn100 immunostim dep) have high RNA expression but low protein expression.

[0079] FIGs 6A and 6B show constructs used in up-selection and study design. FIG.6A show 7 constructs were chosen for up-selection studies. See, e.g., methods for study protocols (Studies 6-10). FIG.6B show the control A vector with control ITR-ITR sequence packaged in AAV9 as wel as AAV2i8. Each vector was manufactured at 2 scales to test for vector lot reproducibility and mice were injected at 2 doses to validate dose dependent protein expression. LAMP2B protein expression and vector genome copies were measured from al 4 chambers of the heart. RNA expression was measured from both ventricles due to insuficient tissue availability from atria.

[0080] FIGs 7A-7D show LAMP2B protein expression normalized to total protein in heart from vectors manufactured at two liter (2L) scale. Expression is shown in the left ventricle (FIG.7A), left atrium (FIG.7B), right ventricle (FIG.7C), or right atrium (FIG.7D). Dose dependent increase in LAMP2B protein expression is observed in al groups across the diferent chambers of the heart.

[0081] FIGs 8A-8D show recovered genome copies / ug DNA in heart from vectors manufactured at 2L scale. Expression is shown in the left ventricle (FIG.8A), left atrium (FIG.8B), right ventricle (FIG.8C), or right atrium (FIG.8D). Dose dependent increase in vector genomes is observed in al groups across the different chambers of the heart.

[0082] FIGs 9A and 9B show RNA expression in heart measured as copies / ug RNA from vectors manufactured at 2L scale. Expression is shown in the left ventricle (FIG.9A) and right ventricle (FIG.9B) Dose dependent increase in RNA is observed in al groups across the diferent chambers of the heart. Most down-selected constructs have similar RNA expression.

[0083] FIGs 10A-10D show LAMP2B protein expression normalized to total protein in heart from vectors manufactured at 20L scale. Expression is shown in the left ventricle (FIG.10A), left atrium (FIG.10B), right ventricle (FIG.10C), or right atrium (FIG.10D). Dose dependent increase in LAMP2B protein expression is observed in al groups across the diferent chambers of the heart.

[0084] FIG.11 shows tissue biodistribution of LAMP2B protein from top selected constructs and control construct. Highest LAPM2B protein expression is observed in the heart, with lower expression in skeletal muscles and very low expression in other organs. Top selected constructs (DA004, DA022 and DA023) display similar tissue biodistribution.Aty. Dkt. No.046192-000118WOPT

[0085] FIG.12 shows schematic of ribosome footprint profiling of top selected constructs to identify potentialy translated ARF peptides. Peaks indicates regions along the RNA where the ribosome stals as a proxy indicator of translation initiation. Ribosome footprinting patern indicates that ribosomes are for the most staled at the translation start site of the LAMP2B mRNA and would be expected to translate ful- length LAMP2B protein.

[0086] FIG.13 presents a micrograph showing intracelular localization of endogenous mouse LAMP2 protein and LAMP2B protein expressed from constructs in heart. Laminin indicates cardiomyocyte cel membranes, DAPI indicates nuclei, endogenous mouse LAMP1, a lysosomal marker and human LAMP2B (huLAMP2) protein expressed from construct localized to lysosomes indicates.

[0087] FIG.14 shows schematic of exemplary vectors for use in treating danon disease.

[0088] FIG.15A and 15B show schematic and description of pDA023. (FIG.15A) A plasmid map of pDA023, a 6754 bp plasmid containing the AAV2 ITR-flanked expression cassete packaged in the final vector. The 5’-ITR has a deleted terminal resolution site (trs) which leads to a self- complementary (sc) AAV when packaged into the AAV2i8 capsid. The LAMP2B gene has been codon optimized, and expression is driven by the muscle-specific promoter SPc5-12. (FIG 15B) Key functional elements of pDA023.

[0089] FIG.16 presents a Western blot of total protein lysates from mouse heart confirming total absence of LAMP2 protein in the Lamp2 KO model. Lamp2 migrates higher than expected due to extensive post-translational glycosylation. Abbreviations: mLAMP2 = mouse LAMP2 protein, TPS = total protein stain, kDa = kilodaltons, WT = wild type, KO = knockout.

[0090] FIG.17 presents data showing animal survival during study period (ages 0-15 weeks).

[0091] FIG.18 presents data showing a summary of animal body weight from 6-40 weeks of age. WT = wildtype, KO = LAMP2 knockout

[0092] FIG.19 presents data showing a summary of heart weight in the indicated animal over time. Heart weight (left panel) and heart weight normalized to body weight (right panel) is presented. KO = Lamp2 knockout; WT = wildtype; ns = not significant; * p<0.05 unpaired t-test; ** p<0.01; *** p<0.001; **** p<0.0001.

[0093] FIG.20 presents data showing a summary of LC3-II expression in the indicated animal over time. KO = Lamp2 knockout; WT = wildtype; LC3-II = microtubule-associated protein 1A / 1B- light chain 3 isoform 2;. ns = not significant; * p<0.05 unpaired t-test; ** p<0.01.

[0094] FIG.21 presents data showing a summary of LC3-II (left panel) and p62 ( right panel) expression in the indicated animal. KO = Lamp2 knockout; WT = wildtype; LC3-II = microtubule- associated protein 1A / 1B-light chain 3 isoform 2; p62 = sequestosome-1; 24h Fast = Fasted for 24 hours; 6w Int. Fast = Intermitent fasting with one day fed, one day fasted for 6 weeks.

[0095] FIG.22 presents data showing vector genome copies and transgene expression levels of hLAMP2B. hLAMP2B = Human lysosomal membrane protein 2 isoform B; KO = Lamp2 knockout;Aty. Dkt. No.046192-000118WOPT WT = wildtype; TPS- Total protein stain; ns- not significant; **** p< 0.0001 One-way ANOVA Dunnet’s multiple comparison’s test.

[0096] FIG.23 presents data showing a summary of animal body weight from 6-14 weeks of age folowing the indicated treatment. KO = Lamp2 knockout; WT = wildtype

[0097] FIG.24 presents data showing animal survival during study period (0-8 weeks) folowing the indicated treatment. KO = Lamp2 knockout; WT = wildtype

[0098] FIG.25 presents data showing a summary of LC3-II (left panel) and p62 ( right panel) expression folowing the indicated treatment. KO = Lamp2 knockout; WT = wildtype; LC3-I = microtubule-associated protein 1A / 1B-light chain 3 isoform 2; p62 = sequestosome-1; ns- not significant; **** p< 0.0001 One-way ANOVA Dunnet’s multiple comparison’s test; **p<0.01.

[0099] FIG.26 presents data showing a summary of heart weight folowing the indicated treatment. Heart weight (left panel) and heart weight normalized to body weight (right panel) is presented. KO = Lamp2 knockout; WT = wildtype; ns- not significant; **** p< 0.0001 One-way ANOVA Dunnet’s multiple comparison’s test; **p<0.01; *p<0.05.

[0100] FIG.27 presents data showing a summary of heart weight to tibia length folowing the indicated treatment. KO = Lamp2 knockout; WT = wildtype; ns- not significant; * p< 0.05 One-way ANOVA Dunnet’s multiple comparison’s test.

[0101] FIG.28 presents schematics of the deleted region Lamp2 wild-type alele deleted region in the transgenic mouse.

[0102] FIG.29 presents schematics of the deletion junction present in the transgenic mouse folowing deletion of exons 2-6 of Lamp2. DETAILED DESCRIPTION

[0103] Danon disease is a rare multisystem lysosomal storage disease caused by mutations in the LAMP2 gene. Lysosome-associated membrane proteins (LAMPs) mediate the acidification of the lumen, the transport of the macromolecules and the fusion of the lysosomes with endosomes, phagosomes and the plasma membrane. The LAMP2 gene undergoes alternative splicing, resulting in 3 diferent spliced isoforms: LAMP2a, LAMP2b and LAMP2c. Analysis of LAMP2 isoforms in diferent human tissues has shown a variable expression profile across tissue types, with LAMP2a and LAMP2b more widely expressed than LAMP2c (Pérez et al, 2016; Qiao et al, 2023). Most of the mutations in the LAMP2 gene are predicted to result in the deficiency of al 3 LAMP2 isoforms. Isoform-specific mutations have only been found in LAMP2b so far, suggesting that LAMP2b deficiency is enough to cause Danon disease (Cenacchi et al, 2020).

[0104] Cel models of LAMP2 deficiency have shown accumulation of LC3 positive-vacuoles, myofibrilar disorganization, and decreased colocalization of ATG14 with VAMP8, suggesting inhibited fusion between autophagosomes and lysosomes. Furthermore, an autophagic block wasAty. Dkt. No.046192-000118WOPT demonstrated in muscle from Danon disease patients that corelated with increased expression of the autophagy markers LC3-I and p62, consistent with accumulation of autophagosomes (Nascimbeni et al, 2017).

[0105] The role of autophagy in healthy cardiomyocytes is crucial for maintaining celular homeostasis and overal cardiac function. Autophagy is a vital process that facilitates the degradation and recycling of damaged organeles, misfolded proteins, and other celular debris. In healthy cardiomyocytes, autophagy helps to maintain celular integrity and eficient contraction. Disruption of this process affects the degradation and recycling processes within cels, which is essential for maintaining celular health.

[0106] The deficiency of LAMP2 results in impaired autophagy and lysosomal function, leading to the accumulation of autophagic vacuoles in cels. Accumulation of substances such as glycogen, degenerating mitochondria, lipids, and basophilic granules in skeletal muscle vacuoles suggests a buildup of lysosomal organeles in myofibers, indicating mitochondrial dysfunction and lysosomal storage abnormalities.

[0107] Danon disease presents a spectrum of clinical manifestations, including cardiomyopathy, skeletal myopathy, and intelectual disability. The severity of cardiac involvement can necessitate significant interventions, such as heart transplantation, highlighting the progressive and potentialy life-threatening nature of the cardiac manifestations. Additionaly, peripheral retinal dystrophy has been reported, indicating broader symptoms beyond cardiac and skeletal muscle issues.

[0108] Evidence suggests gender-related diferences in the manifestation of Danon disease. Females with certain mutations in the LAMP2 gene may present with significant symptoms, including early- onset hypertrophic cardiomyopathy, underscoring variability in presentation based on gender. However, there are significant gaps in understanding the natural history and pathophysiology of Danon disease, particularly in women compared to men.

[0109] In summary, the pathophysiology of Danon disease is intricately linked to mutations in the LAMP2 gene, leading to LAMP2B protein dysfunction. This dysfunction disrupts lysosomal function and autophagy, contributing to clinical manifestations such as cardiomyopathy, skeletal myopathy, and intelectual disability.

[0110] Current Treatment Options for Danon disease

[0111] There are curently no disease-modifying drugs available for treatment of Danon disease, underscoring the high unmet medical need in this population. The disease management approach in males and females is similar. Standard treatment folows guidelines for HCM and heart failure, with consideration of ablation therapy in those with cardiac pre-excitation and arrhythmia, physical therapy for skeletal muscle weakness, standard treatment for developmental delay / intelectual disability, and use of low vision aids for those with retinopathy (Taylor and Adler 2020).

[0112] Typicaly, male patients wil have an implantable cardioverter defibrilator (ICD) by 15 to 19 years of age. Heart transplant often occurs in late teens or early twenties in males, and in the earlyAty. Dkt. No.046192-000118WOPT thirties for females (Boucek 2011; Brambati 2019).

[0113] Medical plausibility of constructs depicted herein

[0114] Danon disease is caused by mutation in the LAMP2 gene resulting in lack of LAMP2B protein. The absence of LAMP2B expression in cardiomyocytes results in an autophagic block, the accumulation of vacuoles and stress for the cel. The autophagic block was also demonstrated in muscle from Danon disease patients that correlated with increased expression of the autophagy markers LC3-I and p62, consistent with accumulation of autophagosomes (Nascimbeni et al, 2017).

[0115] As the LAMP2 gene is on the X-chromosome, females with the disease have some level of expression. Therefore, the phenotype in females is milder and typicaly the symptoms appear approximately 15 years later than in males (Hong et al, 2023). These findings suggest that restoration of even modest levels of LAMP2 expression compared to healthy controls would be expected to result in a milder phenotype and slower progression of disease, supporting a therapeutic approach involving LAMP2 replacement.

[0116] Constructs described herein, e.g., comprising a sequence of SEQ ID NO: 60, 61, 63, 79, 81 and 83, are designed to express LAMP2B specificaly in the heart and skeletal muscle. These constructs restore LAMP2B expression to a level that exerts beneficial physiological effects, resulting in a subsequent reduction in cardiovascular risk.

[0117] Aspects of the invention described herein arise from the identification of codon-optimized nucleic acids that encode a human LAMP2B polypeptide. These codon-optimized nucleic acids can be used to produce vectors for gene therapy (e.g., AAV based gene therapy) to treat disorders related to aberant LAMP2B in a subject, e.g., Danon disease. Recombinant vectors (e.g., AAV) vectors and expression cassetes that contain the codon-optimized nucleic acid are used to deliver the LAMP2B coding sequence in expressible form, to the subject. The nucleic acid encoding the LAMP2B polypeptide described herein is codon optimized for enhanced expression in human subjects. That is, the rAAV vectors described herein for delivering a LAMP2B polypeptide to a subject comprise improvements, such as but not limited to, a codon optimized nucleic acid sequence encoding a LAMP2B polypeptide, where the codon optimized nucleic acid sequence encoding the LAMP2B polypeptide is modified to include features for example, to reduce CpG islands or dinucleotides and / or minimize alternative open reading frames, and / or remove alternative splice sites and / or remove bacterial sequences, and / or maximize sequence diversity or other modifications known to those skiled in the art.

[0118] Furthermore, recombinant AAV (rAAV) vector and constructs described herein for delivering the LAMP2B polypeptide to a subject comprise improvements such as, e.g., incorporation of an intron upstream of the nucleic acid expressing the LAMP2B polypeptide and downstream of the promoter, and use of specific terminator sequences after the 3’ end of nucleic acid expressing the LAMP2B polypeptide, such as, e.g., specific poly A sequences and / or terminator sequences. Moreover, the rAAV, constructs, or expression constructs encoding LAMP2B as described hereinAty. Dkt. No.046192-000118WOPT does not comprise Woodchuck Hepatitis Virus Postranscriptional Regulatory Element or WPRE, e.g., as described in Patricio M, et al., Mol. Therapy Nucleic Acids, March 2017, the contenst of which are incorporated herein by reference in their entirety.

[0119] In particular, described herein are viral vectors, e.g., using rAAV vectors as a non-limiting example, that comprise a nucleotide sequence containing inverted terminal repeats (ITRs), a promoter (e.g., muscle specific promoter), a heterologous gene, a poly-A tail and potentialy other regulator elements (e.g., an intron) for use to treat a disease associated with aberrant LAMP2B expression (e.g., Danon disease), where the heterologous gene is codon-optimized nucleic acid encoding a human LAMP2B polypeptide. In some embodiments, the vector, e.g., rAAV, can be administered to a patient in a therapeuticaly effective dose that is delivered to the appropriate tissue and / or organ (e.g., cardiac tissue) for expression of the heterologous gene and treatment of the disease, e.g., Danon disease. One exemplary rAAV of the invention is a rAAV with self-complementary genome, e.g., as described in U.S. Patent Number 7,790,154, which is incorporated herein by reference in its entirety.

[0120] One aspect of the invention relates to codon-optimized nucleic acids that encode a human LAMP2B polypeptide. In some embodiments, the nucleic acid has the nucleotide sequence set forth in SEQ ID NOs 1, 2 or 3, or a nucleic acid having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid has the nucleotide sequence set forth in SEQ ID NO: 1, or a nucleic acid having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid has the nucleotide sequence set forth in SEQ ID NO: 2, or a nucleic acid having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid has the nucleotide sequence set forth in SEQ ID NO: 3, or a nucleic acid having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

[0121] In some embodiments of the invention, the codon-optimized nucleic acid described herein is operatively linked to a promoter to thereby generate an expression cassete. In some embodiments, the codon-optimized nucleic acid is included in an expression vector in expressible form (e.g., a viral based expression vector). Such expression vectors include nucleic acid constructs in the form of plasmids that comprise viral sequence elements (e.g., that facilitate integration and expression) and also, e.g., recombinant viral particles, enzymatic DNA (neDNA), and lipid nanoparticles (LNPs).

[0122] Another aspect of the invention disclosed herein describes a geneticaly altered mice model, where exon 2 through exon 6 are deleted from mice LAMP2 gene. The model serves as a mice model for Danon disease that shows at least one symptom of the disease symptoms in human including but not limited to autophagy, cardiac hypertrophy, ventricular wal / septum thickening. The mice further comprises a premature stop codon in a deletion alele transcript. The geneticaly altered mice is substantialy free of LAMP2 expression. The mice model serves as a tool to test the eficacy of theAty. Dkt. No.046192-000118WOPT Danon constructs as described in the invention. Recombinant AAV expressing LAMP2B polypeptide

[0123] As disclosed herein, one aspect of the technology relates to the use of the codon-optimized nucleic acid encoding the human LAMP2B polypeptide, described herein, in the treatment of disease (e.g, Danon disease). The native human lysosomal associated membrane protein 2 (LAMP2B) gene has been characterized (Gene ID: 3920; Ensembl:ENSG00000005893 MIM:309060; AlianceGenome:HGNC:6501). GenBank Accession Nos. NM_001122606.1 and NP_001116078.1 provide examples of the nucleotide and amino acid sequences of wild-type native human Lam2B.

[0124] Aspects of the invention relate to an rAAV vector that contains and expresses the codon- optimized nucleic acid. The rAAV vector comprises a capsid, and within its capsid, is comprised a nucleotide segment (i.e., nucleic acid sequence) refered to as the “rAAV vector genome”. The rAAV vector genome (also referred to as “rAAV genome”) typicaly includes multiple elements required for expression of a heterologous gene contained therein, including, but not limited to two inverted terminal repeats (ITRs, e.g., the 5’-ITR and the 3’-ITR), and located between the ITRs are additional elements, including an intron, a promoter, the heterologous gene and a poly-A tail; three ITRs present in the self complementary vectors, including two wild type AAV2 ITRs and one mutated ITR; or only one intact ITR, which is the minimal requirement for packaging particles. The heterologous gene for use in the methods comprises the codon-optimized nucleic acid encoding a human LAMP2B polypeptide, described herein.

[0125] In one aspect, the invention relates to a rAAV vector comprising in its genome the wild-type nucleic acid encoding a human LAMP2B polypeptide, described herein. In one aspect, the invention relates to a rAAV vector comprising in its genome the codon-optimized nucleic acid encoding a human LAMP2B polypeptide, described herein. The nucleic acid has the nucleotide sequence set forth in one of SEQ ID NOs 1-3, or a nucleic acid having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 1, 2 or 3.

[0126] In some embodiments of the invention, the rAAV vector has in its genome: (a) 5’ and 3’ AAV inverted terminal repeats (ITR) sequences, and (b) a heterologous nucleic acid as set forth as the codon-optimized nucleic acid encoding a human LAMP2B polypeptide. The heterologous nucleic acid comprises the nucleotide sequence set forth in one of SEQ ID NOs 1-3, or a nucleic acid having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 1, 2 or 3, and is located between the 5’ and 3’ ITRs in expressible form (e.g., the heterologous nucleic acid is operatively linked to a promoter as disclosed herein).

[0127] In some emboidments, the AAV genome further contains at least one of a 5’ ITR, a promoter sequence, a 5’ UTR sequence, an intron, a poly A sequence, a reverse RNA pol I terminator sequence and a 3’ ITR.

[0128] In some embodidments, the AAV genome comprises in its genome, 5’ and 3’ AAV invertedAty. Dkt. No.046192-000118WOPT terminal repeats (ITR) sequences; and located between the 5’ and 3’ ITRs, a heterologous nucleic acid encoding codon-optimized LAMP2B transgene. In one embodiment, the AAV genome further comprises at least one of a 5’ITR, an intron, a muscle-specific promoter, a polyA sequence, and a 3’ ITR. In one embodiment, the rAAV genome is single stranded (ss) genome. In another embodiment, the rAAV genome is self-complementary (sc) genome.

[0129] In some embodiments, the rAAV genome comprises, in the 5’ to 3’ direction, a 5’ ITR; a muscle-specific promoter; an intron; heterologous nucleic acid encoding codon-optimized LAMP2B transgene; a poly A sequence; and a 3’ ITR.

[0130] In certain embodiments, the muscle specific promoter expresses the LAMP2B polypeptide preferentialy in the muscle. In certain embodiments, the muscle specific promoter expresses the LAMP2B polypeptide preferentialy in the cardiac muscle.

[0131] In one embodiment of any aspect herein, the human LAMP2B polypeptide encoded by the codon-optimized nucleic acid has the amino acid sequence shown in SEQ ID NO: 9. In one embodiment of any aspect herein, the human LAMP2B polypeptide, encoded by the codon-optimized nucleic acid, has the amino acid sequence at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 9. In one embodiment, the human LAMP2B polypeptide is a functional variant of the human LAMP2B polypeptide having the sequence of SEQ ID NO: 9, as defined herein.

[0132] In one embodiment of several aspects of the invention, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide is operably linked with a promoter. Non-limiting examples of the promoter is CMV promoter, CAG promoter, any muscle specific promoter known in the art. In one embodiment, the muscle specific promoter is any Spc5-12 promoter known in the art, e.g., as described in as described in Li, X., et al Nat Biotechnol.1999 Mar;17(3), the contents of which are incorporated herein by reference; SEQ ID NO:3 (nucleotides 253 to 586) of US Patent No. 10,647,751; SEQ ID NO: 5 of International Patent Application Publication WO2019154939; and as described in GenBank: MP275696.1. In one embodiment, the muscle specific promoter is any Syn100 promoter known in the art, e.g, as described in Qiao, C, et al. The American Society fo Gene & Cel Therapy, vol.22 no.11, 1890-1899, Nov.2014, the contents of which are incorporated herein. In one embodiment, the muscle specific promoter is any synthetic muscle specific promoter known in the art, e.g., as described in International Application no: PCT / GB2020 / 053371, PCT / GB2022 / 051611, PCT / EP2023 / 087452, the contents of which are incorporated herein by reference.

[0133] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence selected from the group consisting of of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and is operably linked to a muscle-specific promoter syn100, or a sequence having at least 80% sequence identity thereto.Aty. Dkt. No.046192-000118WOPT

[0134] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 1 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

[0135] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence selected from the group consisting of of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and is operably linked to a muscle-specific promoter Spc5-12, or a sequence having at least 80% sequence identity thereto.

[0136] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 1 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

[0137] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence selected from the group consisting of of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and is operably linked to a muscle-specific promoter SP0524, or a sequence having at least 80% sequence identity thereto.

[0138] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 1 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

[0139] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 2 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

[0140] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 2 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

[0141] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 2 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

[0142] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 3 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

[0143] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 3 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

[0144] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence of SEQ ID NO: 3 and is operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

[0145] In one embodiment, the nucleic acid encoding LAMP2B has a sequence as described in U.S. Patent Number 10,703,797; U. S. Patent Application Number 17 / 264,275 or 17 / 430,107; orAty. Dkt. No.046192-000118WOPT International Patent Application Number WO 2022 / 12489; the contents of which are incorporated herein in their entireties. For example, in one embodiment of the invention, the nucleic acid encoding LAMP2B has a sequence of SEQ ID NOs 2-5, 8-10, or 29-32 as described in U.S. Patent Number 10,703,797. In one embodiment of the invention, the nucleic acid encoding LAMP2B has a sequence of SEQ ID NOs 7-9 as described in U.S. Patent Application Number 17 / 264,275. In one embodiment, the nucleic acid encoding LAMP2B has a sequence of SEQ ID NOs 6-12 as described in U.S. Patent Application Number 17 / 430,107. In one embodiment, the nucleic acid encoding LAMP2B has a sequence of SEQ ID NOs 2-5, 8-10, or 29-33 as described in International Patent Application Number WO 2022 / 125489. In some embodiments of the invention, the nucleic acid encoding Lamp2B as described in U.S. Patent Number 10,703,797; U.S. Patent Application Number 17 / 264,275 or 17 / 430,107; or International Patent Application Number WO 2022 / 125489, further comprises a promoter selected from the group consisting of CMV promoter, Syn100, SP0524, and Spc5-12, or, sequence having at least 80% sequence identity to any of CMV promoter, syn100 promoter, SP0524 promoter or Spc5-12 promoter. In certain embodiments, the nucleic acid encoding Lamp2B as described in U.S. Patent Number 10,703,797; U. S. Patent Application Number 17 / 264,275 or 17 / 430,107; or International Patent Application Number WO 2022 / 125489, further comprises IVS intron. In certain embodiments, the nucleic acid encoding Lamp2B as described in U.S. Patent Number 10,703,797; U.S. Patent Application Number 17 / 264,275 or 17 / 430,107; or International Patent Application Number WO 2022 / 125489, further comprises SV40 poly A tail.

[0146] In some embodiments of several aspects of the invention, recombinant AAV vector comprising nucleic acid encoding Lamp2B polypeptide as described herein comprises is a liver detargeting cardiotropic AAV vector. In some embodiments, the liver-detargeting cardiotropic AAV vector is AAV2i8 vector. In some embodiments, the AAV2i8 vector comprises or consists of the sequence of SEQ ID NO: 116.

[0147] In one embodiment, any of the nucleic acid encoding LAMP2B having a sequence as described in U.S. Patent Number 10,703,797; U. S. Patent Application Number 17 / 264,275 or 17 / 430,107; or International Patent Application Number WO 2022 / 125489 is linked to any of the muscle specific promoters described herein, e.g., SEQ ID NO: 4-6.

[0148] In one embodiment, any of the nucleic acid encoding LAMP2B having a sequence as described in U.S. Patent Number 10,703,797; U. S. Patent Application Number 17 / 264,275 or 17 / 430,107; or International Patent Application Number WO 2022 / 125489 is comprised in a vector with any of the regulatory elements as described herein, e.g., an IVS intron, a polyA tail, promoter (e.g., SEQ ID NOs 4-6 herein), etc.

[0149] In some embodiments of several aspects of the invention, the capsid can be AAV2, AAV6, AAV8, AAV2i8, AAVXL-32, AAVXL32.1. Any of these capsids can be used in al embodiments described herein.

[0150] In one embodiment, the AAV capsid protein cannot be an AAV9 serotype.Aty. Dkt. No.046192-000118WOPT

[0151] In one embodiment, the nucleic acid encoding LAMP2B having a sequence of SEQ ID NOs 1-3 is linked to any promoter described in U.S. Patent Number 10,703,797; U. S. Patent Application Number 17 / 264,275 or 17 / 430,107; or International Patent Application Number WO 2022 / 125489, e.g., a CAG promoter.

[0152] In one embodiment, the codon-optimized nucleic acid encoding a human LAMP2B polypeptide has a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO: 3 and is operably linked to CMV promoter having a sequence of SEQ ID NO: 117 or a sequence having at least 80% sequence identity thereto.

[0153] In one embodiment, the nucleic acid sequence encoding a human Lamp2B polypeptide has a sequence of SEQ ID NO: 115 and is operably linked to a promoter selected from the group consisting of CMV promoter, Syn100, SP0524, and spc5-12, or, sequence having at least 80% sequence identity thereto.

[0154] In one embodiment, the nucleic acid sequence encoding a human Lamp2B polypeptide has a sequence of SEQ ID NO: 115 and is operably linked to CMV promoter.

[0155] In one embodiment, the rAAV vector comprising nucleic acid sequences selected from the group consisting of SEQ ID NOs: 60, 61, 63, 79, 81 and 82 is administered to a subject who has Danon disease or is in need thereof.

[0156] In several embodiments of at least one aspect described herein the rAAV vector is AAV2i8 as described in US Patent NO: 8,889,641.

