Sirna for inhibiting expression of CTGF gene, and composition thereof

Abstract

The present invention provides an siRNA for inhibiting the expression of the CTGF gene, and the siRNA comprises a sense strand and an antisense strand. The siRNA provided by the present invention has good stability, excellent inhibitory activity against the CTGF gene, and negligible cytotoxicity and immunostimulatory capacity, and can significantly reduce the CTGF protein level at the animal level. The present invention has important clinical value for the treatment of diseases or conditions benefiting from CTGF level reduction or expression inhibition.

Description

siRNA and compositions thereof for inhibiting expression of CTGF gene

[0001] Cross-reference to Related Applications

[0002] This application claims priority to Chinese Patent Application No. 202410466117.2, filed April 17, 2024, and Chinese Patent Application No. 202510475533.3, filed April 15, 2025, the entire contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0003] The present application provides siRNA and pharmaceutical compositions thereof for inhibiting expression of connective tissue growth factor (CTGF). The siRNA and pharmaceutical compositions thereof provided by the present application can be used to treat diseases associated with CTGF. TECHNICAL BACKGROUND

[0004] Connective tissue growth factor (CTGF) is a member of the CCN family, which is a family of extracellular matrix (ECM) modulating proteins. CCN is involved in controlling a variety of important biological functions, including cell proliferation, differentiation, adhesion, and angiogenesis. CTGF was first discovered by Bradham et al. in 1991 from human vascular endothelial cells. Subsequently, different research groups confirmed that CTGF can be produced by a variety of cells, such as fibroblasts, tumor cells, muscle cells, and stellate cells. CTGF protein is composed of four domains: insulin-like growth factor binding protein (IGFBP), von Willebrand factor type C repeat (VWC), thrombospondin type 1 repeat (TSPI), and cysteine-containing carboxy-terminal domain (CT). These domains play different physiological regulatory functions by acting on different factors such as cell surface receptors, cytokines, or extracellular matrix (ECM) proteins.

[0005] CTGF plays an important role in the occurrence and development of many diseases. Studies have shown that CTGF interacts with transforming growth factor-β (TGF-β) and can regulate the occurrence of diseases such as liver fibrosis, lung fibrosis, kidney fibrosis, heart fibrosis, Duchenne muscular dystrophy (DMD), and systemic sclerosis (SSc). Among them, the sustained high expression of CTGF is considered to be the main reason for the formation and development of fibrosis.

[0006] There is a large unmet clinical need for the treatment of pulmonary fibrosis diseases. Fibrotic interstitial lung diseases (f-ILDs) are a group of heterogeneous diseases characterized by marked fibrosis with inflammation of the lung interstitium. Idiopathic pulmonary fibrosis (IPF) is the most common f-ILD, and is characterized by severe and progressive scarring (fibrosis) of lung tissue, with many patients surviving only about 3 to 5 years after diagnosis, and death primarily due to respiratory failure. Other f-ILDs include fibrotic-specific interstitial pneumonia, chronic hypersensitivity pneumonitis, and connective tissue disease-associated interstitial lung disease. Irreversible progression of fibrosis leads to destruction of lung structure and loss of function, and thus anti-fibrotic therapies can slow disease progression.

[0007] Accordingly, there is a need in the art for alternative / improved treatments for subjects having high CTGF-associated diseases. Some biological inhibitors and chemical drugs exert beneficial effects by directly or indirectly targeting CTGF.

[0008] Among them, small interfering RNA (siRNA) is a new and extremely potential candidate for research, which can inhibit or block the expression of the target gene of interest in a sequence-specific manner based on the RNA interference mechanism, so as to achieve the purpose of treating diseases. Specifically, siRNA is loaded into the RNA-induced silencing complex (RISC), and the guide strand, also known as the antisense strand, is complementary to the target nucleic acid in the mRNA of the target gene, so that the mRNA of the target gene is degraded, thereby inhibiting or blocking the expression of the target gene. For this reason, siRNA is sequence-specifically recognized by base complementary pairing to target RNA, so as to achieve the purpose of down-regulating the level of target RNA and inhibiting the expression of target gene, and therefore, siRNA has extremely broad application prospects. However, although the development speed of siRNA has been very surprising compared to the development of traditional candidate drugs (such as small molecule compounds and proteins and antibodies), compared to the theoretically infinite value of siRNA, the conversion efficiency of its powerful gene silencing ability into an application means (mainly disease treatment) is still not satisfactory enough.

[0009] However, considering the interspecies difference in the target nucleic acid of CTGF, the development of siRNA drugs targeting the target nucleic acid is difficult; at the same time, compared with traditional drugs, siRNA has poor stability and is easily degraded by nucleases when administered systemically; in addition, it is necessary to try to further improve the activity while avoiding side effects such as off-target effects, immune stimulation, and cytotoxicity. Therefore, it is an urgent problem to be solved to develop more candidate siRNAs that can stably inhibit CTGF gene expression in blood and tissues, have good biological activity, and have low cytotoxicity; at the same time, it is necessary to develop drugs that can effectively prevent and / or treat connective tissue growth factor (CTGF)-related diseases using the above candidate siRNAs that can inhibit CTGF gene expression. SUMMARY

[0010] The present application provides siRNAs that can effectively inhibit CTGF gene expression, and thereby provides drugs and methods for preventing and / or treating CTGF-related diseases.

[0011] siRNA

[0012] In one aspect, the present application provides a small interfering RNA (siRNA) for inhibiting CTGF gene expression, the siRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides from the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 85, and the sense strand is at least partially complementary to the antisense strand.

[0013] The at least partial complementarity means that the two sequences can be completely complementary, or have no more than 6, 5, 4, 3, 2, or 1 mismatched base pairs in total, while retaining the ability to hybridize under the relevant conditions. A person skilled in the art can determine the conditions most suitable for testing the complementarity of the two sequences according to the final application of the hybridized nucleotides. Such conditions may, for example, be stringent conditions, such as 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that can be encountered in vivo, can also be applied.

[0014] In some embodiments, the CTGF mRNA refers to mRNA having, for example, the sequence set forth in Genbank: NM_001901.4.

[0015] In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) differing by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides from the nucleotide sequence set forth in any of SEQ ID NO: 1 to SEQ ID NO: 85. In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) differing by no more than 3 (e.g., 0, 1, 2, or 3) nucleotides from the nucleotide sequence set forth in any of SEQ ID NO: 1 to SEQ ID NO: 85. In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) differing by no more than 2 (e.g., 0, 1, or 2) nucleotides from the nucleotide sequence set forth in any of SEQ ID NO: 1 to SEQ ID NO: 85. In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) differing by no more than 1 (e.g., 0 or 1) nucleotide from the nucleotide sequence set forth in any of SEQ ID NO: 1 to SEQ ID NO: 85. In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) of the nucleotide sequence set forth in any of SEQ ID NO: 1 to SEQ ID NO: 85. In some embodiments, the antisense strand is the nucleotide sequence set forth in any of SEQ ID NO: 1 to SEQ ID NO: 85.

[0016] In some embodiments, the sense strand has no more than 6 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 5 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 4 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 3 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 2 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 1 nucleotide mismatch with the antisense strand. In some embodiments, the sense strand is completely complementary to the antisense strand.

[0017] In some embodiments, the sense strand has at least 15, 16, 17, 18, 19, 20, or 21 nucleotides of complementarity to the antisense strand.

[0018] In some embodiments, the sense strand has at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementarity or perfect complementarity to the antisense strand over at least 15 contiguous nucleotides.

[0019] In some embodiments, the sense strand forms a duplex region of 15-30 nucleotide pairs in length, e.g., 15-25 nucleotide pairs, 15-23 nucleotide pairs, 15-21 nucleotide pairs, 17-25 nucleotide pairs, 17-23 nucleotide pairs, or 17-21 nucleotide pairs, e.g., a duplex region of 15, 16, 17, 18, 19, 20, or 21 nucleotide pairs, to the antisense strand.

[0020] In some embodiments, the antisense strand is 15-30 (e.g., 17-29, 17-28, 17-27, 19-30, 19-29, 19-28, 19-27, 19-25, 19-23, 21-25, 21-23) nucleotides in length and the sense strand is 15-30 (e.g., 17-29, 17-28, 17-27, 17-26, 17-25, 17-21, 19-21) nucleotides in length.

[0021] In some embodiments, the antisense strand is 19-27 nucleotides in length; and the sense strand is 17-25 nucleotides in length.

[0022] In some embodiments, the antisense strand is 21-23 nucleotides in length; and the sense strand is 19-21 nucleotides in length.

[0023] In some embodiments, the antisense strand is 23 nucleotides in length; and the sense strand is 21 nucleotides in length.

[0024] In some embodiments, the siRNA comprises a blunt end and / or an overhang.

[0025] In some embodiments, the siRNA comprises one or more single-stranded nucleotide overhangs. For example, 1, 2, 3, or 4 nucleotide overhangs. In some embodiments, the overhangs can be on the sense strand, the antisense strand, or any combination thereof. In some embodiments, the overhangs are present on the 5’ end, the 3’ end, or both ends of the antisense strand or the sense strand of the siRNA.

[0026] In some embodiments, the 3' end of the antisense strand of the siRNA comprises a 2-nucleotide overhang. In some embodiments, the 3' end of the sense strand of the siRNA is blunt ended.

[0027] In some embodiments, the sense strand of the siRNA comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) differing by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 86-170. The sense and antisense strands of the siRNA comprise the at least 15 contiguous nucleotides forming a duplex region. In some embodiments, the sense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) differing by no more than 3 (e.g., 0, 1, 2, or 3) nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 86-170. In some embodiments, the sense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) differing by no more than 2 (e.g., 0, 1, or 2) nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 86-170. In some embodiments, the sense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) differing by no more than 1 (e.g., 0 or 1) nucleotide from the nucleotide sequence set forth in any one of SEQ ID NOs: 86-170. In some embodiments, the sense strand has a region of at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementarity or perfect complementarity to the antisense strand within the 15 contiguous nucleotides. In some embodiments, the sense strand comprises at least 15 contiguous nucleotides (e.g., at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides) of the nucleotide sequence set forth in any one of SEQ ID NOs: 86-170. In some embodiments, the sense strand is the nucleotide sequence set forth in any one of SEQ ID NOs: 86-170.

[0028] In some embodiments, the sequence of the sense strand and the antisense strand of the siRNA comprises the sense strand and the antisense strand sequence of any of duplexes 1, 4, 25-28, 36, 38, 41, 51, 52, 63, 64, 66, 67, 71, 77-80, 82, 84-86, 93-96, 105, 107, 110, 111, 116, 118, 119, 127, 129-131, 134-145, 147-180 provided in Table 1.

[0029] In some embodiments, the siRNA targets a region located within nucleotides 1-2338 of the CTGF mRNA, for example, targets a sequence set forth in SEQ ID NO: 307.

[0030] In some embodiments, the target gene start position targeted by the antisense strand sequence of the siRNA is located at any position between positions 976-980, or 2256-2298 (e.g., 2258-2294), or 1761-1762 of the CTGF mRNA.

[0031] In the context of the present application, when referring to nucleotide positions of the CTGF mRNA, the position in the sequence set forth in SEQ ID NO: 307 is referenced. For example, the expression "nucleotide 976 of the CTGF mRNA" refers to the 976th nucleotide of the sequence set forth in SEQ ID NO: 307 and its corresponding position. The corresponding position refers to the position in the sequence to be compared that is equivalent to the given position in SEQ ID NO: 307 upon optimal alignment (i.e., to obtain the highest percent identity) of the sequence to be compared with SEQ ID NO: 307.

