Tumor-specific lysosome-targeting chimera and use thereof in tumor therapy

By designing a tumor-specific lysosomal targeting chimera (LYTAC), which utilizes responsive switching elements to degrade tumor cell membrane proteins in the tumor microenvironment, the problems of low response rate and safety risks in existing technologies have been solved, achieving efficient and safe tumor immunotherapy.

WO2025218256A1PCT designated stage Publication Date: 2025-10-23SUZHOU UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/143027
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-17
Filing Date
2024-12-27
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

Existing immune checkpoint blockade therapies have low clinical response rates, and existing technologies suffer from problems such as low delivery efficiency, poor tissue selectivity, in vivo safety risks, and high production costs when applied at the biological level, making it difficult to effectively downregulate PD-L1 expression on the surface of tumor cells.

Method used

A tumor-specific lysosomal targeting chimera (LYTAC) was designed, which includes a specific response switching element that can respond to changes in pH, ions and biomolecules in the tumor microenvironment, dissociate and degrade tumor cell membrane proteins, and achieve tumor-specific targeted degradation using a lysosomal shuttle receptor nucleic acid aptamer.

Benefits of technology

It achieves efficient degradation of tumor cells, induces apoptosis, releases tumor antigens, stimulates immune responses, improves the efficacy and safety of anti-tumor immunotherapy, reduces the impact on normal cells, and has the characteristics of multivalent effect and simple preparation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024143027_23102025_PF_FP_ABST
    Figure CN2024143027_23102025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a switch element capable of specific response and a lysosome-targeting chimera comprising the response switch. Verification shows that the lysosome-targeting chimera can specifically degrade a target protein contained in tumor cells in a tumor microenvironment without affecting the function of normal cells in the body. Moreover, the lysosome-targeting chimera features simple preparation steps, and can be used for preparing an immune checkpoint blockade drug, thereby improving the effect of tumor therapy, solving the translation problem and the problem of on-target / off-tumor toxicity in the prior art, and facilitating the achievement of efficient and safe anti-tumor immunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

Tumor-specific lysosome targeting chimera and its application in tumor treatment TECHNICAL FIELD

[0001] The present application belongs to the technical field of immunotherapy, and particularly relates to a tumor-specific lysosome targeting chimera and its application in tumor treatment. BACKGROUND

[0002] Immune checkpoint blockade therapy is the main means of tumor immunotherapy, and a variety of antibody drugs have been applied in clinical practice. However, the actual clinical response rate of existing immune checkpoint blockade therapy is low, and it is necessary to develop efficient and safe immune checkpoint blockade drugs.

[0003] Recent studies have shown that in addition to the function of immune checkpoint, the intracellular part of the transmembrane structure of programmed death receptor ligand 1 (PD-L1) is widely involved in the growth, proliferation and metastasis related signal pathways of tumor cells, and promotes the occurrence and development of tumor cells. Therefore, simply blocking the immune checkpoint function of PD-L1 by means of antibodies and other means can only achieve the goal of tumor immunotherapy to a certain extent. There are several strategies to down-regulate the expression level of PD-L1 on the surface of tumor cells, such as introducing small molecule inhibitors based on the signal pathway of PD-L1 expression to reduce the expression of PD-L1. However, this strategy can only interfere with one expression pathway, and tumor cells may increase the expression of PD-L1 through other compensatory pathways, resulting in difficulty in achieving the expected PD-L1 down-regulation effect. In addition to the strategy of interfering with PD-L1 expression, PD-L1 can also be down-regulated by silencing PD-L1 related genes, such as using siRNA or gene editing tool CRISPR to silence PD-L1 gene. However, this strategy involving gene editing still faces the problem of low delivery efficiency in practice, which leads to its inability to be widely applied. In addition, the existing technology mainly focuses on the development of new molecular tools and their application at the cellular level, and has not been practiced and popularized at the organism level and in actual application. The difficulties of the existing technology are in aspects of large process difficulty, poor tissue selectivity, important safety hazards such as off-target de-tumor toxicity in vivo, high production cost, and difficult transformation. Therefore, the present application is proposed. SUMMARY

[0004] To solve the above problems, the application provides a tumor-specific lysosome targeting chimera (LYTAC), which contains a specific response switch, the switch is combined with a lysosome shuttle receptor nucleic acid aptamer, and has good responsiveness to the characteristic physical and chemical properties of a tumor microenvironment, such as low pH, high potassium ion concentration and high ATP, in the tumor microenvironment, the switch element changes in configuration, and is dissociated from the lysosome shuttle receptor aptamer, so that the membrane protein of tumor cells in the tumor site is degraded, and it is ensured that the membrane protein on the surface of normal cells in the body is not degraded in a physiological environment.

[0005] A first object of the application is to provide a responsive switch element, which is essentially a customized DNA sequence, and which is provided with a plurality of DNA functional regions connected with each other, and which is combined with a lysosome shuttle receptor nucleic acid aptamer in a non-responsive state and is dissociated from the lysosome shuttle receptor nucleic acid aptamer in a responsive state, and which can at least respond to pH, ions (such as potassium ions), biomolecules (such as ATP, membrane proteins, etc.), and the like. The responsive switch element has at least the following structure:

[0006] I. For responding to pH, the responsive switch element is provided with a response region, a connection sequence, a response region, a base complementary region, a response region, a connection sequence, and a response region connected with each other.

[0007] The response region contains a plurality of cytosines.

[0008] II. For responding to ions, the responsive switch element is provided with a first response region, a connection sequence, a base complementary region, a connection sequence, and a second response region connected with each other.

[0009] The first response region and the second response region are obtained by splitting a sequence containing a core sequence 5'-GGGTAGGGCGGGTTGGG-3'.

[0010] III. For responding to biomolecules, the responsive switch element is provided with a third response region, a base complementary region, and a fourth response region connected with each other.

[0011] The biomolecule nucleic acid aptamer is split into a first sequence and a second sequence, the third response region includes the first sequence, the fourth response region includes the second sequence, and the third response region and the fourth response region can form a hairpin structure with the biomolecule.

[0012] The base complementary region is used to be complementary to a target nucleic acid aptamer.

[0013] In an embodiment of the application, the switch element is a pH-responsive switch element.

[0014] Further, the component units of the pH-responsive switch element sequentially comprise a response region, a connecting sequence, a response region, a base complementary pairing region, a response region, a connecting sequence, and a response region from 5' end to 3' end.

[0015] Further, the response region comprises at least 4-8 cytosines, and the base complementary region is complementary paired with the target nucleic acid aptamer by at least any 5 continuous bases.

[0016] Further, the pH-responsive switch element is complementary paired by at least any 5 continuous bases from 5' end, or the target nucleic acid aptamer is complementary paired by at least any 5 continuous bases from 3' end.

[0017] Further, the pH-responsive switch element is complementary paired by at most 40 bases, preferably 5-20.

[0018] Further, the nucleotides of the connecting sequence are selected from any one or both of A and T, and the number of the nucleotides of the connecting sequence is 1-7. Wherein, the number of T and A has a subtle influence on the response condition of the switch element, for example, when the connecting sequence is 3 Ts, the switch element can be opened in an environment with a pH of about 6.5, and further replacing T with A can lower the pH value at which the conformational transition occurs, that is, the more the number of A is, the lower the pH value at which the conformational transition occurs, and the connecting sequence in the switch element can be adjusted as needed.

[0019] Most preferably, the pH-responsive switch element comprises any one of the sequences shown in SEQ ID NO. 1-15.

[0020] In an embodiment of the present application, the switch element is a potassium ion-responsive switch element.

[0021] Further, the K + The component units of the (potassium ion) responsive switch element sequentially comprise a first response region, a connecting sequence, a base complementary pairing region, a connecting sequence, and a second response region from 5' end to 3' end.

[0022] Further, the first response region and the second response region are split by a sequence comprising a core sequence 5'-GGGTAGGGCGGGTTGGG-3', and the split site is located on the core sequence, and the number ratio of G bases of the core sequence on the first response region and the second response region after splitting is 1:1 or 3:1. Specifically:

[0023] The number of G bases of the first response region: the number of G bases of the second response region = 1:1 or 3:1,

[0024] 1:1 split, the first response region sequence is 5'-GGGTTGGG-3', and the second response region sequence is 5'-GGGTAGGG-3', both of which contain 6 Gs (i.e. 1:1);

[0025] 3:1 split, the first response region sequence is 5'-GGGTAGGGCGGG-3', and the second response region sequence is 5'-GGG-3', which respectively contain 9 Gs and 3 Gs (i.e. 3:1).

[0026] Further, the nucleotides of the connecting sequence are selected from any one or both of A and T, and the number of the nucleotides of the connecting sequence is 2-8. Preferably, the connecting sequence is 3-6 Ts.

[0027] Further, the response region contains at least 4-8 cytosines, and the base complementary region is involved in complementary pairing with the target nucleic acid aptamer by at least any 5 consecutive bases.

[0028] Further, K + The (potassium ion) responsive switch element is involved in complementary pairing by at least any 5 consecutive bases from the 5' end, or K + The (potassium ion) responsive switch element is involved in complementary pairing by at least any 5 consecutive bases from the 3' end, and the target nucleic acid aptamer is involved in complementary pairing by at least any 5 consecutive bases.

[0029] Further, K + The (potassium ion) responsive switch element is involved in complementary pairing by at most 40 bases, preferably 5-20.

[0030] Most preferably, K + The (potassium ion) responsive switch element contains any one of the sequences shown in SEQ ID NO. 16-29.

[0031] In an embodiment of the present application, the switch element is an ATP responsive switch element.

[0032] Further, the constituent unit of the ATP responsive switch element sequentially includes a third response region, a base complementary pairing region, and a fourth response region from the 5' end to the 3' end.