[0157] The administration of the expression vector containing the codon-optimized nucleic acid described herein leads to increased expression of the LAMP2B polypeptide in a subject, as compared to the expression resulting from administration of an otherwise identical expression vector containing a non-codon optimized (native) nucleic acid encoding the same LAMP2B polypeptide. Such expression can be measured by the amount of the expressed polypeptide or by the activity of the polypeptide. In some embodiments, increased expression refers to at least 25% greater exogenous or total LAMP2B polypeptide level or activity in a tissue e.g., heart, muscle, diaphragm of a subject (e.g mammal) administered the codon-optimized LAMP2B nucleic acid of the invention, as compared to the level or activity resulting from the native LAMP2B nucleic acid sequence. In one embodiment, LAMP2B polypeptide activity is determined by assessing protein levels for the autophagy marker, LC3-II. Loss of Lamp2 results in impaired autophagy, as seen by increased LC3-I levels as compared to wild-type levels of Lamp2. Restoration of Lamp2b (i.e., administration of the expression vector containing the codon-optimized nucleic acid described herein, or expression of Lamp2B in, e.g., a lamp2 knockout mouse) would result in restored autophagy, as seen by decreased LC3-II levels as compared to loss of Lamp2b. In some embodiments, increased expression refers to at least 5% greater, at least 10% greater, at least 15% greater, at least 20% greater, at least 25% greater, at least 30% greater, at least 35% greater, at least 40% greater, at least 45% greater, at least 50% greater, at least 75% greater, at least 100% greater, or at least 1.5 fold greater, at least 2 fold greater, at least 2.5Aty. Dkt. No.046192-000118WOPT fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater, at least 15- fold greater, at least 20-fold greater, at least 25-fold greater, at least 30-fold greater, at least 40-fold greater, at least 50-fold greater, at least 60-fold greater, at least 70-fold greater, at least 80-fold greater, at least 90-fold greater, at least 100-fold greater, at least 125-fold greater, at least 150-fold greater, at least 175-fold greater, at least 200-fold greater, at least 225-fold greater, or at least 250-fold greater exogenous or total LAMP2B polypeptide or activity in an subject (e.g., a mammal) administered the codon-optimized nucleic acid encoding LAMP2B polypeptide, as compared to the level or activity of exogenous or total LAMP2B polypeptide or activity in a tissue e.g., heart, muscle, diaphragm of a mammal administered the native LAMP2B encoding nucleic acid. Lamp2b gene and protein level are measured by Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) and western blot analysis respectively or with other methods known in the art. In certain embodiments, the administration of the expression vector containing the codon-optimized nucleic acid described herein leads to comparable expression of the LAMP2B polypeptide in a subject, as compared to the expression resulting from administration of an otherwise identical expression vector containing a non- codon optimized (native) nucleic acid encoding the same LAMP2B polypeptide, where the codon optimized nucleic acid is modified from the native or wild type sequence in having less or none CG dinucleotide sequences, less or none alternating reading frames (ARF), modified splice donor and / or, acceptor site compared to the native LAMP2B nucleic acid sequence, and thereby is less immunostimulatory. In several aspects of the invention described herein, the rAAV comprising the expression construct of the invention is administered localy to the heart or by intracoronary administration to a subject in need thereof. In the instances, the encoded LAMP2B expression or activity is comparable between codon optimized encoding nucleic acids of the invention and native or non codon optimized encoding nucleic acids, the intracoronary administration of the invention alows for the use of love vector doses, and provides greater safety and thus, is an advantage to treating Danon patients using the rAAV vectors of the invention compared to when they are delivered systemicaly. Optimized rAAV Vector Genome

[0158] In some embodiments of the methods and compositions as disclosed herein, an optimized rAAV vector genome is created from any of the elements disclosed herein and in any combination, including nucleic acid sequences encoding a promoter, an intron, an ITR, a poly-A tail, elements capable of increasing or decreasing expression of a heterologous gene, and in one embodiment, a nucleic acid sequence that is codon optimized for expression of LAMP2B protein in vivo (i.e., coLAMP2B or codon optimized LAMP2B gene) and optionaly, one or more element to reduce immunogenicity. Such an optimized rAAV vector genome can be used with any AAV capsid that has tropism for the tissue and cels in which the rAAV vector genome is to be transduced and expressed,Aty. Dkt. No.046192-000118WOPT e.g., cardiac tissue.

[0159] In some embodiments, rAAV genome lacks the AAV P5 promoter or a fragment thereof, which is normaly located upstream of the promoter (e.g., muscle-specific promoter) as disclosed herein. Normaly, the P5 promoter controls expression of the AAV rep / cap proteins during AAV replication. In some embodiments, this P5 promoter fragment is present in the rAAV vector as disclosed herein which contains predicted transcription factor binding sites, e.g., cyclic AMP- responsive element-binding protein 3 (CREB3), which can be activated by endoplasmic reticulum (ER) / Golgi stress (Sampieri 2019), activating transcription factor 2 (ATF2), which is also involved in stress response (Watson 2017), Nuclear Receptor Subfamily 1 Group I Member 2 (NR1I2) (also known as Pregnane X receptor [PXR]) is known to be enriched in muscle, and is activated by pregnane steroids, rifampin and other molecules including dexamethasone (NR1I2_HGNC) (Xing 2020). Accordingly, in some embodiments, a fragment of the AAV P5 promoter in the rAAV genome is removed without afecting the intended performance of the LAMP2B cassete. In some embodiments, the rAAV vector also comprises an RNA polymerase I termination sequence located between the polyA signal and the 3’ ITR. An exemplary terminal sequence is SEQ ID NO: 33, or SEQ ID NO: 34, the later of which introduces two termination codons and one restriction site (e.g., XhoI) replaces TAG, and is located immediately downstream of the last coding amino acids of LAMP2B, and immediately located upstream of the 3’ UTR. Muscle Specific Promoters

[0160] In some embodiments, of the nucleic acid sequences, AAV vectors (for example, rAAV vector constructs or expression constructs) and methods to treat Danon disease described herein, to achieve appropriate levels of LAMP2B expression, the codon-optimized nucleic acid is operatively linked to a muscle specific promoter. A muscle specific promoter enables expression of the operatively linked gene in the muscle, and can in some embodiments, be an inducible muscle specific promoter. In an embodiment, a muscle specific promoter is located upstream 5’ and is operatively linked to the heterologous nucleic acid sequence encoding the LAMP2B polypeptide. Exemplary muscle specific promoter are disclosed herein.

[0161] In one embodiment, the promoter is a muscle specific promoter described in US Patent Application Numbers 18 / 572,668 or 18 / 024,211, or International Patent Application Number PCT / EP2023 / 087452, the contents of which are incorporated herein in their entirties.

[0162] Cis-Regulatory Elements and Functional Variants Thereof

[0163] Disclosed herein are various cis-regulatory elements (CREs) that can be used in the construction of muscle-specific promoters. These CREs are generaly derived from genomic promoter and enhancer sequences, but they are used herein in contexts quite diferent from their native genomic environment. Generaly, the CREs constitute smal parts of much larger genomic regulatory domains, which control expression of the genes with which they are normaly associated.Aty. Dkt. No.046192-000118WOPT It has been surprisingly found that these CREs, many of which are very smal, can be isolated form their normal environment and retain muscle-specific regulatory activity when used to construct various synthetic promoters. This is surprising because the removal of a regulatory sequence from the complex and “three dimensional” natural context in the genome often results in a significant loss of activity, so there is no reason to expect a given CRE to retain the levels of activity observed once removed from their natural environment. Many combinations of these CREs have been tested and found to be highly efective at enhancing muscle-specific promoter activity when combined with minimal and proximal promoters. It should be noted that the sequences of the CREs of the present invention can be altered without causing a substantial loss of activity. Functional variants of the CREs can be prepared by modifying the sequence of the CREs, provided that modifications which are significantly detrimental to activity of the CRE are avoided. In view of the information provided in the present disclosure, modification of CREs to provide functional variants is straightforward. Moreover, the present disclosure provides methodologies for simply assessing the functionality of any given CRE variant. Functional variant examples for are discussed below.

[0164] The relatively smal size of certain CREs according to the present invention is advantageous because it alows for the CREs, more specificaly promoters containing them, to be provided in vectors while taking up the minimal amount of the payload of the vector. This is particularly important when a CRE is used in a vector with limited capacity, such as an AAV-based vector.

[0165] CREs of the present invention comprise certain muscle-specific transcription factor binding sites (TFBS). It is generaly desired that in functional variants of the CREs these muscle-specific TFBS remain functional. The skiled person is wel aware that TFBS sequences can vary yet retain functionality. In view of this, the sequence for a TFBS is typicaly ilustrated by a consensus sequence from which some degree of variation is typicaly present. Further information about the variation that occurs in a TFBS can be ilustrated using a positional weight matrix (PWM), which represents the frequency with which a given nucleotide is typicaly found at a given location in the consensus sequence. Details of TF consensus sequences and associated positional weight matrices can be found in, for example, the Jaspar or Transfac databases htp: / jaspar.genereg.net / and htp: / gene-regulation.com / pub / databases.html). This information alows the skiled person to modify the sequence in any given TFBS of a CRE in a manner which retains, and in some cases even increases, CRE functionality. In view of this the skiled person has ample guidance on how the TFBS for any given TF can be modified, while maintaining ability to bind the desired TF; the Jaspar system wil, for example, score a putative TFBS based on its similarity to a given PWM. Furthermore, CREs can be scanned against al PWM from JASPAR database to identify / analyse al TFBS. The skiled person can of course find additional guidance in the literature, and, moreover, routine experimentation can be used to confirm TF binding to a putative TFBS in any variant CRE. It wil be apparent that significant sequence modification in a CRE, even within TFBS in a CRE, can be made while retaining function.Aty. Dkt. No.046192-000118WOPT

[0166] Synthetic Muscle-Specific Cis-Regulatory Module and Functional Variants Thereof

[0167] Various synthetic muscle-specific cis- regulatory modules (CRMs) are disclosed herein that can be used in the constructions of synthetic muscle-specific promoters. CRMs of the present invention can be used in combination with a wide range of suitable minimal promoters or muscle- specific proximal promoters.

[0168] Functional variants of a CRM include sequences which vary from the reference CRM element, but which substantialy retain activity as muscle-specific CRMs. It wil be appreciated by the skiled person that it is possible to vary the sequence of a CRM while retaining its ability to recruit suitable muscle-specific transcription factors (TFs) and thereby enhance expression. A functional variant of a CRM can comprise substitutions, deletions and / or insertions compared to a reference CRM, provided they do not render the CRM substantialy non-functional.

[0169] In some embodiments, a functional variant of a CRM can be viewed as a CRM which, when substituted in place of a reference CRM in a promoter, substantialy retains its activity. For example, a muscle-specific promoter which comprises a functional variant of a given CRM preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising the unmodified CRM).

[0170] Suitably, functional variants of a CRM retain a significant level of sequence identity to a reference CRM. Suitably functional variants comprise a sequence that is at least 70% identical to the reference CRM, more preferably at least 80%, 90%, 95% or 99% identical to the reference CRM.

[0171] Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRM under equivalent conditions. Suitable assays for assessing muscle-specific promoter activity are disclosed herein, e.g. in the examples.

[0172] Functional variants of a given CRM can, in some embodiments, comprise functional variants of one or more of the CREs present in the reference CRM. For example, functional variants of a given CRM can comprise functional variants of 1, 2, 3, 4, 5, or 6 of the CREs present in the reference CRM.

[0173] Functional variants of a given CRM can, in some embodiments, comprise the same combination CREs as a reference CRM, but the CREs can be present in a diferent order from the reference CRM. It is usualy prefered that the CREs are present in the same order as the reference CRM (thus, the functional variant of a CRM suitably comprises the same permutation of the CREs as set out in a reference CRM).

[0174] Functional variants of a given CRM can, in some embodiments, comprise one or more additional CREs to those present in a reference CRM. Additional CREs can be provided upstream of the CREs present in the reference CRM, downstream of the CREs present in the reference CRM, and / or between the CREs present in the reference CRM. The additional CREs can be CREs disclosedAty. Dkt. No.046192-000118WOPT herein, or they can be other CREs. Generaly, it is preferred that a functional variant of a given CRM comprises the same CREs (or functional variants thereof) and does not comprise additional CREs.

[0175] Functional variants of a given CRM can comprise one or more additional regulatory elements compared to a reference CRM. For example, they may comprise an inducible or repressible element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de-stabilizing element, and a splicing element, etc., provided that they do not render the CRM substantialy non-functional.

[0176] Functional variants of a given CRM can comprise additional spacers between adjacent CREs or if one or more spacers are present in the reference CRM, said one or more spacers can be longer or shorter than in the reference CRM.

[0177] It wil be apparent that the CRMs as disclosed herein, or functional variants thereof, can be combined with any suitable promoter elements in order to provide a synthetic muscle-specific promoter according to the present invention.

[0178] In many instances, shorter promoter sequences are prefered, particularly for use in situations where a vector (e.g. a viral vector such as AAV) has limited capacity. Accordingly, in some embodiments the synthetic muscle-specific CRM has length of 250 or fewer nucleotides, for example 220, 200, 180, 150, 100, 75, 60, 50 or fewer nucleotides. In some particularly preferred embodiments, the synthetic muscle-specific CRM has length of 200 or fewer nucleotides.

[0179] Promoter Elements and Functional Variants Thereof:

[0180] CREs and CRMs of the present invention can be used in combination with a wide range of suitable minimal promoters or muscle-specific proximal promoters, colectively caled promoter elements.

[0181] Functional variants of promoter elements include sequences which vary from the reference promoter element, but which substantialy retain activity as muscle-specific promoter element. It wil be appreciated by the skiled person that it is possible to vary the sequence of a promoter element while retaining its ability to promote expression. A functional variant of a promoter element can comprise substitutions, deletions and / or insertions compared to a reference promoter element, provided they do not render the promoter element substantialy non-functional.

[0182] In some embodiments, a functional variant of a promoter element can be viewed as a promoter element which, when substituted in place of a reference promoter element in a synthetic promoter, substantialy retains its activity. For example, a muscle-specific synthetic promoter which comprises a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising the unmodified promoter element).

[0183] Suitably, functional variants of a promoter element retain a significant level of sequence identity to a reference promoter element. Suitably functional variants comprise a sequence that is atAty. Dkt. No.046192-000118WOPT least 70% identical to the reference promoter element, more preferably at least 80%, 90%, 95% or 99% identical to the reference promoter element.

[0184] Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted promoter element under equivalent conditions. Suitable assays for assessing muscle-specific promoter activity are disclosed herein, e.g. in the examples.

[0185] Synthetic Muscle-Specific Promoters and Functional Variants Thereof

[0186] Various synthetic muscle-specific promoters are disclosed herein. A functional variant of a reference synthetic muscle-specific promoter is a promoter which comprises a sequence which varies from the reference synthetic muscle-specific promoter, but which substantialy retains muscle-specific promoter activity. It wil be appreciated by the skiled person that it is possible to vary the sequence of a synthetic muscle-specific promoter while retaining its ability to recruit suitable muscle-specific transcription factors (TFs) and to recruit RNA polymerase I to provide muscle-specific expression of an operably linked sequence (e.g. an open reading frame). A functional variant of a synthetic muscle- specific promoter can comprise substitutions, deletions and / or insertions compared to a reference promoter, provided such substitutions, deletions and / or insertions do not render the synthetic muscle- specific promoter substantialy non-functional compared to the reference promoter.

[0187] Accordingly, in some embodiments, a functional variant of a synthetic muscle-specific promoter can be viewed as a variant which substantialy retains the muscle-specific promoter activity of the reference promoter. For example, a functional variant of a synthetic muscle-specific promoter preferably retains at least 70% of the activity of the reference promoter, more preferably at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity.

[0188] Functional variants of a synthetic muscle-specific promoter often retain a significant level of sequence similarity to a reference synthetic muscle-specific promoter. In some embodiments, functional variants comprise a sequence that is at least 70% identical to the reference synthetic muscle-specific promoter, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic muscle-specific promoter.

[0189] Activity in a functional variant can be assessed by comparing expression of a suitable reporter under the control of the reference synthetic muscle-specific promoter with the expression of a suitable reporter under the control of the putative functional variant under equivalent conditions. Suitable assays for assessing muscle-specific promoter activity are disclosed herein, e.g. in the examples.

[0190] Functional variants of a given synthetic muscle-specific promoter can comprise functional variants of one or more CREs present in the reference synthetic muscle-specific promoter. For example, functional variant of a given CRM can comprise 1, 2, 3, 4, 5, or 6 of the CREs present in the reference CRM. Functional variants of CREs are discussed above.Aty. Dkt. No.046192-000118WOPT

[0191] Functional variants of a given synthetic muscle-specific promoter can comprise functional variants of the promoter element, or a diferent promoter element when compared to the reference synthetic muscle-specific promoter.

[0192] Functional variants of a given synthetic muscle-specific promoter can comprise the same CREs as a reference synthetic muscle-specific promoter, but the CREs can be present in a diferent order from the reference synthetic muscle-specific promoter.

[0193] Functional variants of a given synthetic muscle-specific promoter can comprise one or more additional CREs to those present in a reference synthetic muscle-specific promoter. Additional CREs can be provided upstream of the CREs present in the reference CRM, downstream of the CREs present in the reference synthetic muscle-specific promoter, and / or between the CREs present in the reference synthetic muscle-specific promoter. The additional CREs can be CREs disclosed herein, or they can be other CREs.

[0194] Functional variants of a given synthetic muscle-specific promoter can comprise one or more additional regulatory elements compared to a reference synthetic muscle-specific promoter. For example, they may comprise an inducible elements, an intronic element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de-stabilizing element, and a splicing element, etc., provided that they do not render the promoter substantialy non-functional.

[0195] Functional variants of a given synthetic muscle-specific promoter can comprise additional spacers between adjacent CREs and promoter elements or if one or more spacer are present in the reference synthetic muscle-specific promoter, said one or more spacers can be longer or shorter than in the reference synthetic muscle-specific promoter. Functional variant examples are provided below.

[0196] SP0522 is a functional variant of SP0502 and vice versa as SP0522 is a shorter version of SP0502. SP0523 is a functional variant of SP0515 and vice versa as SP0523 is a shorter version of SP0515. SP0524 is a functional variant of SP0521 and vice versa as SP0524 is a shorter version of SP0521.

[0197] In one embodiment, the promoter is SP0527 as described in International Patent Application No. PCT / EP2023 / 087452, the contents of which are is incorporated herein by reference.

[0198] It wil be apparent that synthetic muscle-specific promoters of the present invention can comprise a synthetic muscle-specific promoter of the present invention and additional regulatory sequences. For example, they may comprise one or more additional CRMs, an inducible or repressible element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de- stabilizing element, and a splicing element, etc., provided that they do not render the promoter substantialy non-functional.

[0199] Prefered synthetic muscle-specific promoters of the present invention exhibit muscle- specific promoter activity which is at least 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,Aty. Dkt. No.046192-000118WOPT 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity exhibited by the CBA or CAG promoter in muscle cels. In many cases higher levels of promoter activity is prefered, but this is not always the case; thus, in some cases more moderate levels of expression may be prefered. In some cases, it is desirable to have available a range of promoters of different activity levels to alow the level of expression to by tailored to requirements; the present disclose provides promoters which are expected to provide such a range of activities. Activity of a given synthetic muscle-specific promoter of the present invention compared to CBA or RSV can be assessed by comparing muscle- specific expression of a reporter gene under control of the synthetic muscle-specific promoter with expression of the same reporter under control of the CBA or RSV promoter, when the two promoters are provided in otherwise equivalent expression constructs and under equivalent conditions.

[0200] In many instances, shorter promoter sequences are prefered, particularly for use in situations where a vector (e.g. a viral vector such as AAV) has limited capacity. Accordingly, in some embodiments the synthetic muscle-specific promoter has length of 400 or fewer nucleotides, for example, 390, 380, 370, 360, 350, 340, 330, 320, 310, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 150, 100, 75, 70, 68 or fewer nucleotides. In some embodiments, the synthetic muscle- specific promoter has length of 300 or fewer nucleotides, preferably 290 or fewer nucleotides, more preferably 280 or fewer nucleotides, yet more preferably 270 or fewer nucleotides. In some embodiments, the synthetic muscle-specific promoter has length of 260 or fewer nucleotides, preferably 250 or fewer nucleotides, more preferably 240 or fewer nucleotides, yet more preferably 230 or fewer nucleotides.

[0201] Particularly preferred synthetic muscle-specific promoters are those that are both short and which exhibit high levels of activity.

[0202] In some embodiments of the nucleic acid sequences, AAV (e.g rAAV) vectors, constructs and methods to treat Danon disease described herein, the muscle specific promoter is any muscle specific promoter disclosed in International Patent Application Nos WO2022 / 122733, WO2022 / 232141, WO2023 / 141582 or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. International Patent Application Nos WO2022 / 122733, WO2022 / 232141, WO2023 / 141582 are incorporated herein by references in their entirties.

[0203] In some embodiments of the nucleic acid sequences, AAV vectors (e.g rAAV), constructs thereof and methods to treat Danon disease described herein, the promoter is a Syn100 promoter as set forth in SEQ ID NO: 4, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0204] In some embodiments of the nucleic acid sequences, AAV vectors (e.g rAAV), constructs thereof and methods to treat Danon disease described herein, the promoter is a Syn100 promoter as set forth in SEQ ID NO: 114, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. Syn100 was previously described in Qiao, C, et al. The American Society fo Gene & Cel Therapy, vol.22 no.11, 1890-1899, Nov.2014, the contents ofAty. Dkt. No.046192-000118WOPT which are incorporated herein. Syn100 as described in is Qiao et al 2014, --the downstream +100 bp sequence (cga gct acc cgg agg agc ggg agg cgt ctc tgc cag cgg tcc gac gcg cag tca gca cca ggt agg tgg gca ccg cgc cgt gcc gtg ccg tgc cgt gccg) (SEQ ID NO: 115) of chicken skeletal β-actin promoter was added to the end of an SPc5-12 promoter (e.g., as described in, e.g., Li, X, Eastman, EM, Schwartz, RJ and Draghia-Akli, R (1999). Synthetic muscle promoters: activities exceeding naturaly occuring regulatory sequences. Nat Biotechnol 17: 241–245.). In one embodiment, the Syn100 promoter is as described in International Publication No. WO2022076556, the contents of which are incorporated herein by reference in its entirety. In one embodiment, the syn100 promoter is any syn100 promoter known in the art.

[0205] In some embodiments of the nucleic acid sequences, AAV vectors (e.g rAAV), constructs and methods to treat Danon disease described herein, the promoter is a SPc5-12 promoter (SEQ ID NO: 5), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0206] In some embodiments of the nucleic acid sequences, AAV vectors, constructs and methods to treat Danon disease described herein, the promoter is a SP0524 promoter (SEQ ID NO: 6), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0207] In some embodiments of the nucleic acid sequences, AAV vectors (e.g rAAV), constructs and methods to treat Danon disease described herein, the promoter is selected from the group consisting of SEQ ID NOs 84-114, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0208] In some embodiments, the promoter is a Syn100 promoter, e.g., as set forth in SEQ ID NO: 4, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease.

[0209] In some embodiments, the promoter is a Syn100 promoter, e.g., as set forth in SEQ ID NO: 114, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease.

[0210] In some embodiments, the promoter is a SPc5-12 promoter (SEQ ID NO: 5), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease. In one embodiment the SPc5-12 is any SPc5-12 known in the art. For example, as described in Li, X., et al Nat Biotechnol.1999 Mar;17(3), the contents of which are incorporated herein by reference); SEQ ID N):3 (nucleotides 253 to 586) of US Patent No.10,647,751; SEQ ID NO: 5 of Internataionl Patent Aplication Publication WO2019154939; and as described in GenBank: MP275696.1.

[0211] In some embodiments, the promoter is a SP0524 promoter (SEQ ID NO: 6), or a variantAty. Dkt. No.046192-000118WOPT having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease.

[0212] In some embodiments, the promoter is selected from the group consisting of SEQ ID NOs 84-114, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease.

[0213] In some embodiments, the promoter is a SP0527 promoter or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease.

[0214] In some embodiments, the promoter is a Syn100 promoter (SEQ ID NO: 4), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is operatively linked to a nucleic acid encoding LAMP2B (e.g., SEQ ID NOs 1-3, or 115).

[0215] In some embodiments, the promoter is a Syn100 promoter (SEQ ID NO: 114), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is operatively linked to a nucleic acid encoding LAMP2B (e.g., SEQ ID NOs 1-3, or 115).

[0216] In some embodiments, the promoter is a SPc5-12 promoter (SEQ ID NO: 5), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is operatively linked to a nucleic acid encoding LAMP2B (e.g., SEQ ID NOs 1-3, or 115).

[0217] In some embodiments, the promoter is a SP0524 promoter (SEQ ID NO: 6), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is operatively linked to a nucleic acid encoding LAMP2B (e.g., SEQ ID NOs 1-3, or 115).

[0218] In some embodiments, the promoter is selected from the group consisting of SEQ ID NOs 84-114, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is operatively linked to a nucleic acid encoding LAMP2B (e.g., SEQ ID NOs 1-3, or 115).

[0219] In some embodiments, the promoter is a SP0527 promoter or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is operatively linked to a nucleic acid encoding LAMP2B (e.g., SEQ ID NOs 1-3, or 115).

[0220] some embodiments, the promoter is a Syn100 promoter (SEQ ID NO: 4), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct that further comprises any of the regulatory elements described herien.

[0221] In some embodiments, the promoter is a SPc5-12 promoter (SEQ ID NO: 5), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct that further comprises any of the regulatory elements described herien.

[0222] In some embodiments, the promoter is a SP0524 promoter (SEQ ID NO: 6), or a variantAty. Dkt. No.046192-000118WOPT having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct that further comprises any of the regulatory elements described herien.

[0223] In some embodiments, the promoter is selected from the group consisting of SEQ ID NOs 84-114, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct that further comprises any of the regulatory elements described herien.

[0224] In some embodiments, the promoter is a SP0527 promoter or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct that further comprises any of the regulatory elements described herien.

[0225] In some embodiments, the promoter is a Syn100 promoter (e.g., SEQ ID NO: 4), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease, the vector or construct further comprising any nucleic acid encoding LAMP2B described herein (e.g., SEQ ID NO: 1-3, or 115) and any of the regulatory elements as described herein.

[0226] In some embodiments, the promoter is a SPc5-12 promoter (e.g., SEQ ID NO: 5), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease, the vector or construct further comprising any nucleic acid encoding LAMP2B described herein (e.g., SEQ ID NO: 1-3, or 115) and any of the regulatory elements as described herein.

[0227] In some embodiments, the promoter is a SP0524 promoter (SEQ ID NO: 6), or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease, the vector or construct further comprising any nucleic acid encoding LAMP2B described herein (e.g., SEQ ID NO: 1-3, or 115) and any of the regulatory elements as described herein.

[0228] In some embodiments, the promoter is selected from the group consisting of SEQ ID NOs 84-114, or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease, the vector or construct further comprising any nucleic acid encoding LAMP2B described herein (e.g., SEQ ID NO: 1-3, or 115) and any of the regulatory elements as described herein.

[0229] In some embodiments, the promoter is a SP0527 promoter or a variant having a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto is comprised in a vector or construct for used the treatment of Danon disease, the vector or construct further comprising any nucleic acid encoding LAMP2B described herein (e.g., SEQ ID NO: 1-3, or 115) and any of the regulatory elements as described herein.

[0230] In some embodiments of the nucleic acid sequences, AAV vectors, constructs, and methods to treat Danon disease described herein, the promoter is an inducible promoter, or a variant thereof asAty. Dkt. No.046192-000118WOPT described in US Patent Application No.18 / 572,668, which is incorporated herein by reference.

[0231] In some embodiments of the present invention the synthetic muscle specific promoter has a length of 350 or less nucleotides, preferably 340 or less nucleotides, more preferably 330 or less nucleotides, most preferably 320 or less nucleotides. In some embodiments of the present invention the synthetic muscle specific promoter has a length of 310 or less nucleotides, preferably 300 or less nucleotides, more preferably 290 or less nucleotides, most preferably 280 or less nucleotides. In some prefered embodiments of the present invention the synthetic muscle specific promoter has a length of 270 or less nucleotides.

[0232] In a further aspect of the invention, there is provided an expression cassete comprising Syn100 promoter, or a functional variant thereof, operably linked to a sequence encoding an expression product, suitably a gene, e.g., a transgene.