[0032] In some embodiments, the target gene start position targeted by the antisense strand sequence of the siRNA is located at any of the positions set forth in positions 976, 977, 978, 980, 2258, 2266, 2286, 2287, 2291, 2292, 2294, 1761, and 1762 of the CTGF mRNA.

[0033] In some embodiments, the sequence of the antisense strand of the siRNA comprises the antisense strand sequence of any of duplex 93, duplex 94, duplex 95, duplex 96, duplex 156, duplex 160, duplex 161, duplex 162, duplex 164, duplex 165, duplex 167, duplex 172, and duplex 173 provided in Table 1.

[0034] In some embodiments, the sense strand of the siRNA has at least 85% complementarity or is fully complementary to the antisense strand over at least 15 contiguous nucleotides.

[0035] In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sense and antisense strand sequence of any of duplex 93, duplex 94, duplex 95, duplex 96, duplex 156, duplex 160, duplex 161, duplex 162, duplex 164, duplex 165, duplex 167, duplex 172, and duplex 173 provided in Table 1.

[0036] In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sense and antisense strand sequence of any of duplex 94, duplex 95, duplex 96, duplex 156, duplex 161, duplex 162, duplex 164, duplex 173 provided in Table 1.

[0037] In some embodiments, the target gene start position targeted by the sequence of the antisense strand of the siRNA is located at any of the positions between positions 976-980 of the CTGF mRNA, e.g., at any of positions 976, 977, 978, 979, and 980 of the CTGF mRNA.

[0038] In some embodiments, the target gene start position targeted by the sequence of the antisense strand of the siRNA is located at the nucleotide of any of positions 976, 977, 978, and 980 of the CTGF mRNA.

[0039] In some embodiments, the target gene start position targeted by the sequence of the antisense strand of the siRNA is located at the nucleotide of any of positions 976, 978, and 980 of the CTGF mRNA.

[0040] In some embodiments, the sequence of the antisense strand of the siRNA comprises the antisense strand sequence of any of duplex 93, duplex 94, duplex 95, duplex 96, and duplex 111 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0041] In some embodiments, the sequence of the antisense strand of the siRNA comprises the sequence of the antisense strand of any of duplex 93, duplex 94, duplex 95, duplex 96 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0042] In some embodiments, the sequence of the antisense strand of the siRNA comprises the sequence of the antisense strand of any of duplex 94, duplex 95, and duplex 96 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0043] In some embodiments, the sense strand of the siRNA has at least 85% complementarity or is fully complementary to the antisense strand over at least 15 contiguous nucleotides.

[0044] In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sequence of the sense and antisense strands of any of duplex 93, duplex 94, duplex 95, duplex 96, and duplex 111 provided in Table 1. In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sequence of the sense and antisense strands of any of duplex 93, duplex 94, duplex 95, and duplex 96 provided in Table 1. In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sequence of the sense and antisense strands of any of duplex 94, duplex 95, and duplex 96 provided in Table 1.

[0045] In some embodiments, the target gene start position targeted by the antisense strand sequence of the siRNA is located at any position between positions 2256-2298 of the CTGF mRNA, e.g., at any of positions 2256, 2258, 2266, 2286, 2287, 2291, 2292, 2294, 2295, 2296, 2297, 2298 of the CTGF mRNA.

[0046] In some embodiments, the target gene start position targeted by the antisense strand sequence of the siRNA is located at any position between positions 2258-2294 of the CTGF mRNA, e.g., at any of positions 2258, 2266, 2286, 2287, 2291, 2292, and 2294 of the CTGF mRNA.

[0047] In some embodiments, the sequence of the antisense strand of the siRNA targets a start position of a target gene that is at any one of positions 2258, 2286, 2287, and 2291 of the CTGF mRNA.

[0048] In some embodiments, the sequence of the antisense strand of the siRNA comprises the antisense strand sequence of any one of duplexes 155-171 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0049] In some embodiments, the sequence of the antisense strand of the siRNA comprises the antisense strand sequence of any one of duplexes 156-167 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0050] In some embodiments, the sequence of the antisense strand of the siRNA comprises the antisense strand sequence of any one of duplexes 156, 160, 161, 162, 164, 165, and 167 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0051] In some embodiments, the sequence of the antisense strand of the siRNA comprises the antisense strand sequence of any one of duplexes 156, 161, 162, and 164 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0052] In some embodiments, the sense strand of the siRNA has at least 85% complementarity or is fully complementary to the antisense strand over at least 15 contiguous nucleotides.

[0053] In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sense and antisense strand sequence of any one of duplexes 155-171 provided in Table 1. In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sense and antisense strand sequence of any one of duplexes 156-167 provided in Table 1. In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sense and antisense strand sequence of any one of duplexes 156, 160, 161, 162, 164, 165, and 167 provided in Table 1. In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises the sense and antisense strand sequence of any one of duplexes 156, 161, 162, and 164 provided in Table 1.

[0054] In some embodiments, the target gene start position targeted by the antisense strand sequence of the siRNA is at position 1761 or 1762 of the CTGF mRNA.

[0055] In some embodiments, the target gene start position targeted by the antisense strand sequence of the siRNA is at position 1762 of the CTGF mRNA.

[0056] In some embodiments, the sequence of the antisense strand of the siRNA comprises an antisense strand sequence selected from the duplex 172 or the duplex 173 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0057] In some embodiments, the sequence of the antisense strand of the siRNA comprises an antisense strand sequence selected from the duplex 173 provided in Table 1, or a portion thereof (e.g., at least 15 contiguous nucleotides thereof).

[0058] In some embodiments, the sense strand of the siRNA has at least 85% complementarity or is fully complementary to the antisense strand over at least 15 contiguous nucleotides.

[0059] In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises a sense and antisense strand sequence selected from the duplex 172 or the duplex 173 provided in Table 1. In some embodiments, the sequence of the sense and antisense strands of the siRNA comprises a sense and antisense strand sequence selected from the duplex 173 provided in Table 1.

[0060] In one aspect, the present application provides an siRNA for inhibiting the expression of a CTGF gene, the siRNA comprising a sense strand and an antisense strand, wherein the target gene start position targeted by the antisense strand sequence of the siRNA is at any position between positions 2256-2298 of the CTGF mRNA, the antisense strand comprises at least 15 contiguous amino acids, and the sense strand is at least partially complementary to the antisense strand.

[0061] In some embodiments, the CTGF mRNA refers to an mRNA having a sequence as set forth in Genbank: NM_001901.4, for example. In some embodiments, the target gene start position targeted by the antisense strand sequence of the siRNA is at any position between positions 2256-2298 of the CTGF mRNA, such as at any one of positions 2256, 2258, 2266, 2286, 2287, 2291, 2292, 2294, 2295, 2296, 2297, 2298 of the CTGF mRNA.

[0062] In some embodiments, the target gene start position targeted by the sequence of the antisense strand of the siRNA is located at any of positions 2258-2294 of the CTGF mRNA, e.g., at any of positions 2258, 2266, 2286, 2287, 2291, 2292, and 2294 of the CTGF mRNA.

[0063] In some embodiments, the target gene start position targeted by the sequence of the antisense strand of the siRNA is at any of positions 2258, 2286, 2287, and 2291 of the CTGF mRNA.

[0064] In some embodiments, the sense strand has no more than 6 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 5 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 4 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 3 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 2 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 1 nucleotide mismatch with the antisense strand. In some embodiments, the sense strand is completely complementary to the antisense strand.

[0065] In some embodiments, the sense strand has at least 15, 16, 17, 18, 19, 20, or 21 nucleotides of complementarity with the antisense strand.

[0066] In some embodiments, the sense strand has at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementarity or complete complementarity with the antisense strand over at least 15 contiguous nucleotides.

[0067] In some embodiments, the sense strand forms a duplex region of 15-30 nucleotide pairs in length with the antisense strand, e.g., 15-25 nucleotide pairs, 15-23 nucleotide pairs, 15-21 nucleotide pairs, 17-25 nucleotide pairs, 17-23 nucleotide pairs, or 17-21 nucleotide pairs, e.g., a duplex region of 15, 16, 17, 18, 19, 20, or 21 nucleotide pairs.

[0068] In some embodiments, the antisense strand is 15-30 (e.g., 17-29, 17-28, 17-27, 19-30, 19-29, 19-28, 19-27, 19-25, 19-23, 21-25, 21-23) nucleotides in length and the sense strand is 15-30 (e.g., 17-29, 17-28, 17-27, 17-26, 17-25, 17-21, 19-21) nucleotides in length.

[0069] In some embodiments, the antisense strand is 19-27 nucleotides in length; and the sense strand is 17-25 nucleotides in length.

[0070] In some embodiments, the antisense strand is 21-23 nucleotides in length; and the sense strand is 19-21 nucleotides in length.

[0071] In some embodiments, the antisense strand is 23 nucleotides in length and the sense strand is 21 nucleotides in length.

[0072] In some embodiments, the siRNA comprises a blunt end and / or an overhang.

[0073] In some embodiments, the siRNA comprises one or more single-stranded nucleotide overhangs. For example, 1, 2, 3, or 4 nucleotide overhangs. In some embodiments, the overhangs can be on the sense strand, the antisense strand, or any combination thereof. In some embodiments, the overhangs are present on the 5' end, the 3' end, or both ends of the antisense strand or the sense strand of the siRNA.

[0074] In some embodiments, the 3' end of the antisense strand of the siRNA comprises a 2 nucleotide overhang. In some embodiments, the 3' end of the sense strand of the siRNA is blunt.

[0075] In some embodiments, the siRNA targets a region located within nucleotides 1-2338 of a CTGF mRNA, e.g., targets a sequence set forth in SEQ ID NO: 307.

[0076] Modifications

[0077] The siRNAs of the present application can be modified in the nucleobase structure or in the ribose-phosphate backbone structure to reduce off-target effects, and / or to increase the biological stability of the molecule, or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids. Accordingly, siRNA sequences comprising any modifications are also encompassed within the scope of the present application. siRNA molecules comprising ribonucleotide analogs or derivatives must retain the ability to form a duplex and allow or mediate specific degradation of the target RNA via the RISC pathway.

[0078] In some embodiments, the siRNA provided in any of the above embodiments contains at least one modified nucleotide. The modification need not be the same for each of the plurality of modified ribonucleosides in the siRNA.

[0079] In some embodiments, all of the nucleotides in the sense strand and / or the antisense strand of the siRNA provided in any of the above embodiments are modified nucleotides or nucleotide analogs. In some embodiments, all of the nucleotides in the sense strand of the siRNA are modified nucleotides or nucleotide analogs, and all of the nucleotides in the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

[0080] In some embodiments, the siRNA comprises 2'-modified nucleotides.

[0081] In some embodiments, the modified nucleotide or nucleotide analog is selected from a 2'-methoxy nucleotide, a 2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2',3'-seco nucleotide analog, a 2'-fluoroarabinonucleotide, a 2'-methoxyethyl nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a 3'-methoxy nucleotide, a 2'-allyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'-phosphate, a nucleotide comprising a 5'-phosphate mimic, a glycol modified nucleotide, an abasic nucleotide, a morpholino nucleotide, a locked nucleotide (LNA), an unlocked nucleotide (UNA), or a glycerol nucleotide (GNA), although the application is not limited thereto.