[0033] Further, the third response region and the fourth response region further contain an extension sequence for stabilizing the first sequence and / or the second sequence, the extension sequence is 1-3 bases, wherein each base is independently selected from G, C, A, and T, the extension sequence is located at the 3' end of the first sequence and the 5' end of the second sequence, and the two extension sequence bases are complementary to each other.

[0034] Further, the ATP aptamer contains at least the sequence shown as follows: ACCTGGGGGAGTATGCGGAGGAAGGT, preferably, the nucleic acid aptamer is split into: ACCTGGGGGAGTA (core sequence of the third response region), TGCGGAGGAAGGT (core sequence of the fourth response region).

[0035] Further, the ATP-responsive switch element has at least any 5 consecutive bases involved in the complementary pairing from the 5' end, or the ATP-responsive switch element has at least any 5 consecutive bases involved in the complementary pairing from the 3' end, and the target nucleic acid aptamer has at least any 5 consecutive bases involved in the complementary pairing.

[0036] Further, the ATP-responsive switch element has at most 40 bases involved in the complementary pairing, preferably 5-20.

[0037] Most preferably, the ATP-responsive switch element contains any one of the sequences shown in SEQ ID NO. 30-52.

[0038] In an embodiment of the present application, the switch element is other biomolecule-responsive switch element, such as membrane protein-responsive element.

[0039] Further, the switch element can also achieve biomarker response, wherein the biomarker used is a membrane protein, which includes but is not limited to any one of HER2 (human epidermal growth factor receptor-2), EpCAM (epithelial cell adhesion molecule), Nucleolin, PTK7 (protein tyrosine pseudokinase 7), VEGF (vascular endothelial growth factor), EGFR (epidermal growth factor receptor) membrane protein. Since the nucleic acid aptamer recognizes the existence of the target molecule with commonality, the recognition of the target molecule can be achieved by forming some unique structures such as stem (Stem), loop (Loop), hairpin (Hairpin) and other regions, therefore based on the design of the ATP-responsive switch element in the present application, it can be theoretically extended to other biomarker response for protein. According to the difference of the target molecule, the nucleic acid aptamer sequence of the response region will be different.

[0040] Specifically, the ATP-responsive switch element in the present application splits the ATP aptamer into two oligonucleotide chains, which are distributed on both sides of the base complementary pairing region, one end contains the third response sequence ACCTGGGGGAGTA, and the other end contains the fourth response sequence TGCGGAGGAAGGT. When the element is in the high ATP concentration condition of the tumor characteristic microenvironment, the third response sequence and the fourth response sequence will interact with ATP to form a hairpin structure, so that the ATP aptamer is separated from the switch element. When applied to the LYTAC structure, it will release the cation-independent mannose 6-phosphate receptor (CI-M6PR) aptamer for binding with CI-M6PR and restoring the protein function of LYTAC, thereby playing a tumor-specific targeted protein degradation. Similarly, for other membrane proteins such as HER2, EpCAM, Nucleolin, PTK7, VEGF, EGFR, their split aptamers can also be used to prepare switch elements responsive to tumor biomarkers.

[0041] A second object of the present application is to provide a specific target-responsive combination containing the responsive switch element and the lysosome shuttle receptor-targeting aptamer, thereby constructing a tumor-specific lysosome-targeting chimera.

[0042] A third object of the present application is to provide a tumor-specific lysosome-targeting chimera, which comprises at least one lysosome shuttle receptor recognition structure (which can contain at least one lysosome shuttle receptor-targeting aptamer) and at least one responsive switch element, and the lysosome shuttle receptor recognition structure can bind to the base complementary region on the responsive switch element.

[0043] Further, the tumor-specific lysosome-targeting chimera further comprises at least one target protein recognition structure, and the target protein recognition structure and the lysosome shuttle receptor recognition structure are connected to each other. Specifically, the tumor-specific lysosome-targeting chimera is a lysosome-targeting chimera responsive to the tumor microenvironment. The switch element binds to the lysosome shuttle receptor aptamer, and in the tumor microenvironment, it dissociates after specific response, thereby exposing the lysosome shuttle receptor aptamer, providing a binding site for the lysosome shuttle receptor and LYTAC, causing the degradation of the target protein and further inducing tumor cell apoptosis.

[0044] Further, the target protein recognition structure and the lysosome shuttle receptor recognition structure are connected by a connecting molecule.

[0045] Further, the target protein recognition structure can bind to the target protein.

[0046] Further, the target protein recognition structure is selected from one or more of an antibody, a nanobody, an aptamer, and a polypeptide.

[0047] Specifically, the tumor-specific lysosome targeting chimera comprises a structure as described below: a target protein recognition structure and a lysosome shuttle receptor recognition structure connected by a connecting molecule, and the molar ratio n of the lysosome shuttle receptor recognition structure to the target protein recognition structure is ≥1; when n>1, there is a multivalent effect.

[0048] Further, 1≤n≤15.

[0049] Further, the connecting molecule is a molecule that is not degradable in the tumor microenvironment.

[0050] Further, the lysosome shuttle receptor recognition structure or the target protein recognition structure is connected to the connecting molecule by a flexible segment or directly connected to the connecting molecule.

[0051] Further, the flexible segment is selected from one or more of polyethylene glycol, a carbon chain, and a base chain.

[0052] Further, the connecting molecule contains at least one of the following structures: an amide bond, a triazole ring, a sulfide bond, and a disulfide bond.

[0053] Further, the connecting molecule contains at least one of the following structures:

[0054] Further, the target protein recognition structure is selected from commercially available or self-made monoclonal or polyclonal antibodies.

[0055] Further, the target protein recognition structure includes a PD-L1 antibody, a HER2 antibody, a platelet-derived growth factor antibody, a protein tyrosine kinase 7 antibody, a mesenchymal epithelial transformation factor antibody, a G protein-coupled receptor 65 antibody, a CD47 antibody, a CD71 antibody, an EGFR antibody, and an ABCG2 antibody.

[0056] Further, the lysosome shuttle receptor recognition structure includes one or several of a CI-M6PR aptamer, an ASGPR aptamer, a transferrin receptor aptamer, an integrin aptamer, a cytokine receptor aptamer, and a polynucleotide.

[0057] Specifically, the CI-M6PR aptamer is selected from one or several of the following sequences:

[0058] 5'-GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC-3'(SEQ ID NO. 53);

[0059] 5'-GGGGAGGCGATTCGGTGTGTCCTCCAGAAGATATTTCCGA-3'(SEQ ID NO.54);

[0060] 5'-CGGGCACGGATGGAGTCGTTGCAGGGGCCCTTCCCCTTGG-3'(SEQ ID NO.55);

[0061] 5'-CCGACCGTGACCAGACAAACGTTTGAGTAGGCGCCCGACA-3'(SEQ ID NO.56);

[0062] The ASGPR nucleic acid aptamer is as follows:

[0063] 5'-UUGAUUGCGUGUCAAUCAUGGCGUAGUAAAAGACAAGUAGCUACGAGGUCAUGUGUAUGUUGGGGAUUAGGACCUGAUUGAGUUCAGCCCACAUAC-3'(SEQ ID NO.57).

[0064] When the above nucleic acid aptamer is used, the base complementary region in Table 1 is replaced with a sequence complementary to the sequence at the 5' end of the above nucleic acid aptamer, and the length of the base complementary region is preferably 5-20 nt, such as CGCCTCCCC (corresponding to SEQ ID NO. 54).

[0065] Further, the structure of the multivalent lysosome-targeting chimera includes but is not limited to any of the structures shown as follows:

[0066] Wherein, X is a target protein recognition structure, R1 and R2 are flexible segments, and Y is a lysosome shuttle receptor recognition structure.

[0067] Wherein, R1 and R2 are independently selected from PEG, carbon chain or base chain.

[0068] The application also provides the use of the above-mentioned responsive switch element or tumor-specific lysosome-targeting chimera in the preparation of a protein degradation agent or an immunotherapy drug.

[0069] Further, the immunotherapy drug can be prepared into an immune checkpoint blocking drug, etc., for anti-tumor.

[0070] Based on the above scheme, the application further provides a multivalent lysosome-targeting chimera and its use in protein degradation and immunotherapy, and the specific scheme is as follows:

[0071] Immune checkpoint blockade therapy is a major means of tumor immunotherapy, and a variety of antibody drugs have been applied in clinical practice. However, the actual clinical response rate of existing immune checkpoint blockade therapy is low, and it is necessary to develop efficient and safe immune checkpoint blockade drugs.

[0072] Recent studies have shown that in addition to the function of immune checkpoint, the intracellular part of the transmembrane structure of PDL1 is also widely involved in the growth, proliferation and metastasis related signal pathways of tumor cells, promoting the occurrence and development of tumor cells. Therefore, simply blocking the immune checkpoint function of PDL1 by means of antibodies and other means can only achieve the goal of tumor immunotherapy to a certain extent. There are several strategies to down-regulate the expression level of PDL1 on the surface of tumor cells at present, such as introducing some small molecule inhibitors to reduce the expression of PDL1 based on the signal pathway of PDL1 expression. However, this strategy can only interfere with one expression pathway, and tumor cells may increase the expression of PDL1 through other compensatory pathways, resulting in difficulty in achieving the expected PDL1 down-regulation effect. In addition to the strategy of interfering with PDL1 expression, PDL1 can also be down-regulated by silencing PDL1 related genes, such as using siRNA or gene editing tool CRISPR to silence PDL1 gene. However, this strategy involving gene editing still faces problems such as low delivery efficiency in practice, which leads to its inability to be widely applied.

[0073] In recent years, with the development of emerging technologies, the structure of protein degradation targeting chimera (PROTAC) has attracted widespread attention. The two ends of PROTAC molecule recognize target protein and E3 ubiquitin ligase respectively, realize the connection of target protein and E3 ubiquitin ligase, and through a series of biological processes, the target protein is labeled with ubiquitin tag, so as to be recognized by proteasome in cells, and further degraded by proteasome. Since the ubiquitination process mainly occurs in cells, this strategy has limited effect on the degradation of membrane proteins.