[0233] In a further aspect of the invention, there is provided an expression cassete comprising SPc5- 12 promoter, or a functional variant thereof, operably linked to a sequence encoding an expression product, suitably a gene, e.g., a transgene.

[0234] In a further aspect of the invention, there is provided an expression cassete comprising SP0524 promoter, or a functional variant thereof, operably linked to a sequence encoding an expression product, suitably a gene, e.g., a transgene.

[0235] In a further aspect of the invention, there is provided an expression cassete containing any of the codon-optimized nucleic acid described herein, operably linked to a muscle specific promoter.

[0236] The muscle specific promoter can be any promoter. In one embodiment, the promoter can be any of the above described promoters.

[0237] In one embodiment, the codon-optimized nucleic acid, which can be part of an expression vector, can be operably linked to a muscle specific promoter, wherein the muscle specific promoter is selected from any of: SEQ ID NOS: 4-6 or a functional fragment therein, or a muscle specific promoter having at least 80% sequence identity to SEQ ID NOs: 4-6.

[0238] In several embodiments, the muscle-specific promoter comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 110, SEQ ID NO: 112, and SEQ ID NO: 114 or a nucleic acid having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

[0239] In a further aspect of the invention, there is provided an expression cassete containing any of the codon-optimized nucleic acid described herein, operably linked to a muscle specific promoter, wherein the muscle specific promoter is selected from any of: SEQ ID NOS: 4-6 or a functional fragment thereof, or a muscle specific promoter having at least 80% sequence identity to SEQ ID NOs: 4-6.

[0240] In a further aspect, there is provided a vector comprising a synthetic muscle specific promoterAty. Dkt. No.046192-000118WOPT or an expression cassete according to the present invention. In some embodiments the vector is an expression vector. In some embodiments the vector is a viral vector. In some embodiments the vector is a gene therapy vector, suitably an AAV vector, an adenoviral vector, a retroviral vector, or a lentiviral vector. AAV vectors are of particular interest.

[0241] In a further aspect, there is provided a virion (viral particle) comprising a vector, suitably a viral vector, according to the present invention.

[0242] In a further aspect, there is provided a pharmaceutical composition comprising a synthetic muscle specific promoter, expression cassete, vector, or virion according to the present invention.

[0243] In a further aspect, there is provided a synthetic muscle specific promoter, expression cassete, vector, virion or pharmaceutical composition according to the present invention for use in therapy, i.e., the prevention or treatment of a medical condition or disease, e.g., Danon disease. Suitably the condition or disease is associated with aberrant gene expression, optionaly aberant gene expression in the muscle, e.g., cardiac muscle. Suitably the use is for gene therapy, preferably for use in treatment of a disease involving aberant gene expression.

[0244] In some embodiments, the disease is Danon disease.

[0245] In a further aspect, there is provided a cel comprising a synthetic muscle specific promoter, expression cassete, vector, or virion as described herein. In some embodiments the cel is a eukaryotic cel, optionaly a mammalian cel, optionaly a human cel. Suitably the cel can be a muscle cel, optionaly wherein the cel is a human muscle cel. The synthetic muscle specific promoter or expression cassete can be in a vector or can be in the genome of the cel.

[0246] In a further aspect, there is provided a synthetic muscle specific promoter, expression cassete, vector, virion or pharmaceutical composition as described herein for use in the manufacture of a pharmaceutical composition for the treatment of a medical condition or disease as discussed herein, e.g., Danon disease. In some embodiments, the disease is Danon disease. In some preferred embodiments, the synthetic muscle specific promoter, expression cassete, vector, virion, or pharmaceutical composition as described herein are for use in the manufacture of a pharmaceutical composition for the treatment of Danon disease.

[0247] In a further aspect, there is provided a method for producing an expression product, the method comprising providing a synthetic muscle specific expression cassete of the present invention in a muscle cel, e.g., cardiac muscle cel, and expressing the gene present in the synthetic muscle specific expression cassete. The method can be in vitro or ex vivo, or it can be in vivo. In some embodiments the method is a bioprocessing method. In some preferred embodiments, the expression product is LAMP2B protein or LAMP2B polypeptide.

[0248] In a further aspect, there is provided a method of expressing a therapeutic transgene in a muscle cel, the method comprising introducing into the muscle cel a synthetic muscle specific expression cassete, vector or virion as described herein. In some preferred embodiments, the therapeutic transgene is the LAMP2B gene.Aty. Dkt. No.046192-000118WOPT

[0249] In a further aspect, there is provided a method of therapy of a subject, preferably a human, in need thereof, the method comprising:

[0250] administering to the subject an expression cassete, vector, virion, or pharmaceutical composition as described herein, which comprises a sequence encoding a therapeutic product operably linked to a promoter according to the present invention; and

[0251] expressing a therapeutic amount of the therapeutic product in the muscle, e.g., cardiac muscle, of said subject.

[0252] In some prefered embodiments, the therapeutic product is LAMP2B gene or LAMP2B polypeptide.

[0253] In some embodiments the method further comprises introducing into the muscle of the subject an expression cassete, vector, virion, or pharmaceutical composition as described herein, which comprises a gene encoding a therapeutic product. In some prefered embodiments the vector is a viral gene therapy vector, preferably an AAV vector.

[0254] Activity in a functional variant can be assessed by comparing expression of a suitable reporter under the control of the reference synthetic muscle specific promoter with the putative functional variant under equivalent conditions. Suitable assays for assessing muscle specific promoter activity are disclosed herein, e.g., in Examples 2.

[0255] Functional variants of a given synthetic muscle specific promoter can comprise one or more additional regulatory elements compared to a reference synthetic muscle specific promoter. For example, they may comprise an inducible element, an intronic element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de-stabilizing element, and a splicing element, etc., provided that they do not render the promoter substantialy non-functional. Functional variants can also include a 5’ UTR sequence.

[0256] In one embodiment of the nucleic acid sequences, AAV vectors, constructs and methods to treat Danon disease disclosed herein, the muscle promoter is a promoter that has some expression in the muscle. In one embodiment, the promoter that has some expression in the muscle is the Syn100 muscle promoter comprising a sequence of SEQ ID NO: 4, or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identity to SEQ ID NO: 4. In one embodiment, the Syn100 promoter is as described in Qiao et al 2014 or International Publication No. WO2022076556, the contents of which are incorporated herein by reference in its entirety.

[0257] In one embodiment of the nucleic acid sequences, AAV vectors, constructs and methods to treat Danon disease disclosed herein, the muscle promoter is a promoter that has some expression in the muscle. In one embodiment, the promoter that has some expression in the muscle is the SPc5-12 muscle promoter comprising a sequence of SEQ ID NO: 5, or a functional variant have at least 60%,Aty. Dkt. No.046192-000118WOPT at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identity to SEQ ID NO: 5.

[0258] In one embodiment of the nucleic acid sequences, AAV vectors, constructs and methods to treat Danon disease disclosed herein, the muscle promoter is a promoter that has some expression in the muscle. In one embodiment, the promoter that has some expression in the muscle is the SP0524 muscle promoter comprising a sequence of SEQ ID NO: 6, or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identity to SEQ ID NO: 6.

[0259] In some embodiments of the nucleic acid sequences, AAV vectors, constructs and methods to treat Danon disease disclosed herein, a synthetic muscle specific promoter that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 4-6 comprises a nucleic acid sequence where 2% or 1% or fewer of the nucleotides of SEQ ID NO: 4-6 are altered. In some embodiments, a synthetic muscle specific promoter useful in the methods and compositions as disclosed herein is the same length, or not substantialy altered, or 1, 2, 3, 4, 5, or 6 nucleotides longer or 1, 2, 3, 4, 5, or 6 shorter than the length of SEQ ID NO: 4-6.

[0260] In some embodiments of the nucleic acid sequences, AAV vectors, constructs, and methods to treat Danon disease disclosed herein, no nucleotides have been deleted when compared to SEQ ID NO: 4-6. In some embodiments, no nucleotides are inserted when compared to SEQ ID NO: 4-6. In some embodiments, al modifications made to SEQ ID NO: 4-6 are nucleotide substitutions.

[0261] In some embodiments of the nucleic acid sequences, AAV vectors, constructs and methods to treat Danon disease disclosed herein, a synthetic muscle specific promoter that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 4-6 comprises a source regulatory nucleic acid sequence which is active in muscle, and the second type of cel or tissue, e.g., muscle, liver, CNS, pancreas, epidermis, etc. In one embodiment, the second type of cel or tissue is not a muscle cel. In one embodiment, the second type of cel or tissue is a non-cardiac muscle cel. UTRs, regulatory sequences, and Intron sequences

[0262] In some embodiments, the nucleic acid sequences, AAV vectors (e.g rAAV), constructs and methods to treat Danon disease disclosed herein, the promoter, i.e., the muscle specific promoter, as set out above is operably linked to one or more additional regulatory sequences. An additional regulatory sequence can, for example, enhance expression or cause increased stability of the encoded gene or transcript compared to the encoded transcript where promoter is not operably linked the additional regulatory sequence. Generaly, it is preferred that the additional regulatory sequence does not substantively reduce the specificity of the muscle specific promoter.

[0263] For example, the promoter can be operably linked to a sequence encoding a UTR (e.g., a 5’Aty. Dkt. No.046192-000118WOPT and / or 3’ UTR), an intron, or such. In some embodiments, the promoter is operably linked to sequence encoding a UTR, e.g., a 5’ UTR. A 5' UTR can contain various elements that can regulate gene expression. The 5’ UTR in a natural gene begins at the transcription start site and ends one nucleotide before the start codon of the coding region. It should be noted that 5' UTRs as referred to herein may be an entire naturaly occurring 5’ UTR or it may be a portion of a naturaly occurring 5’ UTR. The 5 ’UTR can also be partialy or entirely synthetic. In eukaryotes, 5' UTRs have a median length of approximately 150 nt, but in some cases they can be considerably longer. Regulatory sequences that can be found in 5' UTRs are disclosed in International Application WO2021102107 which is incorporated herein in its entirety by reference.

[0264] In some embodiments, a 5-UTR sequence is located 3’ of a promoter as disclosed herein, and 5’ of the heterologous nucleic acid sequence (e.g., encoding LAMP2B polypeptide).

[0265] Introns within 5' UTRs have been linked to regulation of gene expression and mRNA export. In some embodiments, a muscle specific promoter as set out above is operably linked to a sequence encoding a 5’ UTR derived from the CMV major immediate gene (CMV-IE gene). For example, the 5’ UTR from the CMV-IE gene suitably comprises the CMV-IE gene exon 1 and the CMV-IE gene exon 1, or portions thereof. In some cases, the promoter element may be modified in view of the linkage to the 5 ‘UTR, for example sequences downstream of the transcription start site (TSS) in the promoter element can be removed (e.g., replaced with the 5’ UTR).

[0266] The CMV-IE 5’UTR is described in Simari, et al, Molecular Medicine 4: 700-706, 1998 “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene”, which is incorporated herein by reference. Variants of the CMV-IE 5’ UTR sequences discussed in Simari, et al. are also set out in W02002 / 031137, incorporated by reference, and the regulatory sequences disclosed therein can also be used. Other UTRs that can be used in combination with a promoter are known in the art, e.g., in Leppek, K., Das, R. & Bama, M. “Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them”. Nat Rev Mol Cel Biol 19, 158-174 (2018), incorporated by reference.

[0267] In some embodiments the sequence encoding the 5’ UTR comprises SEQ ID NO: 35-39 as disclosed herein, or a functional variant thereof. In some embodiments, functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. SEQ ID NO: 35-39 as disclosed herein encodes a CMV-IE 5’ UTR.

[0268] In some embodiments the 5’ UTR comprises a nucleic acid motif that functions as the protein translation initiation site, e.g., sequences that define a Kozak sequence in the mRNA produced. For example, in some embodiments, the sequence encoding the 5’ UTR comprises the sequence motif GCCACC at or near its 3’ end. Other Kozak sequences or other protein translation initiation sites can be used, as is known in the art (e.g., Marilyn Kozak, “Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes” Cel, Vol.44, 283- 292, January 31, 1986; Marilyn Kozak “At Least Six Nucleotides Preceding the AUG Initiator CodonAty. Dkt. No.046192-000118WOPT Enhance Translation in Mammalian Cels” J. Mol. Rid. (1987) 196, 947-950; Marilyn Kozak “An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs” Nucleic Acids Research. Vol.15 (20) 1987, al of which are incorporated herein by reference). The protein translation initiation site (e.g., Kozak sequence) is preferably positioned immediately adjacent to the start codon.

[0269] A synthetic promoter, e.g., a synthetic muscle specific promoter, according to the present invention can be operably linked to a sequence encoding a UTR (e.g., a 5’ and / or 3’ UTR), and / or an intron, or suchlike. In some embodiments, a synthetic promoter as set herein, is operably linked to a sequence encoding a 5’ UTR and an intron. In some embodiments, the 5’ UTR and intron is derived from the CMV major immediate gene (CMV-IE gene). The CMV-IE 5’UTR and intron is described in Simari, et al., Molecular Medicine 4: 700-706, 1998 “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene”, which is incorporated herein by reference. Variants of the CMV-IE 5’ UTR and intron sequences discussed in Simari, et al. are also set out in WO2002 / 031137, incorporated by reference, and the regulatory sequences disclosed therein can also be used. In some embodiments the 5’ UTR or the 5’ UTR and intron suitably comprises a nucleic acid motif that functions as the protein translation initiation site, e.g., sequences that define a Kozak sequence in the mRNA produced. For example, in some embodiments, the sequence encoding the 5’ UTR comprises the sequence motif GCCACC at or near its 3’ end. Other Kozak sequences or other protein translation initiation sites can be used, as is known in the art (e.g., Marilyn Kozak, “Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes” Cel, Vol.44, 283-292, January 31, 1986; Marilyn Kozak “At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cels” J. Mol. Rid. (1987) 196, 947-950; Marilyn Kozak “An analysis of 5'’-noncoding sequences from 699 vertebrate messenger RNAs” Nucleic Acids Research. Vol.15 (20) 1987, al of which are incorporated herein by reference). The protein translation initiation site (e.g., Kozak sequence) is preferably positioned immediately adjacent to the start codon.

[0270] In some embodiments, any one of the promoters described herein, or variants thereof, is linked to a sequence encoding a 5’ UTR and / or a 5’UTR and an intron to provide a composite promoter. Herein, such composite promoter may be referred to simply as “composite promoters”, or in some cases simply “promoters” for brevity.

[0271] In some embodiments, the rAAV expressing the codon-optimized nucleic acid encoding human LAMP2B polypeptides for use in the methods to treat Danon disease as disclosed herein comprises an intron sequence located between the 3’ end of the promoter sequence and 5’ end of the heterologous nucleic acid (i.e., 5’ of the nucleic acid encoding the LAMP2B polypeptide). Intron sequences serve to increase one or more of: mRNA stability, mRNA transport out of nucleus and / or expression and / or regulation of the expressed LAMP2B polypeptide. In alternative embodiments, a rAAV genome does not comprise an intron sequence.Aty. Dkt. No.046192-000118WOPT

[0272] In some embodiment, the intron is an IVS intron. In some embodiments the sequence encoding the IVS intron comprises SEQ ID NO: 7 as disclosed herein, or a functional variant thereof. In some embodiments, functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. SEQ ID NO: SEQ ID NO: 7 as disclosed herein encodes an IVS intron.

[0273] In some embodiments, the intron sequence is a MVM intron sequence, for example, but not limited to intron sequence of SEQ ID NO: 40, or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0274] In some embodiments, the intron sequence is a HBB2 intron sequence, for example, but not limited to and intron sequence of SEQ ID NO: 41 or SEQ ID NO: 42 or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0275] In some embodiments, the intron sequence is an ubiquitin C (UBC) intron sequence, e.g., intron 1 from the UBC gene, or a portion thereof, e.g., as disclosed in Bianchi et al, 2009, Gene, 448 (1); 88-101, where the intron 1 sequence of the UBC gene is 812bp and starts at chromosomal location 124,914,586, and ends at 124,913,775. In some embodiments, the intron sequence is a UBC intron, for example, but not limited to intron sequence of SEQ ID NO: 43, or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to SEQ ID NO: 43.

[0276] In some embodiments, the rAAV genotype comprises an intron sequence selected in the group consisting of an IVS intron, a human beta globin b2 (or HBB2) intron, a FIX intron, a chicken beta-globin intron, a CMVIE intron, a UBC intron, a HBB intron sequence, a MVM sequeocne and a SV40 intron. In some embodiments, the intron is optionaly a modified intron such as a modified HBB2 intron (see, e.g., SEQ ID NO: 17 in of WO2018046774A1): a modified FIX intron (see., e.g., SEQ ID NO: 19 in WO2018046774A1), or a modified chicken beta-globin intron (e.g., see SEQ ID NO: 21 in WO2018046774A1), or modified HBB2 or FIX introns disclosed in WO2015 / 162302, which are incorporated herein in their entirety by reference. Poly A sequences and Terminator sequences

[0277] In some embodiments, an rAAV vector genome includes at least one poly A tail that is located 3’ and downstream from the heterologous nucleic acid gene encoding the LAMP2B polypeptide. Any polyA sequence known in the art can be used in the expression constructs of the invention, including but not limited to hGH poly A, bGH poly A, sv40 poly A, synpA polyA and the like. In some embodiments, the polyA is a synthetic polyA sequence. In some embodiments, the rAAV vector genome comprises two polyA tails, e.g., a hGH poly A sequence and another polyA sequence, where a spacer nucleic acid sequence is located between the two poly A sequences.

[0278] In some embodiments of the nucleic acid sequences, AAV (e.g., rAAV) vectors, constructs and methods to treat Danon disease disclosed herein, the polyA signal is 3’ of the heterologousAty. Dkt. No.046192-000118WOPT nucleic acid sequence encoding the LAMP2B polypeptide. In some embodiments, the rAAV genome comprises after the 3’ end of the nucleic acid encoding the LAMP2B polypeptide, a first polyA sequence and a reverse RNA polymerase I terminator sequence (rev RNA PolI terminator sequence), and the 3’ ITR.

[0279] In some embodiments, the rAAV genome comprises 3’ of the nucleic acid encoding the LAMP2B polypeptide, a first polyA sequence, a spacer nucleic acid sequence (e.g., of between 5-10 bp, 5-50 bp, 20-100 bp, 100-400bp, or about 100-250bp, or about 250-400bp), a second poly A sequence, a spacer nucleic acid sequence, and the 3’ ITR.

[0280] In some embodiments, the first and / or second poly A sequence is a hGH poly A sequence, and in some embodiments, the first and second poly A sequences are a synthetic poly A sequence. In some embodiments, the first poly A sequence is a hGH poly A sequence and the second poly A sequence is a synthetic poly A sequence, or vice versa – that is, in alternative embodiments, the first poly A sequence is a synthetic poly A sequence and the second poly A sequence is a hGH polyA sequence. As a non-limiting example, first poly A is a 49 bp poly A as described in Levit et al., and second poly A is Reverse poly A, or Reverse RNA Pol I terminator sequence. In some embodiments, only one poly A sequence is used.

[0281] In some embodiments, the poly A sequence is selected from any of: SEQ ID NO: 8, or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any of SEQ ID NOS: 8.

[0282] In some embodiments, the poly A sequence is selected from any of: SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 or SEQ ID NO: 47, where SEQ ID NO: 44 comprises the signal AATAAA, or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any of SEQ ID NOS: 44-46 or 47.

[0283] In some embodiments, the poly A sequence is selected from any of: SEQ ID NO: 48 or SEQ ID NO: 49, or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any of SEQ ID NOS: 48 or 49.

[0284] In some embodiments, the poly A sequence is, for example, SEQ ID NO: 15 as disclosed in International WO2021102107 (hGH poly A sequence), or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to SEQ ID NO: 15 as disclosed in International Application WO2021102107. In some embodiments, the hGHpolyA sequence encompassed for use is described in Anderson et al. J. Biol. Chem 264(14); 8222-8229, 1989 (See, e.g., p.8223, 2nd column, first paragraph) which is incorporated herein in its entirety by reference).

[0285] In one embodiment, the recombinant AAV disclosed herein comprises in its genome a transcriptional terminator signal sequence or a transcriptional pause signal sequence in the reverse orientation between polyA, e.g., first poly A and 3’ITR. In one embodiment, the recombinant AAV disclosed herein comprises in its genome a reverse RNAPolI transcriptional terminator signalAty. Dkt. No.046192-000118WOPT sequence or a transcriptional pause signal sequence that is in the 3’-5’ orientation between polyA and 3’ITR.

[0286] A “reverse RNA Polymerase I terminator sequence” alternatively caled a “dsRNA terminator sequence or termination element,” or “reverse poly A”, is an element that inhibits transcription of double stranded RNA, e.g., from the 3’ ITR. A reverse poly A can be any poly A known in the art in a reverse orientation, i.e., in 3‘-5’ orientation. In one embodiment of the invention, the reverse poly A is same as reverse RNA Polymerase I terminator sequence or dsRNA terminator sequence. In another embodiment of the invention, the reverse poly A is different than reverse RNA Polymerase I terminator sequence or dsRNA terminator sequence.

[0287] In 3’ to 5’ orientation, the termination element or the termination sequence does not alow the transcription from 3’ITR and hence double stranded RNA is not transcribed from 3’ITR. Any termination element can be used including e.g., inverted natural polyA sequences from any species or synthetic polyA signals, or fragments thereof; or other nucleic acid structure terminators known in the art. Exemplary polyA signal and / or, transcription terminators include, but are not limited to polyA signals of BGH, SV40, HGH, Betaglobin, RNA polymerase I transcriptional pause signal from alpha 2 globin gene, transcription termination signal for pol II, fragments thereof and any combination thereof.

[0288] A “reverse poly A” is a polyA signal sequence placed in a 3’-5’ orientation downstream of the LAMP2B transgene and upstream of 3’ITR. Any natural or synthetic poly A in 3’-5’ orientation can be used as reverse poly A. In some embodiments, the reverse poly A is the poly A (pA) as described in International Publication No. WO2019143950 and US Application Publication No. US20200340013, which are incorporated herein by reference in entirety. In several embodiments, the ‘reverse poly A’ and ‘the double stranded RNA termination element’ and ‘reverse RNA Polymerase I terminator sequence’ are used interchangeably.

[0289] In some embodiments, the poly A signal is a double stranded RNA termination element and / or, a reverse poly A. In some embodiments, the reverse poly A or double stranded RNA terminator is located after the homologous or heterologous poly A signal sequence.

[0290] In some embodiments, a transcriptional terminator signal sequence is a reverse RNA polymerase I terminator sequence which is, in a 5’ to 3’ orientation SEQ ID NO: 50, or a rev RNA PolI terminator sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any of SEQ ID NO: 50, where SEQ ID NO: 50 orientated in a 5’ to 3’ direction is located between the 3’ of the poly A sequence and 5’ of the right ITR sequence (or 3’ ITR).

[0291] In some embodiments, a poly-A tail can be engineered to stabilize the RNA transcript that is transcribed from an rAAV vector genome, including a transcript for a heterologous gene, which in one embodiment is a LAMP2B, and in alternative embodiments, the poly-A tail can be engineered to include elements that are destabilizing.

[0292] In some embodiments of the methods to treat Danon disease as disclosed herein, aAty. Dkt. No.046192-000118WOPT recombinant AAV vector comprises at least one polyA sequence located at, or after the3’ end of the nucleic acid encoding the LAMP2B gene and at or before the 5’ end of the 3’ ITR sequence. In some embodiments, the poly A is a ful length poly A (fl-polyA) sequence. In some embodiments, the polyA is a truncated polyA sequence as disclosed in International WO2021102107, which is incorporated herein in its entirety.

[0293] In an embodiment, a poly-A tail can be engineered to become a destabilizing element by altering the length of the poly-A tail. In an embodiment, the poly-A tail can be lengthened or shortened.

[0294] In some embodiments, there is a 3’ untranslated regions (3’UTRs) located between the heterologous gene encoding the LAMP2B polypeptide and the poly-A tail. In some embodiments, there is a 3’ UTR located 3’ of the nucleic acid sequence encoding the LAMP2B polypeptide.

[0295] In al aspects of the methods for treating Danon disease as disclosed herein, the rAAV genome may also comprise a Stuffer DNA nucleic sequence. An exemplary stuffer DNA sequence is SEQ ID NO: 71 as disclosed in International Application WO2021102107, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. In some embodiments, the stufer sequence is located 3’ of the poly A tail, for example, and is located 5’ of the ‘3 ITR sequence. In some embodiments, the stuffer DNA sequence comprises a synthetic polyadenylation signal in the reverse orientation.

[0296] In some embodiments, a stuffer nucleic acid sequence (also referred to as a “spacer” nucleic acid fragment) can be located between the poly A sequence and the 3’ ITR (i.e., a stufer nucleic acid sequence is located 3’ of the polyA sequence and 5’ of the 3’ ITR). Such a stufer nucleic acid sequence can be about 30bp, 50pb, 75bp, 100bp, 150bp, 200bp, 250bp, 300bp or longer than 300bp. In some embodiments of the methods and compositions as disclosed herein, a stufer nucleic acid fragment is between 20-50bp, 50-100bp, 100-200bp, 200-300bp, 300-500bp, or any integer between 20-500bp. Exemplary stufer (or spacer) nucleic acid sequence can be selected from any of: SEQ ID NO: 16, SEQ ID NO: 71 or SEQ ID NO: 78 as disclosed in International Application WO2021102107, the contents of which are incorporated herein in its entirety, or a nucleic acid sequence at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, identical to SEQ ID NO: 16 or SEQ ID NO: 71 or SEQ ID NO: 78 as disclosed in International Application WO2021102107, the contents of which are incorporated herein in its entirety. In some embodiments, the stuffer sequence is used outside of ITRs, e.g., outside of 5’ITR and / or, outside of 3‘ITR. AAV ITRs

[0297] The rAAV vector or genome, or constructs thereof, as disclosed herein for use in the methods to treat Danon disease can comprise AAV ITRs that have desirable characteristics and can be designed to modulate the activities of, and celular responses to vectors that incorporate the ITRs. InAty. Dkt. No.046192-000118WOPT another embodiment, the AAV ITRs are synthetic AAV ITRs that has desirable characteristics and can be designed to manipulate the activities of and celular responses to vectors comprising one or two synthetic ITRs, including, as set forth in U.S. Patent No.9,447433, which is incorporated herein by reference.

[0298] In another embodiment, an ITR exhibits modified transcription activity relative to a naturaly occuring ITR, e.g., ITR2 from AAV2. It is known that the ITR2 sequence inherently has promoter activity. It also inherently has termination activity, similar to a poly(A) sequence. The minimal functional ITR of the present invention exhibits transcription activity as shown in the examples, although at a diminished level relative to ITR2. Thus, in some embodiments, the ITR is functional for transcription. In other embodiments, the ITR is defective for transcription. In certain embodiments, the ITR can act as a transcription insulator, e.g., preventing transcription of a transgenic cassete present in the vector when the vector is integrated into a host chromosome.

[0299] One aspect of the invention relates to an rAAV vector genome, or construct thereof, comprising at least one synthetic AAV ITR, wherein the nucleotide sequence of one or more transcription factor binding sites in the ITR is deleted and / or substituted, relative to the sequence of a naturaly occurring AAV ITR such as ITR2. In some embodiments, it is the minimal functional ITR in which one or more transcription factor binding sites are deleted and / or substituted. In some embodiments at least 1 transcription factor binding site is deleted and / or substituted, e.g., at least 5 or more or 10 or more transcription factor binding sites, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 transcription factor binding sites.