[0082] In some embodiments, the modified nucleotide or nucleotide analog is selected from at least one of a 2'-methoxy nucleotide, a 2'-fluoro nucleotide, a nucleotide comprising a phosphorothioate group, or a combination thereof. In some embodiments, the antisense strand comprises at least one of a 2'-methoxy nucleotide, a 2'-fluoro nucleotide, or a combination thereof. In some embodiments, the sense strand comprises at least one of a 2'-methoxy nucleotide, a 2'-fluoro nucleotide, or a combination thereof. In some embodiments, the sense strand comprises at least one nucleotide comprising a phosphorothioate group. In some embodiments, the antisense strand comprises at least one nucleotide comprising a phosphorothioate group.

[0083] In some embodiments, the nucleotides in the sense strand are selected from a 2'-methoxy nucleotide and a 2'-fluoro nucleotide, and / or the nucleotides in the antisense strand are selected from a 2'-methoxy nucleotide and a 2'-fluoro nucleotide.

[0084] In some embodiments, the siRNAs of the present application comprise modified internucleoside linkages or modified backbones. Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioates, 2'-O-methoxyethyl (MOE), 2'-fluoro, alkylphosphonates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphotriesters, acetamidates, carboxymethyl esters, and combinations thereof.

[0085] In some embodiments, the modified nucleotides are nucleotides having a phosphate group modified with a phosphorothioate group. That is, the non-bridging oxygen atom in the phosphodiester linkage is replaced with a sulfur atom, thereby replacing the phosphodiester linkage with a phosphorodithioate linkage.

[0086] In some embodiments, the 5' end and / or the 3' end of the sense strand independently comprises 1 or 2 phosphorothioate linkages, respectively; and / or the 5' end and / or the 3' end of the antisense strand independently comprises 1 or 2 phosphorothioate linkages, respectively. In some embodiments, the 5' end and / or the 3' end of the sense strand comprises 1 or 2 phosphorothioate linkages, respectively; and / or the 5' end and / or the 3' end of the antisense strand independently comprises 1 or 2 phosphorothioate linkages, respectively.

[0087] In some embodiments, the sense strand can include one or more terminal residues or moieties, referred to as "terminal residues." In some embodiments, the terminal residues are present at the 5' end, the 3' end, or both the 5' end and the 3' end of the sense strand.

[0088] In some embodiments, an inverted abasic residue (iab) is added as a terminal residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments, the 5' end and / or the 3' end of the sense strand can comprise more than one inverted abasic deoxyribose moiety as a terminal residue.

[0089] In some embodiments, one or more inverted abasic residues (iab) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (iab) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues are included at or near one or more ends of the sense strand of the siRNA.

[0090] The inverted abasic residues can be linked via a phosphoester, phosphorothioate, or other internucleoside linkage.

[0091] In some embodiments, the antisense strand of the siRNA is 23 nucleotides in length and comprises the following modification pattern:

[0092] (1) 5'-mN* / i2FN* / mN / mN / mN / i2FN / mN / mN / mN / mN / mN / mN / mN / i2FN / mN / i2FN / mN / i2FN / mN / mN / mN* / mN* / mN-3' (SEQ ID NO: 297);

[0093] (2) 5'-mN* / i2FN* / mN / mN / mN / i2FN / mN / mN / mN / mN / mN / mN / mN / i2FN / mN / i2FN / mN / mN / mN / i2FN / mN* / mN* / mN-3' (SEQ ID NO: 298);

[0094] (3) 5'-mN* / i2FN* / mN / mN / mN / i2FN / mN / i2FN / mN / mN / mN / mN / mN / i2FN / mN / i2FN / mN / mN / mN / mN / mN* / mN* / mN-3' (SEQ ID NO: 299); or

[0095] (4) 5'-mN* / i2FN* / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / mN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN* / mN* / mN-3' (SEQ ID NO: 300);

[0096] wherein mN is a methoxy modified nucleotide, i2FN is a fluoro modified nucleotide, and * is a phosphorothioate linkage. The nucleotides can be selected from C, G, U, or A.

[0097] In some embodiments, the sense strand of the siRNA is 21 nucleotides in length and comprises the following modification pattern:

[0098] (1) 5'-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / i2FN / mN / mN / mN / mN / mN / mN / mN* / mN-3' (SEQ ID NO: 301);

[0099] (2) 5'-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / mN / mN / i2FN / mN / mN / mN / mN / mN* / mN-3' (SEQ ID NO: 302);

[0100] (3) 5’-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / mN / mN / mN / mN / i2FN / mN / mN / mN* / mN-3’ (SEQ ID NO: 303);

[0101] (4) 5’-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / mN / mN / mN / mN / mN / mN / i2FN / mN* / mN-3’ (SEQ ID NO: 304);

[0102] (5) 5’-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / mN / i2FN / mN / mN / mN / mN / mN / mN / mN / mN / mN* / mN-3’ (SEQ ID NO: 305); or

[0103] (6) 5’-i2FN* / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN* / i2FN-3’ (SEQ ID NO: 306);

[0104] wherein mN is a methoxy modified nucleotide, i2FN is a fluoro modified nucleotide, and * is a phosphorothioate linkage. The nucleotides can be selected from C, G, U, or A.

[0105] In some embodiments, the siRNA comprises a modification pattern selected from the group consisting of: wherein the first SEQ ID NO corresponds to the sense strand and the second SEQ ID NO corresponds to the antisense strand: SEQ ID NO: 301 and SEQ ID NO: 297; SEQ ID NO: 301 and SEQ ID NO: 298; SEQ ID NO: 301 and SEQ ID NO: 299; SEQ ID NO: 301 and SEQ ID NO: 300; SEQ ID NO: 302 and SEQ ID NO: 297; SEQ ID NO: 302 and SEQ ID NO: 298; SEQ ID NO: 302 and SEQ ID NO: 299; SEQ ID NO: 302 and SEQ ID NO: 300; SEQ ID NO: 303 and SEQ ID NO: 297; SEQ ID NO: 303 and SEQ ID NO: 298; SEQ ID NO: 303 and SEQ ID NO: 299; SEQ ID NO: 303 and SEQ ID NO: 300; SEQ ID NO: 304 and SEQ ID NO: 297; SEQ ID NO: 304 and SEQ ID NO: 298; SEQ ID NO: 304 and SEQ ID NO: 299; SEQ ID NO: 304 and SEQ ID NO: 300; SEQ ID NO: 305 and SEQ ID NO: 297; SEQ ID NO: 305 and SEQ ID NO: 298; SEQ ID NO: 305 and SEQ ID NO: 299; SEQ ID NO: 305 and SEQ ID NO: 300; SEQ ID NO: 306 and SEQ ID NO: 297; SEQ ID NO: 306 and SEQ ID NO: 298; SEQ ID NO: 306 and SEQ ID NO: 299; SEQ ID NO: 306 and SEQ ID NO: 300.

[0106] In some embodiments, the antisense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 171-218.

[0107] In some embodiments, the sense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 219-296.

[0108] In some embodiments, the sequences of the sense strand and the antisense strand of the siRNA comprise the sense strand and antisense strand sequences of any one of duplexes 181-328 provided in Table 3.

[0109] In some embodiments, the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 175, 174, 176, 177, 180, 183, 184, 211, 189, 193, 214, 196, 195, 205, 217. In some embodiments, the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 226, 228, 230, 231, 232, 239, 240, 243, 246, 244, 255, 261, 262, 267, 268, 288, 285. In some embodiments, the sequences of the sense strand and the antisense strand of the siRNA comprise the sense strand and the antisense strand sequences of any one of duplex 188, duplex 259, duplex 260, duplex 190, duplex 192, duplex 193, duplex 262, duplex 201, duplex 202, duplex 205, duplex 272, duplex 297, duplex 298, duplex 217, duplex 277, duplex 224, duplex 309, duplex 281, duplex 282, duplex 292, duplex 321, or duplex 324 provided in Table 3.

[0110] Delivery

[0111] The siRNAs of the application can be delivered or introduced (e.g., in vitro to cells, or in vivo to a patient) by any means known in the art. For example, for in vivo delivery, the siRNAs can be injected into a tissue site, or administered systemically. In vivo delivery can also be performed by a beta-glucan delivery system. In vitro introduction to cells includes methods known in the art, such as electroporation and lipofection.

[0112] In some embodiments, the delivery methods include, but are not limited to, viral delivery (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacterial delivery (tkRNAi); chemical modification of siRNA (LNA) to increase stability; lipid nanoparticles (LNP); neutral liposomes (NL); polymeric nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs); and other delivery systems known in the art that can be suitable for nucleic acid or oligonucleotide delivery.

[0113] Conjugates

[0114] In one aspect, the present application provides a conjugate comprising at least one siRNA of the present application and a pharmaceutically acceptable targeting molecule. The conjugate of the present application is obtained by conjugating the siRNA of the present application with a pharmaceutically acceptable targeting molecule, which includes the pharmaceutically acceptable targeting molecule and optionally a linker. The siRNA can be non-covalently conjugated to the targeting molecule, or covalently conjugated to the targeting molecule.

[0115] The pharmaceutically acceptable targeting molecule can be a targeting molecule conventionally used in the field of siRNA administration, which typically enhances the pharmacokinetic or biodistribution properties of the siRNA attached thereto, improves the cell-specific (or organ-specific) distribution and cell-specific (or organ-specific) uptake of the siRNA. Representative targeting molecules include, but are not limited to, a compound having affinity for a cell surface molecule, a cell receptor ligand, a hapten, an antibody or an antibody fragment, an antibody mimetic, etc. In some embodiments, the targeting molecule includes, but is not limited to, one or more of the following targeting molecules or derivatives thereof: the integrin family; a lipophilic molecule, such as cholesterol, a bile acid, a vitamin (e.g., vitamin E), a lipid molecule of different chain length; a polymer, such as polyethylene glycol; a polypeptide, such as a transmembrane peptide; an aptamer; an antibody; a quantum dot; a saccharide, such as lactose, poly-lactose, mannose, galactose, N-acetylgalactosamine (GalNAc); a folate; or a receptor ligand expressed by a liver parenchymal cell, such as an asialoglycoprotein, an asialoglycose residue, a lipoprotein (e.g., high-density lipoprotein, low-density lipoprotein, etc.), a glucagon, a neurotransmitter (e.g., adrenaline), a growth factor, a transferrin, etc.

[0116] The linker can be a linker conventionally used in the field of siRNA administration, including but not limited to one or more of the following linkers or derivatives thereof: an amide linker moiety, an amino linker moiety, a carbonyl linker moiety, a carbamate linker moiety, a urea linker moiety, an ether linker moiety, a disulfide linker moiety, a succinamido linker moiety, etc.

[0117] In some embodiments, the targeting molecule can be directly or indirectly linked to the siRNA of the present application via a linker / attachment group. In some embodiments, the targeting molecule is linked to the siRNA via a labile, cleavable, or reversible bond or linker. In some embodiments, the targeting molecule is linked to at least one end of the sense strand and / or the antisense strand of the siRNA. In some embodiments, the targeting molecule is linked to the 5' end and / or the 3' end of the sense strand. In some embodiments, the targeting molecule is linked to the 5' end and / or the 3' end of the antisense strand.

[0118] Pharmaceutical composition

[0119] In one aspect, the present application provides a pharmaceutical composition comprising at least one siRNA of the present application.

[0120] In some embodiments, the pharmaceutical composition contains one siRNA as described above.

