Novel dnazymes, their analogues and uses for the prevention and treatment of hair loss

Abstract

A composition comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA for use in treating a disease associated with over-expression of Dihydrotestosterone (DHT) is disclosed. Cosmetic compositions are also disclosed.

Description

[0001] NOVEL DNAZYMES, THEIR ANALOGUES AND USES FOR THE PREVENTION AND

[0002] TREATMENT OF HAIR LOSS

[0003] RELATED APPLICATIONS

[0004] This application claims the benefit of priority of U.S. Patent Application No. 63 / 633,882 filed April 15, 2024, the contents of which are incorporated herein by reference in their entirety.

[0005] SEQUENCE LISTING STATEMENT

[0006] The XML file, entitled 103479. xml, created on 15 April, 2025, comprising 61,440 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.

[0007] FIELD AND BACKGROUND OF THE INVENTION

[0008] The present invention, in some embodiments relates to the use of highly active DNAzymes for the prevention and treatment of hair loss and other diseases associated with over-expression of Dihydrotestosterone (DHT).

[0009] There is a high unmet need for prevention and treatment of hair loss which affects up to 50% of men and women throughout their life. Hair loss may lead to depression anxiety and social phobia.

[0010] DNAzymes (ribozymes, aptazymes) are oligonucleotides which possess catalytic activity, resulting in cleavage of targeted DNA / RNA molecules. They have been used to inhibit gene expression in mammalian systems.

[0011] Discovery of DNAzymes (AKA Deoxyribozymes) (e.g. W02011106997 Al) offers improved potency over other RNA silencing agents under use conditions (conditions appropriate for diagnosis purposes or physiological condition for in vivo use) and improved pharmaceutical properties which are essential to meet development objectives. Advantages of DNAzymes over RNA interference (RNAi) or antisense deoxyribonucleotides include their self-sufficient catalytic activity (e.g. no requirement for argonaut proteins or the action of RNase H) and ability to inactivate multiple substrates. The greatest focus of DNAzyme research has concentrated on 8-17 and 10-23 DNAzymes, that cleave RNA. So far, it has been studied for oncogenes, viruses, and genetic mutations.

[0012] A strategy for generating RNA catalytic DNAzymes is based on the 8-17 and 10-23 DNAzymes which cleave RNA. Using these DNAzymes as a basic component enables preparation of DNAzymes with enhanced Kcat values (Wang, et al 2002). However, this strategy does not offer reduction of KD that is required for enzymatic cleavage of multiple substrate molecules. More recently, Wang, et al. (2021) noted that 10 — 23 has been chemically modified in various ways to achieve an improved efficacy in vivo and in cells. Chemical modifications used for this purpose include phosphorothioate linkages, 2-O-methylribonucleotides, inverted 3'-3' thymidine nucleotides, phosphoramidite linkages and locked nucleic acids (LNAs). However, the effect of these modifications on the catalytic activity of the enzyme ranges from deleterious to beneficial depending on the residue location and type of chemical modification. These changes are often directed to the arms of DNAzymes for increasing their affinity for the target.

[0013] In vitro evolved DNAzymes and / or ribozymes have been discovered which have the capacity to catalyse a broad range of reactions including, but not limited to, cleavage of nucleic acids, ligation of nucleic acids, phosphorylation of nucleic acids, nucleic acid capping, amino acid adenylation, cofactor synthesis, RNA polymerization, template-directed polymerization, RNA- protein conjugation, aldol reaction, alcohol oxidation aldehyde reduction, purine and pyrimidine nucleotide synthesis, alkylation, amide synthesis, urea synthesis, formation of peptide bonds, peptidyl-RNA synthesis, acyl transfer- aminoacylation, carbonate hydrolysis, phosphorothioate alkylation, porphyrin metalation, formation of carbon-carbon bonds, Pd nanoparticle formation, biphenyl isomerization, formation of ester bonds, formation of amide bonds, DNA de glycosylation, thymine dimer photo reversion or phosphoramidate cleavage (reviewed Silverman, 2007).