[0074] For the degradation of membrane proteins, Professor Carolyn Bertozzi of the United States developed a lysosome targeting chimera (LYTAC) technology in 2020. One end of the technology is targeted to the target protein through antibody, and the other end is targeted to cation-independent mannose 6-phosphate receptor (CI-M6PR) through oligosaccharide peptide group. This lysosome targeting chimera can form a ternary complex with the target membrane protein and the lysosome shuttle receptor, and further mediate the complete degradation of the target membrane protein to the lysosome through the lysosome shuttle activity of CI-M6PR, so as to achieve the effect of down-regulating the level of target protein on cell membrane.

[0075] In addition, the prior art mainly focuses on the development of new molecular tools and application at the cellular level, and has not been practiced and popularized at the organism level and in practical applications. The difficulties of the prior art are that the process is difficult, there are safety hazards in the organism, the production cost is high, and the degradation efficiency is unstable.

[0076] Currently, the use of LYTAC molecules in the prior art is limited by connection stability, binding efficiency, etc., affecting the degradation efficiency.

[0077] Therefore, the present application further provides a multivalent lysosome-targeting chimera, comprising any one of the following structures: a target protein recognition structure and a lysosome shuttle receptor recognition structure connected by a connecting molecule, and the molar ratio n of the lysosome shuttle receptor recognition structure to the target protein recognition structure is greater than 1.

[0078] Further, 1 < n < 15.

[0079] Further, the lysosome shuttle receptor recognition structure or the target protein recognition structure is connected to the connecting molecule through a flexible segment or directly.

[0080] Further, the connecting molecule is a molecule that is not degradable in the tumor microenvironment.

[0081] Further, the flexible segment is selected from one or more of polyethylene glycol, a carbon chain, and a base chain.

[0082] Further, the connecting molecule contains at least one of the following structures: an amide bond, a triazole ring, a sulfide bond, and a disulfide bond.

[0083] Further, the connecting molecule contains at least one of the following structures:

[0084] Further, the target protein recognition structure includes PDL1 antibody, HER2 antibody, platelet-derived growth factor antibody, protein tyrosine kinase 7 antibody, mesenchymal epithelial transformation factor antibody, G protein-coupled receptor 65 antibody, CD47 antibody, CD71 antibody, EGFR antibody, ABCG2 antibody, etc.

[0085] Further, the target protein recognition structure is selected from commercially available or self-made monoclonal or polyclonal antibodies.

[0086] Further, the lysosome shuttle receptor recognition structure includes one or more of CI-M6PR aptamer, ASGPR aptamer, transferrin receptor (CD71) aptamer, and polyoligonucleotide.

[0087] Preferably, the sequence of the CI-M6PR aptamer is selected from any one of SEQ ID NO. 53-56; and the sequence of the ASGPR aptamer is SEQ ID NO. 57.

[0088] Further, the structure of the multivalent lysosome targeting chimera includes but is not limited to any one of the following structures:

[0089] wherein X is a target protein recognition structure, R1 and R2 are flexible segments, and Y is a lysosome shuttle receptor recognition structure.

[0090] wherein R1 and R2 are independently selected from PEG, carbon chain or base chain.

[0091] The present application also provides the use of the above-mentioned multivalent lysosome targeting chimera in the preparation of a protein degradation agent or an immunotherapy drug.

[0092] Further, the immunotherapy drug can be prepared into an immune checkpoint blocking drug, etc., for anti-tumor.

[0093] The beneficial effects of the present application are:

[0094] 1) The specific lysosome targeting chimera of the present application can bind to the target membrane protein on the surface of tumor cells, degrade the target protein by using the lysosome degradation pathway, further cause tumor apoptosis, and the released tumor-specific antigens further cause an anti-tumor immune response, achieving efficient anti-tumor immunotherapy.

[0095] 2) The specific lysosome targeting chimera of the present application has the property of responding to tumor microenvironment or specific markers, and can only function to degrade membrane proteins at tumor tissue sites, overcoming the problem that current LYTACs do not have tumor selectivity. Therefore, through intravenous administration, the tumor-specific lysosome targeting chimera will not cause degradation of normal cell surface proteins in normal blood circulation. This reduces the impact on normal cells of the patient, avoids on-target off-tumor toxicity, thereby having better safety, and also helps to improve the killing efficiency of immune cells on tumors, enhancing the effect of anti-tumor immunotherapy.

[0096] 3) The specific lysosome targeting chimera of the present application can combine multiple lysosome shuttle receptor aptamers with antibodies, has a multivalent effect, increases the efficiency of the lysosome targeting chimera in simultaneously binding to target proteins and lysosome shuttle receptors, has a greater and higher efficiency in degrading target proteins, further increases the probability of tumor cell apoptosis, improves the efficacy of LYTAC technology in tumor treatment, and increases the application potential of LYTAC technology in tumor treatment.

[0097] 4) The specific lysosome-targeting chimera has the advantages of controllable structure, simple preparation, high yield, and is convenient for mass production and clinical application.

[0098] 5) The lysosome-targeting chimera has a multivalent effect, which makes the target protein recognition structure connected with multiple lysosome shuttle receptor recognition structures, and the efficiency of binding to the lysosome shuttle receptor is higher, thereby improving the degradation efficiency of the target protein, and also enabling sustained action at the target site, achieving the beneficial effect of low dose and high efficacy. In addition to achieving the result of immune checkpoint blockade, the efficient induction of degradation of cell surface PDL1 will lead to tumor cell apoptosis, release of tumor antigens, and stimulation of immune cells to enhance the anti-tumor immune response, which comprehensively combines the continuous response of immunogenic death-antigen presentation and immune cell activation-immune checkpoint blockade effect, thereby realizing a coherent anti-tumor immune response and amplifying the efficacy. BRIEF DESCRIPTION OF DRAWINGS

[0099] Fig. 1 is a response diagram of the switching element of the present application.

[0100] Fig. 2 is a statistical diagram of the change of fluorescence signal of different tumor-specific lysosome-targeting chimeras with pH value.

[0101] Fig. 3 is a statistical diagram of the FAM fluorescence signal intensity of the cell surface in different groups.

[0102] Fig. 4 is a Western blot diagram of PD-L1 protein of cells in different groups.

[0103] Fig. 5 is the PD-L1 content of cells in different groups in Example 5.

[0104] Fig. 6 is a statistical diagram of the apoptosis rate of DC cells in Example 6.

[0105] Fig. 7 is a statistical diagram of the PD-L1 content of CD45+ and CD11+ cells in the peripheral blood of mice in Example 7.

[0106] Fig. 8 is a statistical diagram of the body weight change of tumor-bearing mice in Example 8.

[0107] Fig. 9 is a statistical diagram of the number of CD45+ and CD11+ cells in the peripheral blood of mice in Example 8.

[0108] Fig. 10 is a Western blot diagram of PDL1 protein on the surface of tumor cells.

[0109] Fig. 11 is the tumor volume change of mice in Example 9.

[0110] Fig. 12 is the body weight change of mice in Example 9.

[0111] Figure 13 is the result of PD-L1 protein immunoblotting experiment of PC-3 prostate cancer cell line cells treated with different treatments in Example 10, and the relative content of PD-L1 of other groups was calculated based on the control group.

[0112] Figure 14 is the result of PD-L1 protein immunoblotting experiment of Hela cervical cancer cell line cells treated with different treatments in Example 10, and the relative content of PD-L1 of other groups was calculated based on the control group.

[0113] Figure 15 is the tumor growth curve of 4T1 subcutaneous tumor model of mice in Example 11.

[0114] Figure 16 is a graph of the change in body weight of mice in the 4T1 subcutaneous tumor model of mice in Example 11.

[0115] Figure 17 is a graph of the fluorescence signal intensity of the tumor-specific lysosome-targeting chimera with switch elements of sequences SEQ ID NO. 42-45 at different ATP concentrations in Example 12.

[0116] Figure 18 is a graph of the fluorescence signal intensity of the tumor-specific lysosome-targeting chimera with switch elements of sequences SEQ ID NO. 49-52 at different ATP concentrations in Example 12.

[0117] Figure 19 is a Western blot of PDL1 protein contained on B19F10 tumor cells in different samples detected in Example B1;

[0118] Figure 20 is a Western blot of PDL1 protein of tumor cells in different groups in Example B2;

[0119] Figure 21 is a graph of the PDL1 content of cells incubated for 24 hours at different sample concentrations in Example B3;

[0120] Figure 22 is a graph of the relative content of PDL1 protein on the cell membrane at different time points during the co-incubation of the sample and the cells in Example B4;

[0121] Figure 23 is a graph of the proportion of apoptosis of cells in different groups in Example B5;

[0122] Figure 24 is a graph of the relative activity of cells in different groups in Example B6;

[0123] Figure 25 is a graph of the fluorescence signal captured by laser confocal microscopy of the cell surface calreticulin in Example B7;

[0124] Figure 26 is a graph of the amount of ATP released by cells in different groups in Example B7;

[0125] Figure 27 is a graph of the proportion of dendritic cell maturation in different groups in Example B8;

[0126] Figure 28 is a graph of tumor growth curves of mice in different groups in Example C1. DETAILED DESCRIPTION

[0127] The present application will be further described with reference to the drawings and specific examples, so that those skilled in the art can better understand the present application and implement it. The examples are not intended to limit the present application.

[0128] In this application, unless otherwise specified, A is adenine, T is thymine, C is cytosine, and G is guanine.

[0129] In this application, the term "switching element" refers to a structure that usually has a shielding function for lysosome shuttle receptor aptamer. In a specific environment, the switching element can remove the shielding function. The specific environment includes a specific range of pH value, the presence of potassium ions, ATP (adenosine triphosphate) or other biomarkers.