[0121] In other embodiments, the pharmaceutical composition contains at least two siRNAs (e.g., but not limited to, two, three, four, five, six, seven, eight, nine, ten or more) as described above as active ingredients. Preferably, the at least two siRNAs each target a different target sequence in the CTGF gene, whereby a synergistic effect can be expected from simultaneous action on different target sequences. Here, "different target sequences" means that there is no overlap between the target sequences, or the number of consecutive nucleotides that overlap between the target sequences is less than 5 (e.g., the number of consecutive nucleotides that overlap is 4, 3, 2, 1, 0). In this case, the at least two siRNAs described above can be present in any different ratio. Preferably, the at least two siRNAs described above can be present in a molar ratio of 1 : 100 to 100: 1 to each other; more preferably, the at least two siRNAs described above can be present in a molar ratio of 1 : 10 to 10: 1, 1 :5 to 5: 1, or 1 :2 to 2: 1 to each other. In some embodiments, the at least two siRNAs described above are present in the same molar ratio.

[0122] In other embodiments, the pharmaceutical composition contains at least one siRNA of the present application and also contains at least one siRNA targeting other targets (e.g., other genes than CTGF). In this case, the siRNA of the present application and the siRNA targeting other targets can be present in any different ratio, e.g., in a molar ratio of 1 : 100 to 100: 1, e.g., in a molar ratio of 1 : 10 to 10: 1, 1 :5 to 5: 1, or 1 :2 to 2: 1, e.g., in the same molar ratio.

[0123] In some embodiments, the pharmaceutical composition comprises an effective amount of siRNA. An "effective amount" means the amount of siRNA that is effective for producing a desired pharmacological, therapeutic, or prophylactic result. For example, a therapeutically effective amount of a drug for treating a disease or condition is the amount that achieves at least a 10% reduction in a measurable parameter associated with the disease or condition, if a given clinical treatment is considered effective when there is at least a 10% reduction in the parameter. For example, a therapeutically effective amount of an siRNA targeting CTGF can reduce CTGF mRNA levels by at least 10%.

[0124] In some embodiments, the pharmaceutical composition of any of the above embodiments, the siRNA can be linked to a targeting molecule to form a conjugate. Thus, in some embodiments, the pharmaceutical composition comprises a conjugate of the present application.

[0125] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0126] In some embodiments, the pharmaceutically acceptable carrier and / or excipient is a delivery vehicle. A delivery vehicle is a substance that improves the delivery of a nucleic acid or oligonucleotide to a cell or tissue. Such substances can be any delivery vehicle known in the art to be suitable for nucleic acid or oligonucleotide delivery, including but not limited to: viruses (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacteria (tkRNAi); lipid nanoparticles (LNP); neutral liposomes (NL); polymeric nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs), etc.

[0127] In some embodiments, the siRNA can be encapsulated by the delivery vehicle.

[0128] In some embodiments, the siRNA can be directly or indirectly linked to the delivery vehicle via a linker / linker group. In some embodiments, the delivery vehicle is linked to the siRNA via a labile, cleavable or reversible bond or linker. In some embodiments, the delivery vehicle is linked to at least one end of the sense strand and / or the antisense strand of the siRNA. In some embodiments, the delivery vehicle is linked to the 5’ end and / or the 3’ end of the sense strand. In some embodiments, the delivery vehicle is linked to the 5’ end and / or the 3’ end of the antisense strand.

[0129] In some embodiments, the pharmaceutical composition comprises 1 siRNA provided by the present application, which is encapsulated by the delivery vehicle. The 1 siRNA can be encapsulated in the same delivery vehicle or in different delivery vehicles, respectively.

[0130] In other embodiments, the pharmaceutical composition comprises at least 2 siRNAs (for example but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) provided by the present application, wherein the siRNAs are encapsulated by the delivery vehicle. The at least 2 siRNAs can be encapsulated in the same delivery vehicle or in different delivery vehicles, respectively. Preferably, the at least 2 siRNAs each target a different target sequence in the CTGF gene.

[0131] In other embodiments, the pharmaceutical composition comprises at least one siRNA provided by the present application and an siRNA targeting another target (e.g., another gene other than CTGF), wherein the siRNAs are encapsulated by the delivery vehicle. The siRNA provided by the present application and the siRNA targeting another target (e.g., another gene other than CTGF) can be encapsulated in the same delivery vehicle or in different delivery vehicles, respectively.

[0132] In some embodiments, the pharmaceutical composition of the present application is formulated in a dosage form compatible with its intended route of administration, e.g., local (e.g., direct injection or implantation), systemic, subcutaneous, intravenous, intraperitoneal, or parenteral administration, including intracranial (e.g., intraventricular, intrameningeal, or intrathecal), intramuscular, transdermal, airway (aerosol), nasal, buccal, rectal, or topical (including buccal and sublingual) administration.

[0133] In some embodiments, the pharmaceutical composition is administered by inhalation, intranasally, intratracheally, or oropharyngeal inhalation. Formulations suitable for inhalation administration can be prepared by incorporating the active ingredient into an appropriate solvent, followed by sterile filtration. Generally, formulations for inhalation administration are sterile solutions at physiological pH and have low viscosity. Salts can be added to the formulation to balance tonicity. In some cases, a surfactant or cosolvent can be added to increase active ingredient solubility and improve aerosol properties. In some cases, excipients can be added to control viscosity in order to ensure droplet size and distribution of the aerosol.

[0134] In other embodiments, the pharmaceutical composition can be administered by injection, e.g., intravenous, intramuscular, subcutaneous, intradermal, intraarticular, intraocular, intraperitoneal, or topical administration. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS), etc. The pharmaceutical composition should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Sterile injectable solutions can be prepared by incorporating the active ingredient in the required amount in an appropriate solvent, with optional incorporation of other desired ingredients (including, but not limited to, pH adjusting agents, surfactants, adjuvants, ion strength enhancers, diluents, agents to maintain osmotic pressure, agents to retard absorption, preservatives, or any combination thereof), followed by sterile filtration. In addition, sterile injectable solutions can be prepared as sterile lyophilized powders (e.g., by vacuum drying or freeze-drying) for reconstitution with a suitable solvent prior to use.

[0135] The siRNAs of the application can be formulated in dosage unit form for ease of administration. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.

[0136] In the present application, the dosage regimen will be adjusted to optimize the desired therapeutic or prophylactic response. For example, a single dose can be administered, doses can be administered over a period of time, or the dose can be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.

[0137] Applications

[0138] Inhibition of CTGF expression

[0139] The siRNAs of the application can be used to inhibit the expression of CTGF in vitro and / or in vivo. The CTGF mRNA refers to a mRNA having the sequence set forth in, for example, Genbank: NM_001901.4.

[0140] In one aspect, the present application provides a method of inhibiting the expression of CTGF in a cell, the method comprising introducing into the cell a siRNA, a conjugate, or a pharmaceutical composition of the present application. In some embodiments, the method is performed in vitro. The siRNA of the present application can be introduced by any nucleic acid delivery means known in the art, such as electroporation or lipofection.

[0141] The term "inhibiting the expression of CTGF" means at least partial suppression of the expression of the CTGF gene, which can be manifested as a decrease in the amount of detectable CTGF mRNA. The degree of inhibition can be expressed, for example, as (mRNA in control cells) - (mRNA in treated cells) / (mRNA in control cells) * 100%. Alternatively, the degree of inhibition can be given as a decrease in a parameter functionally linked to the expression of the CTGF gene, such as the amount of protein encoded by the CTGF gene. In principle, the silencing of the CTGF gene can be determined in any cell expressing CTGF (constitutively or by genetic engineering), and by any suitable assay. The measurement can be performed at multiple time points, before, during and after the administration of the siRNA, to determine the effect of the siRNA. The level or expression of CTGF can be measured by evaluation of the mRNA (e.g. by Northern blot or PCR) or the protein (e.g. Western blot). The effect of the siRNA on the expression of CTGF can be determined, for example, by measuring the rate of transcription of the CTGF gene (e.g. by RT-PCR). The effect of the siRNA on the expression of CTGF can be determined, for example, by measuring the amount of expression of a reporter gene (e.g. luciferase) fused to the CTGF gene.

[0142] In some embodiments, the expression of the CTGF gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administering the siRNA of the present application. In some embodiments, the expression of the CTGF gene is suppressed by at least about 60%, 70%, or 80% by administering the siRNA of the present application. In some embodiments, the expression of the CTGF gene is suppressed by at least about 85% by administering the siRNA of the present application. In some embodiments, the expression of the CTGF gene is suppressed by at least about 90% by administering the siRNA of the present application. In some embodiments, the expression of the CTGF gene is suppressed by at least about 95% by administering the siRNA of the present application. In some embodiments, the expression of the CTGF gene is suppressed by at least about 96%, 97%, 98%, 99%, or 100% by administering the siRNA of the present application.

[0143] In some embodiments, the siRNA, the conjugate, or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (e.g., an siRNA targeting a different target sequence in the CTGF gene or an siRNA targeting another target).

[0144] In some embodiments, one siRNA provided by the present application is used. The siRNA is optionally encapsulated by a delivery vehicle. In some embodiments, the one siRNA is encapsulated in the same delivery vehicle. In other embodiments, the one siRNA is encapsulated in different delivery vehicles, respectively.

[0145] In other embodiments, at least two siRNAs provided by the present application are used (e.g., but not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more), preferably each of the at least two siRNAs targets a different target sequence in the CTGF gene. The at least two siRNAs are optionally encapsulated by a delivery vehicle. In some embodiments, the at least two siRNAs are encapsulated in the same delivery vehicle. In other embodiments, the at least two siRNAs are encapsulated in different delivery vehicles, respectively.

[0146] In other embodiments, at least one siRNA provided herein is used in combination with an siRNA targeting another target (e.g., another gene other than CTGF). The siRNA provided herein and the siRNA targeting another target (e.g., another gene other than CTGF) are optionally encapsulated by a delivery vehicle. In some embodiments, the siRNA provided herein and the siRNA targeting another target (e.g., another gene other than CTGF) are encapsulated in the same delivery vehicle. In other embodiments, the siRNA provided herein and the siRNA targeting another target (e.g., another gene other than CTGF) are encapsulated in different delivery vehicles, respectively.

[0147] Treating a CTGF-associated disease

[0148] The siRNAs of the present application can be used to treat a disease or condition that would benefit from a reduction or inhibition of CTGF expression.

[0149] In one aspect, the present application provides a method of preventing and / or treating a disease associated with CTGF in a subject, the method comprising administering to a subject in need thereof an effective amount of an siRNA, conjugate, or pharmaceutical composition of the present application. The present application also relates to the use of an siRNA, conjugate, or pharmaceutical composition of the present application in the manufacture of a medicament for treating and / or preventing a disease associated with CTGF.

[0150] In some embodiments, the disease associated with CTGF involves overexpression of CTGF. Overexpression of CTGF refers to a level of CTGF (e.g., present in the plasma of a subject or in a tissue, and preferably in an injured tissue) that is higher than a normal level of CTGF (e.g., a corresponding level in a healthy control).

[0151] In some embodiments, the disease associated with CTGF would benefit from a reduction or inhibition of CTGF expression.

[0152] In some embodiments, the disease associated with CTGF is a liver fibrotic disease, a lung fibrotic disease, chronic hypersensitivity pneumonitis, a connective tissue disease-related interstitial disease, a kidney fibrotic disease, a heart fibrotic disease, Duchenne muscular dystrophy (DMD), systemic sclerosis (SSc), a hypertrophic scar, or a keloid.

[0153] In some embodiments, the lung fibrotic disease is a fibrotic interstitial lung disease (f-ILD), e.g., idiopathic pulmonary fibrosis (IPF).

[0154] In some embodiments, the subject is a mammal, e.g., a human.