[0300] Another embodiment, a rAAV vector or construct thereof, including an rAAV vector genome as described herein comprises a polynucleotide comprising at least one synthetic AAV ITR, wherein one or more CpG islands (a cytosine base folowed immediately by a guanine base (a CpG) in which the cytosines in such arrangement tend to be methylated) that typicaly occur at, or near the transcription start site in an ITR are deleted and / or substituted. In an embodiment, deletion, or reduction in the number of CpG islands can reduce the immunogenicity of the rAAV vector. This results from a reduction or complete inhibition in TLR-9 binding to the rAAV vector DNA sequence, which occurs at CpG islands. It is also wel known that methylation of CpG motifs results in transcriptional silencing. Removal of CpG motifs in the ITR is expected to result in decreased TLR-9 recognition and / or decreased methylation and therefore decreased transgene silencing. In some embodiments, it is the minimal functional ITR in which one or more CpG islands are deleted and / or substituted. In an embodiment, AAV ITR2 is known to contain 16 CpG islands of which one or more, or al 16 can be deleted.

[0301] In some embodiments, at least 1 CpG motif is deleted and / or substituted, e.g., at least 4 or more or 8 or more CpG motifs, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 CpG motifs.

[0302] In another embodiment, the synthetic ITR comprises, consists essentialy of, or consists ofAty. Dkt. No.046192-000118WOPT one of the nucleotide sequences listed in Table 1. In other embodiments, the synthetic ITR comprises, consist essentialy of, or consist of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to any one of the nucleotide sequences listed in Table 1. In some embodiments, the ITR is a sequence is disclosed in FIG.1 of Samulski et al., 1983, Cel, 33; 135-143 (refered to “Samulski et al, 1983” as which is incorporated herein in its entirety by reference), which discloses modified ITR sequences in FIG.1. In some embodiments, the ITR sequence comprises, or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to one of the ITR sequences in FIG.1 as disclosed in Samulski et al, 1993. In some embodiments, the ITR comprises, or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to the ITR sequence of pSM 609 right disclosed in the middle panel of FIG.1 (that lacks the 9bp) disclosed in Samulski et al, 1983. In some embodiments, the ITR comprises a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to the ITR sequence of any of SEQ ID NOs: 51-58.

[0303] In some embodiments, the ITR sequence, e.g., Right ITR (or 3’ ITR) is SEQ ID NO: 58 or SEQ ID NO: 54 or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to SEQ ID NO: 58 or SEQ ID NO: 54. In some embodiments, the ITR sequence, e.g., left ITR (or 5’ ITR) is SEQ ID NO: 51 or SEQ ID NO: 53 or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to SEQ ID NO: 51 or SEQ ID NO: 53.

[0304] In one embodiment, the ITR is a mutant ITR that is at least 106 bp in length. For example, the mutant ITR has a sequence of SEQ ID NO: 16. ctgcgc gctcgctcgc tcactgaggc cgcccgggca aagcccgggc gtcgggcgac cttggtcgc ccggcctcag tgagcgagcg agcgcgcaga gagggagtgg (SEQ ID NO: 16).

[0305] In some embodiments of any aspect of the invention, one or both of the ITR sequences is a wt ITR or an ITR sequence disclosed herein, having an insertion, deletion or substitution. In one embodiment of any aspect of this invention, any one or both of 5’ITR and 3’ITR is 145 bp long or smaler than 145 bp in length e.g, 142 bp, 141 bp, 140 bp, 135 bp, 130 bp, 128 bp, 120 bp, 117 bp, 115 bp, or smaler than 115 bp in length. In one embodiment, the 5’ITR or 3’ITR is 130 bp long. In one embodiment, both 5’ITR and 3’ITR are 130 bp long.

[0306] In one embodiment, the ITR is at least 145 bp in length. For example, the ITR has a sequence of SEQ ID NO: 17. aggaaccc ctagtgatgg agtggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga ccaaaggtcg cccgacgccc gggcttgcc cgggcggcct cagtgagcga gcgagcgcgc agagagggag tggccaa (SEQ ID NO: 17). Table 1 : Exemplary synthetic ITR sequencesAty. Dkt. No.046192-000118WOPTExpression construct

[0307] A construct or an expression construct of the invention comprising LAMP2B polypeptide encoded by codon optimized LAMP2B sequences of the invention (e.g., SEQ ID NOs 1-3 herein, orAty. Dkt. No.046192-000118WOPT SEQ ID NOs 2-5, 8-10, or 29-32 as described in U.S. Patent Number 10,703,797; SEQ ID NOs 7-9 as described in U.S. Patent Application Number 17 / 264,275; SEQ ID NOs 6-12 as described in U.S. Patent Application Number 17 / 430,107; or SEQ ID NOs 2-5, 8-10, or 29-33 as described in International Patent Application Number WO 2022 / 12489) is a nucleic acid sequence that can be expressed in eukaryotic cel. The expression construct can be plasmid, cosmid, viral vectors, or artificial chromosomes. In some embodiments, the expression construct is a plasmid. In some other embodiments the expression construct is a no end DNA, or neDNA. One example of neDNA is doggy bone DNA or dbDNA. Another example of neDNA is dumbbel shaped DNA. Dumbbel-shaped DNA and doggy bone DNA are described in U.S. Patent No.6,451,563; Efficient production of superior dumbbel-shaped DNA minimal vectors for smal hairpin RNA expression-Nucleic Acids Res.2015 Oct 15; 43(18): e120; High-Purity Preparation of a Large DNA Dumbbel-Antisense & nucleic acid drug development 11:149–153 (2001); US 9,109,250; U.S. Patent No.9,499,847; U.S. Patent No.10,501,782; and WO 2018033730 A1. The rAAV of the invention comprises plasmid DNA or neDNA encoding LAMP2B polypeptide. Vectors and Virions

[0308] In one embodiment, the rAAV vector (also referred to as a rAAV virion) as disclosed herein comprises a capsid protein, and a rAAV genome encapsidated in the capsid protein. A rAAV vector of the invention used to treat Danon disease is any AAV serotype listed in Table 2 or comprises at least one capsid protein of the AAV serotypes listed in Table 2 or in Table 1 as disclosed in International Applications WO2020 / 102645, and WO2020 / 102667, each of which are incorporated herein in their entirety. In one embodiment, a rAAV capsid of the rAAV virion used in the invention to treat Danon disease is an AAV2i8 capsid as described in the granted US Patent US 8,889,641, which is incorporated by reference in its entirety. In one embodiment of the invention, the rAAV vector comprising Lamp2B nucleic acid as discussed herein is a cardiotropic, liver detargeting AAV vector. In one embodiment, a rAAV vector of the invention comprising Lamp2B nucleic acid as discussed herein is an rAAV2i8 vector. In one embodiment, the rAAV2i8 vector has a sequence of SEQ ID NO: 83. In one embodiment, at least one of VP1, VP2, or VP3 of rAAV of the invention is from AAV2i8 capsid. As a further embodiment, the rAAV of the invention described herein comprises AAV capsid proteins that can be polyploid (also refered to as haploid, or rational haploid, or rational polyploid), i.e., they can comprise VP1, VP2, and VP3 capsid proteins from more than one AAV serotypes in a single AAV virion as described in International Application Nos PCT / US2018 / 022725, PCT / US2018 / 044632, and US Patent No.10,550,405; al of which are incorporated here by reference. In some embodiments, rAAV comprises at least one capsid protein of VP1, VP2, and VP3 selected from AAV serotypes listed in Table 2.

[0309] In one embodiment, the AAV capsid protein cannot be an 309, 310, serotype.

[0310] Aspects disclosed herein cannot comprises AAV9 serotype. Accordingly, in oneAty. Dkt. No.046192-000118WOPT embodiment, the AAV serotype cannot be an AAV9 serotype. In one embodiment, the AAV capsid protein cannot be an AAV9 serotype. In one embodiment, any AAV vector comprising the expression cassetes disclosed herein cannot be an AAV9 serotype. In one embodiment, any pharmaceutical composition disclosed herein cannot comprise an AAV9 serotype. In one embodiment, any method of treating Danon disease disclosed herein cannot comprise an AAV9 serotype.

[0311] Table 2: Exemplary descriptions of capsids and sequences. *Table 2 does not includeAty. Dkt. No.046192-000118WOPTAty. Dkt. No.046192-000118WOPTUS20150315612) US20150315612) AAVhu.l6 (AAV33.8) (See SEQ ID NO: 51 in AAVhu.16 (See SEQ ID NO: 148 in US20150315612) US20150315612) AAVhu.l7 (AAV33.12) (See SEQ ID NO: 4 in AAVhu.17 (See SEQ ID NO: 83 in US20150315612) US20150315612)Aty. Dkt. No.046192-000118WOPT AAVhu.172.2 (See SEQ ID NO: 172 in AAVhu.172.1 (See SEQ ID NO: 171 in US20150315612) US20150315612)US20150315612)AAVhu.21 (See SEQ ID NO: 135 in AAVhu.21 (See SEQ ID NO: 65 in US20150315612) US20150315612) AAVhu.22239 (See SEQ ID NO: 138 in AAVhu.22 (See SEQ ID NO: 67 in US20150315612) US20150315612)AAVhu.25 (See SEQ ID NO: 146 in AAVhu.25 (See SEQ ID NO: 49 in US20150315612) US20150315612) AAVhu.26 (See SEQ ID NO: 33 in AAVhu.26 (See SEQ ID NO: 17 in US20150159173 US20150159173, and SEQ ID NOS: 61 and 139 and SEQ ID NO: 61 in US20150315612) in US20150315612) AAVhu.27 (See SEQ ID NO: 140 AAVhu.27 (See SEQ ID NO: 64 in US20150315612) US20150315612) AAVhu.28 (See SEQ ID NO: 130 AAVhu.28 (See SEQ ID NO: 68 in US20150315612) US20150315612) AAVhu.29 (See SEQ ID NO: 42 in AAVhu.29 (See SEQ ID NO: 69 in US20150315612) US20150159173 and SEQ ID NO: US20150315612)AAVhu.29 (See SEQ ID NO: 225 AAVhu.29R (See SEQ ID NO: 42 with G396E in US20150315612) US20150159173) AAVhu.3 (See SEQ ID NO: 44 in AAVhu.3 (See SEQ ID NO: 145 in US20150315612) US20150315612) AAVhu.30 (See SEQ ID NO: 70 AAVhu.30 (See SEQ ID NO: 131 in US20150315612) US20150315612) AAVhu.31 (See SEQ ID NO: 1 in AAVhu.31 (See SEQ ID NO: 121 in US20150315612) US20150315612) AAVhu.32 (See SEQ ID NO: 2 in AAVhu.32 (See SEQ ID NO: 122 in US20150315612) US20150315612) AAVhu.33 (See SEQ ID NO: 75 AAVhu.33 (See SEQ ID NO: 124 in US20150315612) US20150315612) AAVhu.34 (See SEQ ID NO: 72 AAVhu.34 (See SEQ ID NO: 125 in US20150315612) US20150315612)AAVhu.35 (See SEQ ID NO: 73 AAVhu.35 (See SEQ ID NO: 164 in US20150315612) US20150315612)US20150315612) US20150159173)Aty. Dkt. No.046192-000118WOPT AAVhu.38 (See SEQ ID NO: 161 in AAVhu.39 (See SEQ ID NO: 102 in US20150315612) US20150315612)US20150315612) AAVhu.40 (AAV114.3) (See SEQ AAVhu.41 (See SEQ ID NO: 91 in US20150315612) US20150315612) AAVhu.41 (AAV127.2) (See SEQ AAVhu.42 (See SEQ ID NO: 85 in US20150315612) US20150315612) AAVhu.42 (AAV127.5) (See SEQ AAVhu.43 (See SEQ ID NO: 160 in US20150315612) US20150315612) AAVhu.43 (See SEQ ID NO: 236 AAVhu.43 (AAV128.1) (See SEQ ID NO: 80 in US20150315612)US20150315612) AAVhu.44 (See SEQ ID NO: 45 in AAVhu.44Rl (See SEQ ID NO: 45 modified with US20150159173 and SEQ ID NO: 158 in E137K in US20150159173) US20150315612) AAVhu.44 (AAV128.3) (See SEQ ID NO: 81 in AAVhu.44R3 (See SEQ ID NO: 45 modified with US20150315612) E137K, P446L, and G609D in US20150159173) AAVhu.44R2 (See SEQ ID NO: 45 AAVhu.45 (See SEQ ID NO: 127 in US20150315612) with E137K and P446L in AAVhu.45 (See SEQ ID NO: 76 in AAVhu.46 (See SEQ ID NO: 159 in US20150315612) US20150315612) AAVhu.46 (See SEQ ID NO: 82 in AAVhu.47 (See SEQ ID NO: 77 in US20150315612) US20150315612) AAVhu.46 (See SEQ ID NO: 224 in AAVhu.48 (See SEQ ID NO: 38 in US20150159173) US20150315612) AAVhu.47 (See SEQ ID NO: 128 in AAVhu.48 (AAV130.4) (See SEQ ID NO: 78 in US20150315612)US20150315612) AAVhu.48 (See SEQ ID NO: 157 in AAVhu.48R2 (See SEQ ID NO: 38 modified with US20150315612) G277S and E322K in US20150159173)US20150159173)AAVhu.55 (See SEQ ID NO: 187 in AAVhu.56 (AAV145.6) (See SEQ ID NO: 192 in US20150315612) US20150315612) AAVhu.56 (AAV145.6) (See SEQ ID NO: 168 in AAVhu.57 (See SEQ ID NO: 169 in US20150315612) US20150315612) AAVhu.57 (See SEQ ID NO: 206AAVhu.58 (See SEQ ID NO: 207 in US20150315612) US20150315612)Aty. Dkt. No.046192-000118WOPTAty. Dkt. No.046192-000118WOPTAty. Dkt. No.046192-000118WOPT AAVrh.2 (See SEQ ID NO: 231 in AAVrh.21 (AAV42.10) (See SEQ ID NO: 35 in US20150315612) US20030138772) AAV42.10 (See SEQ ID NO: 106 in AAVrh.22 (AAV42.11) (See SEQ ID NO: 37 in US20030138772) US20030138772) AAV42.11 (See SEQ ID NO: 108 in AAVrh.23 (AAV42.12) (See SEQ ID NO: 58 in US20030138772) US20030138772) AAV42.12 (See SEQ ID NO: 113 in AAVrh.24 (AAV42.13) (See SEQ ID NO: 31 in US20030138772) US20030138772) AAV42.13 (See SEQ ID NO: 86 in AAVrh.25 (AAV42.15) (See SEQ ID NO: 28 in US20030138772) US20030138772) AAV42.15 (See SEQ ID NO: 84 in AAVrh.31 (AAV223.1) (See SEQ ID NO: 48 in US20030138772) US20030138772) AAVrh.2R (See SEQ ID NO: 39 modified with AAVrh.32 (AAVC1) (See SEQ ID NO: 19 in 446 V651I in US20150159173) US20030138772) AAVC1 (See SEQ ID NO: 60 in AAVrh.51 (AAV2-5) (See SEQ ID NO: 104 in US20030138772) US20150315612)AAVrh.53 (See SEQ ID NO: 97 in AAVrh.54 (See SEQ ID NO: 40 in US20150315612) US20150315612) AAVrh.53 (AAV3-11) (See SEQ ID NO: 186 in AAVrh.55 (AAV4-19) (See SEQ ID NO: 117 in US20150315612) US20150315612) AAVrh.54 (See SEQ ID NO: 49 in AAVrh.56 (See SEQ ID NO: 152 in US20150315612) US20150159173 and SEQ ID NO: 116 in US20150315612) AAVrh.55 (See SEQ ID NO: 37 in AAVrh.57 (See SEQ ID NO: 105 in US20150315612) US20150315612) AAVrh.56 (See SEQ ID NO: 54 in AAVrh.58 (See SEQ ID NO: 48 in US20150159173 US20150315612) and SEQ ID NO: 106 in US20150315612) AAVrh.57 (See SEQ ID NO: 26 in AAVrh.58 (See SEQ ID NO: 232 in US20150315612) US20150315612)US20150315612) AAVrh.60 (See SEQ ID NO: 31 in AAVrh.61 (AAV2-3) (See SEQ ID NO: 21 in US20150315612) US20150315612) AAVrh.61 (See SEQ ID NO: 107 in AAVrh.62 (AAV2-15) (See SEQ ID NO: 114 in US20150315612) US20150315612) AAVrh.62 (AAV2-15) (See SEQ ID NO: 33 in AAVrh.64 (See SEQ ID NO: 43 in US20150159173 US20150315612) and SEQ ID NO: 99 in US20150315612) AAVrh.64 (See SEQ ID NO: 15 in AAVrh.64 (See SEQ ID NO: 233 in US20150315612) US20150315612)AAVrh.65 (See SEQ ID NO: 35 in AAVrh.65 (See SEQ ID NO: 112 in US20150315612) US20150315612) AAVrh.67 (See SEQ ID NO: 36 in AAVrh.67 (See SEQ ID NO: 230 in US20150315612) US20150315612) AAVrh.67 (See SEQ ID NO: 47 in AAVrh.68 (See SEQ ID NO: 100 in US20150315612) US20150159173 and SEQ ID NO: 47 in US20150315612)Aty. Dkt. No.046192-000118WOPTAty. Dkt. No.046192-000118WOPTAty. Dkt. No.046192-000118WOPTAty. Dkt. No.046192-000118WOPTAty. Dkt. No.046192-000118WOPT AAV CSp-11 (See SEQ ID NO: 47 in AAV CSp-2 (See SEQ ID NO: 122 in US8734809) US8734809) AAV CSp-2 (See SEQ ID NO: 48 in US8734809) AAV CSp-3 (See SEQ ID NO: 123 in US8734809) AAV CSp-3 (See SEQ ID NO: 49 in US8734809) AAV CSp-4 (See SEQ ID NO: 124 in US8734809) AAV CSp-4 (See SEQ ID NO: 50 in US8734809) AAV CSp-6 (See SEQ ID NO: 125 in US8734809) AAV CSp-6 (See SEQ ID NO: 51 in US8734809) AAV CSp-7 (See SEQ ID NO: 126 in US8734809) AAV CSp-7 (See SEQ ID NO: 52 in US8734809) AAV CSp-8 (See SEQ ID NO: 127 in US8734809) AAV CSp-8 (See SEQ ID NO: 53 in US8734809) AAV CSp-8.10 (See SEQ ID NO: 88 in WO2016065001)Aty. Dkt. No.046192-000118WOPTAty. Dkt. No.046192-000118WOPT MyoAAV4D (see SEQ ID NO:31 and inAAVhu37 (see SEQ ID NO: 16 in US20220354969)US20220354969) AAVsh10 (see SEQ ID NO: 35 US20220354969) AAVrh8 (see SEQ ID NO: 12 in US20220354969) AAV2i8 (see SEQ ID NO: 22 US20220354969) AAVhu13 (see SEQ ID NO: 15 in US20220354969) AAV2G9 (see SEQ ID NO: 24 US20220354969) AAVAnc80 (see SEQ ID NO: 33 in US20220354969) AAVPHPB (see SEQ ID NO: 27 in AAVPHPeB (see SEQ ID NO: 28 in US20220354969) US20220354969) AAVbovine (see SEQ ID NO.12 in AAV2R585E (see SEQ ID NO: in US11866462) US20220184227

[0312] In one embodiment, the rAAV vector of the invention is AAV2, AAV6, AAV8, AAV2i8, AAV2G9, AAVXL32, or AAVXL32.1.

[0313] In one embodiment, the AAV vector (also referred to as a rAAV virion) as disclosed herein comprises a capsid protein from any of those disclosed in WO2019 / 241324, which is specificaly incorporated herein in its entirety by reference.

[0314] Exemplary chimeric or variant capsid proteins that can be used as the AAV capsid in theAty. Dkt. No.046192-000118WOPT rAAV vector described herein can be selected from Table 2 from U.S. provisional application 62,937,556, filed on November 19, 2019 (PCT / US20 / 61223, filed on 11-19-2020; WO 2021 / 102107), which is specificaly incorporated herein by reference or can be used with any combination with wild type capsid proteins and / or other chimeric or variant capsid proteins now known or later identified and each is incorporated herein. In some embodiments, the rAAV vector encompassed for use is a chimeric vector, e.g., as disclosed in 9,012,224 and US 7,892,809, which are incorporated herein in their entirety by reference.

[0315] In some embodiments, the rAAV vector is a rational polyploid rAAV vector, as disclosed in US application US2018 / 0371496 and PCT / US18 / 22725, or polyploid rAAV vector, e.g., as disclosed in PCT / US2018 / 044632 filed on 7 / 31 / 2018 and in US application 16 / 151,110, each of which are incorporated herein in their entirety by reference. In some embodiments, the rAAV vector is a rAAV3 vector, as disclosed in 9,012,224 and WO 2017 / 106236 which are incorporated herein in their entirety by reference.

[0316] In a particular embodiment, the rAAV is a AAVXL32 or AAVXL32.1 AAV vector as disclosed in WO2019 / 241324, which is incorporated herein in its entirety by reference. In some embodiments, the rAAV vector comprises a capsid disclosed in WO2019241324A1, or International Patent application PCT / US2019 / 036676, which are incorporated herein in their entirety by reference. In some embodiments, the AAV vector is a AAV8 vector or a rational polyploid comprising an AAV8 capsid protein. In some embodiments, the AAV vector is a AAV2 vector or a rational haploid polyploid comprising an AAV2 capsid protein. In some embodiments, the recombinant AAV vector is a chimeric AAV vector, rational haploid AAV vector, a hybrid AAV vector or rational polyploid AAV vector. In some embodiments, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemicaly modified AAV vector, or a AAV vector from any AAV serotypes, for example, from any AAV serotype disclosed in Table 1 as disclosed in International Applications WO2020 / 102645, and WO2020 / 102667, each of which are incorporated herein in their entirety.

[0317] In an embodiment, an rAAV vector useful in the treatment of Danon disease as disclosed herein is an AAV3b capsid. AAV3b capsids encompassed for use are described in 2017 / 106236, and 9,012,224 and 7,892,809, and International application PCT / US19 / 61653, filed Nov 15, 2019, and International Applications WO2020 / 102645, and WO2020 / 102667, each of which are incorporated herein in their entirety. In addition, AAV3b capsids of the AAV vector for use according to the methods as disclosed herein are disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107, which are incorporated herein in its entirety by reference herein.

[0318] In some embodiments, the AAV3b capsid comprises SEQ ID NO: 44 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. In an embodiment, the AAV capsid used in the treatment of Danon disease can be a modified AAV capsid that is derived in whole or in part from the AAV capsid set forth in SEQ ID NO: 44. In some embodiments, the amino acids from an AAV3b capsid as set forth in SEQ ID NO: 44 can be, or are substituted with aminoAty. Dkt. No.046192-000118WOPT acids from another capsid of a diferent AAV serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturaly occuring or partialy or completely synthetic amino acids.

[0319] In another embodiment, an AAV capsid used in the treatment of Danon disease is an AAV3b265D capsid. In this particular embodiment, an AAV3b265D capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid G265 of the AAV3b capsid with D265. In some embodiments, an AAV3b265D capsid comprises SEQ ID NO: 46 as set forth in International Patent Applications WO 2020 / 102645 and WO2021102107. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 46 as set forth in International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments, the amino acids from AAV3b265D as set forth in SEQ ID NO.46 can be, or are substituted with amino acids from a capsid from an AAV of a diferent serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturaly occuring or partialy or completely synthetic amino acids.

[0320] In another embodiment an rAAV vector useful in the treatment of Danon disease as disclosed herein is an AAV3b265D549A capsid. In this particular embodiment, an AAV3b265D549A capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid G265 of the AAV3b capsid with D265 and replacement of amino acid T549 of the AAV3b capsid with A549. In some embodiments, an AAV3b265D549A capsid comprises SEQ ID NO: 50 as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 50. In some embodiments, the amino acids from AAV3b265D549A as set forth in SEQ ID NO: 50 can be, or are substituted with amino acids from a capsid from an AAV of a diferent serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturaly occuring or partialy or completely synthetic amino acids. In some embodiments, the amino acids from AAV3bSASTG (i.e., a AAV3b capsid comprising Q263A / T265 mutations) can be, or are substituted with amino acids from a capsid from an AAV of a diferent serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturaly occuring or partialy or completely synthetic amino acids.

[0321] In another embodiment, an rAAV vector useful in the treatment of Danon disease as disclosed herein is an AAV3b549A capsid. In this particular embodiment, an AAV3b549A capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid T549 of the AAV3b capsid with A549. In some embodiments, an AAV3b549A capsid comprises SEQ ID NO: 52 as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 52. In some embodiments, the amino acids from AAV3b549A as set forth in SEQ ID NO: 52 can be, or are substituted with amino acids from a capsidAty. Dkt. No.046192-000118WOPT from an AAV of a diferent serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturaly occurring or partialy or completely synthetic amino acids.

[0322] In another embodiment, an rAAV vector useful in the treatment of Danon disease as disclosed herein is an AAV3bQ263Y capsid. In this particular embodiment, an AAV3bQ263Y capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid Q263 of the AAV3b capsid with Y263. In some embodiments, an AAV3b549A capsid comprises SEQ ID NO: 54 as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 54. In some embodiments, the amino acids from AAV3bQ263Y as set forth in SEQ ID NO: 54 can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturaly occurring or partialy or completely synthetic amino acids.

[0323] In another embodiment, an rAAV vector useful in the treatment of Danon disease as disclosed herein is AAV3bSASTG serotype or comprises a AAV3bSASTG capsid. In this particular embodiment, an AAV3bSASTG capsid comprises a modification in the amino acid sequence to comprise a SASTG mutation, in particular, the AAV3b capsid was modified to resemble AAV2 Q263A / T265 subvariant by introducing these modifications at similar positions in the AAV3b capsid (as disclosed in Messina EL, et al., Adeno-associated viral vectors based on serotype 3b use components of the fibroblast growth factor receptor signaling complex for eficient transduction. Hum. Gene Ther.2012 Oct: 23(10):1031-4, Piacentino II, Valentino, et al. "X-linked inhibitor of apoptosis protein-mediated atenuation of apoptosis, using a novel cardiac-enhanced adeno-associated viral vector." Human gene therapy 23.6 (2012): 635-646.which are both incorporated herein in their entirety by reference). Accordingly, in some embodiments, an rAAV vector useful in the treatment of Danon disease as disclosed herein is AAV3bSASTG serotype or comprises a AAV3bSASTG capsid comprising a AAV3b Q263A / T265 capsid. In some embodiments, the amino acids from AAV3bSASTG can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturaly occurring or partialy or completely synthetic amino acids.

[0324] In order to facilitate their introduction into a cel, an rAAV vector genome useful in the invention are recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (in one embodiment, a polynucleotide encoding a LAMP2B polypeptide) and (2) viral sequence elements that facilitate integration and expression of the heterologous genes. The viral sequence elements may include those sequences of an AAV vector genome that are required in cis for replication and packaging (e.g., functional ITRs) of the DNA into an AAV capsid. In an embodiment, the heterologous gene encodes LAMP2B, which is useful for corecting a LAMP2B-deficiency in aAty. Dkt. No.046192-000118WOPT patient suffering from Danon disease. In an embodiment, such an rAAV vector genome may also contain marker or reporter genes. In an embodiment, an rAAV vector genome can have one or more of the AAV3b wild-type (WT) cis genes replaced or deleted in whole or in part, but retain functional flanking ITR sequences.

[0325] In one embodiment, one can use a nanoparticle, e.g., a lipid nanoparticule (LNP), instead of an AAV vector to deliver the LAMP2B cargo. The term “nanoparticles” also encompasses liposomes and lipid particles having the size of a nanoparticle. Exemplary liposomes can comprise, e.g., DSPC, DPPC, DSPG, Cholesterol, hydrogenated soy phosphatidylcholine, soy phosphatidyl choline, methoxypolyethylene glycol (mPEG-DSPE) phosphatidyl choline (PC), phosphatidyl glycerol (PG), distearoylphosphatidylcholine, and combinations thereof. In some embodiments of any of the aspects, the carier is, comprises, or consists of a lipid nanoparticle (LNP). Lipid nanoparticles can comprise multiple components, including, e.g., ionizable lipids (such as MC3, DLin-MC3-DMA, ALC-0315, or SM-102), pegylated lipids (such as PEG2000-C-DMG, PEG2000-DMG, ALC-0159), phospholipids (such as DSPC), and cholesterol.