[0014] The effectiveness of a DNAzyme was found to be dependent on super-physiological concentrations of divalent metal ions (e.g., Mg24). Under simulated physiological conditions, the unbound Mg2physiological intracellular concentration is only 0.1-0.5 mM, at this concentration, the catalytic efficiency usually does not meet the requirements for therapeutic purposes. Therefore, identification of new efficient catalytic DNAzyme at low Mg2+ concentrations, has been considered a therapy breakthrough.

[0015] Some examples of DNAzymes or ribozymes, which can cleave RNA and may have therapeutic applications were described (Sugiyama, et al. 2011); (Enjoji, et al. 2000); (Li, et al., 2000) Li et al. 2006); W02020089646A1; US2008051342A1).

[0016] Inhibition of the 5 alpha-reductase enzyme which converts testosterone to it more active form dihydrotestosterone (DHT) has therapeutic value. There are three isoenzymes of 5 alpha Reductase (5AR1-3). Hair follicles express 5AR1 and 5AR2. Inhibition of 5AR1 / 5AR2 enzymes was proven to prevent hair loss. Finasteride is a potent (mean inhibitory concentration [IC50], 69 nM) competitive inhibitor of 5AR2 but inhibits less effectively 5AR1 (IC50 360 nM), it is approved in a tablet form of Img to prevent some degree of hair loss in cases of male pattern baldness. Dutasteride is a dual 5AR1 and 5AR2 inhibitor that is more potent than finasteride with 5 ARI (IC507nM) and 5AR2 (IC50 6 nM). Dutasteride reduced mean levels of serum DHT at 24 weeks better than finasteride (94.7% versus 70.8% suppression). Dutasteride proved as better treatment for male pattern baldness clinical studies but it is not approved for this indication. However, undesirable toxicities are associated with the use of the currently available 5 alphareductase inhibitors, and new alternatives, including more potent compounds, are being sought (El-Naggar, et al. 2020).

[0017] Dihydrotestosterone (DHT) binds to Androgen Receptors (AR) inside the hair cell where it is transported to the nucleus. The DHT+AR complex activates transcription of ARRG genes (androgen receptor-regulated genes).

[0018] SUMMARY OF THE INVENTION

[0019] According to an aspect of the present invention, there is provided a composition comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA for use in treating a skin disease associated with over-expression of Dihydrotestosterone (DHT).

[0020] According to another aspect of the present invention, there is provided a pharmaceutical composition formulated for topical delivery comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA.

[0021] According to another aspect of the present invention, there is provided a cosmetic composition comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA.

[0022] According to another aspect of the present invention, there is provided a method of treating a skin disease comprising administering to a subject in need thereof a cosmetically effective amount of a composition comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA, thereby treating the skin disease.

[0023] According to embodiments of the invention, the method is a non-therapeutic method.

[0024] According to embodiments of the invention, the DNAzyme is capable of cleaving the 5AR2 mRNA.

[0025] According to embodiments of the invention, a cleavage site of the DNAzyme is comprised within positions 512-540, 721-756 or 463-493 of 5AR2, wherein the numbering of the positions is according to a nucleic acid sequence as set forth in SEQ ID NO: 50. According to embodiments of the invention, the cleavage site resides within SEQ ID NO:

[0026] 2, 3 or 1 of the 5AR2 gene:

[0027] According to embodiments of the invention, the cleavage site is between TA / G of the SEQ ID NOs: 1-3.

[0028] According to embodiments of the invention, the cleavage site is between T / AG of the SEQ ID NOs: 1-3.

[0029] According to embodiments of the invention, the DNAzyme has a nucleic acid sequence represented by the following formula:

[0030] Hl - C - H2, wherein Hl is a first hybridization arm;

[0031] C is a catalytic core; and

[0032] H2 is a second hybridization arm wherein Hl fully hybridizes with at least four nucleic acids which are no more than 10 nucleic acids 3’ to the cleavage site and H2 fully hybridizes with at least four nucleic acids which are no more than 10 nucleic acids 5’ to the cleavage site.

[0033] According to embodiments of the invention, no more than 25 nucleic acids of the first or the second hybridization arm are complementary to their target mRNA.

[0034] According to embodiments of the invention, the at least one DNAzyme cleaves between TA / G or T / AG of SEQ ID NO: 2.