[0155] In some embodiments, the siRNA, the conjugate, or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (e.g., an siRNA targeting a different target sequence in the CTGF gene or an siRNA targeting another target) such as simultaneous or sequential administration.

[0156] In some embodiments, one siRNA provided herein is used. The siRNA is optionally encapsulated by a delivery vehicle. In some embodiments, the one siRNA is encapsulated in the same delivery vehicle. In other embodiments, the one siRNA is encapsulated in different delivery vehicles, respectively.

[0157] In other embodiments, at least two siRNAs provided herein (e.g., but not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) are used, preferably each of the at least two siRNAs targets a different target sequence in the CTGF gene. The at least two siRNAs are optionally encapsulated by a delivery vehicle. In some embodiments, the at least two siRNAs are encapsulated in the same delivery vehicle. In other embodiments, the at least two siRNAs are encapsulated in different delivery vehicles, respectively.

[0158] In other embodiments, at least one siRNA provided herein is used in combination with an siRNA targeting another target (e.g., a gene other than CTGF). The siRNA provided herein and the siRNA targeting another target (e.g., a gene other than CTGF) are optionally encapsulated by a delivery vehicle. In some embodiments, the siRNA provided herein and the siRNA targeting another target (e.g., a gene other than CTGF) are encapsulated in the same delivery vehicle. In other embodiments, the siRNA provided herein and the siRNA targeting another target (e.g., a gene other than CTGF) are encapsulated in different delivery vehicles, respectively.

[0159] Definitions of terms

[0160] In the present application, the scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art, unless otherwise indicated. Also, the cell culture, molecular biology, biochemistry, nucleic acid chemistry, immunology, and other biological procedures described herein are conventional procedures well understood by those skilled in the art. In order to better understand the present application, the following definitions and explanations of related terms are provided.

[0161] In the present text, the mRNA sequence of connective tissue growth factor (CTGF) is well known to the person skilled in the art, for example, see the mRNA sequence shown in Genbank Accession No. NM_001901.4. Further, the term "target gene" as used herein refers to a gene which transcribes the above-mentioned CTGF mRNA, the term "target RNA" or "target mRNA" refers to the above-mentioned CTGF mRNA, and the term "inhibiting the CTGF gene" refers to inhibiting the expression of the CTGF mRNA and protein, if not otherwise specified.

[0162] In the present text, capital letters C, G, U, A, T represent the base composition of a nucleotide, including modified or unmodified nucleotides; the lower case letter m represents that the nucleotide adjacent to the right of the letter m is a methoxy-modified nucleotide; i2F represents that the nucleotide adjacent to the right of the i2F is a fluorine-modified nucleotide; the symbol * represents that the two nucleotides adjacent to the left and right of the symbol * are connected by a phosphorothioate group.

[0163] In the present text, the term "modified nucleotide" refers to a nucleotide independently having a modified ribose moiety, a modified internucleoside linkage, or a modified base. Thus, the term "modified nucleotide" encompasses substitutions, additions, or removals (e.g., using functional groups or atoms) to the internucleoside linkage, ribose moiety, or base. Modifications suitable for use in the present application include all types of modifications disclosed herein or known in the art. A "methoxy-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group is replaced by a methoxy group. A "fluorine-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group is replaced by a fluorine. A "nucleotide analogue" refers to a group that can replace a nucleotide in a nucleic acid, but is structurally different from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or a thymine deoxyribonucleotide. Such as an isonucleotide, a bridged nucleic acid (BNA), or an acyclic nucleotide.

[0164] In which, the structure of the fluorine-modified nucleotide is as follows:

[0165] The structure of the methoxy-modified nucleotide is as follows:

[0166] In the present context, the term "siRNA" means an RNA molecule capable of sequence-specifically inducing the RNAi phenomenon, consisting of a sense strand and an antisense strand, and having a partially or fully complementary double-stranded structure. In the siRNAs according to the present application, the complementary double-stranded structure can have a length of 15 to 30 base pairs, such as 15, 16, 17, 18, 19, 20 or 21 base pairs, such as 15 to 19 base pairs. In some embodiments of the present application, the siRNAs can also contain modified nucleotides as desired, which do not result in a significant impairment or loss of the function of the siRNA to inhibit the expression of the CTGF gene. At present, there are a number of ways available in the art for modifying siRNAs, including, for example, backbone modifications (such as modification of the phosphate group), ribose group modifications and base modifications (Watts, J.K., G.F. Deleavey, and M.J. Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55).

[0167] The term "antisense strand" refers to a polynucleotide that is substantially complementary to a target nucleic acid sequence. The term "sense strand" refers to a polynucleotide that is substantially identical to a target nucleic acid sequence. The term "region of complementarity" refers to a region on the antisense strand that is substantially complementary to the CTGF mRNA or a region on the sense strand that is substantially complementary to the antisense strand. When the region of complementarity is not fully complementary to the target nucleic acid sequence, mismatches can be in the interior of the molecule or in the terminal regions. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, 2 or 1 nucleotides of the 5' and / or 3' terminus. The term "substantially" includes a portion or all.

[0168] In the present context, the term "complementary" means, unless otherwise specified, the ability of an oligonucleotide of a first sequence to hybridize under certain conditions and form a duplex structure with an oligonucleotide of a second sequence. "At least partially complementary" means that the two sequences can be completely complementary or have no more than 6, 5, 4, 3, or 2 or 1 mismatched base pairs in total while retaining the ability to hybridize under the relevant conditions. Also in cases where the two oligonucleotides are designed to hybridize with one or more single-stranded overhangs, such overhangs shall not be considered mismatches in terms of complementarity. In the present context, "complementary" sequences can also include or be formed entirely from non-Watson (Waston)-Crick (Crick) base pairs and / or base pairs formed from non-natural and modified nucleotides, as long as the above hybridization ability is met. Such non-Watson (Waston)-Crick (Crick) base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing. Correspondingly, in the present context, "mismatch" means, unless otherwise specified, that the bases at the corresponding position in the siRNA duplex molecule are not present in complementary form.

[0169] The skilled person will be able to determine the conditions most suitable for testing the complementarity of two sequences depending on the final application of the hybridized nucleotides. Such conditions can for example be stringent conditions, such as 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that can be encountered in vivo can also be applied.

[0170] In the present context, "nucleotide sequence differs" means, unless otherwise specified, that the base type of the nucleotide at the same or corresponding position has been changed compared to the original nucleotide sequence. For example, if one nucleotide base in the original nucleotide sequence is A, a nucleotide sequence difference is considered to exist at that position if the nucleotide base at the same or corresponding position has been changed to U, C, G, or dT, dC, dG, etc. It is noted that a nucleotide sequence difference is not considered to exist at a position if the nucleotide at the same or corresponding position differs only in the presence or type of modification compared to the original nucleotide sequence.

[0171] In this context, the term "pharmaceutically acceptable carriers and / or excipients" refers to carriers, delivery vehicles, diluents, adjuvants, and / or salts / esters / hydrates thereof formed, etc. that are generally chemically and / or physically compatible with other ingredients constituting a pharmaceutical dosage form, such as the siRNA of the present application, and physiologically compatible with the subject. The "pharmaceutically acceptable carriers and / or excipients" do not exert or are not intended to exert a therapeutic effect at the intended dosage. Such ingredients can serve a variety of purposes, such as: a) aiding in the processing of the drug delivery system during manufacture, b) protecting, supporting or enhancing the stability, bioavailability or patient acceptability of the active ingredients, c) aiding in product identification, and / or d) enhancing the overall safety, effectiveness, delivery, etc. of the active ingredients during storage and use. For example, the siRNA of the present application can be encapsulated by a delivery vehicle. The "pharmaceutically acceptable carriers and / or excipients" include, but are not limited to: viruses, liposomes, nanoparticles, bacteria, lipid nanoparticles (LNP), neutral liposomes (NL), polymeric nanoparticles, double-stranded RNA binding motifs (dsRBMs), pH modifiers, surfactants, adjuvants, ionic strength enhancers, diluents, agents to maintain osmotic pressure, agents to delay absorption, preservatives. For example, viruses include, but are not limited to, retroviruses, adenoviruses, lentiviruses, baculoviruses, AAV. Liposomes include, but are not limited to, Lipofectamine, cationic DOTAP, neutral DOPC. Nanoparticles include, but are not limited to, cationic polymers, PEI. Bacteria include, but are not limited to, tkRNAi. Polymeric nanoparticles include, but are not limited to, low molecular weight polymers or high molecular weight polymers. For example, pH modifiers include, but are not limited to, phosphate buffer. Surfactants include, but are not limited to, cationic, anionic or non-ionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial agents and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. Agents to maintain osmotic pressure include, but are not limited to, sugars, NaCl and the like. Agents to delay absorption include, but are not limited to, monostearate and gelatin. Diluents include, but are not limited to, water, aqueous buffers (such as buffered saline), alcohols and polyols (such as glycerol), etc. Adjuvants include, but are not limited to, inorganic adjuvants (such as aluminum hydroxide, vanadate), biological adjuvants (such as Mycobacterium tuberculosis, BCG, Corynebacterium parvum, Bordetella pertussis, Gram-negative bacterial endotoxins, B subunit of cholera toxin, muramyl dipeptide, cytokines), synthetic adjuvants (such as double-stranded polyadenylic acid, uridylic acid), oil agents (such as Freund's complete adjuvant, peanut oil emulsion) and nano-adjuvants, etc.

[0172] In the present context, the term "inhibition" refers to a down-regulation of the expression of a target gene due to siRNA-mediated degradation of the mRNA of the target gene, unless otherwise specifically indicated. The term "down-regulation" refers to a decrease in the level of expression of a target gene by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or even 100% relative to the level of expression of the target gene in the absence of siRNA treatment. A decrease in the level of expression of a target gene by 100% refers to a level of expression of the target gene that is not detectable.

[0173] In the present context, the term "overhang" or "nucleotide overhang" refers to at least one unpaired nucleotide projecting from the duplex structure of an siRNA. For example, an overhang is present when the 3' end of one strand of an siRNA extends beyond the 5' end of the other strand (or vice versa). An siRNA can comprise an overhang of at least one nucleotide, or the overhang can comprise at least 2 nt, at least 3 nt, at least 4 nt, at least 5 nt, or more. The overhang can comprise or consist of nucleotides / nucleoside analogs, including deoxynucleotides / nucleosides. The overhang can be on the sense strand, the antisense strand, or any combination thereof. The nucleotides of the overhang can be present on the 5' end, the 3' end, or both ends of the antisense strand or the sense strand of an siRNA. Accordingly, the term "blunt end" refers to an absence of a nucleotide overhang.

[0174] In the present context, the term "prevention" refers to a method undertaken in order to stop or delay the onset of a disease or disorder or a symptom in a subject; the term "treatment" refers to a method undertaken in order to obtain a beneficial or desired clinical result. For the purposes of the present application, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilization (i.e., not worsening) of the state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Moreover, "treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0175] As used herein, the term "effective amount" means an amount that is sufficient to achieve or at least partially achieve a desired effect. For example, an effective prophylactic amount is an amount that is sufficient to prevent, arrest, or delay the onset of a disease; an effective therapeutic amount is an amount that is sufficient to cure or at least partially arrest the disease and its complications in an already afflicted patient. Determining such effective amounts is well within the capability of those skilled in the art. For example, an effective amount for therapeutic uses will depend on the severity of the disease to be treated, general state of health of the patient, age, weight, and gender of the patient, mode of administration of the drug, and other concurrent therapeutic measures, etc.