[0326] Generaly, the lipid nanoparticles have a mean diameter selected to provide an intended therapeutic effect. Accordingly, in some aspects, the lipid nanoparticle has a mean diameter from about 30 nm to about 150 nm, more typicaly from about 50 nm to about 150 nm, more typicaly about 60 nm to about 130 nm, more typicaly about 70 nm to about 110 nm, most typicaly about 85 nm to about 105nm, and preferably about 100 nm. In some aspects, the disclosure provides for lipid particles that are larger in relative size to common nanoparticles and about 150 to 250 nm in size. Lipid nanoparticle particle size can be determined by quasi-elastic light scatering using, for example, a Malvern Zetasizer Nano ZS (Malvern, UK) system.

[0327] Depending on the intended use of the lipid particles, the proportions of the components can be varied, and the delivery efficiency of a particular formulation can be measured using, for example, an endosomal release parameter (ERP) assay.

[0328] The nucleic acid can be complexed with the lipid portion of the particle or encapsulated in the lipid position of the lipid nanoparticle. In some embodiments, the nucleic acid can be fuly encapsulated in the lipid position of the lipid nanoparticle, thereby protecting it from degradation by a nuclease, e.g., in an aqueous solution. In some embodiments, the nucleic acid in the lipid nanoparticle is not substantialy degraded after exposure of the lipid nanoparticle to a nuclease at 37°C. for at least about 20, 30, 45, or 60 minutes. In some embodiments, the nucleic acid in the lipid nanoparticle is not substantialy degraded after incubation of the particle in serum at 37oC. for at least about 30, 45, or 60 minutes or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours.

[0329] In certain embodiments, the lipid nanoparticles are substantialy non-toxic to mammals such as humans.Aty. Dkt. No.046192-000118WOPT

[0330] In some embodiments, lipid nanoparticles are solid core particles that possess at least one lipid bilayer. In other embodiments, the lipid nanoparticles have a non-bilayer structure, i.e., a non- lamelar (i.e., non-bilayer) morphology. Without limitations, the non-bilayer morphology can include, for example, three dimensional tubes, rods, cubic symmetries, etc. The non-lamelar morphology (i.e., non-bilayer structure) of the lipid particles can be determined using analytical techniques known to and used by those of skil in the art. Such techniques include, but are not limited to, Cryo- Transmission Electron Microscopy (“Cryo-TEM”), Differential Scanning calorimetry (“DSC”), X- Ray Difraction, etc… For example, the morphology of the lipid nanoparticles (lamelar vs. non- lamelar) can readily be assessed and characterized using, e.g., Cryo-TEM analysis as described in US2010 / 0130588, content of which is incorporated herein by reference in its entirety.

[0331] In some further embodiments, the lipid nanoparticles having a non-lamelar morphology are electron dense. In embodiments, the lipid nanoparticle is either unilamelar or multilamelar in structure. In some aspects, the disclosure provides for a lipid nanoparticle formulation that comprises multi-vesicular particles and / or foam-based particles.

[0332] Lipid nanoparticles can form spontaneously upon mixing of mRNA and the lipid(s). Depending on the desired particle size distribution, the resultant nanoparticle mixture can be extruded through a membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be omited. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration.

[0333] Generaly, lipid nanoparticles can be formed by any method known in the art including. For example, the lipid nanoparticles can be prepared by the methods described, for example, in US2013 / 0037977, US2010 / 0015218, US2013 / 0156845, US2013 / 0164400, US2012 / 0225129, and US2010 / 0130588, content of each of which is incorporated herein by reference in its entirety. In some embodiments, lipid nanoparticles can be prepared using a continuous mixing method, a direct dilution process, or an in-line dilution process. The processes and apparatuses for apparatuses for preparing lipid nanoparticles using direct dilution and in-line dilution processes are described in US2007 / 0042031, content of which is incorporated herein reference in its entirety. The processes and apparatuses for preparing lipid nanoparticles using step-wise dilution processes are described in US2004 / 0142025, content of which is incorporated herein reference in its entirety. Methods of Treatment

[0334] The rAAV vectors, codon-optimized nucleic acids encoding LAMP2B protein or LAMP2B polypeptide, and expression cassetes described herein can be used in methods to treat Danon disease. Aspects of the invention relate to the treatment of disease (e.g., Danon disease) by administration of the rAAV vectors, codon-optimized nucleic acids or expression cassetes (e.g., contained within in aAty. Dkt. No.046192-000118WOPT pharmaceutical composition) disclosed herein, to a subject in need thereof for therapeutic expression of the codon-optimized nucleic acids encoding a LAMP2B polypeptide in the subject.

[0335] In any embodiment of the methods as disclosed herein, a LAMP2B polypeptide suitable for use in the therapeutic method includes those proteins encoded by the codon optimized LAMP2B nucleic acids described herein. In some embodiments of the methods and compositions as disclosed herein, the LAMP2B polypeptide is encoded by a codon optimized LAMP2B nucleic acid sequence. In some embodiments of the methods and compositions as disclosed herein, the LAMP2B polypeptide is encoded by a codon optimized LAMP2B nucleic sequence, for example, a nucleic acid with the sequence set forth in any of: SEQ ID NO: 1-3, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto, which encode a LAMP2B polypeptide.

[0336] In some embodiments of the methods and compositions as disclosed herein, a rAAV vector as described herein transduces the muscle of a subject. In some embodiments of the methods and compositions as disclosed herein, a rAAV vector as described herein transduces the cardiac muscle of a subject.

[0337] In any embodiment of the methods as disclosed herein, administration of a AAV vector expressing the LAMP2B polypeptide can be by any suitable method including by systemic administration (e.g., intravenous administration, intra-arterial administration, and / or intra-peritoneal administration) and local administration (e.g, to the muscle, such as cardiac muscle).

[0338] In one embodiment, the local administration is intracoronary administration, which is a combination of vascular administration and local administration. Intracoronoary administration is not direct injection into muscle, but rather localy administered to the heart vasculature. The heart is the first organ administered the vector and is exposed to the highest vector concentration. Such administration is also vascular delivery because it is administered to blood. Intracoronary delivery requires a lower dose than traditional intervenous delivery, thereby improving safety of the product and not needing immune prophylaxis protocols. Intracoronary injection is not the same a direct local injection into heart muscle, because it achieved a broader and more uniform spread than a true local injection would produce. Exemplary modes of other modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intralymphatic, and the like, as wel as direct tissue or organ injection (e.g., to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain). In some embodiments, administration is directly to the muscle. In some embodiments, administration is directly to the cardiac muscle. The most suitable route in any given case wil depend on the nature and severity of the condition being treated and / or prevented and on the nature of the particular vector that is being used.Aty. Dkt. No.046192-000118WOPT

[0339] In some aspects, the technology described herein relates to methods of administration and rAAV vectors of the invention disclosed herein in a method for treating a subject with Danon disease or with aberant LAMP2B expression , comprising administering the rAAV vector to the vasculature or myocardium of the subject by intracoronary injection, preferably by injecting the rAAV vector directly into one or both coronary arteries (or grafts), whereby the expression of the transgene (e.g., encoding LAMP2B polypeptide) is expressed and blood flow and / or contractile function are improved. By way of ilustration, a rAAV vector is delivered to the heart where the protein or peptide is produced to a therapeuticaly significant degree in the myocardium continuously for sustained periods, angiogenesis can be promoted in the affected region of the myocardium. In some instances, the administration of the rAAV to a subject with Danon disease wil be by intracoronary injection, or a direct injection into the heart muscle tissue, including but not limited to the muscle of the left ventricle and / or the location of the myocardial infarct (MI). In some instances, the subject can also be administered an additional therapeutic agent to increase blood flow to the infarct region. In some embodiments, a subject in need thereof is administered with single intracoronary administration of rAAV of invention comprising LAMP2B nucleic acid sequences. In one embodiment, a subject in need thereof is administered with more than one intracoronary administration of rAAV of invention.

[0340] In some aspects of the methods and compositions disclosed herein, the subject is administered a vasodilator concurrent with and / or, before, and / or, after the administration of the at least one total dose of a rAAV vector comprising LAMP2B nucleic acid sequences. In one embodiment, the vasodilator is nitroglycerin. In some embodiments, the patients to be treated with rAAV as disclosed herein, are co-administered with nitroglycerin or nitroprusside.

[0341] In some embodiments, rAAVs can be administered with vasoactive agents or vasculature permeability agents along with vasodilators. In some embodiments, rAAVs can be administered with only vasoactive agents or vasculature permeability agents. In some embodiments, vasoactive agents and vasodilators are co administered at different times. Exemplary vasoactive agents or vasculature permeability agents can be without limitation, histamine, histamine agonist, vascular endothelial growth factor protein (VEGF protein), serotonin, bradykinin, platelet activating factor (PAF), prostaglandin E1 (PGE1), zona occludens toxin (ZOT), interleukin 2, bradykinin, other plasmakinins as described in International Publication Number WO1999040945A3; U.S. Patent Number 6,855,701, the contents of which are incorporated herein by reference in their entirety.

[0342] In some embodiments, rAAV of invention comprising LAMP2B nucleic acid sequences is administered to a subject in need thereof by intracardiac injection.

[0343] In any embodiment of the methods as disclosed herein, the rAAV vectors and / or rAAV genome are administered to the skeletal muscle, liver, diaphragm, costal, and / or cardiac muscle cels of a subject. For example, a conventional syringe and needle can be used to inject a rAAV virion suspension into a subject. Parenteral administration of a the rAAV vectors and / or rAAV genome, by injection can be performed, for example, by bolus injection or continuous infusion. Formulations forAty. Dkt. No.046192-000118WOPT injection may be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain agents for a pharmaceutical formulation, such as suspending, stabilizing and / or dispersing agents. Alternatively, the rAAV vectors and / or rAAV genome as disclosed herein can be in powder form (e.g., lyophilized) for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.

[0344] In particular embodiments, more than one administration (e.g., two, three, four, five, six, seven, eight, nine, 10, etc., or more administrations) may be employed to achieve the desired level of LAMP2B expression over a period of various intervals, e.g., hourly, daily, weekly, monthly, yearly, etc. Dosing can be single dosage or cumulative (serial dosing), and can be readily determined by one skiled in the art. As disclosed herein, it is envisioned that treatment of a subject (e.g., for Danon disease) according to the methods as disclosed herein comprises a one-time administration of an effective dose of a pharmaceutical composition comprising a AAV vector comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide.

[0345] However, in alternative embodiments, treatment of a subject with Danon disease may comprise multiple administrations of a pharmaceutical composition comprising a AAV vector comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide, described herein, wherein the multiple administrations can be carried out over a range of time periods, such as, e.g., once yearly, or every 6-months, or about every 2-years, or about every 3-years, or about every 4 years, or about every 5-years or longer than 5-year intervals. The timing of administration can vary from individual to individual, depending upon such factors as the severity of an individual's symptoms. For example, in some embodiments, an efective dose of a AAV vector as disclosed herein can be administered to an individual once every year, or once every two years, or every six months for an indefinite period of time, or until the individual no longer requires any additional Danon disease therapy. A person of ordinary skil in the art wil recognize that the condition of the individual can be monitored throughout the course of treatment and that the effective amount of a AAV vector as disclosed herein that is administered can be adjusted accordingly.

[0346] Injectables comprising a AAV vector comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide, as disclosed herein, can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, one may administer the AAV vector in a local rather than systemic manner, for example, in a depot or sustained-release formulation. Further, the virus vector and / or virus capsid can be delivered adhered to a surgicaly implantable matrix (e.g., as described in U.S. Patent Publication No. US-2004-0013645-Al). In some embodiments, the AAV vector can be administered to the lungs of a subject by any suitable means, optionaly by administering an aerosol suspension of respirable particles comprised of the virus vectors and / or virus capsids, which the subject inhales. The respirable particles can be liquid or solid. Aerosols of liquidAty. Dkt. No.046192-000118WOPT particles comprising the virus vectors and / or virus capsids may be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those of skil in the art. See, e.g., U.S. Patent No.4,501,729. Aerosols of solid particles comprising the virus vectors and / or capsids may likewise be produced with any solid particulate medicament aerosol generator, by techniques known in the pharmaceutical art.

[0347] In some embodiments, a AAV vector comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide, as disclosed herein can be formulated in a solvent, emulsion or other diluent in an amount sufficient to dissolve an rAAV vector. In other aspects of this embodiment, the rAAV vectors and / or rAAV genome encoding LAMP2B polypeptide as disclosed herein can herein may be formulated in a solvent, emulsion or a diluent in an amount of, e.g., less than about 90% (v / v), less than about 80% (v / v), less than about 70% (v / v), less than about 65% (v / v), less than about 60% (v / v), less than about 55% (v / v), less than about 50% (v / v), less than about 45% (v / v), less than about 40% (v / v), less than about 35% (v / v), less than about 30% (v / v), less than about 25% (v / v), less than about 20% (v / v), less than about 15% (v / v), less than about 10% (v / v), less than about 5% (v / v), or less than about 1% (v / v). In other aspects, the rAAV vectors and / or rAAV genome encoding a LAMP2B polypeptide as disclosed herein can disclosed herein may comprise a solvent, emulsion or other diluent in an amount in a range of, e.g., about 1% (v / v) to 90% (v / v), about 1% (v / v) to 70% (v / v), about 1% (v / v) to 60% (v / v), about 1% (v / v) to 50% (v / v), about 1% (v / v) to 40% (v / v), about 1% (v / v) to 30% (v / v), about 1% (v / v) to 20% (v / v), about 1% (v / v) to 10% (v / v), about 2% (v / v) to 50% (v / v), about 2% (v / v) to 40% (v / v), about 2% (v / v) to 30% (v / v), about 2% (v / v) to 20% (v / v), about 2% (v / v) to 10% (v / v), about 4% (v / v) to 50% (v / v), about 4% (v / v) to 40% (v / v), about 4% (v / v) to 30% (v / v), about 4% (v / v) to 20% (v / v), about 4% (v / v) to 10% (v / v), about 6% (v / v) to 50% (v / v), about 6% (v / v) to 40% (v / v), about 6% (v / v) to 30% (v / v), about 6% (v / v) to 20% (v / v), about 6% (v / v) to 10% (v / v), about 8% (v / v) to 50% (v / v), about 8% (v / v) to 40% (v / v), about 8% (v / v) to 30% (v / v), about 8% (v / v) to 20% (v / v), about 8% (v / v) to 15% (v / v), or about 8% (v / v) to 12% (v / v).

[0348] In any embodiment of the methods as disclosed herein, a AAV vector comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide, as disclosed herein, can be an AAV of any serotype, including but not limited to encapsulated by any AAV capsid descibred herein, e.g., AAV2i8.

[0349] To facilitate delivery of a AAV vector comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide, as disclosed herein, it can be mixed with a carrier or excipient. Carriers and excipients that might be used include saline (especialy sterilized, pyrogen- free saline) saline bufers (for example, citrate bufer, phosphate buffer, acetate bufer, and bicarbonate bufer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. USP grade cariers and excipients are particularly useful for delivery of virions to human subjects.Aty. Dkt. No.046192-000118WOPT

[0350] In addition to the formulations described previously, a AAV vector comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide, as disclosed herein can also be formulated as a depot preparation. Such long-acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by IM injection. Thus, for example, a rAAV vector and / or rAAV genome as disclosed herein may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives.

[0351] In any embodiment of the methods as disclosed herein, the method is directed to treating a disease or disorder, e.g., Danon disase, that results from a deficiency of LAMP2B in a subject, wherein a AAV vector comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide, as disclosed herein is administered to a patient suffering from Danon disease, and folowing administration, LAMP2B polypeptide is transduced, e.g., in cardiac muscle. In some embodiments, the AAV vector is encapsulated in a capsid, e.g., encapsulated by any AAV capsid descibred herein, e.g., AAV2i8.

[0352] In some embodiments, at least about 1.0x1009 to about 1.0x1013 vg / kg wil be administered per dose in a pharmaceuticaly acceptable carrier. In a further embodiment, dosages of the virus vector and / or capsid to be administered to a subject depend upon the mode of administration, the individual subject's condition, age and gender, and the particular virus vector or capsid, the nucleic acid encoding LAMP2B polypeptide to be delivered, and the like, and can be determined in a routine manner.

[0353] Exemplary doses for achieving therapeutic effects are AAV doses of at least about 1.5X1010 vg / kg, at least about 1.5 x 1011 vg / kg, or at least about 1.5x1012 vg / kg, at least about 4.0 x1012 vg / kg, at east 1.0 x 1013 vg / kg, at least about 3 x 1014 vg / kg; 1.0 x 1013 vg / kg, at least about 2 x 1014 vg / kg; 3.0 x 1013 vg / kg, at least about 3 x 1014 vg / kg; 1.0 x 1013 vg / kg, at least about 3 x 1013 vg / kg; 1.0 x 1013 vg / kg, at least about 2 x 1013 vg / kg; 3.0 x 1013 vg / kg, at least about 3 x 1013 vg / kg; 1.0 x 1014 vg / kg, at least about 3 x 1014 vg / kg; 1.0 x 1014 vg / kg, at least about 2 x 1014 vg / kg; and 3.0 x 1014 vg / kg, or at least about 3 x 1014 vg / kg. It is encompassed that the dose for achieving therapeutic effects as disclosed herein may also be determined by the strength of the promoter operatively linked to the nucleic acid encoding the LAMP2B polypeptide. For example, the dose of the AAV herein can be lower than about 1.6x1012 when the promoter, for example, is stronger than the muscle specific promoter, however, the dose of AAV should be titrated and determined based on the level of LAMP2B polypeptide expressed in the cel, as determined by transduction efficiency of the AAV capsid and the promoter, and the ability of the cel to expressed LAMP2B polypeptide in order to avoid LAMP2B polypeptide accumulation in the transfected cel and any associated cel toxicity.

[0354] In another aspect, disclosed herein is a method of treating Danon disease by administering a codon-optimized nucleic acid encoding a human LAMP2B polypeptide in expressible form to a cel, of a patient, comprising contacting the cel with a rAAV vector and / or rAAV genome as disclosedAty. Dkt. No.046192-000118WOPT herein, under conditions for the nucleic acid to be introduced into the cel and expressed to produce the LAMP2B polypeptide. In some embodiments, the cel is a cel in vivo. In some embodiments, the cel is a mammalian cel in vivo.

[0355] In any embodiment of the methods as disclosed herein, a AAV vector encoding a LAMP2B polypeptide as disclosed herein is useful in methods to decrease symptoms a mammal caused by Danon disease and / or insuficient LAMP2B levels.

[0356] In an embodiment, a rAAV capsid of the rAAV virion used to treat Danon disease is any of those listed in Table 1 as disclosed in International Applications WO2020 / 102645, and WO2020 / 102667, each of which are incorporated herein in their entirety. In some embodiments, treatment with the rAAV virion comprising the codon-optimized nucleic acid encoding the human LAMP2B, as disclosed herein, is capable of reducing any one or more of symptoms of in a patient suffering from Danon disease (i.e., cardiomyopathy, myopathy, intelectual disability, palpitations, or arrhymias) by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% as compared to a patient not receiving the same treatment. In other aspects of this embodiment, an AAV containing encoding LAMP2B of any serotype is capable of reducing any one or more of the symptoms in a patient suffering from Danon disease (i.e., cardiomyopathy, myopathy, intelectual disability, palpitations, or arrhymias) by, e.g., about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70% as compared to a patient not receiving the same treatment.

[0357] In any embodiment of the methods and compositions as disclosed herein, at least one symptom associated with Danon disease, or at least one adverse side efect associated with Danon disease (i.e., cardiomyopathy, myopathy, intelectual disability, palpitations, or arrhymias) are reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, and the severity of at least one symptom associated with Danon disease, or at least one adverse side efect is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In another embodiment, at least one symptom associated with Danon disease, or at least one adverse side effect associated with Danon disease (i.e., cardiomyopathy, myopathy,Aty. Dkt. No.046192-000118WOPT intelectual disability, palpitations, or arhymias) is reduced by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%. Methods of Administration

[0358] Accordingly, in one embodiment, the technology relates to a method of treating Danon disease in a subject, comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome, a heterologous codon- optimized nucleic acid sequence encoding an LAMP2B polypeptide in expressible form wherein the heterologous nucleic acid is operatively linked to a promoter (e.g., a muscle specific promoter), in the absence or presence of administration of an additional anti-Danon disease therapy. In some embodiments, the dosage of the recombinant AAV ranges from 1.0E8 vg / kg to 5.0E14 vg / kg, 1.0E9 vg / kg to 5.0E12vg / kg, and al ranges in between, and in some embodiments, the LAMP2B is expressed to a level that the subject has a level of LAMP2B expressed by the AAV at a pharmaceutical activity range from at least 25% to about 150% of normal, or at least 50% to about 150% of normal, e.g., at least within two weeks of administration.

[0359] In some embodiments, the LAMP2B is expressed to a level that the subject has a level of LAMP2B expressed by the AAV at a pharmaceutical activity range from at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, or 149% of normal, e.g., at least within 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 29 weeks or more of administration. In one embodiment, the LAMP2B is expressed to a level that the subject has a level of LAMP2B expressed by the AAV at a pharmaceutical activity no more than 150%, e.g., at least within two weeks of administration.

[0360] In some embodiments, the LAMP2B is expressed to a level that the subject has a level ofAty. Dkt. No.046192-000118WOPT LAMP2B expressed by the AAV at a pharmaceutical activity range from at least 15-140%, 55-150%, 60-150%, 65-150%, 70-150%, 75-150%, 80-150%, 85-150%, 90-150%, 95-150%, 100-150%, 105- 150%, 110-150%, 115-150%, 120-150%, 125-150%, 130-150%, 135-150%, 140-150%, 145-150%, 50-145%, 50-140%, 50-135%, 50-130%, 50-125%, 50-120%, 50-115%, 50-110%, 50-105%, 50- 100%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, 60-140%, 70-130%, 80-120%, 90-110%, 100-110% of normal activity, e.g., at least within two weeks of administration. Pharamceutial activity can be assessed, e.g., by measuring protein, DNA or RNA levels, or assessing for the localization of lysosomes in biopsy samples.

[0361] In some embodiments, the dosage of the AAV ranges from 1.0E9 vg / kg to 5.0E12vg / kg. In some embodiments, the dosage of the AAV is no more than 4.0E13 vg / kg. In some embodiments, the dosage ranges from 1.0E8 vg / kg to 1.0E12vg / kg.

[0362] In some embodiments, the dosage of AAV containing the codon-optimized nucleic acid encoding the LAMP2B polypeptide is no more than 5.0E12vg / kg. In some embodiments, the dosages range from 1.0E9 vg / kg to 5.0E12vg / kg.

[0363] In some embodiments of the invention, the total dosage of AAV containing the codon- optimized nucleic acid encoding the LAMP2B polypeptide to treat a subject in need thereof is about e12vg, about 5e12 vg, about e13vg, about 3e13 vg, about 3.25e13 vg, about 5e13 vg, about 6e13vg, about 6.5e13vg, about e14vg, about 1.08e14vg, about 2e14vg, about 3e14vg, about 3.5e14vg, or about 4e14vg.

[0364] In particular, the technology described herein relates to the discovery that a single infusion of a rAAV vector containing the codon-optimized nucleic acid encoding the LAMP2B polypeptide can be a stand-alone therapeutic. In one embodiment, a one-time administration of the AAV leads to long-term transduction of the LAMP2B polypeptide into muscle cels, e.g., skeletal or cardiac cels and continuous constitutive expression of LAMP2B polypeptide in the systemic circulation or in the tissue of interest, e.g., heart.

[0365] In one embodiment, described herein is a method of treating Danon disase in a subject in need thereof by administering the subject a composition comprising a AAV vector containing the codon-optimized nucleic acid encoding the LAMP2B polypeptide, where the subject is not being concurrently administered any additional Danon disease therapies. In some embodiments, the technology relates to a method of administering the AAV where the subject has not been administrered any additional -Danon disease therapies for an extended period of time, e.g., at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 1½ years and points in between 6 months or longer. In some embodiments, the subject has not been administered an additional Danon disease therapy on the day of, or shortly before administration of the AAV. In some embodiment, the subject receiving the Danon treatment of the invention is concurrently undergoing or had previously been under standard of care therapies available, e.g., to stabilize muscle and or heart function.

[0366] In one embodiment, described herein is a method of treating Danon disease in a subject in need thereof by administering the subject a composition comprising a AAV vector comprising theAty. Dkt. No.046192-000118WOPT codon-optimized nucleic acid encoding the LAMP2B polypeptide, where the subject is concurently administered at least one additional Danon disease therapies. In some embodiments, the technology relates to a method of administering the AAV where the subject has been administrered at least one additional -Danon disease therapies for an extended period of time, e.g., at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 1½ years and points in between 6 months or longer. In some embodiments, the subject has been administered at least one additional Danon disease therapy on the day of, or shortly before administration of the AAV.

[0367] Subjects administered a AAV encoding the codon-optimized nucleic acid encoding the LAMP2B polypeptide according to the methods and dose ranges as disclosed herein, can exhibit a minimal immune response to the LAMP2B protein expressed by the AAV. According, in some embodiments, there is minimal, or no need for immune modulation or administration of immune suppressants at the time of, or before, or after the administration of the AAV to the subject, and therefore normal immune suppressants protocols which are typicaly administered when a subject is administered a viral vector, or undergoing gene therapy are not required.

[0368] In certain aspects, the AAV that comprise a nucleotide sequence containing inverted terminal repeats (ITRs), an intron, a promoter, a heterologous gene, a poly-A tail and potentialy other regulator elements for use to treat a at least one, wherein the heterologous gene is the codon- optimized nucleic acid encoding the LAMP2B polypeptide, and wherein the vector, e.g., rAAV can be administered to a patient in a therapeuticaly effective dose that is delivered to the appropriate tissue and / or organ for expression of the LAMP2B polypeptide and treatment of the disease, e.g., at least one.

[0369] In some embodiments, the method to treat at least one with rAAV comprising the heterologous codon-optimized nucleic acid encoding a human LAMP2B polypeptide, as disclosed herein comprises administration of a therapeuticaly efective amount of a rAAV disclosed herein to result in a level of the expressed LAMP2B polypeptide e.g., in a tissue sample.

[0370] In various embodiments, eficacy of any of the therapeutics of methods of treatment described herein is assessed by at least one endpoint. Endpoints are assessments used to determine if the therapeutic or method of treatment described herein were effecious in treating the disease (e.g., Danon disease), preventing onset of the disease, or preventing or slowing progression of the disease. Examplary endpoints include, but are not limited to, change in cardiac wal thickness (e.g., as assessed by either echocardiography or cardiac MRI), change in left ventricle mass, change in left ventricle wal thickness, LVEF, ECG findings (e.g., Atrial fibrilation / fluter, AV block, or Wolf- Parkinson-White), Holter recording results (if available, including heart rate, occurrence of atrial fibrilation / fluter, occurence of ventricular or supraventricular ectopy, or AV block), ICD findings, occurance of Heart transplantation, occurance of cardiac device implantation (e.g., ICD, CRT-D, pacemaker), NYHA class determination, time since Danon Disease diagnosis, changes in blood tests (e.g., BNP, NT-proBNP, Troponin, CK-MB, LFTs (e.g., ALT, AST, bilirubin), or LDH), occurrenceAty. Dkt. No.046192-000118WOPT and severity of extracardiac manifestations of Danon Disease (including, e.g., Cognitive impairment, Retinal involvement, Pulmonary disease, Myopathy), changes in treatment before and after diagnosis, occurence of hospitalization for heart failure, occurrence of hospitalization for arrhythmias or palpitations, occurrence of hospitalization for device implantation or revision, or death.

[0371] In one embodiment, an endpoint is assessed at least once post-administration of the therapeutic, e.g, rAAV comprising Lamp2B nucleic acid of the invention. In one embodiment, an endpoint is assessed at least once per day, at least once per week, at least per month, at least once in months, at least once in 6 months, and / or at least one year post-administration. Endpoints can be assessed at any given interval folowing adminstration, e.g., at 3 months, 6 months, 9 months, and 12 months post-administration, or at 2 months, 4 months, 6 months, 8 months, and 12 months post- administration, or at 6 months and 12 months post-administration, or at 4 months, 8 months, and 12 months post-administration. In one embodiment, an endpoint is assessed at at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, and 12 months post-administration.