[0035] According to embodiments of the invention, the at least one DNAzyme comprises:

[0036] (i) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0037] (ii) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 6);

[0038] (iii) an Hl sequence at least 90 % identical with ATATATAGTCA (SEQ ID NO: 7) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0039] (iv) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTA (SEQ ID NO: 8);

[0040] (v) an Hl sequence at least 90 % identical with TATATAGTCA (SEQ ID NO: 9) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0041] (vi) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTT;

[0042] (vii) an Hl sequence at least 90 % identical with GCA ATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5); (viii) an Hl sequence at least 90 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11);

[0043] (ix) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 14);

[0044] (x) an Hl sequence at least 90 % identical with ATATATAGTCA (SEQ ID NO: 15) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11);

[0045] (xi) an Hl sequence at least 90 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 % identical with TGAATGTTTA (SEQ ID NO: 8);

[0046] (xii) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11);

[0047] (xiii) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11); or

[0048] (xiv) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 14);

[0049] According to embodiments of the invention, the DNAzyme has a sequence at least 90 % identical to the sequence as set forth in SEQ ID NO: 20, 16-19 or 21-29.

[0050] According to embodiments of the invention, the at least one DNAzyme has a sequence at least 90 % identical to SEQ ID NO: 20 or 23.

[0051] According to embodiments of the invention, the at least one DNAzyme cleaves between TA / G or T / AG of SEQ ID NO: 3.

[0052] According to embodiments of the invention, the the at least one DNAzyme comprises:

[0053] (i) an Hl sequence at least 90 % identical with GAGGTAGA AC and a H2 sequence at least 90 % identical with TGGTGGTG;

[0054] (ii) an Hl sequence at least 90 % identical with AGGTAGAAC and a H2 sequence at least 90 % identical with TGGTGGTG;

[0055] (iii) an Hl sequence at least 90 % identical with GGTAG AAC and a H2 sequence at least 90 % identical with TGGTGGTG;

[0056] (iv) an Hl sequence at least 90 % identical with GTAGAAC and a H2 sequence at least 90 % identical with TGGTGGTG;

[0057] (v) an Hl sequence at least 90 % identical with GAGGTAGA AC and a H2 sequence at least 90 % identical with TGGTGGT;

[0058] (vi) an Hl sequence at least 90 % identical with GAGGTAGAAC and a H2 sequence at least 90 % identical with TGGTGG; or (vii) an Hl sequence at least 90 % identical with GAGGTAGAAC and a H2 sequence at least 90 % identical with TGGTG.

[0059] According to embodiments of the invention, the at least one DNAzyme has a sequence which is at least 90 % identical with a sequence as set forth in SEQ ID NOs 32-38 or a sequence having up to four modifications as compared to the nucleic acid sequence as set forth in SEQ ID NOs: 32-38.

[0060] According to embodiments of the invention, the at least one DNAzyme has a sequence as set forth in SEQ ID NO: 38.

[0061] According to embodiments of the invention, the sequence of the catalytic core is at least 90 % identical as the sequence as set forth in SEQ ID NO: 39 or SEQ ID NO: 40.

[0062] According to embodiments of the invention, the at least one DNAzyme comprises at least two DNAzymes having a sequence as set forth in SEQ ID NO: 23 and SEQ ID NO: 38 or at least two DNAzymes having a sequence as set forth in SEQ ID NO: 20 and SEQ ID NO: 38.

[0063] According to embodiments of the invention, the at least one DNAzyme comprises at least three DNAzymes having a sequence as set forth in SEQ ID NO: 20, SEQ ID NO: 23 and SEQ ID NO: 38.

[0064] According to embodiments of the invention, the DNAzyme is capable of cleaving the 5 ARI gene.

[0065] According to embodiments of the invention, the DNAzyme is comprised within positions 712-739 or 1006-1039 of 5AR1, wherein the numbering of the positions is according to a nucleic acid sequence as set forth in SEQ ID NO: 51.

[0066] According to embodiments of the invention, the cleavage site resides within SEQ ID NO: 41 or SEQ ID NO: 42 of the 5AR1 gene.

[0067] According to embodiments of the invention, the cleavage site is between G / C of the SEQ ID NO: 41 or A / T of the SEQ ID NO: 42.