[0176] Advantages of the Invention

[0177] The siRNA of the present application can effectively inhibit CTGF gene expression in vitro and / or in vivo, has good stability, can significantly reduce CTGF protein expression level at animal level, and has little cytotoxicity and immunostimulatory. Thus, the siRNA of the present application can be used for treating diseases or conditions that benefit from reduction or inhibition of CTGF level, and has important clinical value for treating CTGF-related diseases, etc.

[0178] Embodiments of the present application will be described in detail below with reference to the accompanying drawings and examples, but those skilled in the art will understand that the following drawings and examples are only used to illustrate the present application, and are not limiting the scope of the present application. According to the following detailed description of the preferred embodiments and the accompanying drawings, various objects and advantageous aspects of the present application will become apparent to those skilled in the art. BRIEF DESCRIPTION OF DRAWINGS

[0179] Figures 1A-1C are results of in vitro CCK8 cytotoxicity detection of different modified duplexes. In the results, each group of results is for different duplex RNA, and in each group of results, the left side is for 20 nM concentration of duplex RNA, and the right side is for 1 nM concentration of duplex RNA.

[0180] Figures 2A-2C are results of human serum stability detection of different modified duplexes.

[0181] Preparation Example 1: Synthesis of unmodified siRNA

[0182] This preparation example provides a series of siRNAs for inhibiting CTGF expression, the nucleotide sequences of which are designed based on the target mRNA, see Table 1.

[0183] Table 1: Unmodified siRNA duplex sequence

[0184] Preparation Example 2: Synthesis of modified siRNA

[0185] This preparation example provides a series of modified siRNA for inhibiting CTGF expression, the modification modes of siRNA are shown in Table 2, and the sequences of the modified siRNA are shown in Table 3.

[0186] Modification explanation:

[0187] In Table 3, mN is a methoxy-modified nucleotide, i2FN is a fluorine-modified nucleotide, and * is a phosphorothioate linkage. The suffixes P1, P2, P3, P4, P5, P6, P7, P8, P9, P10, P11, P12, P15, P16 in the sequence names in Table 3 represent different modification modes, respectively, and the different modification modes are explained as follows:

[0188] P1 represents the modification mode of the sense strand SEQ ID NO: 301 and the modification mode of the antisense strand SEQ ID NO: 297. Among them, the sense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 20 and 21 are connected by a phosphorothioate linkage, the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 14, 15, 16, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 7, 9, 10, 11, and 13 are fluorine-modified nucleotides; the antisense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, 22 and 23 are connected by a phosphorothioate linkage, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 19, 20, 21, 22, and 23 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, 16, and 18 are fluorine-modified nucleotides.

[0189] P2 represents the modification pattern of SEQ ID NO: 301 on the sense strand + the modification pattern of SEQ ID NO: 298 on the antisense strand. Wherein, the sense strand comprises the following chemical modifications: the nucleotides at position 1-2, 20-21 are connected through phosphorothioate linkage in 5' to 3' end direction, the nucleotides at position 1, 2, 3, 4, 5, 6, 8, 12, 14, 15, 16, 17, 18, 19, 20, 21 are methoxy modified nucleotides, the nucleotides at position 7, 9, 10, 11, 13 are fluoro modified nucleotides; the antisense strand comprises the following chemical modifications: the nucleotides at position 1-2, 2-3, 21-22, 22-23 are connected through phosphorothioate linkage in 5' to 3' end direction, the nucleotides at position 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 21, 22, 23 are methoxy modified nucleotides, the nucleotides at position 2, 6, 14, 16, 20 are fluoro modified nucleotides.

[0190] P3 represents the modification pattern of SEQ ID NO: 301 on the sense strand + the modification pattern of SEQ ID NO: 299 on the antisense strand. Wherein, the sense strand comprises the following chemical modifications: the nucleotides at position 1-2, 20-21 are connected through phosphorothioate linkage in 5' to 3' end direction, the nucleotides at position 1, 2, 3, 4, 5, 6, 8, 12, 14, 15, 16, 17, 18, 19, 20, 21 are methoxy modified nucleotides, the nucleotides at position 7, 9, 10, 11, 13 are fluoro modified nucleotides; the antisense strand comprises the following chemical modifications: the nucleotides at position 1-2, 2-3, 21-22, 22-23 are connected through phosphorothioate linkage in 5' to 3' end direction, the nucleotides at position 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23 are methoxy modified nucleotides, the nucleotides at position 2, 6, 8, 14, 16 are fluoro modified nucleotides.

[0191] P4 represents the modification pattern of SEQ ID NO: 302 on the sense strand + the modification pattern of SEQ ID NO: 297 on the antisense strand. Among them, the sense strand comprises the following chemical modifications: the nucleotides at positions 1 and 2, 20 and 21 are connected through phosphorothioate group in the direction from the 5' end to the 3' end, the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 16, 17, 18, 19, 20, 21 are methoxy modified nucleotides, and the nucleotides at positions 7, 9, 10, 11, 15 are fluorine modified nucleotides; the antisense strand comprises the following chemical modifications: the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, 22 and 23 are connected through phosphorothioate group in the direction from the 5' end to the 3' end, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 19, 20, 21, 22, 23 are methoxy modified nucleotides, and the nucleotides at positions 2, 6, 14, 16, 18 are fluorine modified nucleotides.

[0192] P5 represents the modification pattern of SEQ ID NO: 302 on the sense strand + the modification pattern of SEQ ID NO: 298 on the antisense strand. Among them, the sense strand comprises the following chemical modifications: the nucleotides at positions 1 and 2, 20 and 21 are connected through phosphorothioate group in the direction from the 5' end to the 3' end, the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 16, 17, 18, 19, 20, 21 are methoxy modified nucleotides, and the nucleotides at positions 7, 9, 10, 11, 15 are fluorine modified nucleotides; the antisense strand comprises the following chemical modifications: the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, 22 and 23 are connected through phosphorothioate group in the direction from the 5' end to the 3' end, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 21, 22, 23 are methoxy modified nucleotides, and the nucleotides at positions 2, 6, 14, 16, 20 are fluorine modified nucleotides.

[0193] P6 represents sense strand modification pattern SEQ ID NO: 302 + antisense strand modification pattern SEQ ID NO: 299. Wherein, the sense strand comprises the following chemical modifications: the nucleotides at position 1-2, 20-21 are connected through phosphorothioate group in 5' end to 3' end direction, the nucleotides at position 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 16, 17, 18, 19, 20, 21 are methoxy modified nucleotides, the nucleotides at position 7, 9, 10, 11, 15 are fluoro modified nucleotides; the antisense strand comprises the following chemical modifications: the nucleotides at position 1-2, 2-3, 21-22, 22-23 are connected through phosphorothioate group in 5' end to 3' end direction, the nucleotides at position 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23 are methoxy modified nucleotides, the nucleotides at position 2, 6, 8, 14, 16 are fluoro modified nucleotides.

[0194] P7 represents sense strand modification pattern SEQ ID NO: 303 + antisense strand modification pattern SEQ ID NO: 297. Wherein, the sense strand comprises the following chemical modifications: the nucleotides at position 1-2, 20-21 are connected through phosphorothioate group in 5' end to 3' end direction, the nucleotides at position 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 18, 19, 20, 21 are methoxy modified nucleotides, the nucleotides at position 7, 9, 10, 11, 17 are fluoro modified nucleotides; the antisense strand comprises the following chemical modifications: the nucleotides at position 1-2, 2-3, 21-22, 22-23 are connected through phosphorothioate group in 5' end to 3' end direction, the nucleotides at position 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 19, 20, 21, 22, 23 are methoxy modified nucleotides, the nucleotides at position 2, 6, 14, 16, 18 are fluoro modified nucleotides.

[0195] P8 represents the modification pattern of SEQ ID NO: 303 on the sense strand + the modification pattern of SEQ ID NO: 298 on the antisense strand. Among them, the sense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 20 and 21 are connected through phosphorothioate group, the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 18, 19, 20, 21 are methoxy modified nucleotides, and the nucleotides at positions 7, 9, 10, 11, 17 are fluorine modified nucleotides; the antisense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, 22 and 23 are connected through phosphorothioate group, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 21, 22, 23 are methoxy modified nucleotides, and the nucleotides at positions 2, 6, 14, 16, 20 are fluorine modified nucleotides.

[0196] P9 represents the modification pattern of SEQ ID NO: 303 on the sense strand + the modification pattern of SEQ ID NO: 299 on the antisense strand. Among them, the sense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 20 and 21 are connected through phosphorothioate group, the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 18, 19, 20, 21 are methoxy modified nucleotides, and the nucleotides at positions 7, 9, 10, 11, 17 are fluorine modified nucleotides; the antisense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, 22 and 23 are connected through phosphorothioate group, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23 are methoxy modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, 16 are fluorine modified nucleotides.

[0197] P10 represents the sense strand modification pattern SEQ ID NO: 304 + the antisense strand modification pattern SEQ ID NO: 297. Among them, the sense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 20 and 21 are connected through phosphorothioate group, the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 20, 21 are methoxy modified nucleotides, and the nucleotides at positions 7, 9, 10, 11, 19 are fluoro modified nucleotides; the antisense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, 22 and 23 are connected through phosphorothioate group, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 19, 20, 21, 22, 23 are methoxy modified nucleotides, and the nucleotides at positions 2, 6, 14, 16, 18 are fluoro modified nucleotides.

[0198] P11 represents the sense strand modification pattern SEQ ID NO: 304 + the antisense strand modification pattern SEQ ID NO: 298. Among them, the sense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 20 and 21 are connected through phosphorothioate group, the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 20, 21 are methoxy modified nucleotides, and the nucleotides at positions 7, 9, 10, 11, 19 are fluoro modified nucleotides; the antisense strand comprises the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, 22 and 23 are connected through phosphorothioate group, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 21, 22, 23 are methoxy modified nucleotides, and the nucleotides at positions 2, 6, 14, 16, 20 are fluoro modified nucleotides.

[0199] P12 represents the modification mode of the sense strand SEQ ID NO: 304 + the modification mode of the antisense strand SEQ ID NO: 299. Among them, the sense strand comprises the following chemical modifications: in the direction from 5' end to 3' end, the nucleotides at position 1 and 2, position 20 and 21 are connected through phosphorothioate group, the nucleotides at position 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 20, 21 are methoxy modified nucleotides, and the nucleotides at position 7, 9, 10, 11, 19 are fluorine modified nucleotides; the antisense strand comprises the following chemical modifications: in the direction from 5' end to 3' end, the nucleotides at position 1 and 2, position 2 and 3, position 21 and 22, position 22 and 23 are connected through phosphorothioate group, the nucleotides at position 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23 are methoxy modified nucleotides, and the nucleotides at position 2, 6, 8, 14, 16 are fluorine modified nucleotides.

[0200] P15 represents the modification mode of the sense strand SEQ ID NO: 305 + the modification mode of the antisense strand SEQ ID NO: 299. Among them, the sense strand comprises the following chemical modifications: in the direction from 5' end to 3' end, the nucleotides at position 1 and 2, position 20 and 21 are connected through phosphorothioate group, the nucleotides at position 1, 2, 3, 4, 5, 6, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 are methoxy modified nucleotides, and the nucleotides at position 7, 9, 11 are fluorine modified nucleotides; the antisense strand comprises the following chemical modifications: in the direction from 5' end to 3' end, the nucleotides at position 1 and 2, position 2 and 3, position 21 and 22, position 22 and 23 are connected through phosphorothioate group, the nucleotides at position 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23 are methoxy modified nucleotides, and the nucleotides at position 2, 6, 8, 14, 16 are fluorine modified nucleotides.