[0372] In one embodiment, cardiac wal thickness is stabilized or improved post-administration of the rAAV comprising Lamp2B of the invention. As used herein, “stabilized” cardiac wal thickness is indicative of a cardic wal thinkness that has remained unchanged as compared to the cardiac wal thickness at or prior to administration. In one embodiment, cardiac wal thickness is improved post- administration by at least 5% as compared to the cardiac wal thickness at or prior to administration. In one embodiment, cardiac wal thickness is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the cardiac wal thickness at or prior to administration.Aty. Dkt. No.046192-000118WOPT

[0373] In one embodiment, left ventricle mass is stabilized or improved post-administration of the therapeutic, e.g., rAAV comprising Lamp2B nucleic acid of the invention. As used herein, “stabilized” left ventricle mass is indicative of a left ventricle mass that has remained unchanged as compared to the left ventricle mass at or prior to administration. In one embodiment, left ventricle mass is improved post-administration by at least 5% as compared to the left ventricle mass at or prior to administration. In one embodiment, left ventricle mass is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more as compared to the left ventricle mass at or prior to administration.

[0374] In one embodiment, LVMI is decreased post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. In one embodiment, LVMI is stabilized post-administration of the rAAV of the invention. As used herein, “stabilized” LVMI is indicative of a LVMI that has remained unchanged as compared to the LVMI at or prior to administration. In one embodiment, LVMI is decreased post-administration by at least 10% as compared to the LVMI at or prior to administration. In one embodiment, LVMI is decreased post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, atAty. Dkt. No.046192-000118WOPT least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more as compared to the LVMI at or prior to administration.

[0375] In one embodiment, myocardial Lamp2B expression is stabilized or improved post- administration of the rAAV of the invention comprisin Lamp2B nucleic acids as discussed herein. As used herein, “stabilized” myocardial Lamp2B expression is indicative of a myocardial Lamp2B expression that has remained unchanged as compared to the left myocardial Lamp2B expression at or prior to administration. In one embodiment, myocardial Lamp2B expression is improved post- administration by at least 5% as compared to the myocardial Lamp2B expression at or prior to administration. In one embodiment, myocardial Lamp2B expression is improved post-administration by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the myocardial Lamp2B expression at or prior to administration.

[0376] In one embodiment, left ventricle wal thickness is stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” left ventricle wal thickness is indicative of a left ventricle wal thickness that has remained unchanged as compared to the left ventricle wal thickness at or prior to administration. In one embodiment, left ventricle wal thickness is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 5% as compared to the left ventricle wal thickness at or prior to administration. In one embodiment, left ventricle wal thickness is improved post-administration by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, atAty. Dkt. No.046192-000118WOPT least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the left ventricle wal thickness at or prior to administration.

[0377] In one embodiment, LVEF is stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” LVEF is indicative of a LVEF that has remained unchanged as compared to the LVEF at or prior to administration. In one embodiment, LVEF is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 5% as compared to the LVEF at or prior to administration. In one embodiment, LVEF is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the LVEF at or prior to administration.Aty. Dkt. No.046192-000118WOPT

[0378] In one embodiment, ECG findings are stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” ECG findings are indicative of a ECG findings are that has remained unchanged as compared to the ECG findings at or prior to administration. In one embodiment, ECG findings are improved post-administration by at least 5% as compared to the ECG findings at or prior to administration. In one embodiment, ECG findings are improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the ECG findings at or prior to administration.

[0379] In one embodiment, Holter recording results are stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” Holter recording results are indicative of a Holter recording results that has remained unchanged as compared to the Holter recording results at or prior to administration. In one embodiment, Holter recording results are improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 5% as compared to the Holter recording results at or prior to administration. In one embodiment, Holter recording results are improved post-administration by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, atAty. Dkt. No.046192-000118WOPT least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the Holter recording results at or prior to administration.

[0380] In one embodiment, ICD findings are stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” ICD findings are indicative of a ICD findings that has remained unchanged as compared to the ICD findings at or prior to administration. In one embodiment, ICD findings are improved post-administration by at least 5% as compared to the ICD findings at or prior to administration. In one embodiment, ICD findings are improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the ICD findings at or prior to administration.

[0381] In one embodiment, NYHA class determination is stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” NYHA class determination is indicative of a NYHA class determination that has remained unchanged as compared to the NYHA class determination at or prior to administration. In one embodiment, NYHA class determination is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 5% as compared to the NYHA class determination at or prior to administration. In one embodiment, NYHA class determination is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %,Aty. Dkt. No.046192-000118WOPT at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the NYHA class determination at or prior to administration. In some embodiments, NYHA class is improved by at least 1 class, e.g, by 2, or, 3 class. Non limiting examples include the treatment as described herein causes improvement from NYHA class IV to class II, or, to class I or, to classI. In other examples, the treatment causes improvement from NYHA class II to class I, or to class I. In yet other examples, treatment causes improvement from NYHA class I to class I.

[0382] In one embodiment, blood test readouts (e.g., BNP, NT-proBNP, Troponin, CK-MB, LFTs (e.g., ALT, AST, bilirubin), or LDH) are stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” blood test readouts are indicative of a blood test readouts that has remained unchanged as compared to the blood test readouts at or prior to administration. In one embodiment, blood test readouts are improved post- administration by at least 5% as compared to the blood test readouts at or prior to administration. In one embodiment, blood test readouts are improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, atAty. Dkt. No.046192-000118WOPT least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the blood test readouts at or prior to administration.

[0383] In one embodiment, occurrence and severity of extracardiac manifestations of Danon Disease is stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” occurrence and severity of extracardiac manifestations of Danon Disease is indicative of a occurrence and severity of extracardiac manifestations of Danon Disease that has remained unchanged as compared to the occurrence and severity of extracardiac manifestations of Danon Disease at or prior to administration. In one embodiment, occurence and severity of extracardiac manifestations of Danon Disease is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 5% as compared to the occurence and severity of extracardiac manifestations of Danon Disease at or prior to administration. In one embodiment, occurrence and severity of extracardiac manifestations of Danon Disease is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the occurence and severity of extracardiac manifestations of Danon Disease at or prior to administration.

[0384] In one embodiment, retinal involvement is stabilized or improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” retinal involvement is indicative of a retinal involvement that has remained unchanged as compared to the retinal involvement at or prior to administration. In one embodiment, retinal involvement is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 5% as compared to the retinal involvement at or prior to administration. In one embodiment, retinalAty. Dkt. No.046192-000118WOPT involvement is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or more as compared to the retinal involvement at or prior to administration.

[0385] In one embodiment, the subjects’ required treatment is stabilized or improved post- administration of the rAAV comprising Lamp2B nucleic acids of the invention. As used herein, “stabilized” sujbects’ required treatment is indicative of a subjects’ required treatment that has remained unchanged as compared to the sujbects’ required treatment at or prior to administration. In one embodiment, subjects’ required treatment is improved post-administration by at least 5% as compared to the sujbects’ required treatment at or prior to administration. In one embodiment, subjects’ required treatment is improved post-administration of the rAAV comprising Lamp2B nucleic acids of the invention by at least 1 %, at least 2 %, at least 3 %, at least 4 %, at least 5 %, at least 6 %, at least 7 %, at least 8 %, at least 9 %, at least 10 %, at least 11 %, at least 12 %, at least 13 %, at least 14 %, at least 15 %, at least 16 %, at least 17 %, at least 18 %, at least 19 %, at least 20 %, at least 21 %, at least 22 %, at least 23 %, at least 24 %, at least 25 %, at least 26 %, at least 27 %, at least 28 %, at least 29 %, at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40 %, at least 41 %, at least 42 %, at least 43 %, at least 44 %, at least 45 %, at least 46 %, at least 47 %, at least 48 %, at least 49 %, at least 50 %, at least 51 %, at least 52 %, at least 53 %, at least 54 %, at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69 %, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, atAty. Dkt. No.046192-000118WOPT least 98 %, at least 99 % or more, or at least 1x, 2x, 3x, 4x, 5x or more as compared to the subjects’ required treatment at or prior to administration.

[0386] In one embodiment, the subject does not undergo a heart transplant post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. In one embodiment, the subject does not undergo a heart transplant at least 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or longer post-administration.

[0387] In one embodiment, the subject does not undergo a cardiac device implantation post- administration of the rAAV comprising Lamp2B nucleic acids of the invention. In one embodiment, the subject does not undergo a cardiac device implantation at least 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or longer post- administration.

[0388] In one embodiment, the subject is not hospitalized for heart failure post-administration of the rAAV comprising Lamp2B nucleic acids of the invention. In one embodiment, the subject is not hospitalized for heart failure at least 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or longer post-administration.

[0389] In one embodiment, the subject is not hospitalized for arrhythmias or palpitations post- administration of the rAAV comprising Lamp2B nucleic acids of the invention. In one embodiment, the subject is not hospitalized for arrhythmias or palpitations at least 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or longer post- administration.

[0390] In one embodiment, the subject is not hospitalized for device implantation or revision post- administration of the rAAV comprising Lamp2B nucleic acids of the invention. In one embodiment, the subject is not hospitalized for device implantation or revision at least 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or longer post-administration.

[0391] In one embodiment, improvement is seen in at least two of these endpoints. In one embodiment, improvement is seen in at least three of these endpoints, in at least four of these endpoints, in at least five of these endpoints, in at least six of these endpoints, in at least seven of these endpoints, or more. AAV- LAMP2B Dosages

[0392] In some embodiments, the methods disclosed herein relate to human subjects can be administered a rAAV containing the codon-optimized nucleic acid encoding the LAMP2B polypeptide as disclosed herein at a dose in the range of 1.0E8 vg / kg to 5.0E14 vg / kg, 1.0E9 vg / kg to 5.0E12vg / kg. In some embodiments, the methods disclosed herein relate to human subjects can be administered a rAAV containing the codon-optimized nucleic acid encoding the LAMP2B polypeptide as disclosed herein at a dose in the range of 3.0E13 vg / kg to 3.0E14vg / kg. In someAty. Dkt. No.046192-000118WOPT embodiments, the dosage is lower than 1.0E8 vg / kg to 3.0E13vg / kg. In one embodiment, there can be a therapeutic correction of disease pathophysiology with administration of the rAAV, as disclosed herein and also protection against immune response to the expressed LAMP2B polypeptide e.g, as measured by the antibodies against the expressed LAMP2B polypeptide.

[0393] In some embodiments the dose of the a rAAV vector or rAAV genome to be administered to the subject according to the method to treat Danon disase as disclosed herein depends upon the mode of administration, the promoter used, the severity of the disease or other condition to be treated and / or prevented, the individual subject's condition, the particular virus vector or capsid, the promoter being used and the nucleic acid to be delivered, including but not limited to, nucleic acid encoding the signal peptide atached to the 5’ of the nucleic acid encoding expressible LAMP2B polypeptide, and the like, and can be determined in a routine manner.

[0394] In some embodiments, the dose of the rAAV vector comprising the codon-optimized nucleic acid encoding a human LAMP2B polypeptide, is a therapeuticaly efective amount to increase the level of LAMP2B polypeptide levels in the subject to therapeutic levels. In some embodiments, the dose of the rAAV vector is a therapeuticaly effective amount to increase LAMP2B polypeptide in the subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the native active form of LAMP2B content. Female subjects produce a native form of LAMP2B. In contrast, male subjects do not produce a native for of LAMP2B. Thus, in one embodiment, wherein the subject is a male, the native active form of LAMP2B content is zero. In some embodiments, the dose of the rAAV vector is a therapeuticaly efective amount to increase LAMP2B polypeptide content in the subject more than 2-fold, or 3-fold, or 4-fold, or 5-fold, or 6-fold, or 7-fold, or 8-fold, or 9-fold, or 10-fold, or more than 10-fold of the level of LAMP2B content in the subject with Danon disease. In some embodiments, the dose of the rAAV vector is a therapeuticaly effective amount to increase LAMP2B polypeptide content in the subject to about 50%, or about 40%, or about 30%, or about 20%, or about 10%, or about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2% or about 1% of the level of LAMP2B in a healthy subject. In some embodiments, the LAMP2B polypeptide activity is at least 1.5 fold, at least 2 fold, at least 3 fold, at least 5 fold, at least 8 fold, or at least 10 fold than the level prior to AAV administration.

[0395] In some embodiments, the dose of the rAAV vector comprising the codon-optimized nucleic acid encoding a human LAMP2B polypeptide is a therapeuticaly effective amount of rAAV vector to exhibit an improvement in the therapeutic index of 3- to 5-fold. In some embodiments, the dose of the rAAV vector is a therapeuticaly efective amount to result in the subject having clinicaly stable levels of LAMP2B polypeptide at 10-weeks, or at least 20 weeks, or 30 weeks post rAAV administration.

[0396] In some embodiments, the dose of the rAAV vector comprising the codon-optimized nucleic acid encoding a human LAMP2B polypeptide wil be therapeuticaly effective in at least 5% of tissue penetrance. In some embodiments, the dose of the rAAV vector comprising the codon-optimizedAty. Dkt. No.046192-000118WOPT nucleic acid encoding a human LAMP2B polypeptide wil be therapeuticaly efective in at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more of tissue penetrance.

[0397] In an embodiment, as used herein, without limitation, the term “effective amount” is synonymous with “therapeuticaly effective amount”, “efective dose”, or “therapeuticaly efective dose.” In an embodiment, the efectiveness of a therapeutic compound disclosed herein to treat Danon disease can be determined, without limitation, by observing an improvement in an individual based upon one or more clinical symptoms, and / or physiological indicators associated with Danon disease.

[0398] In some embodiments, exemplary doses for achieving therapeutic effects of a rAAV comprising the codon-optimized nucleic acid encoding a human LAMP2B polypeptide as disclosed herein is within the range of 1.0E8 vg / kg to 5.0E12vg / kg. In some embodiments, the dose administered to a subject is at least about 1.0E8 vg / kg, at least about 1.0E9 vg / kg, at least about 1.0E10 vg / kg, at least about 1.0E11 vg / kg, at least about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 3.0E12 vg / kg, about 4.0E12 vg / kg, about 5.0E12 vg / kg, about 6.0E12 vg / kg, about 7.0E12 vg / kg, about 8.0E12 vg / kg, about 9.0E12 vg / kg, about 1.0E12 vg / kg, about 1.2E12 vg / kg, about 1.2E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 3.0E12 vg / kg, about 4.0E12 vg / kg, about 5.0E12 vg / kg.

[0399] In preferred embodiments, exemplary doses for achieving therapeutic effects according to the methods as disclosed herein are titers of at between 1.2E12 and 4.0E12 vg / kg, for example, least about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 2.1E12 vg / kg, about 2.2E12 vg / kg, about 2.3E12 vg / kg, about 2.4E12 vg / kg, about 2.5E12 vg / kg, about 2.6E12 vg / kg, about 2.7E12 vg / kg, about 2.8E12 vg / kg, about 2.9E12 vg / kg, about 3.0E12 vg / kg, about 3.1E12 vg / kg, about 3.2E12 vg / kg, about 3.3E12 vg / kg, about 3.4E12 vg / kg, about 3.5E12 vg / kg, about 3.6E12 vg / kg, about 3.7E12 vg / kg, about 3.8E12 vg / kg, about 3.9E12 vg / kg, about 4.0E12 vg / kg.

[0400] In some embodiments, a rAAV vector comprising the codon-optimized nucleic acid encoding a human LAMP2B polypeptide as disclosed herein useful for the methods to treat Danon disease, exemplary doses for achieving therapeutic effects are titers of at least about 1.0E12 to 4.0E12 vg / kg, or about 1.2E12 to 3.0E12 vg / kg, or about 1.2E12 to 2.5E12 vg / kg, or about 2.5E12 to 4.0E12 vg / kg.

[0401] In some embodiments, the dosage may be modified by a person of ordinary skil in the art, e.g., the dose administered can be lower than 1.0E12 vg / kg, or lower than about 5.0E12 vg / kg where a stronger promoter is operatively linked to the nucleic acid encoding LAMP2B polypeptide. In contrast, in alternative embodiments, the dosage may be modified by a person of ordinary skil in theAty. Dkt. No.046192-000118WOPT art, e.g., the dose of the rAAV vector administered can be higher than about 1.6E12 vg / kg, or higher than about 5.0E12 vg / kg when a weaker promoter used in the vector is operatively linked to the nucleic acid encoding the LAMP2B polypeptide. Exemplary doses for achieving therapeutic efects are titers of at least about 1.0E51.0E61.0E71.0E81.0E91.0E10, 1.0E111.0E12 vg / kg, optionaly a 10 , , , , , , bout 1.0E to about 1.0E12 transducing units (vg / kg), and optionaly does not exceed about 4.0E12 vg or optionaly is about 3.0E12 transducing units (vg).

[0402] In some prefered embodiments of the invention, the total dosage of AAV containing the codon-optimized nucleic acid encoding the LAMP2B polypeptide to treat a subject in need thereof is about e12vg, about 5e12 vg, about e13vg, about 3e13 vg, about 3.25e13 vg, about 5e13 vg, about 6e13vg, about 6.5e13vg, about e14vg, about 1.08e14vg, about 2e14vg, about 3e14vg, about 3.5e14vg, or about4e14vg.

[0403] In a further embodiment, administration of rAAV vector or rAAV genome according to the methods as disclosed herein to treat a subject with Danon disease can result in production of a LAMP2B polypeptide with a circulatory half-life of 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, one month, two months, three months, four months or more.

[0404] In some embodiments, the methods for treatment of Danon disease as disclosed herein relate to a single dose of a rAAV comprising the codon-optimized nucleic acid encoding a human LAMP2B polypeptide is used to treat a subject in a single administration. However, in some embodiments, the dose of rAAV to be administered can be given to the subject in multiple administrations, e.g., a dose of rAAV can be divided into sub-doses and administered in multiple administrations.

[0405] In some embodiments, it is envisioned that the methods for treatment of Danon disease as disclosed herein can comprise multiple administrations of a single dose of a rAAV comprising the codon-optimized nucleic acid encoding a human LAMP2B polypeptide, that is, the subject can be treated with a booster administration (i.e., a second, third, fourth, etc.) of the rAAV after a defined period of time after the initial or first administration. The dose of a booster administration (i.e., 2nd, 3rd, 4th, or 5th etc.) can be the same dose (amount) of rAAV administered in the first administration, or can be a higher dose, or a lower dose, depending on the factors above, including, but not limited to, a therapeuticaly efective dose to achieve any one or more of (i) LAMP2B polypeptide levels indicating steady state of LAMP2B polypeptide expression and (i) substantial reduction in one or more Danon disease symptoms, including, without limitation weakening of heart muscle or skeletal muscle, inteluctual disability, heart palpitations, or arrhymia.

[0406] In other embodiments, the total dose of rAAV comprising the Lamp2b nucleic acids of the invention is subdivided in two or more subdoses and are administered to the subject at the same time or subsequently one after another over a period of time, e.g., over a period of about 2 minutes, about 5Aty. Dkt. No.046192-000118WOPT minutes, about 8 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, or over a longer period of time. As disclosed herein, a steady state of LAMP2B polypeptide expression by the rAAV as disclosed herein is a level of LAMP2B polypeptide thatprovides a therapeutic effect. Stability of one or more symptoms of Danon disease can be determined by the clinical stability of one or more parameters or endpoints as disclosed herein.

[0407] In an embodiment, the time period of between administration of a first dose, and a subsequent dose (i.e., a booster dose) of a rAAV vector according to the methods for treatment of Danon disease as disclosed herein is selected from any of the folowing: about 4 months, about 6 months, about 7 months, about 8 months, about 9 months, about 12 months, about 18 months, about 24 months, or about 3 years, about 4 years, about 5 years, or more than 5 years. Immune suppression

[0408] In another aspect, the technology relates to methods to treat Danon disease by administering a rAAV vector containing a codon-optimised nucleic acid encoding a human LAMP2B polypeptide as disclosed herein, where the administration of a composition comprising a AAV vector is administered to the subject without ongoing immune suppression. That is, in some embodiments, immune suppression is not administered to the subject long term.

[0409] In some embodiments, an immune suppressant or immune modulator is administered to the subject intermitently, or for a transient period, e.g., as an immune prophylaxis to the subject to prevent or reduce any immune response to the administered AAV vector, therefore alowing, if necessary, a subsequent or booster administration of the AAV vector according to the methods as disclosed herein.

[0410] In some embodiments, an immune modulator is administered for an initial period at, or around the time the rAAV vector containing a codon-optimised nucleic acid encoding a human LAMP2B polypeptide as disclosed herein, is administered to the subject. For example, an immune modulator is administered starting at about 24 hrs before the rAAV vector is administered to the subject. In some embodiments, an immune modulator is administered starting at about 24hrs before the rAAV administration and is administered for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week, or for longer than 1 week after administration of the rAAV vector. In some embodiments, an immune modulator is administered starting at, or about 24 hrs before rAAV administration and is administered for no more than 1 day, or 2 days, 3 days, or 4 days, or 5 days, or 6 days, or for 1 week, or for 2 weeks, or for 3 weeks or for 1 month after administration of the rAAV.

[0411] In some embodiments, an immune modulator is administered to the subject at tapering lower doses, e.g., at a first dose for a first period of time, at a second lower dose for a second period of time, and third dose that is lower than the second dose – for a third period of time, and so forth until no immune response to the AAV or the LAMP2B polypeptide is produced. For example, in someAty. Dkt. No.046192-000118WOPT embodiments, the first dose of an immune modulator is started at, or about 24hrs before rAAV administration and is administered for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week, or about 2 weeks, or about 3 weeks, or about 4 weeks, after which the immune modulator is reduced to a third dose (which is lower than the second dose) for a third period of time (e.g., for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week).

[0412] For exemplary purposes only, in some embodiments, the methods to treat Danon disease is disclosed herein comprise administering prednisone as an immune suppressant, i.e., immune prophylaxis, at a first dose of 60 miligrams (given oraly) starting 24 hours prior to rAAV vector administration. In some embodiments, prednisone is continued at 60 mg / day po through the completion of week four after vector administration, after which, at the beginning of week 5 the prednisone dose is tapered to a second dose level of 55 mg / day po and maintained for 7 days. In some embodiments, at the beginning of week 6 the dose is tapered to a third dose level of 50 mg / day po and maintained for 7 days etc., so that the dose of the immune suppressant (i.e., prednisone) is tapered on a weekly basis by 5 mg / day, after an initial immune suppressant dose for 4 weeks.

[0413] The use of prednisone is exemplified herein as an immune suppressant for immune prophylaxis according to the methods as disclosed herein. However, it is envisioned that prednisone can be readily substituted with a different immune modulator and administration regimen known by a person of ordinary skil in the art.

[0414] In some embodiments, normal immune prophylaxis for preventing immune reactivity to the rAAV or the expressed LAMP2B polypeptide is stopped, or withdrawn on day 1, or shortly before or after administration of the rAAV according to the methods as disclosed herein. Immune Modulation and Immunosuppression:

[0415] As disclosed herein, in some embodiments, the methods to treat Danon disease by administering a rAAV containing a codon-optimized nucleic acid encoding a human LAMP2B polypeptide as disclosed herein, to the subject without ongoing immune suppression. That is, in some embodiments, immune suppression is not administered to the subject long term and is only administered for a short and pre-defined period, including an initial period (with an initial dose) and a tapering period (with incremental tapering doses) after the administration of the AAV vector to the subject. Accordingly, in some embodiments, the immune suppression is administered for between 4 weeks to up to about 15 weeks after the administration of the AAV vector to the subject and can be administered in an initial and tapering doses as disclosed herein.

[0416] Accordingly, in some embodiments, the methods and compositions using the AAV vectors and AAV genomes as described herein, for treating Danon disease, further comprises administering an immune modulator for an initial period folowed by a tapering period. In some embodiments, theAty. Dkt. No.046192-000118WOPT immune modulator can be administered at the time of rAAV vector administration, before rAAV vector administration or after the rAAV vector administration.

[0417] In any embodiment of the methods and compositions as disclosed herein, a subject being administered a rAAV vector or rAAV genome as disclosed herein is also administered an immunosuppressive agent. Various methods are known to result in the immunosuppression of an immune response of a patient being administered AAV. Methods known in the art include administering to the patient an immunosuppressive agent, such as a proteasome inhibitor. One such proteasome inhibitor known in the art, for instance as disclosed in U.S. Patent No.9,169,492 and U.S. Patent Application No.15 / 796,137, both of which are incorporated herein by reference, is bortezomib. In another embodiment, an immunosuppressive agent can be an antibody, including polyclonal, monoclonal, scfv or other antibody derived molecule that is capable of suppressing the immune response, for instance, through the elimination or suppression of antibody producing cels. In a further embodiment, the immunosuppressive element can be a short hairpin RNA (shRNA). In such an embodiment, the coding region of the shRNA is included in the rAAV cassete and is generaly located downstream, 3’ of the poly-A tail. The shRNA can be targeted to reduce or eliminate expression of immunostimulatory agents, such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF and others that are publicly known).

[0418] In some embodiments, the immune modulator is an immunoglobulin degrading enzyme such as IdeS, IdeZ, IdeS / Z, Endo S, or their functional variant. Non-limiting examples of references of such immunoglobulin degrading enzymes and their uses as described in US 7,666,582, US 8,133,483, US 20180037962, US 20180023070, US 20170209550, US 8,889,128, WO2010 / 057626, US 9,707,279, US 8,323,908, US 20190345533, US 20190262434, and WO2020 / 016318, each of which are incorporated in their entirety by reference.

[0419] In some embodiments, the immune modulator or immunosuppressive agent is a proteasome inhibitor. In certain aspects, the proteasome inhibitor is Bortezomib. In some aspects of the embodiment, the immune modulator comprises bortezomib and anti CD20 antibody, Rituximab. In other aspects of the embodiment, the immune modulator comprises bortezomib, Rituximab, methotrexate, and intravenous gamma globulin. Non-limiting examples of such references, disclosing proteasome inhibitors and their combination with Rituximab, methotrexate and intravenous gamma globulin, as described in US 10,028,993, US 9,592,247, and US 8,809,282, each of which are incorporated in their entirety by reference. One such proteasome inhibitor known in the art, for instance as disclosed in U.S. Patent No.9,169,492 and U.S. Patent Application No.15 / 796,137, both of which are incorporated herein by reference, is bortezomib.

[0420] In another embodiment, an immunosuppressive agent can be an antibody, including polyclonal, monoclonal, scfv or other antibody derived molecule that is capable of suppressing the immune response, for instance, through the elimination or suppression of antibody producing cels. In a further embodiment, the immunosuppressive element can be a short hairpin RNA (shRNA). In suchAty. Dkt. No.046192-000118WOPT an embodiment, the coding region of the shRNA is included in the rAAV cassete and is generaly located downstream, 3’ of the poly-A tail. The shRNA can be targeted to reduce or eliminate expression of immunostimulatory agents, such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF and others that are publicly known).

[0421] In alternative embodiments, the immune modulator is an inhibitor of the NF-kB pathway. In certain aspects of the embodiment, the immune modulator is Rapamycin, or a functional variant. Non- limiting examples of references disclosing rapamycin and its use described in US 10,071,114, US 20160067228, US 20160074531, US 20160074532, US 20190076458, US 10,046,064, are incorporated in their entirety. In other aspects of the embodiment, the immune modulator is synthetic nanocarriers comprising an immunosuppressant. Non limiting examples of references of immunosuppresants, immunosuppressants coupled to synthetic nanocarriers, synthetic nanocarriers comprising rapamycin, and / or, toloregenic synthetic nanocariers, their doses, administration and use as described in US20150320728, US 20180193482, US 20190142974, US 20150328333, US20160243253, US 10,039,822, US 20190076522, US 20160022650, US 10,441,651, US 10,420,835, US 20150320870, US 2014035636, US 10,434,088, US 10,335,395, US 20200069659, US 10,357,483, US 20140335186, US 10,668,053, US 10,357,482, US 20160128986, US 20160128987, US 20200038462, US 20200038463, each of which are incorporated in their entirety by reference.