[0068] According to embodiments of the invention, the DNAzyme has a nucleic acid sequence represented by the following formula: Hl - C - H2, wherein Hl is a first hybridization arm;

[0069] C is a catalytic core; and

[0070] H2 is a second hybridization arm wherein Hl fully hybridizes with at least four nucleic acids which are no more than 10 nucleic acids 3’ to the cleavage site and H2 fully hybridizes with at least four nucleic acids which are no more than 10 nucleic acids 5’ to the cleavage site. According to embodiments of the invention, no more than 25 nucleic acids of the first or the second hybridization arm are complementary to their target mRNA.

[0071] According to embodiments of the invention, the at least one DNAzyme comprises:

[0072] (i) an Hl sequence at least 90 % identical with GGACGATGAAATAG (SEQ ID NO: 43) and a H2 sequence at least 90 % identical with AAAAGTTCTACAGGA (SEQ ID NO: 44); or

[0073] (ii) an Hl sequence at least 90 % identical with TATGCATTGACGT (SEQ ID NO: 45) and a H2 sequence at least 90 % identical with GGTTGATAAAACCT (SEQ ID NO: 46).

[0074] According to embodiments of the invention, the DNAzyme has a sequence at least 90 % identical to the sequence as set forth in SEQ ID NOs: 47 or 48 or a sequence having up to four modifications as compared to the nucleic acid sequence as set forth in SEQ ID NOs: 47 or 48.

[0075] According to embodiments of the invention, the sequence of the catalytic core is at least 90 % identical as the sequence as set forth in SEQ ID NO: 49.

[0076] According to embodiments of the invention, the at least one DNAzyme is chemically modified.

[0077] According to embodiments of the invention, the chemical modification comprises phosphorothioate linkages, 2’-O-methyl ribonucleotides, inverted 5’ & inverted 3'-3' thymidine nucleotides, phosphoramidite linkages and locked nucleic acids (LNAs) or Xeno Nucleic Acids (XNAs).

[0078] According to embodiments of the invention, the composition further comprises a divalent cation.

[0079] According to embodiments of the invention, the divalent cation is Mg2+ or Zn2+.

[0080] According to embodiments of the invention, the concentration of the Mg2+ is between 1- 4 mM. According to embodiments of the invention, the composition is comprised in a delivery agent.

[0081] According to embodiments of the invention, the delivery agent comprises a cationic lipid.

[0082] According to embodiments of the invention, the lipid is a phospholipid.

[0083] According to embodiments of the invention, the disease is androgenic alopecia, acne or dandruff.

[0084] According to embodiments of the invention, the composition is formulated for topical delivery.

[0085] According to embodiments of the invention, the composition is formulated as a shampoo, a cream, a gel, a foam, a spray, a hair mask or a conditioner.

[0086] According to another aspect of the present invention, there is provided a DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA, wherein a cleavage site of the DNAzyme is comprised within positions 463-493, 512-540 or 721-756 of 5AR2, wherein the numbering of the positions is according to a nucleic acid sequence as set forth in SEQ ID NO: 50.

[0087] According to embodiments of the invention, the cleavage site resides within SEQ ID NO: 1, 2 or 3 of the 5AR2 gene:

[0088] According to embodiments of the invention, the DNAzyme is represented by the following formula:

[0089] Hl - C - H2, wherein Hl is a first hybridization arm;

[0090] C is a catalytic core; and

[0091] H2 is a second hybridization arm,

[0092] Wherein the DNAzyme has:

[0093] (i) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0094] (ii) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 6);

[0095] (iii) an Hl sequence at least 90 % identical with ATATATAGTCA (SEQ ID NO: 7) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0096] (iv) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTA (SEQ ID NO: 8);

[0097] (v) an Hl sequence at least 90 % identical with TATATAGTCA (SEQ ID NO: 9) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0098] (vi) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTT;

[0099] (vii) an Hl sequence at least 90 % identical with GCA ATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0100] (viii) an Hl sequence at least 90 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 % identical with TGAATGTTT ATTC (SEQ ID NO: 11);

[0101] (ix) an Hl sequence at least 90 % identical with GCA ATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 14);

[0102] (x) an Hl sequence at least 90 % identical with ATATATAGTCA (SEQ ID NO: 15) and a H2 sequence at least 90 % identical with TGAATGTTT ATTC (SEQ ID NO: 11);

[0103] (xi) an Hl sequence at least 90 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 % identical with TGAATGTTTA (SEQ ID NO: 8); (xii) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11);

[0104] (xiii) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11); or

[0105] (xiv) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 14).