[0130] The detection equipment and methods used in the examples in the specification are as follows:

[0131] Flow cytometer, BD, model FACSCalibur.

[0132] Confocal microscope, Leica, model TCS SP8.

[0133] Western Blot, refer to the standard procedures known to those skilled in the art.

[0134] Synergy.

[0135] Unless otherwise specified, the non-tumor specific lysosome targeting chimera used in the examples has the structure: X-(R1-L-R2-Y) n . Wherein X is the corresponding antibody of the target protein, i.e. PD-L1 antibody; L is a linking molecule; Y is the nucleic acid aptamer of CI-M6PR, the sequence is SEQ ID NO. 53; n = 6; R1 and R2 are flexible connecting segments.

[0136] The tumor specific lysosome targeting chimera used in the examples is based on the structure of the above-mentioned non-tumor specific lysosome targeting chimera, Y is combined with a switching element, and the switching element is Seq. 1.

[0137] Example 1

[0138] A tumor specific lysosome targeting chimera includes a target protein recognition structure, a lysosome shuttle receptor recognition structure, and a specific response type switching structure switching element.

[0139] The specific sequence of the specific response switch element is shown in the following table, and FIG. 1 is a schematic diagram of a tumor-specific lysosome targeting chimera, wherein the switch element has a complementary pairing region with M6PR, taking CI-M6PR aptamer as an example. In the pH-responsive switch element in the following table, the regular font part is the response region, the italic and bold part is the connection sequence, and the underlined part is the base complementary pairing region of the aptamer.

[0140] Table 1

[0141] Example 2

[0142] The pH-responsive tumor-specific lysosome targeting chimera can open the switch element of the switch structure under a specific pH condition (the slightly acidic condition of the tumor microenvironment), thereby removing the shielding effect on the lysosome shuttle receptor aptamer sequence. That is, under a specific pH condition, the lysosome shuttle receptor aptamer can bind to the lysosome shuttle receptor, so that the LYTAC causes lysosome targeting degradation of the target protein.

[0143] The sample number and the pH corresponding to the 50% structural transition of the switch element (pH T ) are shown in the table:

[0144] Experimental method: The 5' end of the M6PR aptamer is labeled with a fluorescent group tetramethyl rhodamine (TAMRA), and the switch element is labeled with a quenching group BHQ-2. When the nucleic acid aptamer and the switch element are complementary to each other under physiological conditions, no fluorescence signal can be detected. When the tumor-specific lysosome targeting chimera is exposed to low pH, the switch element is opened, the fluorescent group and the quenching group are separated, thereby exposing the fluorescence signal. Therefore, during the pH change process, the stronger the fluorescence signal, the higher the exposure amount of the lysosome shuttle receptor aptamer, so as to be able to bind to the lysosome shuttle receptor on the cell surface. The pH T value is measured by analyzing the structural transition midpoint pH T of the switch element, which can measure whether the designed switch element is suitable for the system, and can cause the switch element to undergo a sensitive conformational transition between the physiological condition pH 7.4 and the tumor microenvironment pH 6.5. In theory, the appropriate pH T should be between pH 6.5-7.4, and can sufficiently inhibit or release the inhibition of CI-M6PR aptamer.

[0145] Figure 2 is a graph showing the change of fluorescence signal of different samples with pH. In the sample of Example 2.1, when the pH is 7.4, simulating the physiological environment pH condition, about 90% of the fluorescence intensity is inhibited, indicating that the switch element substantially completely inhibits the activity of the aptamer; as the pH gradually decreases, the fluorescence intensity gradually increases, and when the pH is about 6.6 (the pH of the tumor microenvironment is about 6.5), the fluorescence signal intensity tends to be balanced, releasing most of the about 80% signal, indicating that Seq. 1 has a switch element response that is substantially fully opened in a slightly acidic environment with a pH of about 6.6 or less, thereby removing the shielding effect on the lysosome shuttle receptor aptamer. In comparison, the corresponding switch element structures of Examples 2.2-2.5 change by about 50% at a pH of about 6.6, 6.75, 7.07, and 5.95, respectively. Among them, the pH of Example 2.5 does not meet the interval from the physiological condition pH 7.4 to the tumor microenvironment pH 6.5, and Examples 2.2-2.4 have a low efficiency of inhibiting / releasing the inhibition of CI-M6PR aptamer. Example 2.1 is the best sequence for constructing a switch element. T

[0146] Therefore, in combination with the data in Figure 2, a tumor-specific lysosome targeting chimera with a switch structure is further designed for degrading specific target proteins in tumor tissues. The tumor-specific lysosome targeting chimera described in the present application can open the switch element and expose the lysosome shuttle receptor aptamer as the pH condition changes, further indicating that the tumor-specific lysosome targeting chimera described in the present application can carry the target protein to the lysosome under the slightly acidic microenvironment conditions at the tumor site, and cannot affect other cells expressing the same protein in the normal physiological environment.

[0147] Example 3:

[0148] Change the pH condition to detect the binding ability of the nucleic acid aptamer end of the tumor-specific lysosome targeting chimera and the lysosome shuttle protein on the surface of tumor cells.

[0149] ​The 5' end of the lysosome shuttle receptor aptamer of the tumor-specific lysosome targeting chimera (nucleic acid aptamer recognizing and binding to cell surface CI-M6PR) is labeled with a FAM fluorescent group, and LYTAC is co-incubated with B16F10 cells, and the pH value of the incubation system is adjusted. It is noted that the expression amount of PD-L1 on the surface of B16F10 cells is low under in vitro conditions without additional IFN-γ stimulation, and therefore the antibody end of LYTAC is approximately considered to be unable to bind to the cells. If FAM signal is detected on the surface of the cells, it can only be due to the binding of the nucleic acid aptamer end to CI-M6PR, and therefore the fluorescence signal intensity on the surface of the cells is quantitatively detected by flow cytometry, so as to determine whether the switch structure on LYTAC inhibits / releases the inhibition of the CI-M6PR binding activity under different pH conditions, and further cannot / can connect with B16F10 cells. In addition, after the B16F10 cells are combined with different samples, the cells are washed with PBS for 3 times and then detected by the machine, and the FAM fluorescence is basically not affected by the pH.

[0150] The groups are as follows:

[0151] Result analysis: the statistical data are shown in FIG. 3, which is a statistical diagram of the FAM fluorescence signal intensity on the surface of the cells in different groups. The results show that in Comparative Example 3.1, only tumor cells, almost no fluorescence signal can be detected, indicating that the content of background fluorescence signal in the system is extremely low. In Example 3.2, the FAM fluorescence signal is weak, which is close to that in Comparative Example 3.1, indicating that under the condition of pH 7.4, the lysosome targeting chimera does not bind to the tumor cells, that is, under the condition of pH 7.4, the switch element of the tumor-specific lysosome targeting chimera has a shielding effect on the targeting group. In Example 3.3, the pH is about 6.5, which simulates the pH condition in the tumor microenvironment of the solid tumor site. The results show that the tumor-specific lysosome targeting chimera successfully binds to the tumor cells, indicating that under the micro-acidic environment, the switch element of the tumor-specific lysosome targeting chimera is opened, exposing the binding site, which can bind to the tumor cells with high efficiency. In Example 3.4, the free CI-M6PR nucleic acid aptamer can successfully bind to the tumor cells under the pH environment of 7.4, which is a positive control group, showing that the switch element in Example 3.3 can fully release the inhibition effect in the tumor micro-acidic environment, and restore the interaction between the tumor-specific lysosome targeting chimera and CI-M6PR, which is conducive to further promoting the degradation of the target protein. In summary, the experimental data in this example show that the tumor-specific lysosome targeting chimera described in the present application can form a complex in the tumor microenvironment with a specific pH value, and does not work in the general body fluid with neutral pH, thereby avoiding binding to other cells carrying the same receptor in the circulation process, and improving the utilization efficiency.

[0152] Example 4:

[0153] Tumor cells and different samples were co-incubated, pH was adjusted, and the protein content of PD-L1 on the surface of tumor cells was detected. The lower the protein content, the more PD-L1 protein on the surface of tumor cells was degraded, indicating that the lysosome-targeting chimera played a role. The tumor cells were B16F10 cell lines.

[0154] The experimental groups were as follows:

[0155] After the cells were co-incubated with the samples for 24 hours, the protein content on the surface of the tumor cells was characterized by Western blotting. The results are shown in Figure 4, which is a Western blotting diagram of PD-L1 protein of different groups of cells. The results show that several groups of cells contain PD-L1 bands, among which, the PD-L1 protein on the surface of tumor cells cannot be degraded in Example 4.1 and Example 4.2. In Example 4.3, under the condition of pH 7.4, the non-tumor-specific lysosome-targeting chimera (the difference compared with the tumor-specific lysosome-targeting chimera is that it does not contain a switch element, the same below) degrades about 57% of PD-L1, indicating that the lysosome-targeting chimera can play a role in degrading PD-L1. In Example 4.4 and 4.5, the tumor-specific lysosome-targeting chimera (with a switch element) is used, and under the condition of pH = 7.4, the PD-L1 on the surface of tumor cells cannot be degraded, but when the pH is adjusted to about 6.5, the content of PD-L1 on the surface of tumor cells decreases significantly by about 61%, close to the degradation effect of the non-tumor-specific lysosome-targeting chimera. It is verified that the tumor-specific lysosome-targeting chimera described in the present application has the characteristics of pH response, and the switch element can basically completely inhibit / resume the activity of degrading PD-L1.

[0156] Example 5:

[0157] The tumor-specific lysosome-targeting chimera will not cause damage to immune cells under normal physiological environmental conditions.