[0422] In some embodiments, the immune modulator is synthetic nanocariers comprising rapamycin (ImmTOR™ nanoparticles) (Kishimoto, et al., 2016, Nat Nanotechnol, 11(10): 890-899; Maldonado, et al., 2015, PNAS, 112(2): E156-165), as disclosed in US20200038463, US Patent 9,006,254 each of which is incorporated herein in its entirety. In some embodiments, the immune modulator is an engineered cel, e.g., an immune cel that has been modified using SQZ technology as disclosed in WO2017192786, which is incorporated herein in its entirety by reference.

[0423] In some embodiments, the immune modulator is selected from the group consisting of poly- ICLC, 1018 ISS, aluminum salts, Amplivax, AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, vector system, PLGA microparticles, resiquimod, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, and Aquila's QS21 stimulon. In another further embodiment, the immunomodulator or adjuvant is poly-ICLC.

[0424] In some embodiments, the immune modulator is a smal molecule that inhibit the innate immune response in cels, such as chloroquine (a TLR signaling inhibitor) and 2-aminopurine (a PKR inhibitor), can also be administered in combination with the composition comprising at least one rAAV as disclosed herein. Some non-limiting examples of commercialy available TLR-signaling inhibitors include BX795, chloroquine, CLI-095, OxPAPC, polymyxin B, and rapamycin (alAty. Dkt. No.046192-000118WOPT available for purchase from INVIVOGEN™). In addition, inhibitors of patern recognition receptors (PRR) (which are involved in innate immunity signaling) such as 2-aminopurine, BX795, chloroquine, and H-89, can also be used in the compositions and methods comprising at least one rAAV vector as disclosed herein for in vivo protein expression as disclosed herein.

[0425] In some embodiments, a rAAV vector can also encode a negative regulator of innate immunity such as NLRX1. Accordingly, in some embodiments, a rAAV vector can also optionaly encode one or more, or any combination of NLRX1, NS1, NS3 / 4A, or A46R. Additionaly, in some embodiments, a composition comprising at least one rAAV vector as disclosed herein can also comprise a synthetic, modified RNA encoding inhibitors of the innate immune system to avoid the innate immune response generated by the tissue or the subject.

[0426] In some embodiments, an immune modulator for use in the administration methods as disclosed herein is an immunosuppressive agent. As used herein, the term "immunosuppressive drug or agent" is intended to include pharmaceutical agents which inhibit or interfere with normal immune function. Examples of immunosuppressive agents suitable with the methods disclosed herein include agents that inhibit T-cel / B- cel costimulation pathways, such as agents that interfere with the coupling of T-cels and B-cels via the CTLA4 and B7 pathways, as disclosed in U.S. Patent Pub. No 2002 / 0182211. In one embodiment, an immunosuppressive agent is cyclosporine A. Other examples include myophenylate mofetil, rapamicin, and anti- thymocyte globulin. In one embodiment, the immunosuppressive drug is administered in a composition comprising at least one rAAV vector as disclosed herein or can be administered in a separate composition but simultaneously with, or before or after administration of a composition comprising at least one rAAV vector according to the methods of administration as disclosed herein. An immunosuppressive drug is administered in a formulation which is compatible with the route of administration and is administered to a subject at a dosage suficient to achieve the desired therapeutic efect. In some embodiments, the immunosuppressive drug is administered transiently for a sufficient time to induce tolerance to the rAAV vector as disclosed herein.

[0427] In certain embodiments of any of the aspects, the immunosuppressant is a monoclonal antibody which specificaly inhibits FcRn-IgG binding without interfering with FcRn-albumin binding and that can be used to treat patients having neutralizing antibodies to viral vectors, e.g, AAV. In certain embodiments, the monoclonal antibody is nipocalimab (M281), rozanolixizumab (UCB7665); IMVT-1401, RVT-1401, HL161, HBM916, ARGX-113 (efgartigimod), SYNT001, SYNT002, ABY-039, or DX-2507, derivatives or combinations thereof as described in published US application US20230220069, which is incorporated by reference in its entirety. In certain embodiments, the monoclonal antibody is delivered one to seven days prior to administration of the viral vector. In some embodiments, the monoclonal antibody is delivered daily. In some other embodiments, the monoclonal antibody is dosed or administered on the same day the viral vector isAty. Dkt. No.046192-000118WOPT administered. In another embodiment, the monoclonal antibody is dosed for one day to four weeks post-vector administration.

[0428] Various methods are known to result in the immunosuppression of an immune response of a patient being administered rAAV. Methods known in the art include administering to the patient an immunosuppressive agent, such as a proteasome inhibitor. One such proteasome inhibitor known in the art, for instance as disclosed in U.S. Patent No.9,169,492 and U.S. Patent Application No. 15 / 796,137, both of which are incorporated herein by reference, is bortezomib. In some embodiments, an immunosuppressive agent can be an antibody, including polyclonal, monoclonal, scfv or other antibody derived molecule that is capable of suppressing the immune response, for instance, through the elimination or suppression of antibody producing cels. In a further embodiment, the immunosuppressive element can be a short hairpin RNA (shRNA). In such an embodiment, the coding region of the shRNA is included in the rAAV cassete and is generaly located downstream, 3’ of the poly-A tail. The shRNA can be targeted to reduce or eliminate expression of immunostimulatory agents, such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF and others that are publicly known).

[0429] The use of such immune modulating agents facilitates the ability to for one to use multiple dosing (e.g., multiple administration) over numerous months and / or years. This permits for using multiple agents as discussed below, e.g., a rAAV vector encoding multiple genes, or multiple administrations to the subject. Manufacturing of the rAAV of the invention

[0430] In some aspects of the invention, the recombinant AAV comprising a nucleic acid encoding LAMP2B is produced by the triple transfection method that uses close ended linear duplexed DNA molecules that lack bacterial backbone sequences, for example, as described in International Patent Application No. PCT / US2021 / 013689, published as WO / 2021 / 146591, which is incorporated herein by reference in its entirety. In some embodiments, the rAAV of the invention is manufactured where one or more, or al of nucleic acids, e.g., AAV rep-cap, Adenovirus helper, and transgene, used as starting material are plasmid. In some embodiments, the rAAV of the invention is manufactured where one or more, or al of nucleic acids, e.g., AAV rep-cap, Adenovirus helper, and transgene, used as starting materials are no end DNA (neDNA) or close ended linear duplexed DNA. One example of close ended linear duplexed DNA is dumbbel shaped DNA. Another example of close ended linear duplexed DNA is doggy bone DNA. Non-limiting examples of methods describing cel free in vitro synthesis of dumbbel-shaped DNA and doggy bone DNA are described in U.S. Patent No.6,451,563; Efficient production of superior dumbbel-shaped DNA minimal vectors for smal hairpin RNA expression-Nucleic Acids Res.2015 Oct 15; 43(18): e120; High-Purity Preparation of a Large DNA Dumbbel-Antisense & nucleic acid drug development 11:149–153 (2001);US 9,109,250; U.S. Patent No.9,499,847; U.S. Patent No.10,501,782; and WO 2018033730 A1; al of which are hereinAty. Dkt. No.046192-000118WOPT incorporated by reference in their entireties. The DNA from cel free in vitro synthesis is devoid of any prokaryotic DNA modifications (e.g., is substantialy free of bacterial DNA). In some aspects of the invention, rAAV is manufactured using a adherent HEK293 cel or a HEK293 cel in suspension. In some embodiments of any of the aspects described herein, the rAAV of the invention is manufactured using Pro10 cel as described in US Patent No: 9,441,206 which is incorporated herein by reference in its entirety.

[0431] In some aspects of the invention, the recombinant AAV comprising a nucleic acid encoding LAMP2B is produced by the method as described in PCT / US2021 / 013689, published as WO / 2021 / 146591, or as described in PCT / US2022 / 013279, published as WO / 2022 / 159679, which is incorporated herein by reference in its entirety. Pharmaceutical Compositions

[0432] The rAAV vectors containing a codon-optimized nucleic acid encoding a human LAMP2B polypeptide as disclosed herein, for use in the methods of administration as disclosed herein can be formulated in a pharmaceutical composition with a pharmaceuticaly acceptable excipient, i.e., one or more pharmaceuticaly acceptable carier substances and / or additives, e.g., bufers, carriers, excipients, stabilizers, etc. The pharmaceutical composition may be provided in the form of a kit. Pharmaceutical compositions comprising the rAAV vectors as disclosed herein for use in the methods of administration as disclosed herein and uses thereof are known in the art.

[0433] Accordingly, a further aspect of the invention provides a pharmaceutical composition comprising a rAAV vector containing a codon-optimized nucleic acid encoding a human LAMP2B polypeptide as disclosed herein, for use in the methods of administration as disclosed herein. Relative amounts of the active ingredient (e.g., a rAAV vectors as disclosed herein), a pharmaceuticaly acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and / or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1 percent and 99 percent (w / w) of the active ingredient. By way of example, the composition may comprise between 0.1 percent and 100 percent, e.g., between.5 and 50 percent, between 1-30 percent, between 5- 80 percent, at least 80 percent (w / w) active ingredient.

[0434] The pharmaceutical compositions can be formulated using one or more excipients or diluents to (1) increase stability; (2) increase cel transfection or transduction; (3) permit the sustained or delayed release of the payload; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cel types); (5) increase the translation of encoded protein; (6) alter the release profile of encoded protein and / or (7) alow for regulatable expression of the payload of the invention. In some embodiments, a pharmaceuticaly acceptable excipient may be at least 95 percent, at least 96 percent, at least 97 percent, at least 98 percent, at least 99 percent, or 100 percent pure. In some embodiments,Aty. Dkt. No.046192-000118WOPT an excipient is approved for use for humans and for veterinary use. In some embodiments, an excipient may be approved by United States Food and Drug Administration. In some embodiments, an excipient may be of pharmaceutical grade. In some embodiments, an excipient may meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia. Excipients, as used herein, include, but are not limited to, any and al solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21 st Edition, A. R. Gennaro, Lippincot, Wiliams and Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition. Compositions / formulations

[0435] The rAAV vectors containing a codon-optimized nucleic acid encoding a human LAMP2B polypeptide as disclosed herein, can be formulated in a composition. For example, the rAAV vectors as disclosed herein can be formulated in a pharmaceutical composition with a pharmaceuticaly acceptable excipient, i.e., one or more pharmaceuticaly acceptable carrier substances and / or additives, e.g., buffers, carriers, excipients, stabilisers, etc. The composition, e.g., the pharmaceutical composition may be provided in the form of a kit. It is noted the terms “composition” and “formulation” are used interchangeably here.

[0436] Accordingly, in one aspect, provided herein is a composition comprising the recombinant AAV vector particles described herein. Generaly, the composition comprises the recombinant AAV vector particles described herein at a concentration from about 1e9 vg / ml to about 1e15vg / ml. In some embodiments, the composition comprises the recombinant AAV vector particles described herein at a concentration from about 1e10vg / ml to about 1e14 vg / ml. In some embodiments, the composition comprises the recombinant AAV vector particles described herein at a concentration from about 1e12vg / ml to about 1e14 vg / ml. In some embodiments, the composition comprises the recombinant AAV vector particles described herein at a concentration from about 1e12vg / ml to about 1e15 vg / ml. For example, the composition comprises the recombinant AAV vector particles described herein at a concentration from about 3e12vg / ml to about 3e13 vg / ml, from about 2.5e12vg / ml to about 1e14 vg / ml, from about 3e13vg / ml to about 1e14 vg / ml, or from 1e13vg / ml to about 1e14 vg / ml.

[0437] In some embodiments, the composition comprises the recombinant AAV vector particles described herein at a concentration of about about 1e10vg / ml, or about 1.5e10 vg / ml, or about 2e10Aty. Dkt. No.046192-000118WOPT vg / ml, or about 2.5e10 vg / ml, or about 3e10 vg / ml, or about 3.5e10 vg / ml, or about 4e10 vg / ml, or about 4.5e10 vg / ml, or about 5e10 vg / ml, or about 5.5e10 vg / ml, or about 6e10 vg / ml, or about 6.5e10 vg / ml, or about 7e10 vg / ml, or about 7.5e10 vg / ml, or about 8e10 vg / ml, or about 8.5e10 vg / ml, or about 9e10 vg / ml, or about 1e11vg / ml, or about 1.5e11 vg / ml, or about 2e11 vg / ml, or about 2.5e11 vg / ml, or about 3e11 vg / ml, or about 3.5e11 vg / ml, or about 4e11 vg / ml, or about 4.5e11 vg / ml, or about 5e11 vg / ml, or about 5.5e11 vg / ml, or about 6e11 vg / ml, or about 6.5e11 vg / ml, or about 7e11 vg / ml, or about 7.5e11 vg / ml, or about 8e11 vg / ml, or about 8.5e11 vg / ml, or about 9e11 vg / ml, or about 1e12vg / ml, or about 1.5e12 vg / ml, or about 2e12 vg / ml, or about 2.5e12 vg / ml, or about 3e12 vg / ml, or about 3.5e12 vg / ml, or about 4e12 vg / ml, or about 4.5e12 vg / ml, or about 5e12 vg / ml, or about 5.5e12 vg / ml, or about 6e12 vg / ml, or about 6.5e12 vg / ml, or about 7e12 vg / ml, or about 7.5e12 vg / ml, or about 8e12 vg / ml, or about 8.5e12 vg / ml, or about 9e12 vg / ml, or about 9.5e13 vg / ml, or about 1e13vg / ml, or about 1.5e13vg / ml, or about 2e13vg / ml, or about 2.5e13vg / ml, or about 3e13vg / ml, or about 3.5e13vg / ml, or about 4e13 vg / ml, or about 4.5e13 vg / ml, or about 5e13 vg / ml, or about 5.5e13 vg / ml, or about 6e13 vg / ml, or about 6.5e13 vg / ml, or about 7e13vg / ml, or about 7.5e13vg / ml, or about 8e13vg / ml, or about 8.5e13vg / ml, or about 9e13vg / ml, or about 9.5e13 vg / ml, or about 1e14 vg / ml.

[0438] In one embodiment, the composition comprises the recombinant AAV vector particles described herein at a concentration of 6.7e13vg / ml.

[0439] In one embodiment, the composition comprises the recombinant AAV vector particles described herein at a concentration of 6.7e13vg / ml when administered to a pedicatric subject.

[0440] The pharmaceutical composition comprises the population of purified recombinant adeno- associated virus (rAAV) described herein. The pharmaceutical composition comprising the rAAV, comprises a buffer of pH about 6.5 to about 8.0. In some embodiments, the pH is about 6.5 to about 7.5. For example, the pH is from about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4 or about 7.5. In some preferred embodiments, the pH is less than about 7.5. For example, the pH is less than about 7.4, less than about 7.3, less than about 7.2, less than about 7.1, less than about 7.0, less than about 6.9, less than about 6.8, less than about 6.7, or less than about 6.6. In some embodiments, the pharmaceutical composition comprises one or more excipients, comprising one or more multivalent ions and / or, salts thereof. In some embodiments, the multivalent ions can be selected or optionaly selected from the group consisting of citrate, sulfate, magnesium and phosphate. In some embodiments, the pharmaceutical composition comprises one or more excipients, comprising one or more ions selected or optionaly selected from the group consisting of, sodium, potassium, chroride, ammonium, carbonate, nitrate, chlorate, chlorite, and calcium. In some embodiments, the pharmaceutical composition comprising the rAAV, further comprises a non-ionic surfactant. In some embodiments, the non-ionic surfactant is selected from the group consisting of polyoxyethylene faty alcohol ethers, polyoxyethylene alkyl phenyl ethers, polyoxyethylene-polyoxypropylene block copolymers, alkylglucosides, alkyl phenol ethoxylates, preferably polysorbates, polyoxyethylene alkyl phenyl ethers, and any combinations thereof. In someAty. Dkt. No.046192-000118WOPT embodiments, non-ionic surfactant is selected from the group consisting of TWEEN 60 nonionic detergent, PPG-PEG-PPG Pluronic 10R5, Polyoxyethylene (18) tridecyl ether, Polyoxyethylene (12) tridecyl ether, MERPOL SH surfactant, MERPOL OJ surfactant, MERPOL HCS surfactant, Poloxamer P188, Poloxamer P407, Poloxamer P338 IGEPAL CO-720, IGEPAL CO-630, IGEPAL CA-720, Brij S20, BrijSl0, Brij 010, Brij Cl0, BRIJ 020, ECOSURF EH-9 ,ECOSURF EH-14, TERGITOL 15-S-7, PF-68, ECOSURF SA-15, TERGITOL15-S-9, TERGITOL 15-S-12, TERGITOL L-64, TERGITOLNP-7, TERGITOL NP-8, TERGITOL NP-9, TERGITOL NP-9.5,TERGITOL NP- 10, TERGITOL NP-11, TERGITOL NP-12, TERGITOLNP-13, polysorbate 20, and any combinations thereof. In some embodiments, the pharmaceutical composition further comprises polyol, or sugar, or similar. See, e.g., International Patent No. WO2022 / 159679, which is incorporated herein by reference in its entirety.

[0441] In some embodiments, the composition comprises a buffer. It is noted that any physiological buffer can be used. Non-limiting examples of bufers include, but are not limited to, PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, α-ketoglutaric acid, carbonate (bicarbonate-carbonic acid buffer), and protein buffers. In some embodiments, the buffer is PBS. In some embodiments, the buffer comprises Tris. In some embodiments, buffer is Tris.HCl. In some embodiments, the bufer is histidine bufer.

[0442] Generaly, the buffer has a salt concentration of from about 50 mM to about 750 mM. For example, the buffer has a salt concentration from about 75 mM to about 700 mM, from about 100 mM to about 650 mM, from about 120 mM to about 600 mM, or from about 140 mM to about 550 mM. In some embodiments, the buffer has a salt concentration from about 150mM to about 400mM. In some embodiments, the bufer has a salt concentration of about 150 mM, about 175 mM, about 200 mM, about 225 mM, about 250 mM, about 275 mM, about 300 mM, about 325 mM, about 350 mM, about 375 mM, about 400 mM, about 425 mM, about 450 mM, or about 475 mM. In some preferred embodiments, the bufer has a salt concentration of about 150 mM, about 200 mM or about 365 mM.

[0443] In some embodiments, the ionic strength of the composition is at least about 100 mM. For example, the ionic strength of the composition is from about 125 mM to about 750 mM, or from about 150 mM to about 500 mM, or from about 175 mM to about 700 mM, from about 200mM to about 600 mM, or from about 225 mM to about 550 mM, or from about 250 mM to about 500 mM, or from about 275 mM to about 450 mM, or from about 300 mM to about 400 mM. In some embodiments, the ionic strength of the composition is at least about 125 mM, at least about 150 mM, at least about 175 mM, at least about 200 mM, at least about 225 mM, at least about 250 mM, at least about 275 mM, at least about 300 mM, at least about 325 mM, at least about 350 mM, at least about 375 mM, at least about 400 mM, at least about 425 mM, at least about 450 mM, at least about 475 mM or at least about 500 mM. In some embodiments, the ionic strength of the composition is less than 100mM, for example about 95mM, about 90mM, about 85mM, about 80mM, about 75mM, about 70mM, about 65mM, about 60mM, about 55mM, about 50mM, or even less.Aty. Dkt. No.046192-000118WOPT

[0444] The osmolarity of the composition is maintained at near isotonic levels. For example, the osmolarity of the composition can be from about 100 mOsm to about 600 mOsm, such as from about 125 mOsm to about 500 mOsm, or from about 130 mOsm to about 350 mOsm, or from about 140 mOsm to about 400 mOsm, or from about 140 mOsm to about 350 mOsm, or from about 200 mOsm to about 400 mOsm, or from about 500 mOsm to about 600 mOsm, or from about 200 mOsm to about 600 mOsm, or from about 300 mOsm to about 600 mOsm, or from about 200 mOsm to about 500 mOsm, or from about 300 mOsm to about 400 mOsm, or from about 150 mOsm to about 350 mOsm, or from about 175 mOsm to about 300 mOsm, or from about 300 mOsm to about 375 mOsm, or from about 200 mOsm to about 350 mOsm, or from about 225 mOsm to about 325 mOs, or from about 525 mOsm to about 590 mOsm. In some embodiments, the composition comprises an isotonic solution.

[0445] Generaly, the composition has a pH of about 6.5 to about 8.0. For example, the composition has a pH of about 6.5 to about 7.5. In some embodiments, the composition has a pH of from about 7 to about 8. For example, the composition has a pH of from about 7.3 to about 7.9. In some other non- limiting example, the composition has a pH of from about 7.4 to about 7.8 or from about 7.4 to about 7.7. In some embodiments, the composition has a pH of from about 7.3 to about 7.6, e.g., from about 7.3 to about 7.55. In some prefered embodiments, the composition has a pH less than about 7.5. For example, the composition has a pH about 7.4 or lower, about 7.3 or lower, about 7.2 or lower, about 7.1 or lower, about 7.0 or lower, about 6.9 or lower, about 6.8 or lower, about 6.7 or lower, about 6.6 or lower, or about 6.5 or lower.

[0446] Generaly, the composition has a pH of about 6.5 to about 8.0. For example, the composition has a pH of about 6.5 to about 7.5. In some embodiments, the composition has a pH of from about 7 to about 8. For example, the composition has a pH of from about 7.3 to about 7.9. In some other non- limiting example, the composition has a pH of from about 7.4 to about 7.8 or from about 7.4 to about 7.7. In some embodiments, the composition has a pH of from about 7.3 to about 7.6, e.g., from about 7.3 to about 7.55. In some prefered embodiments, the composition has a pH less than about 7.5. For example, the composition has a pH about 7.4 or lower, about 7.3 or lower, about 7.2 or lower, about 7.1 or lower, about 7.0 or lower, about 6.9 or lower, about 6.8 or lower, about 6.7 or lower, about 6.6 or lower, or about 6.5 or lower.

[0447] The composition can comprise one or more ions and / or salts thereof. Exemplary ions include, but are not limited to sodium, potassium, chloride, magnesium ammonium, carbonate, nitrate, chlorate, chlorite, and calcium. The ions can be provided as a salt, such as a halide (F, Cl, Br, I) salt of sodium, potassium, magnesium, and / or calcium, non-limiting examples of which include NaCl, KCl, MgCl2, CaCl2, and combinations thereof. Additional exemplary salts that can be used include, but are not limited to, carboxylic acid salts, such as acetates, propionates, pyrol idonecarboxylates (or pidolates) or sorbates; poly hydroxylated carboxylic acid salts, such as gluconates, heptagluconates, ketogluconates, lactate gluconates, ascorbates or pantothenates; mono- or polycarboxyl hydroxy acidAty. Dkt. No.046192-000118WOPT salts, such as citrates or lactates; amino acid salts, such as aspartates or glutamates; and fulvate salts. The salts are individualy included at a concentration of from about 500 μM to about 500 mM.

[0448] In some embodiments, the composition comprises one or more multivalent ions and / or salts thereof. Exemplary multivalent ions include, but are not limited to, calcium, citrate, sulfate, magnesium, and phosphate. Multivalent ions and / or salts thereof can be individualy included in the composition at a concentration of from about 500 μM to about 500 mM, for example, at a concentration of about 500 μM, about 750 μM, about 1 mM, about 1.3 mM, about 1.5 mM, about 1.7 mM, about 2.3 mM, about 2.5 mM, about 2.7 mM, about 3.3 mM, about 3.5 mM, about 3.7 mM, about 4.3 mM, about 4.5 mM, about 4.7 mM, about 5 mM, about 10 mM, about 25 mM, about 50 mM, about 75 mM, about 80mM, about 85mM, about 90mM, about 95mM, about 100 mM, about 125 mM, about 150 mM, about 175 mM, about 200 mM, about 225 mM, about 250 mM, about 275 mM, about 300 mM, about 325 mM, about 350 mM, about 375 mM, about 400 mM, about 425 mM, about 450 mM, about 475 mM, or about 500 mM. Non limiting examples of salts are NaCl, KCl, CaCl2, CaSO4, MgSO4, Na3PO4, CaCO3, NaNO3, Al2(SO4)3.

[0449] In some embodiments, the composition comprises NaCl. When present, NaCl can be at a concentration from about 100 mM to about 500 mM, or from about 125 mM to about 450 mM, or from about 100 mM to about 200 mM, or from about 150 mM to about 200 mM. For example, the composition can comprise NaCl at a concentration from about 150 mM to about 425 mM, from about 175 mM to about 400 mM, or from about 175 mM to about 375 mM, or from about 200 mM to about 375 mM.

[0450] In some embodiments, the composition comprises KCl. When present, KCl can be at a concentration from about 1 mM to about 10 mM. For example, the composition can comprise KCl at a concentration from about 1.5 mM to about 7.5 mM.

[0451] In some embodiments, the composition comprises CaCl2. When present, CaCl2 can be at a concentration from about 0.1 mM to about 2 mM. For example, the composition can comprise CaCl2 at a concentration from about 0.5 mM to about 1.5 mM. In some embodiments, the composition comprises CaCl2 at a concentration from about 0.75 mM to about 1.25 mM.

[0452] In some embodiments, the composition comprises MgCl2. When present, MgCl2 can be at a concentration from about 0.1 mM to about 1.5 mM. For example, the composition can comprise MgCl2 at a concentration from about 0.25 mM to about 1 mM or from about 0.25 mM to about 0.75 mM.

[0453] In some embodiments, the composition comprises MgSO4. When present, MgSO4 can be at a concentration from about 5 mM to about 150 mM. For example, the composition can comprise MgSO4 at a concentration from about 10 mM to about 120 mM, or from about 10 mM to about 50 mM, or from about 15 mM to about 45 mM, or about 75 mM to about 125 mM, or from about 80 mM to about 100 mM, or from about 85 mM to about 95 mM, or from about 15 mM to about 100 mM.Aty. Dkt. No.046192-000118WOPT

[0454] In some embodiments, the composition comprises phosphate, e.g., mono basic or dibasic phosphate or a salt thereof. When present, the phosphate, e.g., mono basic or dibasic phosphate or a salt thereof can be at a concentration from about 5 mM to about 30 mM. For example, the composition can comprise phosphate, e.g., mono basic or dibasic phosphate or a salt thereof at a concentration from about 7.5 mM to about 25 mM. In some embodiments, the composition comprises phosphate, e.g., mono basic or dibasic phosphate or a salt thereof at a concentration from about 10 mM to about 20 mM.

[0455] In some embodiments, the composition comprises a mono basic phosphate or a salt thereof at a concentration from about 0.25 mM to about 3 mM. For example, the composition comprises a mono basic phosphate or a salt thereof at a concentration from about 0.5 mM to about 2.75 mM, or from about 0.75 mM to about 2.5 mM or from about 1 mM to about 2.25 mM. In some embodiments, the mono basic phosphate or salt thereof is potassium phosphate monobasic.

[0456] In some embodiments, the composition comprises a dibasic phosphate or a salt thereof at a concentration from about 5 mM to about 15 mM. For example, the composition comprises a dibasic phosphate or a salt thereof at a concentration from about 7.5 mM to about 12.5 mM or from about 8 mM to about 10 mM. In some embodiments, the dibasic phosphate or a salt thereof is sodium phosphate dibasic. In some embodiments, the composition is substantialy free of dibasic phosphate, e.g., sodium phosphate dibasic.

[0457] In some embodiments, the composition comprises Tris (e.g., Tris.HCl) or a salt thereof at a concentration from about 1 mM to about 50 mM. For example, the composition comprises Tris (e.g., Tris.HCl) or a salt thereof at a concentration of from about 5 mM to about 40 mM, or from about 7.5 mM to about 35 mM, or from about 10 mM to about 30 mM or from about 15 mM to about 25 mM.

[0458] In some embodiments, the composition comprises histidine or a salt thereof at a concentration from about 1 mM to about 50 mM. For example, the composition comprises histidine or a salt thereof at a concentration of from about 5 mM to about 40 mM, or from about 7.5 mM to about 35 mM, or from about 10 mM to about 30 mM or from about 15 mM to about 25 mM.