[0106] According to embodiments of the invention, the sequence of the catalytic core is at least 90 % identical as the sequence as set forth in SEQ ID NO: 39 or SEQ ID NO: 40.

[0107] According to embodiments of the invention, the DNAzyme has a nucleic acid sequence as set forth in SEQ ID NO: 16-29, 32-38 or a sequence having up to four modifications as compared to the nucleic acid sequence as set forth in SEQ ID NOs: 16-29 or SEQ ID NO: 32-38.

[0108] According to another aspect of the invention, there is provided a DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA, wherein a cleavage site of the DNAzyme is comprised within positions 712-739 or 1006-1039 of 5AR1, wherein the numbering of the positions is according to a nucleic acid sequence as set forth in SEQ ID NO: 51.

[0109] According to embodiments of the invention, the cleavage site resides within SEQ ID NO: 41 or SEQ ID NO: 42 of the 5AR1 gene:

[0110] According to embodiments of the invention, the DNAzyme is represented by the following formula:

[0111] Hl - C - H2, wherein Hl is a first hybridization arm;

[0112] C is a catalytic core; and

[0113] H2 is a second hybridization arm, wherein the DNAzyme has:

[0114] (i) an Hl sequence at least 90 % identical with GGACGATGAAATAG (SEQ ID NO: 43) and a H2 sequence at least 90 % identical with AAAAGTTCTACAGGA (SEQ ID NO: 44); or

[0115] (ii) an Hl sequence at least 90 % identical with TATGCATTGACGT (SEQ ID NO: 45) and a H2 sequence at least 90 % identical with GGTTGATAAAACCT (SEQ ID NO: 46);

[0116] According to embodiments of the invention, the DNAzyme has a sequence at least 90 % identical to the sequence as set forth in SEQ ID NOs: 47 or 48 or a sequence having up to four modifications as compared to the nucleic acid sequence as set forth in SEQ ID NOs: 47 or 48.

[0117] According to embodiments of the invention, a sequence of the catalytic core is at least 90 % identical as the sequence as set forth in SEQ ID NO: 49. Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0118] BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0119] For Figures 1-3 below the same definition of DG1 / placebo holds. DG1 is a combination of three DNAzymes — DZ2860, DZ2863, and DZ2888 — each at a dose of 1 nanomole, diluted in 0.3 mL of 1 / 10 PBS with 10 micromolar MgCh. The placebo consists solely of 1 / 10 PBS with 10 micromolar MgCh.

[0120] FIG. 1 The bar graph illustrates the mean change in the blood DHT (dihydrotestosterone) to bioavailable testosterone ratio over time at 24, 48, and 72 hours following the administration of DG1 compared to a placebo. The results are presented as follows:

[0121] At 24 hours the DG1 group shows a slight decrease in the DHT / bioavailable testosterone ratio, with a mean change of approximately -6.9% compared to baseline. The placebo group exhibits a slightly smaller decrease, with a mean change of around -4.2%. The error bars (indicating variability, likely standard error or standard deviation) overlap between the two groups, suggesting no significant difference at this time point.

[0122] At 48 hours, the DG1 group shows a minimal change in the DHT / bioavailable testosterone ratio, remaining close to baseline (around 0% change). The placebo group demonstrates a more pronounced decrease, with a mean change of approximately -25%. The error bars for the placebo group extend further downward (to around -40%), indicating greater variability, while the DG1 group’s error bars remain near the baseline, suggesting a more stable response. The lack of overlap in the error bars suggests a potential difference between the groups at this time point, with the placebo group showing a greater reduction in the ratio.