[0158] Different samples were co-incubated with dendritic cells DC2.4 (hereinafter referred to as DC cells) for 24 hours, and the content of PD-L1 on the surface of DC cells was detected. The samples were treated and detected by Western blotting, and the groups and pH conditions were as follows:

[0159] Results are shown in Figure 5. Compared with Comparative Example 5.1, in Example 5.2, due to the lack of tumor specificity of the sample, partial degradation of the PD-L1 protein on the surface of the DC cells occurred in a pH 7.4 environment, while in Example 5.3, the specific lysosome-targeting chimera of the present application did not affect the content of the PD-L1 protein on the surface of the DC cells. The side effects of degrading the PD-L1 on the surface of the DC cells will be further studied.

[0160] Example 6:

[0161] The tumor-specific lysosome-targeting chimera does not cause apoptosis of DC cells under physiological conditions.

[0162] Different samples were incubated with DC cells for 72 hours, then stained with Annexin V-FITC and PI, and the apoptosis of the cells was detected by flow cytometry, and the groups were as follows:

[0163] The proportion of DC cell apoptosis in different groups was counted, and Figure 6 is a graph showing the proportion of DC cell apoptosis in Example 6. The results show that in Comparative Example 6.1 and Comparative Example 6.2, the number of cell apoptosis is small, basically maintained at about 10%. However, in Example 6.3, the DC cells produced significant apoptosis (more than 60%), indicating that the non-tumor-specific lysosome-targeting chimera affects the activity of the DC cells and may cause side effects. In contrast, the tumor-specific lysosome-targeting chimera in Example 6.4 well avoids the side effects on the DC cells, and there is no significant difference compared with Comparative Example 6.1, indicating that the tumor-specific targeting chimera of the present application can reverse the negative effects on the DC cells, thereby being more beneficial to the overall anti-tumor treatment. However, due to the difference in the survival environment of the cells in vitro and in vivo, the extent of the effect of the lysosome-targeting chimera on the DC cells in actual use still needs to be further explored and verified.

[0164] Example 7:

[0165] In vivo verification of the degrading effect of the tumor-specific lysosome-targeting chimera on the PD-L1 of the DC cells

[0166] Experimental method:

[0167] The mice were intravenously infused with sample solutions, 20 or 40 μg per mouse (in 200 μL of normal saline), and the sample doses are shown in the table below. On the first day after injection, the peripheral blood of the mice was taken, and the content of the PD-L1 on the surface of the CD45+ and CD11+ cells in the peripheral blood of different groups was detected by flow cytometry, and a statistical graph was made.

[0168] Grouping explanation:

[0169] Results analysis:

[0170] The relative content of PD-L1 on the surface of CD45 and CD11c double positive cells (i.e. DC cells in peripheral blood) of mice was detected on the first day after administration, and the results are shown in Figure 7, which is a statistical diagram of the PD-L1 content of CD45+ and CD11+ cells in the peripheral blood of mice in Example 7. The results show that the relative content of PD-L1 on the surface of DC cells in the peripheral blood of mice in Example 7.2 is higher, but compared with the control group, it decreases by about 15%, while the content of PD-L1 on the surface of DC cells in the peripheral blood of mice in Example 7.3 decreases by a large margin of about 60%, and the content of PD-L1 on the surface of DC cells in the peripheral blood of mice in Example 7.4 and Example 7.5 is at a higher level, which is almost consistent with the control group. It is proved that the tumor-specific lysosome targeting chimera does not reduce the content of PD-L1 on the surface of DC cells in the peripheral blood of mice, i.e. the tumor-specific lysosome targeting chimera does not cause the degradation of PD-L1 on the surface of DC cells in the peripheral blood, thereby avoiding the potential side effect risk to DC cells in the peripheral blood, and having better safety.

[0171] Example 8: Change in the number of CD45+CD11+ cells in the peripheral blood of mice

[0172] The tumor-bearing mice were intravenously infused with sample solutions, 20 or 40 μg per mouse (in 200 μL of normal saline), administered once, and the sample doses are shown in the following table.

[0173] Grouping explanation:

[0174] The proportion of CD45+CD11c+ cells (i.e. DC cells in peripheral blood) in CD45+ cells (i.e. total immune cells) in the peripheral blood of mice was detected on the 1st, 3rd, 5th, and 7th days after administration. As shown in Figure 8, in Example 8.2, the non-tumor-specific lysosome targeting chimera has a fluctuating effect on DC cells in the peripheral blood, and the DC cells basically recover to the level consistent with Example 8.1 after 7 days of administration, but in Example 8.3, after a higher dose is administered, the DC cells in the peripheral blood of mice do not completely recover within a week, and decrease significantly by about 50%. On the contrary, in Example 8.4 and Example 8.5, the tumor-specific lysosome targeting chimera does not significantly affect the DC cells in the peripheral blood, proving that the activity of the tumor-specific lysosome targeting chimera in degrading DC-PD-L1 in the peripheral blood can be completely inhibited under physiological conditions, and it can be inferred that the tumor-specific lysosome targeting chimera has higher availability and safety.

[0175] In addition, on the 7th day of administration, we further analyzed the DCs in the lymph nodes of mice and found that the high-dose non-tumor-specific lysosome-targeting chimera of Example 8.3 significantly reduced the proportion of DCs in total immune cells in the lymph nodes (Figure 9), which may be the result of affecting the homing of peripheral blood DCs to the lymph nodes. DCs in the lymph nodes play an important role in anti-tumor immunity.

[0176] At the same time, the relative value of the content of PD-L1 on the cell surface of tumor cells in tumor-bearing mice was detected by WB, and Figure 10 is the protein immunoblotting map of PD-L1 protein on the cell surface of tumor cells, and the content relative to the blank control group was counted. The results show that whether the lysosome-targeting chimera is tumor-specific or not, it can achieve the effect of degrading the content of PD-L1 on the cell surface of tumor cells, and the tumor-specific lysosome-targeting chimera has a more excellent degradation effect than the non-specific one. At the same dose, the tumor-specific lysosome-targeting chimera acts more on the degradation of PD-L1 on the cell membrane surface of tumor cells, has better utilization, higher efficiency and higher safety.

[0177] Example 9:

[0178] Therapeutic experiment

[0179] The tumor-specific lysosome-targeting chimera described in the present application was verified for its therapeutic effect on solid tumors on a mouse subcutaneous tumor model. The grouping is as follows:

[0180] Experimental method: B16 cells were inoculated on the back of mice to establish a mouse subcutaneous melanoma model, and the first intravenous infusion of samples was taken as the 0th day. The average tumor volume of mice was about 50 cubic millimeters, and the above-mentioned doses of samples were injected through the tail vein on the 0th day, the 3rd day, the 6th day, and the 9th day, respectively. The tumor volume was recorded every two days, and the statistical results are shown in Figure 11. The body weight of mice was recorded every two days, and the statistical results are shown in Figure 12.

[0181] Result analysis:

[0182] From the data analysis of Fig. 11, it can be found that the tumor growth curves of Examples 9.2-9.4 are slower than that of Comparative Example 9.1, and the effect is more significant, indicating that the lysosome-targeting chimera has a tumor treatment effect. Secondly, the treatment effect is improved when the same sample dose is increased in Example 9.2 and Example 9.3, and in Example 9.4 and Example 9.5. Most importantly, it is observed that the tumor-specific lysosome-targeting chimera has a better treatment effect than the non-specific lysosome-targeting chimera at the same dose. On the one hand, it indicates that the tumor-specific lysosome-targeting chimera has a tumor treatment effect, and on the other hand, it indicates that increasing the dose of the sample in the tumor site helps to increase the treatment effect, and in combination with the in vitro experimental data and the data of this example, it can be reasonably speculated that the tumor-specific lysosome-targeting chimera reduces the binding in the non-tumor site, thereby increasing the effective amount of molecules that play a role in killing tumors in the whole system, thereby further increasing the treatment effect and being more helpful for clinical application.

[0183] From the data analysis of Fig. 12, the body weight of most mice does not decrease significantly during the entire treatment period, indicating that the sample has good safety, but the body weight of the mice in Example 9.3 increases more slowly, which may be due to the non-specific adsorption of the lysosome-targeting chimera to immune cells, which has a slight effect on the health of the mice, and the specific lysosome-targeting chimera has better safety.

[0184] Example 10:

[0185] Detection of PD-L1 degradation ability of tumor-specific lysosome-targeting chimera in human cell lines.

[0186] The experimental method is the same as that of Example 4, except that the cells used are human Hela cervical cancer cell lines and PC-3 prostate cancer cell lines.

[0187] Grouping:

[0188] Fig. 13 is the relative content of PD-L1 of PC-3 prostate cancer cell lines after different treatments. Fig. 14 is the relative content of PD-L1 of Hela cervical cancer cell lines after different treatments. The results show that the tumor-specific lysosome-targeting chimera described in the present application can degrade PD-L1 on the surface of tumor cells in a pH environment of about 6.5, and does not have the function of degrading PD-L1 in an environment with a pH of about 7.4, indicating that the tumor-specific lysosome-targeting chimera described in the present application has the characteristic of pH response, and the pH environment in general solid tumors is weakly acidic, indicating that the present application has tissue selectivity and will not degrade the same antigen on the surface of other cells in other environments in vivo, thereby having better safety.

[0189] Example 11:

[0190] The therapeutic effect of the tumor-specific lysosome targeting chimera described in the present application in a mouse 4T1 subcutaneous tumor model.

[0191] The experimental method is the same as in Example 9, except that the tumor model is different, and a mouse 4T1 subcutaneous tumor model is established in advance, and dosing is performed after random grouping.

[0192] Grouping:

[0193] Figure 15 is a mouse tumor growth curve in Example 11, and Figure 16 is a mouse body weight change curve in Example 11. The results show that the tumor volume growth rate of mice treated with a 40 μg dose of the tumor-specific lysosome targeting chimera is significantly lower than that of other groups (** represents p≤0.01), indicating that the tumor-specific lysosome targeting chimera described in the present application has better efficacy. And compared with the same dose of non-specific lysosome targeting chimera, the efficacy is better.