[0201] P16 represents SEQ ID NO: 306 for the modification pattern of the sense strand and SEQ ID NO: 300 for the modification pattern of the antisense strand. Wherein, the sense strand comprises the following chemical modifications: the nucleotides at position 1-2, 20-21 are connected through phosphorothioate group, the nucleotides at position 2, 4, 6, 8, 12, 14, 16, 18, 20 are methoxy modified nucleotides, the nucleotides at position 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, 21 are fluoro modified nucleotides, in the order of 5' end to 3' end; the antisense strand comprises the following chemical modifications: the nucleotides at position 1-2, 2-3, 21-22, 22-23 are connected through phosphorothioate group, the nucleotides at position 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, 21, 22, 23 are methoxy modified nucleotides, the nucleotides at position 2, 4, 6, 8, 10, 14, 16, 18, 20 are fluoro modified nucleotides, in the order of 5' end to 3' end.

[0202] Table 2: Modification patterns of siRNAs

[0203] Table 3: Modified antisense and sense strand sequences of siRNAs DETAILED DESCRIPTION

[0204] The present application is now described in the following non-limiting examples.

[0205] Those skilled in the art know that the examples describe the present application by way of illustration, and are not intended to limit the scope of the application claimed herein. The experimental methods in the examples are all conventional methods unless specifically stated otherwise. The specific conditions not specified in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are all conventional products that can be obtained commercially unless the manufacturer is specified.

[0206] Example 1: Synthesis of siRNAs

[0207] The siRNA sequence was designed against the CTGF gene sequence (see NCBI Reference Sequence: NM_001901.4, SEQ ID NO: 307). For the sense and antisense strands of the siRNA sequence of the present application and the sense and antisense strands of the modified duplex, deoxynucleoside CPG was used as a solid support; the sense strand was synthesized using a solid support, and the antisense strand was synthesized using a universal CPG.

[0208] The 48-channel synthesizer was used to perform sequence synthesis at a scale of 0.2 pmol. The phosphoramidite monomers were used at a concentration of 0.05 M, and the activator was used at a concentration of 0.3 M BTT.

[0209] The cleavage and deprotection of the sequence were performed in a 1.5 ml tube, the first step using AMA, and the second step using triethylamine trifluoride to remove the di-protecting group. For sequences containing di-positions with all modifications, ammonolysis with ammonia was required. The sequence after cleavage and deprotection was precipitated using a mixture of acetone: ethanol (80:20 by volume) and dissolved in RNase-free water. Each sequence was analyzed by LC-MS to determine sequence accuracy, by spectrophotometer to determine the quantity, and by HPLC to determine the purity.

[0210] After HPLC purification, lyophilization, and quality testing, the siRNA duplex was formed by mixing the sense and antisense strands in a 1:1 ratio after the salt exchange with sodium acetate and desalting with a 3KD ultrafiltration tube. The obtained siRNA duplexes are shown in Table 1 of Preparation Example 1 and Table 3 of Preparation Example 2.

[0211] Example 2: In vitro activity detection

[0212] 2-1. Cell culture and transfection

[0213] (1) A549 cell culture: A549 cells (ATCC) were cultured at 37°C in an environment with 5% CO2 using F-12K complete medium (Gibco, added with 10% FBS) until near confluence, and then the cells were trypsinized and plated using a 96-well plate, with 8000 A549 cells and 0.1 mL F-12K medium (Gibco, added with 10% FBS) per well, and cultured for 24 h. After lipofectamine 2000 (Invitrogen) transfection of siRNA, RNA extraction was performed after continued culture at 37°C in an environment with 5% CO2 for 24 h. Single-dose experiments were performed at a duplex concentration of 1.0 nM and 0.3 nM.

[0214] (2) MRC-5 cell culture: MRC-5 cells (ATCC) were cultured at 37°C in a 5% CO2 environment using MEM complete medium (Gibco, added 10% FBS) to near confluence, then the cells were trypsinized and plated using a 96-well plate, 12000 MRC-5 cells and 0.1 mL of MEM medium (Gibco, added 10% FBS) were added to each well, and after transfection with lipofectamine RNAiMAX (Invitrogen) siRNA, the cells were cultured at 37°C in a 5% CO2 environment for 24 h before RNA extraction. The single-dose experiment was performed at a concentration of 0.3 nM duplex.

[0215] 2-2. RNA extraction

[0216] The RNA extraction kit (yeasen company, Cat: 18600ES50) was used according to the instructions of the RNA extraction kit, and finally 170 μL of RNase-free water was added, and the RNA was collected.

[0217] 2-3. Real-time fluorescent quantitative PCR

[0218] The one-step RT-qPCR kit (Cat: 11143ES80) of yeasen was used according to the steps of the instructions to perform one-step RT-qPCR. The ΔΔCt method was used to determine the relative expression level of the target gene in the ABI QuantStudio TM 6 Real-time fluorescent PCR was performed in a real-time fluorescent PCR system. Each duplex was tested independently three times, and each transfection was determined in triplicate.

[0219] The one-step RT-qPCR system is as follows:

[0220] The sequences of the detection primers are as follows:

[0221] hCTGF-F: CACCCGGGTTACCAATGACA (SEQ ID NO: 308)

[0222] hCTGF-R: TCCGGGACAGTTGTAATGGC (SEQ ID NO: 309)

[0223] hGAPDH-F: GAGTCAACGGATTTGGTCGT (SEQ ID NO: 310)

[0224] hGAPDH-R: GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 311)

[0225] 2-4. Protein detection

[0226] The CTGF ELISA kit (R&D-DY9190) was used according to the instructions. The CTGF antibody was coated on the 96-well plate at 200 ng / ml, and incubated at room temperature overnight. The detection sample was taken from the cell culture supernatant (100 μL / well) and added to the 96-well plate, incubated for 2 hours, then washed, added with detection antibody, incubated at room temperature for 2 hours, washed again, and then the conventional termination liquid and developing liquid were operated, and finally detected by machine.

[0227] The results of in vitro activity test are shown in Tables 4-7, and the results show that the duplex and modified duplex can effectively inhibit the expression of CTGF mRNA in A549 cells and MRC-5 cells.

[0228] Table 4: Test results of duplex single dose (0.3 nM) in A549 cells

[0229] Table 5: Test results of duplex single dose (0.3 nM) in MRC-5 cells

[0230] Table 6: Test results of modified duplex single dose (1 nM) in A549 cells

[0231] Table 7: Test results of modified duplex single dose (0.3 nM) in A549 cells

[0232] The results of the inhibition rate of modified duplex protein in A549 and MRC-5 cells are shown in Table 8, and the results show that the inhibition rate of modified duplex protein reaches more than 90%, indicating that the modified duplex has high inhibition activity at the protein level.

[0233] Table 8: Inhibition rate of modified duplex protein in A549 and MRC-5 cells

[0234] 2-5. CCK8 cytotoxicity test

[0235] The effect of modified duplex RNA on the activity of A549 cells at high concentration (1 nM, 20 nM) was detected. The CCK8 kit (purchased from Biyun Tian C0040) was used for cell activity detection. Among them, siNC is a meaningless siRNA sequence that is not the same as the target point.

[0236] One day before transfection, A549 cells were seeded into a 96-well plate at a density of 8000 per well, and LipofectamineTM RNAiMAX (purchased from Invitrogen), siRNA was transfected into A549 cells respectively, the final concentration of siRNA was 1 nM, 20 nM, and MOCK was set as a control group, and the MOCK group was only added Lipofectamine TM The RNAiMAX reagent was not added to any siRNA group.

[0237] CCK8 detection: After 48 hours, all old culture medium in the cell plate was aspirated, and culture medium containing 10% CCK-8 detection solution was added, and incubated at 37°C for 1 hour in the dark. The TECAN Spark 20M was used to read the absorbance value at 450 nm and the reference wavelength was 620 nm, and the remaining activity% was calculated: (absorbance value-blank well absorbance value) / (untreated group absorbance value-blank well absorbance value)*100%.

[0238] The results of CCK8 detection of modified duplex in vitro cytotoxicity are shown in Figures 1A-1C, and the results show that the modified duplex has little effect on the activity of A549 cells in vitro, indicating that the cytotoxicity is negligible.

[0239] Example 3: Stability detection

[0240] 3-1. Mouse serum stability

[0241] Prepare siRNA serum mixed solution (100 μL) system, 40 μL DMEM + 50 μL serum + 10 μL siRNA (10 μM, final concentration 1 μM), mix well, and seal with sealing film; incubate at 37°C for a specified time (0 / 48h). After incubation, extract siRNA using phenol chloroform according to the kit instructions (Biyun Tian, p1011), and extract the siRNA using 10% PAGE gel for nucleic acid electrophoresis. After electrophoresis, use a gel imager (Bio-Rad) to image the PAGE gel and perform image quantification analysis. As shown in Table 9, the results show that the modified duplex has good stability in serum.

[0242] 3-2. RNase A stability

[0243] Take 5 μL siRNA (20 μM), add 15 μL RNase A (final concentration 10 μg / ml), prepare 4 tubes for each group, and treat in a 37°C water bath or metal bath for different reaction times 0 min, 15 min, 60 min, and 240 min, respectively. After treatment, perform nucleic acid electrophoresis using 10% PAGE gel. After electrophoresis, perform imaging of the PAGE gel using a gel imager (Bio-Rad) and image quantification analysis. As shown in Table 9, the results show that the modified duplexes all have good stability in RNase A.

[0244] Table 9: Modified duplex stability test results

[0245] 3-3: Human serum stability test (durability investigation)

[0246] The human serum used in this experiment (purchased from Australia, item number: FSU-MIX-100ml) was used at a final concentration of 50% human serum, and the siRNA was used at a final concentration of 1 μM. Four tubes were prepared for each group, mixed, sealed with sealing film, and placed in a 37°C incubator for different reaction times D0, D2, D4, and D7, respectively. After treatment, perform quick freezing using liquid nitrogen and store at -80°C. Perform nucleic acid electrophoresis using 10% PAGE gel. After electrophoresis, perform imaging analysis of the PAGE gel using a gel imager (Bio-Rad). The control PCMD is 93CTGF-Ome, which is derived from SEQ ID NO: 29 and 30 in WO2017178883A2.

[0247] As shown in FIGS. 2A-2C, the results show that the modified duplexes have good 7-day stability in human serum.

[0248] Although the specific embodiments of the present application have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the details in light of the overall teachings of the disclosure, and such changes and modifications are intended to be within the scope of the present application. The full scope of the application is given by the appended claims and any equivalents thereof.

Claims

1. A small interfering RNA (siRNA) for inhibiting CTGF gene expression, the siRNA comprising a sense strand and an antisense strand, wherein, the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 (e.g. 0, 1, 2, 3 or 4) nucleotides from the nucleotide sequence recited in any one of SEQ ID NO: 1 to SEQ ID NO: 85, and the sense strand is at least partially complementary to the antisense strand.

2. The siRNA of claim 1, wherein, the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 2 (e.g. 0, 1 or 2) nucleotides from the nucleotide sequence recited in any one of SEQ ID NO: 1 to SEQ ID NO:

85.

3. The siRNA of claim 1 or 2, wherein, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 (e.g. 0, 1, 2, 3 or 4) nucleotides from the nucleotide sequence recited in any one of SEQ ID NO: 86 to SEQ ID NO: 170; Preferably, the sense strand has a region of at least 85% complementarity to the antisense strand within the 15 contiguous nucleotides; Preferably, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 2 (e.g. 0, 1 or 2) nucleotides from the nucleotide sequence recited in any one of SEQ ID NO: 86 to SEQ ID NO:

170.