[0123] At 72 hours, the DG1 group continues to show a minimal change, with the mean DHT / bioavailable testosterone ratio still near baseline (around 0% change). The placebo group maintains a significant decrease, with a mean change of approximately -20%, though slightly less pronounced than at 48 hours. The error bars for the placebo group extend to around -35%, while the DG1 group’s error bars remain close to 0%, again indicating a potential difference between the groups, as the error bars do not overlap. FIG. 2 is a bar graph illustrating reduction of 5AR2 mRNA levels in plucked hairs 48 hours following administration. The graph illustrates the percentage change in 5AR2 mRNA levels after 48 hours, comparing two groups: DG1 treatment (5 left bars) and placebo (5 right bars). Subjects treated with DG1 show a significant reduction in 5AR2 mRNA levels, with changes ranging from approximately -40% to -60%. The average reduction is -45.81%, with a standard deviation of 22.15. Subjects receiving placebo (rightbars) exhibit minimal changes in 5AR2 mRNA levels, mostly hovering around 0%, with slight variations. The average change is -0.44%, with a standard deviation of 7.67. The difference between the DG1 treatment and placebo groups is statistically significant, indicated by a P value = 0.0077 (below the typical threshold of 0.05). In conclusion, the DG1 treatment leads to a substantial decrease in 5AR2 mRNA levels compared to placebo, suggesting its effectiveness in modulating this gene expression. The low P value supports the reliability of this result.

[0124] FIG. 3 is a bar graph illustrating reduction of 5AR2 proteins levels in plucked hairs 72 hours following administration.

[0125] In the treatment group DG1 (left bar), treatment results in a notable reduction of protein levels by -39.46%, with a standard deviation of 10.91. While in the placebo group (right bar) an increase in protein levels, averaging +25.93%, with a higher variability (standard deviation = 38.63). The observed difference is statistically significant (P value = 0.017), further supporting the efficacy of DG1 treatment in reducing protein levels. The conclusion from the graph is that DG1 treatment significantly reduces 5AR2 protein levels compared to placebo, with strong statistical support for its effectiveness.

[0126] FIG. 4 is a bar graph illustrating the effect of DZ173 (SEQ ID NO: 48) a DNAzyme applied to frontal scalp on amount of 5 ARI mRNA measured from plucked hairs.

[0127] Y-Axis: Relative 5AR1 mRNA levels (normalized to GAPDH and Actin, measured by qRT-PCR).

[0128] ° Scale: 0 to 1.2 (arbitrary units, where 1.0 represents baseline expression of frontal hairs).

[0129] • X-Axis: Conditions and scalp regions.

[0130] ° "Front": Frontal scalp area (10 cm2, treated with DNAzyme 173).

[0131] ■ "before treatment": Baseline 5AR1 mRNA levels.

[0132] ■ "after DZ 3 weeks": Post-treatment levels after 3 weeks of daily DNAzyme application.

[0133] 'Back": Back scalp area (untreated, control for diffusion).

[0134] ■ "before treatment": Baseline 5 ARI mRNA levels. ■ "after DZ 3 weeks": Post-treatment levels to assess diffusion.

[0135] Bars: Gray bars represent mean 5 ARI mRNA levels (normalized).

[0136] ° Front (before): ~1.0 (baseline).

[0137] ° Front (after): ~0.6 (40% reduction).

[0138] ° Back (before): ~0.6 (baseline).

[0139] DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

[0140] The present invention, in some embodiments relates to the use of highly active DNAzymes for the prevention and treatment of hair loss and other diseases associated with over-expression of Dihydrotestosterone (DHT).

[0141] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0142] Inhibition of the 5 alpha-reductase (5AR) enzyme which converts testosterone to it more active form dihydrotestosterone (DHT) is known to have therapeutic value. There are three isoenzymes of 5 alpha Reductase (5AR1-3). Hair follicles express 5AR1 and 5AR2. Inhibition of 5AR1 / 5AR2 enzymes has been shown to prevent hair loss. Finasteride is a potent (mean inhibitory concentration [IC50], 69 nM) competitive inhibitor of 5AR2 but inhibits less effectively 5AR1 (IC50 360 nM), it is approved in a tablet form of Img to prevent some degree of hair loss in cases of male pattern baldness.

[0143] The present inventors conceived of using DNAzymes to target 5AR1 or 5AR2 for the treatment of male pattern baldness and other diseases associated with an overexpression of 5AR.

[0144] RNA molecules fold into complex secondary (e.g., hairpins, cores) and tertiary structures which can hide or block certain sequences, making them inaccessible to the DNAzyme.