[0194] Example 12:

[0195] The ATP-responsive tumor-specific lysosome targeting chimera can open the switch element of the switch structure under the action of ATP, thereby removing the shielding effect on the lysosome shuttle receptor aptamer sequence, i.e. in a certain concentration of ATP environment, the lysosome shuttle receptor aptamer can bind to the lysosome shuttle receptor, so that the LYTAC causes lysosome targeting degradation of the target protein. The sequence is constructed and tested for ATP response.

[0196] Experimental method: The 5' end of the M6PR nucleic acid aptamer is labeled with a fluorescent group tetramethyl rhodamine (TAMRA), and the switch element is labeled with a quenching group BHQ-2. When the nucleic acid aptamer and the switch element are complementary to each other under physiological conditions, no fluorescence signal can be detected. When the tumor-specific lysosome targeting chimera is exposed to an environment containing ATP, the switch element is opened, the fluorescent group and the quenching group are separated, and the fluorescence signal is exposed. Therefore, in an environment with different ATP concentrations, the stronger the fluorescence signal detected, the higher the exposure of the lysosome shuttle receptor aptamer, and the higher the probability of binding to the lysosome shuttle receptor on the cell surface. The ATP content in peripheral blood and healthy tissue stroma is 10-100 nM, which is extremely low, while the ATP content in the tumor microenvironment is about 1-5 mM. When the ATP-responsive switch element can be opened in this concentration range and has no response in the nM level, it indicates that the switch element can meet the specific response requirements.

[0197] The experimental results are shown in Figure 17, which is a statistical diagram of the fluorescence signal intensity of the tumor-specific lysosome targeting chimera with the switch element being SEQ ID NO. 42-45 respectively under different ATP concentrations. The results show that the four sequences can meet the requirements of ATP-specific response switch element, and can realize the function of lysosome targeting degradation in the ATP concentration environment of tumor differentiation from other normal tissues.

[0198] Figure 18 is a statistical diagram of the fluorescence signal intensity of the tumor-specific lysosome targeting chimera with the switch element being SEQ ID NO. 49-52 respectively under different ATP concentrations. The results show that the four sequences can meet the requirements of ATP-specific response switch element, and can realize the function of lysosome targeting degradation in the ATP concentration environment of tumor differentiation from other normal tissues.

[0199] The present application also provides a multivalent lysosome targeting chimera (LYTAC) containing a target protein recognition structure and a ligand structure targeting a lysosome shuttle receptor, and one target protein recognition structure is connected to more than one ligand structure. This multivalent protein degradation agent has better stability in vivo and higher degradation efficiency.

[0200] Example A1: A multivalent lysosome targeting chimera comprising a target protein recognition structure and a lysosome shuttle receptor recognition structure. The specific structural composition is shown in the following table:

[0201] Example A2: A preparation method of a multivalent lysosome targeting chimera:

[0202] The amino group of the PDL1 antibody is replaced by azide to obtain an azide-modified PDL1 antibody; the CI-M6PR aptamer is modified by DBCO to obtain a DBCO-modified CI-M6PR aptamer;

[0203] The azide-modified PDL1 antibody and the DBCO-modified CI-M6PR aptamer are connected by click chemistry reaction.

[0204] The experimental method for preparing the LYTAC by the azide-modified antibody and the click chemistry reaction is as follows:

[0205] 1) Mix 30 mM of PDL1 antibody with 1.5 mM of bifunctional crosslinker NHS-PEG4-N3 in neutral PBS buffer and react under gentle stirring for 1 hour (300 rpm, 25 °C) to obtain the product, i.e. azido-modified PDL1 antibody.

[0206] 2) After the reaction is completed, the product is filtered with a 50 kD ultrafiltration centrifuge tube and washed with neutral PBS buffer to completely remove excess bifunctional crosslinker NHS-PEG4-N3.

[0207] 3) Mix 10 mM of PDL1 antibody with azido group with DBCO-modified nucleic acid aptamer and incubate at 25 °C for 1-24 hours to obtain the lysosome-targeting chimera. To remove excess DBCO-oligonucleotide, the lysosome-targeting chimera needs to be ultrafiltrated using a 50 kD ultrafiltration centrifuge filter and washed with neutral PBS buffer.

[0208] 4) Finally, collect the lysosome-targeting chimera and store at 4 °C for standby use.

[0209] By adjusting the feeding ratio of azido-modified PDL1 antibody and DBCO-modified CI-M6PR nucleic acid aptamer, multivalent lysosome-targeting chimeras can be obtained. For Examples A1.1-A1.4, the feeding amounts are shown in the following table:

[0210] The multivalent lysosome-targeting chimera is an antibody connected with multiple nucleic acid aptamers, which can increase the affinity (efficiency) of the antibody recognizing ligands and binding with lysosome shuttle proteins, thereby improving the effect of lysosome targeting.

[0211] Example B1: PDL1 degradation efficiency detection experiment of lysosome-targeting chimera.

[0212] 10 5 B19F10 tumor cells were respectively incubated with 10 nM of lysosome-targeting chimeras of Examples A1.1-A1.4, and then the content of PDL1 on the tumor cells was detected using western blot technology. In addition, the amount of lysosome-targeting chimera was increased, 10 5 nM of lysosome-targeting chimeras of Examples A1.1-A1.4, and the content of PDL1 on the tumor cells was also detected using western blot technology.

[0213] Figure 19 is a PDL1 protein blotting chart of B19F10 tumor cells in different samples, the darker the band, the higher the PDL1 content, and the lighter the band, the lower the PDL1 content. As can be seen from Figure 19, the lysosome-targeting chimeras of Examples A1.1 to A1.4 can all reduce the content of PDL1 in tumor cells, indicating that the lysosome-targeting chimeras of the present application have the ability to down-regulate the level of PDL1. Secondly, as the amount of lysosome-targeting chimeras increases, the efficiency of degrading PDL1 increases, among which the lysosome-targeting chimeras of Examples A1.1, A1.2 and A1.3 have a higher correlation between the efficiency of degrading PDL1 and the amount, and the lysosome-targeting chimeras of Example A1.4 cannot improve the degradation efficiency to a corresponding degree with the increase of the amount, which is probably because too many aptamers coupled to the antibody can affect the recognition efficiency between the antibody and PDL1, thereby interfering with the binding of the lysosome-targeting chimeras and the target protein, and further affecting the efficiency of lysosome targeting and dissolution.

[0214] In summary, the lysosome-targeting chimeras of the present application can cause a significant multivalent effect by increasing the number of aptamers coupled to the antibody, significantly improve the efficiency of lysosome-targeting chimeras degrading target proteins relative to coupling a single aptamer, and can achieve down-regulation of target protein content at a lower dosage, thereby enhancing the effect of anti-tumor immunotherapy.

[0215] Example B2: Verify that the lysosome-targeting chimeras of the present application degrade PDL1 through the lysosome degradation pathway by adding different inhibitors.

[0216] Experimental method: 10 5 B16F10 cells were incubated with 50 nM of the lysosome-targeting chimeras of Example A1.2, 5 μM of MG132 proteasome inhibitor or 100 μM of Chloroquine lysosome inhibitor was added, and after 24 hours of incubation, the content of PDL1 protein on the tumor cells was detected by western blot.

[0217] Blank control: cells were not treated;

[0218] Comparative Example B2.1: B16F10 cells were incubated with the lysosome-targeting chimeras of Example A1.2;

[0219] Example B2.2: B16F10 cells were incubated with the lysosome-targeting chimeras of Example A1.2 and MG132 proteasome inhibitor;

[0220] Example B2.3: B16F10 cells were incubated with the lysosome-targeting chimeras of Example A1.2 and Chloroquine lysosome inhibitor.

[0221] Figure 20 is a Western blot of PDL1 of tumor cells in different groups in Example B2. The results show that in Example B2.2, the addition of proteasome inhibitor has no effect on the efficiency of PDL1 protein degradation by the lysosome-targeting chimera of Example A1.2; while in Example B2.3, the addition of lysosome inhibitor can significantly interfere with the degradation of PDL1 protein by the lysosome-targeting chimera of Example A1.2, and almost no degradation of PDL1 can be achieved, indicating that the lysosome-targeting chimera of the application achieves the degradation of PDL1 through the lysosome pathway rather than the proteasome pathway.

[0222] Example B3:

[0223] Experimental method: according to the method of Example B1, the difference is that the multivalent lysosome-targeting chimera is from Example A1.2, and the concentrations are 2nM, 5nM, 10nM, 50nM and 100nM, respectively. Each group of samples is incubated with 10 5 B16F10 cells for 24 hours.

[0224] Experimental results: Figure 21 is a statistical diagram of PDL1 content after 24 hours of incubation of cells in different sample concentrations in Example B3, wherein the abscissa is the concentration of multivalent lysosome-targeting chimera, and the ordinate is the relative content of cell surface PDL1. The results show that as the concentration of multivalent lysosome-targeting chimera increases, more PDL1 protein on the cell surface is degraded in the same time, indicating that the higher the concentration of multivalent lysosome-targeting chimera, the higher the efficiency of degrading PDL1 protein on the cell membrane. And it shows that the multivalent lysosome-targeting chimera of the application has good uniformity, which can ensure the consistency of degradation efficiency and concentration.

[0225] Example B4: Experimental verification of the sustained effect of the lysosome-targeting chimera of the application on the degradation of PDL1.