[0459] The composition can also comprise a bulking agent. Exemplary bulking agents include, but are not limited to sugars, polyols and (PVP K24). Exemplary polyols include, but are not limited to, polyhydroxy hydrocarbons, monosaccharides, disaccharides, and trisaccharides. Some exemplary polyols include but are not limited to, sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose and dextran. In some embodiments, polyol is sorbitol, sucrose or mannitol. In some embodiments, the bulking agent is sorbitol. In some embodiments, the bulking agent is sucrose. In some embodiments, the bulking agent is mannitol. In some embodiments, the bulking agent is trehalose, e.g., trehalose dehydrate. In some embodiments, the bulking agent is a dextran, e.g., Dextran T40 and / or Dextran T10.

[0460] When present, the bulking agent can be present at a concentration of from about 0.5 % (w / v) to about 10% (w / v). For example, the composition can comprise a bulking agent, e.g., a polyol orAty. Dkt. No.046192-000118WOPT providone (PVP K24) at a concentration from about from about 1 % (w / v) to about 7.5% (w / v), e.g., from about 1%(w / v) to about 4% (w / v) or from about 4%(w / v) to about 6% (w / v).

[0461] In some embodiments, the composition comprises glycerol, sorbitol, sucrose, or mannitol at a concentration from about 1% (w / v) to about 10% (w / v). In some embodiments, the composition comprises glycerol, sorbitol, sucrose, or mannitol at a concentration from about 1%(w / v) to about 10%(w / v). In some embodiments, the composition comprises sorbitol at concentration from about 3%(w / v) to about 6% (w / v). In some embodiments, the composition comprises sorbitol at concentration of about 1% (w / v), about 2% (w / v), about 3% (w / v), about 4% (w / v), about 5% (w / v), about 6% (w / v), about 7% (w / v), about 8% (w / v), about 9% (w / v), or about 10% (w / v). In some embodiments, the composition comprises sucrose at concentration from about 3%(w / v) to about 6% (w / v). In some embodiments, the composition comprises sucrose at concentration of about 1% (w / v), about 2% (w / v), about 3% (w / v), about 4% (w / v), about 5% (w / v), about 6% (w / v), about 7% (w / v), about 8% (w / v), about 9% (w / v), or about 10% (w / v). In some embodiments, the composition comprises mannitol at concentration from about 3%(w / v) to about 6% (w / v). In some embodiments, the composition comprises mannitol at concentration of about 1% (w / v), about 2% (w / v), about 3% (w / v), about 4% (w / v), about 5% (w / v), about 6% (w / v), about 7% (w / v), about 8% (w / v), about 9% (w / v), or about 10% (w / v).

[0462] The composition can also comprise a non-ionic surfactant. The non-ionic surfactant can be selected from the group consisting of polyoxyethylene faty alcohol ethers, polyoxyethylene alkyl phenyl ethers, polyoxyethylene-polyoxypropylene block copolymers, alkylglucosides, alkyl phenol ethoxylates, preferably polysorbates, polyoxyethylene alkyl phenyl ethers, and any combinations thereof. Non-limiting examples of suitable non-ionic surfactants include polyoxyethylene (12) isooctylphenyl ether (e.g., IGEPAL® CA-270 polyoxyethylene (12) isooctylphenyl ether), polyoxyethylenesorbitan monooleate (e.g., TWEEN® 80 polyoxyethylenesorbitan monooleate), polyethylene glycol octadecyl ether (e.g., Brij® S20 polyethylene glycol octadecyl ether), seed oil surfactant (e.g., EcosurfTM SA-15 seed oil surfactant), poloxamer 188 (a copolymer of polyoxyethylene and polyoxypropylene), nonylphenol ethoxylate (e.g., TergitolTM NP-10 nonylphenol ethoxylate), and combinaitons thereof. In some embodiments, the non-ionic surfactant is selected from the group consisting of TWEEN 60 nonionic detergent, PPG-PEG-PPG Pluronic 10R5, Pluronic F-68 (PF 68), Polyoxyethylene (18) tridecyl ether, Polyoxyethylene (12) tridecyl ether, MERPOL SH surfactant, MERPOL OJ surfactant, MERPOL HCS surfactant, Poloxamer P188, Poloxamer P407, Poloxamer P 338, IGEPAL CO-720, IGEPAL CO-630, IGEPAL CA-720, Brij S20, BrijSl0, Brij 010, Brij Cl0, BRIJ 020, ECOSURF EH-9 ,ECOSURF EH-14, TERGITOL 15-S-7, ECOSURF SA-15, TERGITOL15-S-9, TERGITOL 15-S-12, TERGITOL L-64, TERGITOLNP-7, TERGITOL NP-8, TERGITOL NP-9, TERGITOL NP-9.5,TERGITOL NP-10, TERGITOL NP-11, TERGITOL NP-12, TERGITOLNP-13, polysorbate 20, and any combinations thereof. In some embodiments, the non-ionic surfactant is Poloxamer P 188, Poloxamer P407, Pluronic F-68, EcosurfAty. Dkt. No.046192-000118WOPT SA-15, Brij S20, Tergitol NP-10, IGEPAL CA 720 or Tween 80. In some embodiments, the composition is substantialy free of a non-ionic surfactant. In some embodiments, the non-ionic surfactant is not a polysorbate, e.g., Tween 80 (also referred to as polysorbate 80 or PS80).

[0463] When present, the non-ionic surfactant can be present at a concentration from about 0.0001% (w / v) to about 0.01% (w / v). For example, the composition can comprise a non-ionic surfactant at a concentration from about 0.0005% (w / v) to about 0.0015% (w / v). In some embodiments, the composition can comprise a non-ionic surfactant at a concentration of about 0.0001% (w / v), about 0.0002% (w / v), about 0.0003% (w / v), about 0.0004% (w / v), about 0.0005% (w / v), about 0.0006% (w / v), about 0.0007% (w / v), about 0.0008% (w / v), about 0.0009% (w / v), about 0.001% (w / v), about 0.002% (w / v), about 0.003% (w / v), about 0.004% (w / v), about 0.005% (w / v), about 0.006% (w / v), about 0.007% (w / v), about 0.008% (w / v), about 0.009% (w / v), or about 0.01%. (w / v). In some prefered embodiments, the composition comprises a non-ionic surfactant at a concentration of about 0.0005% (w / v) or about 0.001% (w / v).

[0464] In some embodiments, the composition comprises, in addition to the rAAV, a bufer (e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, α- ketoglutaric acid, carbonate buffer), a bulking agent (e.g., a polyol such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose and dextran) and a non-ionic surfactant (e.g., Poloxamer P 188, Poloxamer P407, Pluronic F-68, Ecosurf SA-15, Brij S20, Tergitol NP-10, IGEPAL CA 720 or Tween 80).

[0465] In some embodiments, the composition comprises, in addition to the rAAV, a bufer (e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, α- ketoglutaric acid, carbonate buffer), a bulking agent (e.g., a polyol such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose and dextran), a non-ionic surfactant (e.g., Poloxamer P 188, Poloxamer P407, Pluronic F-68, Ecosurf SA- 15, Brij S20, Tergitol NP-10, IGEPAL CA 720 or Tween 80), and a multivalent ion (e.g., a multivalent ion selected from the group consisting of calcium, citrate, sulfate, and magnesium).

[0466] In some embodiments, the composition comprises, in addition to the rAAV, a bufer (e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, α- ketoglutaric acid, carbonate buffer), a bulking agent (e.g., a polyol such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose and dextran), and a multivalent ion (e.g., a multivalent ion selected from the group consisting of calcium, citrate, sulfate, and magnesium).

[0467] It is noted that any one of the specific bufers or group of buffers listed in the description of the compositions can be used with any one of the specific bulking agents or group of bulking agents listed in the description of the compositions and with any of the specific non-ionic surfactants or group of surfactants listed in the description of the compositions and with any of the specific multivalent ions and multivalent ion group listed in the description of the compositions. Similarly,Aty. Dkt. No.046192-000118WOPT any one of the specific bulking agents or group of bulking agents listed in the description of the compositions can be used with any one of the specific buffers or group of buffers listed in the description of the compositions and with any of the specific non-ionic surfactants or group of surfactants listed in the description of the compositions and with any of the specific multivalent ions and multivalent ion group listed in the description of the compositions. Likewise, any of the specific non-ionic surfactants or group of surfactants listed in the description of the compositions can be used with any one of the specific buffers or group of buffers listed in the description of the compositions and with any one of the specific bulking agents or group of bulking agents listed in the description of the compositions and with any of the specific multivalent ions and multivalent ion group listed in the description of the compositions. As wel, any of the specific multivalent ions and multivalent ion group listed in the description of the compositions can be used with any one of the specific buffers or group of buffers listed in the description of the compositions and with any one of the specific bulking agents or group of bulking agents listed in the description of the compositions and with any of the specific non-ionic surfactants or group of surfactants listed in the description of the compositions. In other words, al individual specific combinations of buffers, buffer group, bulking agents, bulking agent groups, non-ionic surfactants, non-ionic surfactant groups, multivalent ions and multivalent ion groups listed in the description of the compositions are specificaly contemplated and claimed.

[0468] In yet other embodiments of the present invention, the formulation comprises sodium phosphate, dibasic at a concentration of from about 0.1 mg / ml to about 3 mg / ml, sodium phosphate monobasic monohydrate at a concentration of from about 0.1 mg / ml to about 3 mg / ml, sodium chloride at a concentration of from about 1 mg / ml to about 20 mg / ml, mannitol at a concentration of from about 5 mg / ml to about 40 mg / ml, and poloxamer 188 at a concentration of from about 0.1 mg / ml to about 4 mg / ml. In another embodiment, the formulation of the present invention comprises sodium phosphate, dibasic at a concentration of about 1.42 mg / ml, sodium phosphate monobasic monohydrate at a concentration of about 1.38 mg / ml, sodium chloride at a concentration of about 8.18 mg / ml, mannitol at a concentration of about 20 mg / ml, and poloxamer 188 at a concentration of about 2 mg / ml. The formulations of the present invention may be in liquid form and may comprise the AAV LAMP2B virus particle at a concentration of from about 1E12 vg / ml to about 2E14 vg / ml, or at a concentration of about 2E13 vg / ml.

[0469] In other aspects, the AAV LAMP2B formulation of the invention comprises one or more pharmaceuticaly acceptable excipients to provide the formulation with advantageous properties for storage and / or administration to subjects for the treatment of Danon disease. In certain embodiments, the formulations of the present invention are capable of being stored at ≤65° C for a period of at least 2 weeks, at least 4 weeks, at least 6 weeks and at least about 8 weeks, without detectable change in stability. In this regard, the term “stable” means that the recombinant AAV LAMP2B virus present in the formulation essentialy retains its physical stability, chemical stability and / or biological activity during storage. In certain embodiments of the present invention, the recombinant AAV LAMP2BAty. Dkt. No.046192-000118WOPT virus present in the formulation retains at least about 80% of its biological activity in a human patient during storage for a determined period of time at −65° C., or at least about 85%, 90%, 95%, 98% or 99% of its biological activity in a human patient.

[0470] In certain aspects, the formulation comprising recombinant AAV LAMP2B virions further comprises one or more bufering agents. For example, in various aspects, the formulation of the present invention comprises sodium phosphate dibasic at a concentration of about 0.1 mg / ml to about 3 mg / ml, about 0.5 mg / ml to about 2.5 mg / ml, about 1 mg / ml to about 2 mg / ml, or about 1.4 mg / ml to about 1.6 mg / ml. In another embodiment, the AAV LAMP2B formulation of the present invention comprises about 1.42 mg / ml of sodium phosphate, dibasic (dried). Another bufering agent that may find use in the recombinant AAV LAMP2B formulations of the present invention is sodium phosphate, monobasic monohydrate which, in some embodiments, finds use at a concentration of from about 0.1 mg / ml to about 3 mg / ml, about 0.5 mg / ml to about 2.5 mg / ml, about 1 mg / ml to about 2 mg / ml, or about 1.3 mg / ml to about 1.5 mg / ml. In one embodiment, the AAV LAMP2B formulation of the present invention comprises about 1.38 mg / ml of sodium phosphate, monobasic monohydrate. In another embodiment of the present invention, the recombinant AAV LAMP2B formulation of the present invention comprises about 1.42 mg / ml of sodium phosphate, dibasic and about 1.38 mg / ml of sodium phosphate, monobasic monohydrate.

[0471] In another aspect, the recombinant AAV LAMP2B formulation of the present invention may comprise one or more isotonicity agents, such as sodium chloride, at a concentration of about 1 mg / ml to about 20 mg / ml, for example, about 1 mg / ml to about 10 mg / ml, about 5 mg / ml to about 15 mg / ml, or about 8 mg / ml to about 20 mg / ml. In one embodiment, the formulation of the present invention comprises about 8.18 mg / ml sodium chloride. Other buffering agents and isotonicity agents known in the art are suitable and may be routinely employed for use in the formulations of the present disclosure.

[0472] In another aspect, the recombinant AAV LAMP2B formulations of the present invention may comprise one or more bulking agents. Exemplary bulking agents include without limitation mannitol, sucrose, dextran, lactose, trehalose, and povidone (PVP K24). In some embodiments, the formulations of the present invention comprise mannitol, which may be present in an amount from about 5 mg / ml to about 40 mg / ml, or from about 10 mg / ml to about 30 mg / ml, or from about 15 mg / ml to about 25 mg / ml. In one embodiment, mannitol is present at a concentration of about 20 mg / ml.

[0473] In yet another aspect, the recombinant AAV LAMP2B formulations of the present invention may comprise one or more surfactants, which may be non-ionic surfactants. Exemplary surfactants include ionic surfactants, non-ionic surfactants, and combinations thereof. For example, the surfactant can be, without limitation, TWEEN 80 (also known as polysorbate 80, or its chemical name polyoxyethylene sorbitan monooleate), sodium dodecylsulfate, sodium stearate, ammonium lauryl sulfate, TRITON AG 98 (Rhone-Poulenc), poloxamer 407, poloxamer 188 and the like, and combinations thereof. In one embodiment, the formulation of the present invention comprisesAty. Dkt. No.046192-000118WOPT poloxamer 188, which may be present at a concentration of from about 0.1 mg / ml to about 4 mg / ml, or from about 0.5 mg / ml to about 3 mg / ml, from about 1 mg / ml to about 3 mg / ml, about 1.5 mg / ml to about 2.5 mg / ml, or from about 1.8 mg / ml to about 2.2 mg / ml. In one embodiment, poloxamer 188 is present at a concentration of about 2.0 mg / ml.

[0474] The recombinant AAV LAMP2B virus-containing formulations of the present disclosure are stable and can be stored for extended periods of time without an unacceptable change in quality, potency, or purity. In one aspect, the formulation is stable at a temperature of about 5° C. (e.g., 2° C. to 8° C.) for at least 1 month, for example, at least 1 month, at least 3 months, at least 6 months, at least 12 months, at least 18 months, at least 24 months, or more. In another aspect, the formulation is stable at a temperature of less than or equal to about −20° C. for at least 6 months, for example, at least 6 months, at least 12 months, at least 18 months, at least 24 months, at least 36 months, or more. In another aspect, the formulation is stable at a temperature of less than or equal to about −40° C. for at least 6 months, for example, at least 6 months, at least 12 months, at least 18 months, at least 24 months, at least 36 months, or more. In another aspect, the formulation is stable at a temperature of less than or equal to about −60° C. for at least 6 months, for example, at least 6 months, at least 12 months, at least 18 months, at least 24 months, at least 36 months, or more. Exemplary compositions

[0475] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10 mM Phosphate pH 7.4, 350 mM NaCl, about 2.7 mM KCl, 5 % (w / v) sorbitol, and 0.001% (w / v) poloxamer 188.

[0476] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10 mM Phosphate pH 7.4, about 200 mM NaCl, about 5 mM KCl, about 1% (w / v) mannitol, and about 0.0005% (w / v) IGEPAL CA 720.

[0477] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 20 mM Phosphate pH 7.4, about 300 mM NaCl, about 3 mM KCl, about 3 % (w / v) mannitol, and about 0.001% (w / v) Brij S20.

[0478] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 20 mM Phosphate pH 7.4, about 300 mM NaCl, about 3 mM KCl, about 3 % (w / v) sorbitol, and about 0.001% (w / v) Ecosurf SA-15.

[0479] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10 mM Phosphate pH 7.4, about 350 mM NaCl, about 2.7 mM KCl, about 5 % (w / v) sorbitol, and about 0.001% (w / v) poloxamer 188.

[0480] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10mM Phosphate pH 6.95-7.2, about 137mM NaCl, about 2.7mM KCl, about 0.9mM CaCl2, about 0.5mM MgCl2, and about 0.001% (w / v) Pluronic F-68.Aty. Dkt. No.046192-000118WOPT

[0481] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10mM Phosphate pH 7.3, about 180 mM NaCl, about 2.7 mM KCl, about 5 % (w / v) sorbitol, and about 0.001% (w / v) Poloxamer 188.

[0482] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 15 mM Phosphate pH 7.4, about 375 mM NaCl, about 3.5 mM KCl, about 5 % (w / v) sorbitol, and about 0.0005% (w / v) Tergitol NP-10.

[0483] In some embodiments, the c composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 15 mM Phosphate pH 7.4, about 375 mM NaCl, about 3.5 mM KCl, about 3 % (w / v) glycerol, and about 0.0005% (w / v) Tween 80.

[0484] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 9.0 mM Na2HPO4.7H2O, about 1.0 mM KH2PO4 pH 7.4, about 350 mM NaCl, about 2.7 mM KCl, about 5 % (w / v) sorbitol, and about 0.001% (w / v) poloxamer 188.

[0485] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10mM Phosphate pH 7.6, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) sorbitol, and about 0.01% Pluronic F-68.

[0486] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10mM Phosphate pH 7.4, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) sorbitol, about 0.01% Pluronic F-68, and about 20 mM MgSO4.

[0487] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10mM Phosphate pH 7.6, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) mannitol, and about 0.01% Pluronic F-68.

[0488] In some embodiments, the composition, e.g., the pharmaceutical composition comprises, in addition to the rAAV, about 10mM Phosphate pH ...

Claims

Aty. Dkt. No.046192-000118WOPT CLAIMS 1. A codon-optimized nucleic acid encoding a human LAMP2B polypeptide, wherein the nucleic acid comprises a nucleic acid segment (i.e., a nucleic acid sequence) set forth in any one of SEQ ID NOs 1-3, or nucleotide segment having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity to any of SEQ ID NOs 1, 2, or 3.

2. The codon-optimized nucleic acid of claim 1, wherein the nucleic acid comprises the nucleic acid sequence set forth in any one of SEQ ID NO: 1, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

3. The codon-optimized nucleic acid of claim 1, wherein the nucleic acid comprises the nucleic acid sequence set forth in any one of SEQ ID NO: 2, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

4. The codon-optimized nucleic acid of claim 1, wherein the nucleic acid comprises the nucleic acid sequence set forth in any one of SEQ ID NO: 3, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

5. The codon-optimized nucleic acid of any one of claims 1-4, wherein the LAMP2B polypeptide is a polypeptide having amino acid sequence of SEQ ID NO: 9 or is a functional variant of the LAMP2B polypeptide having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to the amino acid sequence shown in SEQ ID NO:

9.

6. The codon-optimized nucleic acid of any one of claims 1-5, that is comprised within a nucleic acid construct that further comprises viral or non viral sequence elements that facilitate integration and / or expression of the codon optimized nucleic acid.

7. An expression cassete containing the codon-optimized nucleic acid of any one of claims 1-5, operably linked to a muscle-specific promoter.

8. The expression cassete of claim 7, wherein the muscle-specific promoter targets skeletal and cardiac muscle.

9. The expression cassete of claim 7, wherein the muscle-specific promoter targets cardiac muscle.

10. The expression cassete of claim 7, wherein the muscle-specific promoter targets skeletal muscle.

11. The expression cassete of any one of claims 7-10, wherein the muscle-specific promoter comprises a nucleic acid sequence selected from the group consisting of SP0497, SP0498, SP0499, SP0500, SP0508, SP0509, SP0510, SP0511, SP0512, SP0513, SP0522, SP0524, Syn100, and Spc5-12, or a nucleic acid having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

12. The expression cassete of any one of claims 7-11, further comprising one or more additional regulatory elements and / or a poly A sequence.Aty. Dkt. No.046192-000118WOPT 13. The expression cassete of claim 12, wherein the one or more additional regulatory elements is selected from the group consisting of an enhancer, a 5’ untranslated region (5’UTR), an intron, a reverse RNA pol I terminator sequence, and combinations thereof.

14. The expression cassete of claim 13, wherein the intron is an IVS intron.

15. The expression cassete of claim 14, wherein the intron is an IVS intron comprises a nucleic acid sequence of SEQ ID NO: 7, or a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98%, or 99% sequence identity thereto.

16. A recombinant adeno-associated virus (rAAV) vector comprising in its genome the expression cassete of any one of claims 7-15.

17. A recombinant adeno-associated virus (rAAV) vector comprising in its genome: a) 5’ and 3’ AAV inverted terminal repeats (ITR) sequences; and b) located between the 5’ and 3’ ITRs, the expression cassete specified in any one of claims 7-15.

18. The rAAV vector of claim 17, wherein the AAV genome further comprises at least one of: a) a 5’ ITR; b) an intron; c) a poly A sequence; and d) a 3’ ITR.

19. The rAAV vector of any one of claims 16-18, wherein the AAV genome comprises, in the 5’ to 3’ direction: a) a 5’ ITR; b) a muscle-specific promoter; c) an intron d) a codon-optimized nucleic acid specified in any one of claims 1-6; e) a poly A sequence; f) a 3’ ITR.

20. The rAAV vector of any one of claims 18-19, wherein the intron is selected from the group consisting of an IVS intron sequence, a MVM intron sequence, a HBB2 intron sequence, an CMVIE intron sequence, a UBC intron sequence, and a SV40 intron sequence.

21. The rAAV vector of any one of claims 17-20, wherein at least one of the 5’ ITR or 3’ITR comprises an insertion, deletion or substitution.

22. The rAAV vector of claim 17-21, wherein one or more CpG islands in the ITR are removed.

23. The rAAV vector of any one of claims 17-22, wherein the poly A sequence is a ful length SV40 polyA sequence or HGF poly A sequence.

24. The rAAV vector of any one of claims 17-23, wherein poly A sequence is selected from SEQ ID NO: 8, or a nucleic acid sequence at least 80% sequence identity thereto.Aty. Dkt. No.046192-000118WOPT 25. The rAAV vector of any one of claims 17-24, wherein the rAAV vector is a chimeric AAV vector, rational haploid AAV vector, a hybrid AAV vector or a rational polyploid AAV vector.

26. The rAAV vector of any one of claims 17-25, wherein the rAAV vector comprises a rational polyploid AAV capsid, a mosaic AAV capsid, a chemicaly modified AAV capsid, or a AAV capsid from any AAV serotypes.

27. The rAAV vector of any one of claims 17-26, wherein the rAAV capsid is a capsid from an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrh10, po1, AAV9-PHP.B, AAV9-ePHP.B, AAV LK03, AAV Anc80L65, AAVDJ, AAV1A6i, AAV1P5i, AAV4A1i, AAV7P4i, AAV9A1i, AAV9A2i, AAV9A6i, AAV9P1i, AAV9P2i, AAV9P5i, AAVrh10A1i, AAVrh10A2i, AAVrh10P1i, AAV12P2i, AAVS10P1i, AAV JEA, AAV23xA P2i, AAVDJ P2i, AAV 2i8, AAV2G9, AAV2.5i82g9, AAV2.5, AAV 2.5G9, AAVr10pLDB_L2, AAVr10pLDB_P31, AAV4E, and AAV4A.

28. A pharmaceutical composition comprising the rAAV vector of any one of claims 17-27 in a pharmaceuticaly acceptable carier.

29. A method for treating a subject in need of LAMP2B, the method comprising administering the rAAV vectors of any one of claims 17-27 or the pharmaceutical composition of claim 28, or the expression cassete of any one of claims 7-16 or the codon-optimized nucleic acid of any one of claims 1-6, to the subject.

30. A method for treating danon disease, the method comprising administering the rAAV vectors of any one of claims 17-27 or the pharmaceutical composition of claim 28, or the expression cassete of any one of claims 7-16 or the codon-optimized nucleic acid of any one of claims 1-6, to the subject.

31. The method of any claims 29 or 30, wherein administering to the subject is by systemic administration.

32. The method of claim 31, wherein the systemic administration is by intravenous administration.

33. The method of any claims 29 or 32, wherein administering to the subject is by local administration.

34. The method of claim 33, wherein the local administration is by intracoronary administration.

35. The method of any one of claims 29-34, where the rAAV vector is administered at a dosage range of between 1.0E9 vg to 5.0E14vg.

36. Use of a rAAV vector in the preparation of a medicament for treating subject in need of LAMP2B, the medicament comprising the rAAV vector specified in of any one of claims 17-27.

37. Use of a rAAV vector in the preparation of a medicament for treating danon disease, the medicament comprising the rAAV vector specified in of any one of claims 17-27.Aty. Dkt. No.046192-000118WOPT 38. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 1, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

39. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 1, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

40. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 1, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

41. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 2, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

42. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 2, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

43. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 2, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

44. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 3, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 4, or a sequence having at least 80% sequence identity thereto.

45. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 3, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 5, or a sequence having at least 80% sequence identity thereto.

46. An expression cassete containing the codon-optimized nucleic acid sequence of SEQ ID NO: 3, operably linked to a muscle-specific promoter having a sequence of SEQ ID NO: 6, or a sequence having at least 80% sequence identity thereto.

47. A recombinant adeno-associated virus (rAAV) vector comprising in its genome the expression cassete of any of claims 38-46.

48. An expression cassete comprising spc5-12 promoter sequence, wherein the expression cassete is used to treat Danon disease.

49. An expression cassete comprising SP0524 promoter sequence, wherein the expression cassete is used to treat Danon disease.

50. An expression cassete of any of claims 48 or 49, wherein the expression cassete further comprises nucleic acid sequence of SEQ ID NO: 1-3, each of which encodes a LAMP2B polypeptide sequence.Aty. Dkt. No.046192-000118WOPT 51. An expression cassete of any of claims 48-50, further comprising an intron sequence, wherein the intron is selected from the group consisting of an IVS sequence, a MVM sequence, a HBB2 sequence, an CMVIE intron sequence, a UBC intron sequence, and a SV40 sequence.

52. An expression cassete of any of claims 48-51, further comprising a poly A sequence.

53. An expression cassete of any of the preceeding claims comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:s 60, 61, 63, 79, 81 and 82, or a sequence having at least 80% sequence identity thereto.

54. An expression cassete of any of claims 48-53, is delivered to a subject in need thereof by using a non-viral vector.

55. An expression cassete of any of claims 48-53, is delivered to a subject in need thereof by using a viral vector.

56. The viral vector of claim 55 is recombinant adeno associated virus (rAAV) vector.

57. The viral vector of claim 56 is a AAV2i8 vector.

58. A transgenic mouse having a genome that cannot express functional Lamp2, wherein the genome is substantialy devoid of exons 2-6 of the Lamp2 gene, and comprises a premature stop codon upstream of exon 7 of the Lamp2 gene.

59. The transgenic mouse of claim 58, wherein the premature stop codon results in an out-of-frame shift of exons 7-9 of the Lamp2 gene.

60. The transgenic mouse of claim 58, wherein the premature stop codon results in nonsense- mediated mRNA decay of the Lamp2 gene.

61. The transgenic mouse of any of claims 58-60, wherein the mouse exhibits a complete loss of the Lamp2 expression.

62. A method of making a transgenic mouse having a genome that cannot express functional Lamp2 gene , the method comprising contacting a mouse embryo or a plurality of mouse embryonic cels with at least one sgRNA tareting exons 1 and 6 of the Lamp2 gene, and a Cas nuclease.

63. The method of claim 62, wherein the contacting is performed by electroporation.

64. The method of claim 62 and 63, wherein the mouse embryo is a C57BL / 6J mouse embryo.

65. The method of any of claims 62-64, wherein the at least one sgRNA is selected from TAGTCGATCCTTGATGCGGA (SEQ ID NO: 119) and AACAGTGGTAGGTGTATGCG (SEQ ID NO: 120).

66. The method of any of claims 62-65, wherein the contacted mouse embryos or mouse embryonic cels are implanted in pseudopregnant recipient female mice.

Images