[0145] The present inventors leveraged complex 3D simulations to uncover potential targets on the mRNA encoding 5AR and carried out intensive screening to identify particular DNAzymes that are active under physiological conditions.

[0146] Ultimately, the present inventors identified three potential targets on the 5AR2 mRNA which were amenable to enzyme cleavage - namely at positions 463-493, 512-540 or 721-756 of 5AR2 and two potential targets on the 5 ARI mRNA which were amenable to enzyme cleavage - namely at positions 712-739 or 1006-1039 of 5AR1.

[0147] Whilst further reducing the present invention to practice, the present inventors synthesized a myriad of DNAzymes which potentially targeted these sites and identified particular sequenceswhich could effectively cleave their targets. This was confirmed both at the RNA and proteinlevel.A clinical study aiming to see the effect of selected DNAzymes and combinations thereofon male pattern baldness showed that they were effective at reducing 5AR2 both at eh mRNAlevel and the protein level - (Figures 1-3).The present inventors propose that the identified DNAzymes could be useful in treatingother diseases associated with overexpression of 5AR, including for example acne and dandruff.Thus, according to a first aspect of the present invention, there is provided a compositioncomprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNAand / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA.As used herein, the term “DNAzyme” refers to any DNA that can catalytically cleave thephosphodiester bond in an RNA in the presence of a divalent cation (e.g., Mg2) to produce aproduct that contains a 3 ' terminus comprising a 2', 3 '-cyclic phosphate and a 5 ’ terminal hydroxyl .Structurally, DNAzymes contain two “hybridization arms” that hybridize to a target sequence andare separated by a single-stranded catalytic core or a partially base-paired hairpin. DNAzymes areextensively reviewed in, e.g., Baum et al (Cell Mol. Life. Sei. 2008 65:21 56-74), Schlosser et al(Chem. Biol. 2009 1 6:311-22), Pan et al (Expert Opin. Biol. Ther. 2008 8: 1071 -85), Chan et al(Intern. Med. J. 2009 39:249-51 ) and Cairns et al (Cum Drug Targets. 2002 3 :269-79), which areincorporated by reference for their description of different types of DNAzyme. Several typesof DNAzyme are known (e.g., E.5, 17EM / 17EV1 , 10-23, GR-5, Dz46 and 8- 17 enzymes), andnew types of DNAzymes are readily made using known in vitro evolution methods, see, e.g. ,Santoro et al (Proc. Natl. Acad. Sci. 1 997 94:4262-6), Santoro et al (J. Am. Chem. Soc. 2000 22122:2433-9), Schlosserl Nucleic Acids Res. 2009 February; 37(2): 41 3 -420. Joyce et al (AngewChem. Int. Ed. Engl. 2007 46: 6420-36); Joyce et al ( Annu. Rev. Biochem. 2004 73 : 791-836),Wilson et al (Annu. Rev. Biochem. 1999 68: 61 1 -47) and Santoro et al (Biochemistry. 199837: 13330-4), which are incorporated by reference herein.The nucleic acid sequence of contemplated DNAzymes may be represented by thefollowing formula:

[0148] Hl - C - H2,wherein Hl is a first hybridization arm;C is a catalytic core; andH2 is a second hybridization armwherein Hl is complementary with at least four, five, six, seven, eight, nine, or ten nucleicacids which are no more than 10 nucleic acids 3 ’ to the cleavage site and H2 is complementary with at least four, five, six, seven, eight, nine, or ten nucleic acids which are no more than 10 nucleic acids 5’ to the cleavage site.

[0149] The complementary' regions Hl and H2 allow sufficient hybridization (at physiological conditions) of the DNAzyme molecule to the target RNA to facilitate cleavage of the RNA target by the intermolecular nuclease activity of the catalytic core.

[0150] According to a specific embodiment, Hl and H2 of the DNAzyme comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 consecutive nucleic acids which are complementary with their target mRNA.

[0151] In another embodiment, no more than 25 nucleic acids of the first or the second hybridization arm are complementary to their target mRNA.

[0152] According to a particular embodiment, the DNAzyme has a E5 core (e.g. has a sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%>, 99% or even 100 % identical to AGCGATTAACGGAACGTTACACCCATGT (SEQ ID NO: 39).