[0226] About 10 5B16F10 cells were incubated with 50 nM of the lysosome-targeting chimera of Example A1.2, and the relative content of PDL1 protein on the cell membrane was detected at different time points (4 hours, 8 hours, 12 hours, 20 hours, 30 hours). Figure 22 is a statistical diagram of the relative content of PDL1 protein on the cell membrane at different time points during the incubation. The results show that within 12 hours, the content of PDL1 antibody was significantly down-regulated, and around 12 hours, PDL1 antibody was almost completely degraded. After 20 hours, the down-regulation rate of the content of PDL1 protein on the membrane surface of the sample decreased, and the relative content reached a very low level, indicating that the lysosome-targeting chimera can achieve sustained down-regulation of the expression of PDL1 antibody on the cell membrane surface and maintain the content of PDL1 at a low level. That is, the lysosome-targeting chimera can down-regulate the PDL1 antibody on the cell membrane surface of the tumor in vivo for a long time, thereby achieving the effect of anti-tumor immunotherapy.

[0227] Example B5: After the lysosome-targeting chimera of the present application down-regulates the level of PDL1 protein on the surface of tumor cells, it can cause cell apoptosis.

[0228] Since the intracellular part of PDL1 protein is also involved in cell proliferation, metastasis and other signaling pathways, it is speculated that the degradation of cell membrane PDL1 can cause the tumor cells to slow down the proliferation. This example was designed to verify it.

[0229] Grouping:

[0230] Comparative Example B5.1: No treatment

[0231] Example B5.2: PDL1 antibody

[0232] Example B5.3: Unconjugated PDL1 antibody and CI-M6PR aptamer

[0233] Example B5.4: Lysosome-targeting chimera of Example A1.2

[0234] Experimental method: About 10 5 B16F10 cells were incubated with different samples (to be supplemented to the concentration) for 24 hours, and flow cytometry was used to detect the proportion of cell apoptosis.

[0235] Figure 23 is a statistical diagram of the apoptosis rate of different groups of cells in Example B5, and the results show that the lysosome-targeting chimera of the present application can cause apoptosis of most tumor cells. That is, after the PDL1 protein on the cell membrane is degraded, it directly leads to the apoptosis of tumor cells, which has never been reported in the prior art. It is an unexpected finding that the lysosome-targeting chimera of the present application has the effect of inducing tumor cell apoptosis. The lysosome-targeting chimera with multivalent effect of the present application has stronger targeted degradation efficiency than the lysosome-targeting chimera in the prior art. Therefore, in addition to having an immune checkpoint blocking effect, it will also cause spontaneous apoptosis of tumor cells. The lysosome-targeting chimera of the present application has an unexpected technical effect.

[0236] Example B6: MTT experiment

[0237] This example is used to explore the effective concentration of the multivalent lysosome-targeting chimera.

[0238] Logarithmic phase B16F10 cells were inoculated into a 96-well plate at a density of 10,000 cells per well. After overnight culture, different concentrations of different samples were added for incubation. After 24 hours of incubation, the culture medium was removed and replaced with fresh culture medium, and MTT solution (1 mg / mL) was added for about 4 hours of incubation. The culture medium was removed, 150 μL of dimethyl sulfoxide was added to each well to dissolve the crystals in the cells, and then the OD value at 570 nm was detected using an enzyme-linked immunosorbent assay instrument. The cell survival rate was calculated according to the formula: survival rate = (experimental group absorbance / control group absorbance) x 100%.

[0239] Grouping explanation:

[0240] Experimental results:

[0241] Figure 24 is a statistical diagram of the relative activity of cells in different groups in Example B6, and the experimental results show that the relative survival rate of the cells in the blank control group is 100%. Compared with the blank control group, the increase in the concentration of the multivalent targeting chimera sample gradually enhances the killing effect of the multivalent lysosome-targeting chimera on tumor cells within the same time. The half-inhibitory concentration (IC50) of the lysosome-targeting chimera of the present application is about 4.2 nM. The smaller the IC50, the stronger the ability to kill tumor cells, indicating that the lysosome-targeting chimera of the present application has the effect of inducing tumor cell death.

[0242] The lysosome-targeting chimera has a multivalent effect, greatly improving the degradation efficiency of PDL1 protein. A large amount of PDL1 degradation leads to the death of tumor cells. Therefore, the lysosome-targeting chimera can not only achieve the complete removal of PDL1, cause immune checkpoint blocking, and enhance the effect of immune cells on recognizing and killing tumor cells, but also directly cause the apoptosis of tumor cells, expose tumor-associated antigens, stimulate immune cells to enhance the anti-tumor immune response, have multiple effects, and significantly enhance the tumor treatment effect.

[0243] Example B7: It is proved that the apoptosis of tumor cells caused by the lysosome-targeting chimera of the present application can enhance the immunogenicity of tumor cells. This embodiment is designed to prove that the surface calreticulin of tumor cells increases after the action of the lysosome-targeting chimera.

[0244] Comparative Example B7.1: Blank control

[0245] Comparative Example B7.2: PDL1 antibody and tumor cells are co-incubated

[0246] Comparative Example B7.3: Unconjugated PDL1 antibody and CI-M6PR aptamer are co-incubated with tumor cells

[0247] Example B7.4: The lysosome-targeting chimera of Example A1.2 is co-incubated with tumor cells

[0248] Experimental method: To be supplemented with amount, detection method, etc.

[0249] The cells treated in different groups are labeled with a calreticulin detection kit, and the labeling method is performed according to the instructions. Then, the cells are fixed with 4% paraformaldehyde, and stained with Hoechst to label the cell nucleus, and then the stained cells are observed by laser confocal microscopy.

[0250] The increase of calreticulin on the surface of tumor cells makes the tumor cells more easily recognized by immune cells, promotes the antigen presentation of tumor cells, causes immune activation effect, and then induces anti-tumor immune response. FIG. 25 is a fluorescence signal diagram of laser confocal capture of cell surface calreticulin in Example B7.

[0251] FIG. 25 shows that the cells of Example B7.4 have increased calreticulin expression, indicating that the lysosome-targeting chimera causes an increase in the surface calreticulin of tumor cells, thereby helping immune cells to recognize tumor cells and enhancing the efficacy of anti-tumor immunotherapy.

[0252] In addition, ATP release is another indicator of the immunogenicity of tumor cells. The higher the ATP release, the stronger the immunogenicity.

[0253] Figure 26 is a graph showing the amount of ATP released from cells in different groups in Example B7. The results show that the lysosome-targeting chimera of Example A1.2 can cause a significant increase in the amount of ATP released from tumor cells after acting on the tumor cells. Both the released ATP and the exposed tectin are damage-associated molecular patterns (DAMPs) that are positively correlated with the immunogenicity of tumor cells, indicating that the lysosome-targeting chimera described herein can enhance the immunogenicity of tumor cells. The enhancement of the immunogenicity of tumor cells can cause the occurrence of a strong anti-tumor immune response, and thus the lysosome-targeting chimera described herein can cause a strong anti-tumor immune response, thereby achieving the purpose of anti-tumor immunotherapy.

[0254] Example B8: Experiment of using the apoptotic cell product of Example 9 to stimulate the maturation of bone marrow-derived dendritic cells (BMDCs).

[0255] Grouping:

[0256] Comparative Example B8.1: Co-incubation of the apoptotic cell product of Comparative Example B7.1 with bone marrow-derived dendritic cells

[0257] Comparative Example B8.2: Co-incubation of the apoptotic cell product of Comparative Example B7.2 with bone marrow-derived dendritic cells

[0258] Example B8.3: Co-incubation of the apoptotic cell product of Example B7.4 with bone marrow-derived dendritic cells

[0259] Experimental method:

[0260] Bone marrow cells were isolated from the femur and tibia of male C57BL / 6 mice, and the isolated bone marrow cells were cultured in a medium containing granulocyte macrophage colony-stimulating factor (GM-CSF, at a concentration of 20 ng / mL) and interleukin-4 (IL-4, at a concentration of 10 ng / mL). After 5 days of culture, a small amount of cells was taken for examination of maturity by CD11c flow cytometry antibody staining, to confirm that the myeloid cells had differentiated into DC cells. At the same time, B16F10 tumor cells were co-incubated with different samples (50 nM) for 48 hours, and then the tumor cells treated with different samples were co-incubated with DC cells at a ratio of 1:1 for 3 days. Finally, the DC cells were collected and the expression of CD80 and CD86 on the DC cells was determined by flow cytometry. CD80 and CN86 are key markers of DC cell maturation, and cells that are positive for both CD80 and CD86 are mature myeloid DC cells.

[0261] Myeloid-derived dendritic cells are currently the most powerful antigen-presenting cells, and dendritic cells are the only antigen-presenting cells that can significantly stimulate the proliferation of initial T cells, so dendritic cells are the key link of the adaptive T cell immune response of the organism, and have a very important role in tumor immunotherapy. The maturation ratio of dendritic cells will affect the degree of subsequent anti-tumor immune response, the higher the maturity, the stronger the expected anti-tumor immune response.

[0262] Figure 27 is a statistical graph of the maturation ratio of dendritic cells in different groups in Example B8, and the results show that the apoptotic products of Example B7.4 can cause the maturation of myeloid-derived dendritic cells, indicating that the lysosome-targeting chimera described in the present application can cause an anti-tumor immune response, and achieve anti-tumor immunotherapy at the level of the living body.

[0263] Example C1: Animal experiments show that the lysosome-targeting chimera described in the present application can cause an anti-tumor immune response and inhibit tumor growth and metastasis.

[0264] The mice were inoculated with tumor cells (about 5x10 5 B16F10 cells) on the back, and the tumors were allowed to grow to 25mm 3 in diameter. The mice were randomly divided into groups, and the grouping is as follows:

[0265] Comparative Example C1.1: blank control group, no treatment of mouse tumor

[0266] Comparative Example C1.2: PDL1 antibody treatment of tumor-bearing mice

[0267] Example C1.3: PDL1 antibody and M6PR aptamer mixture treatment of tumor-bearing mice, the dose ratio of PDL1 antibody and M6PR aptamer is 1:6

[0268] Example C1.4: lysosome-targeting chimera of Example A1.2 treatment of tumor-bearing mice

[0269] Experimental method:

[0270] Comparative Example C1.2, Example C1.3, and Example C1.4 were each injected intravenously with 20 μg of PDL1 antibody or the same concentration of LYTAC (quantified by PDL1), once every 3 days, a total of 4 times, and the change in tumor volume was recorded, and a tumor growth curve was made, and the results are shown in Figure 28.