4. The siRNA according to any one of claims 1 to 3, wherein, the siRNA comprises a blunt end and / or a 1-4 nucleotide overhang; Preferably, the siRNA comprises a 1 or 2 nucleotide overhang; Preferably, the overhang is present on the 5' end and / or the 3' end of the antisense strand and / or the sense strand; Preferably, the 3' end of the antisense strand of the siRNA comprises a 2 nucleotide overhang.

5. The siRNA according to any one of claims 1 to 4, wherein, the antisense strand and the sense strand are each independently 15-30 nucleotides in length; preferably the antisense strand is 19-27 nucleotides in length; preferably the sense strand is 17-25 nucleotides in length.

6. The siRNA according to any one of claims 1 to 5, wherein, the antisense strand is 21-23 nucleotides in length and the sense strand is 19-21 nucleotides in length.

7. The siRNA according to any one of claims 1 to 6, wherein, the sense strand has no more than 6 (e.g. 0, 1, 2, 3, 4, 5 or 6) nucleotide mismatches with the antisense strand; Preferably, the sense strand has no more than 2 (e.g. 0, 1 or 2) nucleotide mismatches with the antisense strand.

8. The siRNA according to any one of claims 1 to 7, wherein, the sequence of the sense strand and the antisense strand of the siRNA comprises the sense strand and antisense strand sequence of any one of duplex 1, duplex 4, duplex 25-duplex 28, duplex 36, duplex 38, duplex 41, duplex 51, duplex 52, duplex 63, duplex 64, duplex 66, duplex 67, duplex 71, duplex 77-duplex 80, duplex 82, duplex 84-duplex 86, duplex 93-duplex 96, duplex 105, duplex 107, duplex 110, duplex 111, duplex 116, duplex 118, duplex 119, duplex 127, duplex 129-duplex 131, duplex 134-duplex 145, duplex 147-duplex 180 provided in Table 1.

9. The siRNA according to any one of claims 1 to 8, wherein, the target gene start position targeted by the sequence of the antisense strand of the siRNA is any position between positions 976-980, or 2256-2298 (e.g., 2258-2294), or 1761-1762 of the CTGF mRNA set forth in SEQ ID NO: 307; Preferably, the target gene start position targeted by the sequence of the antisense strand of the siRNA is any one of positions 976, 977, 978, 980, 2258, 2266, 2286, 2287, 2291, 2292, 2294, 1761, and 1762 of the CTGF mRNA set forth in SEQ ID NO: 307; Preferably, the sequence of the antisense strand of the siRNA comprises the antisense strand sequence of any one duplex selected from the group consisting of duplex 93, duplex 94, duplex 95, duplex 96, duplex 156, duplex 160, duplex 161, duplex 162, duplex 164, duplex 165, duplex 167, duplex 172, and duplex 173 provided in Table 1; Preferably, the sense strand of the siRNA has at least 85% complementarity or is completely complementary to the antisense strand over at least 15 contiguous nucleotides; Preferably, the sequence of the sense and antisense strands of the siRNA comprises the sense and antisense strand sequence of any one duplex selected from the group consisting of duplex 93, duplex 94, duplex 95, duplex 96, duplex 156, duplex 160, duplex 161, duplex 162, duplex 164, duplex 165, duplex 167, duplex 172, and duplex 173 provided in Table 1.

10. An siRNA for inhibiting the expression of a CTGF gene, the siRNA comprising a sense strand and an antisense strand, wherein, the target gene start position targeted by the sequence of the antisense strand of the siRNA is any position between positions 2256-2298 of the CTGF mRNA set forth in SEQ ID NO: 307, the antisense strand comprises at least 15 contiguous nucleotides, and the sense strand is at least partially complementary to the antisense strand; Preferably, the sense strand comprises at least 15 contiguous nucleotides having at least 85% complementarity to the antisense strand within the 15 contiguous nucleotides; Preferably, the siRNA comprises a blunt end and / or 1-4 nucleotide overhangs; Preferably, the antisense strand and the sense strand are each independently 15-30 nucleotides in length; preferably, the antisense strand is 19-27 nucleotides in length; preferably, the sense strand is 17-25 nucleotides in length; Preferably, the antisense strand is 21-23 nucleotides in length, and the sense strand is 19-21 nucleotides in length.

11. The siRNA according to any one of claims 1-10, wherein, The siRNA comprises at least one modified nucleotide.

12. The siRNA of claim 11, wherein, All nucleotides in the sense and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs; Preferably, the siRNA comprises at least one modified nucleotide. Preferably, all nucleotides in the sense strand of the siRNA are modified nucleotides or nucleotide analogs, and all nucleotides in the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

13. The siRNA of claim 11 or 12, wherein, The modified nucleotides or nucleotide analogs are selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide analogs, 2'-fluoroarabinonucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides comprising phosphorothioate groups, nucleotides comprising methylphosphonate groups, nucleotides comprising 5'-phosphate esters, nucleotides comprising 5'-phosphate ester mimics, glycol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleotides, unlocked nucleotides, or glycerol nucleotides.

14. The siRNA according to any one of claims 11-13, wherein, The nucleotides in the sense strand of the siRNA are selected from 2'-methoxy nucleotides and 2'-fluoro nucleotides; and / or the nucleotides in the antisense strand of the siRNA are selected from 2'-methoxy nucleotides and 2'-fluoro nucleotides.

15. The siRNA according to any one of claims 11-14, wherein, The sense strand and / or the antisense strand of the siRNA comprises modified internucleoside linkages; Preferably, the 5' end and / or the 3' end of the sense strand independently comprises 1 or 2 phosphorothioate group linkages, respectively; and / or the 5' end and / or the 3' end of the antisense strand independently comprises 1 or 2 phosphorothioate group linkages, respectively.

16. The siRNA according to any one of claims 11-15, wherein, The antisense strand of the siRNA comprises the following modification pattern: (1) 5'-mN* / i2FN* / mN / mN / mN / i2FN / mN / mN / mN / mN / mN / mN / i2FN / mN / i2FN / mN / i2FN / mN / mN / mN* / mN* / mN-3' (SEQ ID NO: 297); (2) 5'-mN* / i2FN* / mN / mN / mN / i2FN / mN / mN / mN / mN / mN / mN / mN / i2FN / mN / i2FN / mN / mN / mN / i2FN / mN* / mN* / mN-3' (SEQ ID NO: 298); (3) 5'-mN* / i2FN* / mN / mN / mN / i2FN / mN / i2FN / mN / mN / mN / mN / mN / i2FN / mN / i2FN / mN / mN / mN / mN / mN* / mN* / mN-3' (SEQ ID NO: 299); or (4) 5'-mN* / i2FN* / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / mN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN* / mN* / mN-3' (SEQ ID NO: 300); wherein mN is a methoxy-modified nucleotide, i2FN is a fluoro-modified nucleotide, and * is a phosphorothioate group linkage.

17. The siRNA according to any one of claims 11-16, wherein, The sense strand of the siRNA comprises the following modification pattern: (1) 5'-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / i2FN / mN / mN / mN / mN / mN / mN / mN* / mN-3' (SEQ ID NO: 301); (2) 5'-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / mN / mN / i2FN / mN / mN / mN / mN / mN* / mN-3' (SEQ ID NO: 302); (3) 5'-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / mN / mN / mN / mN / i2FN / mN / mN / mN* / mN-3' (SEQ ID NO: 303); (4) 5'-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / mN / mN / mN / mN / mN / mN / i2FN / mN* / mN-3' (SEQ ID NO: 304); (5) 5'-mN* / mN / mN / mN / mN / mN / i2FN / mN / i2FN / mN / i2FN / mN / mN / mN / mN / mN / mN / mN / mN / mN* / mN-3' (SEQ ID NO: 305); or (6) 5'-i2FN* / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / i2FN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN* / i2FN-3' (SEQ ID NO: 306); wherein mN is a methoxy modified nucleotide, i2FN is a fluoro modified nucleotide, and * is a phosphorothioate linkage.

18. The siRNA of any one of claims 11-17, wherein, the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 171-218.

19. The siRNA according to any one of claims 11-18, wherein, the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 219-296.

20. The siRNA of any one of claims 11-19, wherein, the sense and antisense strand sequences of the siRNA comprise the sense and antisense strand sequences of any one duplex selected from the group consisting of duplexes 181-328 provided in Table 3; preferably, the sense and antisense strand sequences of the siRNA comprise the sense and antisense strand sequences of any one duplex selected from the group consisting of duplexes 188, 259, 260, 190, 192, 193, 262, 201, 202, 205, 272, 297, 298, 217, 277, 224, 309, 281, 282, 292, 321, and 324 provided in Table 3.

21. A conjugate of the formula: ###00011### wherein, The conjugate comprises the siRNA according to any one of claims 1 to 20 and a pharmaceutically acceptable targeting molecule.

22. A pharmaceutical composition, wherein, The pharmaceutical composition comprises the siRNA according to any one of claims 1 to 20 or the conjugate according to claim 21 and a pharmaceutically acceptable carrier and / or excipient.

23. The pharmaceutical composition of claim 22, wherein, The pharmaceutically acceptable carrier is a delivery vehicle; preferably, the siRNA is encapsulated by the delivery vehicle.

24. Use of the siRNA according to any one of claims 1 to 20, the conjugate according to claim 21 and / or the pharmaceutical composition according to claim 22 or 23 for the manufacture of a medicament for the treatment and / or prevention of a CTGF-associated disease; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (e.g. an siRNA targeting a different target sequence in the CTGF gene or an siRNA targeting another target).

25. The use of claim 24, wherein, The CTGF-associated disease is a liver fibrosis disease, a lung fibrosis disease, chronic hypersensitivity pneumonitis, a connective tissue disease-related interstitial disease, a kidney fibrosis disease, a heart fibrosis disease, Duchenne muscular dystrophy (DMD), systemic sclerosis (SSc), a hypertrophic scar or a keloid; preferably, the lung fibrosis disease is a fibrotic interstitial lung disease (f-ILD), e.g. idiopathic pulmonary fibrosis (IPF).

26. A method of inhibiting CTGF expression in a cell, said method comprising: Introducing into a cell the siRNA according to any one of claims 1 to 20, the conjugate according to claim 21 or the pharmaceutical composition according to claim 22 or 23; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (e.g. an siRNA targeting a different target sequence in the CTGF gene or an siRNA targeting another target).

27. A method of preventing and / or treating a CTGF-associated disease in a subject, the method comprising administering to a subject in need thereof an effective amount of the siRNA according to any one of claims 1 to 20, the conjugate according to claim 21 or the pharmaceutical composition according to claim 22 or 23; Preferably, the CTGF-associated disease is a liver fibrosis disease, a lung fibrosis disease, chronic hypersensitivity pneumonitis, a connective tissue disease-related interstitial disease, a kidney fibrosis disease, a heart fibrosis disease, Duchenne muscular dystrophy (DMD), systemic sclerosis (SSc), a hypertrophic scar or a keloid; preferably, the lung fibrosis disease is a fibrotic interstitial lung disease (f-ILD), e.g. idiopathic pulmonary fibrosis (IPF); Preferably, the subject is a mammal, e.g. a human; Preferably, the subject is a mammal, e.g. a human; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (e.g. an siRNA targeting a different target sequence in the CTGF gene or an siRNA targeting another target) e.g. administered simultaneously or sequentially.

Images