[0271] Experimental results: Figure 28 is a tumor growth curve of mice in different groups in Example C1, and the results show that the traditional immune checkpoint blockade therapy used in Comparative Example C1.2 cannot well inhibit tumor growth, and the effect of using only the lysosome-targeting receptor nucleic acid aptamer mixed with the PDL1 antibody in Example C1.3 is the same as that of the immune checkpoint blockade therapy alone. In Example C1.4, the lysosome-targeting chimera therapy according to the present application is used, which has a significant effect of inhibiting tumor growth. It shows that the lysosome-targeting chimera according to the present application has a good application prospect in inducing anti-tumor therapy in vivo, and has good curative effect. The lysosome-targeting chimera according to the present application can be administered intravenously, and the administration method is convenient and efficient.

[0272] Example D: Multivalent lysosome-targeting chimeras of other connecting molecules and their efficiency in degrading proteins.

[0273] According to the preparation method of Example A2, a plurality of multivalent lysosome-targeting chimeras are prepared, all of which have the effect of degrading target proteins, and the degradation efficiency is better than that of the monovalent lysosome-targeting chimera.

[0274] The detection equipment and methods used in the above examples are: flow cytometry, BD, model FACSCalibur. Confocal microscope, Leica, model TCS SP8. Western Blot.

[0275] In summary, the lysosome-targeting chimeras with multivalent effect described above make the target protein recognition structure connected with multiple lysosome shuttle receptor recognition structures, and the efficiency of binding to the lysosome shuttle receptor is higher, thereby improving the degradation efficiency of the target protein. The multivalent lysosome-targeting chimeras of the present application are prepared by covalent coupling reaction, and the synthesis method is simple, the reaction efficiency is high, the purification operation is easy, and the overall preparation cost is low.

[0276] The multivalent lysosome-targeting chimeras of the present application have good stability in vivo, and no adverse reactions occur that are not conducive to physiological activity, and due to the high recognition efficiency, they can be better enriched in the tumor site, improving the safety of use.

[0277] The multivalent lysosome-targeting chimeras of the present application can have a sustained effect at the target site, achieving the beneficial effect of low dose and high efficacy. In addition to achieving the results of immune checkpoint blockade, it can also induce the degradation of cell surface PDL1, leading to tumor cell apoptosis, releasing tumor antigens, stimulating immune cells to enhance anti-tumor immune response, and combining the continuous reactions of immunogenic death-antigen presentation and immune cell activation-immune checkpoint blockade effect, thereby realizing a coherent anti-tumor immune response and amplifying the efficacy.

[0278] Obviously, the above-described embodiments are merely meant to be illustrative examples, and are not meant to limit the embodiments.

[0279] While the foregoing disclosure discusses some presently contemplated embodiments of the application by way of various examples, it is to be understood that such specifics are merely for the purposes of illustration and that the additional claims are not limited to the embodiments disclosed, but rather, the claims are intended to cover all modifications and equivalent arrangements that are consistent with the spirit and scope of the embodiments of the application.

[0280] Similarly, it is to be noted that, in order to simplify the description of the application and to help in the understanding of one or more embodiments of the application, the foregoing description of the embodiments of the application sometimes incorporates features that are described in relation to one embodiment, drawing or description of the embodiments of the application into a single embodiment, drawing or description of the embodiments of the application. However, this method of disclosure is not meant to imply that the claimed application requires more features than those mentioned in the claims. In fact, the features of the embodiments of the application are less than all of the features of the single embodiments of the disclosure described above.

[0281] Some embodiments use numerical descriptions of components, quantities of attributes, it should be understood that such numerical descriptions of the embodiments, in some examples, using the adverb "about", "approximately" or "generally" to modify. Unless otherwise stated, "about", "approximately" or "generally" indicates that the number allows ± variation. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximations that can vary depending on the desired characteristics of the individual embodiments.

[0282] Finally, it should be understood that the embodiments described herein are merely for the purpose of illustrating the principles of the embodiments of the application. Other variations can also be within the scope of the application. Thus, for example, alternative configurations of the embodiments of the application can be considered as consistent with the teachings of the application. Accordingly, the embodiments of the application are not limited to the embodiments explicitly introduced and described herein.

Claims

1. A response-type switching element characterized by, The responsive switch element is a DNA sequence, and a plurality of DNA functional regions are connected thereon, and the responsive switch element is capable of binding to the target nucleic acid aptamer in the non-responsive state and separating from the target nucleic acid aptamer in the responsive state, and at least one of pH, ions, and biomolecules.

2. The response-type switching element according to claim 1, wherein The responsive switch element comprises at least one of the following I-III in sequence from the 5' end to the 3' end of the DNA sequence: I. The responsive switch element is provided with a response region, a connection sequence, a response region, a base complementary region, a response region, a connection sequence, and a response region, and the response region comprises a plurality of cytosines; II. The responsive switch element is provided with a first response region, a connection sequence, a base complementary region, a connection sequence, and a second response region, and the first response region and the second response region are split from a sequence comprising a core sequence 5'-GGGTAGGGCGGGTTGGG-3'; III. The responsive switch element is provided with a third response region, a base complementary region, and a fourth response region, and a biomolecule nucleic acid aptamer is split into a first sequence and a second sequence, the third response region comprises the first sequence, the fourth response region comprises the second sequence, and the third response region and the fourth response region can form a hairpin structure with the biomolecule; The base complementary region is used for complementary pairing with the target nucleic acid aptamer.

3. The response-type switching element according to claim 2, wherein The base complementary region and the target nucleic acid aptamer have at least any 5 continuous bases involved in complementary pairing.

4. The response-type switching element according to claim 2, wherein The nucleotides of the connection sequence are selected from any one or both of A and T, and the number of the nucleotides of the connection sequence is 1-8.

5. The response-type switching element according to claim 2, wherein When responding to pH, the response region comprises 4-8 cytosines.

6. The response-type switching element according to claim 2, wherein When responding to potassium ions, the first response region and the second response region are split from a sequence comprising a core sequence 5'-GGGTAGGGCGGGTTGGG-3', and the split site is located on the core sequence, and the number of G bases of the core sequence on the first response region and the second response region after splitting is 1:1 or 3:

1.

7. The response-type switching element according to claim 2, wherein The third response region and the fourth response region further comprise an extension sequence for stabilizing the first sequence and / or the second sequence, the extension sequence is 1-3 bases, each base is independently selected from G, C, A, and T, the extension sequence is located at the 3' end of the first sequence and the 5' end of the second sequence, and the two extension sequences are complementary to each other.

8. The response-type switching element according to claim 2, wherein The biomolecule nucleic acid aptamer comprises at least the sequence shown in the following formula: ACCTGGGGGAGTATGCGGAGGAAGGT, and the third response region comprises at least ACCTGGGGGAGTA, and the fourth response region comprises at least TGCGGAGGAAGGT.

9. The response-type switching element according to claim 1, wherein The responsive switch element comprises any one of the sequences shown in SEQ ID NO. 1-52.

10. A tumor-specific lysosome targeting chimera, comprising, The lysosome shuttle receptor recognition structure comprises at least one target lysosome shuttle receptor nucleic acid aptamer, and the target lysosome shuttle receptor nucleic acid aptamer can bind to the base complementary region on the responsive switch element.

11. The tumor-specific lysosome targeting chimera of claim 10, wherein, The tumor-specific lysosome targeting chimera comprises a target protein recognition structure, and the target protein recognition structure and the lysosome shuttle receptor recognition structure are connected by a connecting molecule.

12. The tumor-specific lysosome targeting chimera of claim 11, wherein, The connecting molecule is a molecule that is not degradable in the tumor microenvironment.

13. The tumor-specific lysosome targeting chimera of claim 10, wherein, The tumor-specific lysosome targeting chimera comprises a structure as described below: a target protein recognition structure and a lysosome shuttle receptor recognition structure connected by a connecting molecule, and the molar ratio n of the lysosome shuttle receptor recognition structure to the target protein recognition structure is ≥1.

14. The tumor-specific lysosome targeting chimera of any one of claims 10-13, wherein, The connecting molecule contains at least one of the following structures: an amide bond, a triazole ring, a sulfide bond, and a disulfide bond.

15. The tumor-specific lysosome targeting chimera of claim 14, wherein, The linking molecule contains at least one of the following structures:

16. Use of the responsive switch element of any one of claims 1-9 or the tumor-specific lysosome targeting chimera of any one of claims 10-15 in the preparation of a protein degrading agent or an immunotherapeutic drug.

17. An antitumor agent, characterized by comprising: the compound or salt according to claim 1 or 2. The anti-tumor drug contains the responsive switch element of any one of claims 1-9 or the tumor-specific lysosome targeting chimera of any one of claims 10-15.

18. A multivalent lysosome targeting chimera, comprising, The multivalent lysosome targeting chimera comprises a structure as described below: a target protein recognition structure and a lysosome shuttle receptor recognition structure connected by a connecting molecule, and the molar ratio n of the lysosome shuttle receptor recognition structure to the target protein recognition structure is >1.

19. Use of the multivalent lysosome targeting chimera of claim 18 in the preparation of a protein degrading agent or an immunotherapeutic drug.

Citation Information

Patent Citations

  • Lysosome targeting chimera as well as preparation method and application thereof

    CN117122690A

  • Anti-tumor medicine composition and application thereof

    CN117257938A

  • Preparation for and application of lysosome-targeting nucleic acid chimera

    WO2022095853A1