[0153] According to a particular embodiment, the DNAzyme has a 17EM / 17EV1 core (e.g. has a sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical to a sequence as set forth in CTCAGCGAGTCGAA (SEQ ID NO: 40).

[0154] According to a particular embodiment, the DNAzyme has a 10-23 core (e.g. has a sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical to a sequence as set forth in CTCAGCGAGTCGAA (SEQ ID NO: 49).

[0155] According to still another embodiment, the DNAzyme has a 8-17 core.

[0156] Throughout the specification, the term “sequence identity in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that arc the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the ait that can be used to obtain alignments of amino acid or nucleotide sequences.

[0157] Suitable programs to determine percent sequence identity include for example the BLAST suite of programs available from the U.S. government’s National Center for Biotechnology Information BLAST web site). Comparisons between two sequences can be carried using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLAST? is used to compare amino acid sequences. ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or MegAlign, available from DNASTAR, are additional publicly available software programs that can be used to align sequences. One skilled in the art can determine appropriate parameters for maximal alignment by particular alignment software. In certain embodiments, the default parameters of the alignment software are used.

[0158] The term “5 Alpha reductase” refers to an enzyme which catalyzes the conversion of testosterone to it more active form dihydrotestosterone (DHT).

[0159] In one embodiment, the DNAzyme is capable of cleaving 5 Alpha reductase 2 (5AR2) mRNA. This mRNA has a nucleic acid sequence as set forth in SEQ ID NO: 50. Encompassed in the term “5 Alpha reductase” are mutant and splice variant forms of 5 Alpha reductase. Mutants include 5 Alpha reductase proteins with amino acid additions, insertions, truncations and deletions.

[0160] The present inventors have found that there are at least three sequences within the full- length 5AR2 mRNA sequence which are particularly amenable to cleavage. Such target sequences fall within positions 463-493 (referred to herein as position 1), 512-540 (referred to as position 2) or 721-756 (referred to as position 3) of 5AR2 mRNA, wherein the numbering of the positions are according to the sequence set forth in SEQ ID NO: 50.

[0161] Depending on the catalytic core used in the DNAzyme, the cleavage site may be between TA / G of SEQ ID NOs: 1-3 (e.g. in the case of E5 catalytic core) or between T / AG of SEQ ID NOs: 1-3 (e.g. in the case of I7EM or I7EV1 ) of 5AR2 mRNA.

[0162] Other cleavage sites (such as between nucleotides 2 and 3, between nucleotides 4 and 5, between nucleotides 5 and 6. between nucleotides 7 and 8 and between nucleotides 8 and 9) of the sequence UUCAUAGUG are also contempl ted:

[0163] In one embodiment, the cleavage site for the DNAzyme falls within position 1 of 5AR2 and more specifically within the sequence as set forth in SEQ ID NO: 1 of 5AR2.

[0164] In another embodiment, the cleavage site for the DNAzyme falls within position 2 of 5AR2 and more specifically within the sequence as set forth in SEQ ID NO: 2 of 5AR2.

[0165] Exemplary sequences of hybridization arms of DNAzymes which are complementary to nucleic acids 5’ of the cleavage site within SEQ ID NO: 2 of 5AR2 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 %identical to those set forth in SEQ ID NOs: 5, 6, 8, TGAATGTTT, 11 or 14.

[0166] Exemplary sequences of hybridization arms of DNAzymes which are complementary to nucleic acids 3’ of the cleavage site within SEQ ID NO: 2 of 5AR2 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical to those set forth in SEQ ID NOs: 4, 7, 9, 12, 13 or 27.

[0167] Contemplated pairs of hybridization arms on one particular DNAzyme which cleave within SEQ ID NO: 2 of 5AR2 include: (i) a first hybridization sequence (referred to herein as Hl) at least 90 % 91 %, 92%, 93%>, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a second hybridization sequence (referred to herein as H2) sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0168] (ii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTAT (SEQ ID NO: 6);

[0169] (iii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%>, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with ATATATAGTCA (SEQ ID NO: 7) and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%>, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0170] (iv) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%>, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTA (SEQ ID NO: 8);

[0171] (v) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TATATAGTCA (SEQ ID NO: 9) and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0172] (vi) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 %, 91 %, 92%. 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTT;

[0173] (vii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with SEQ ID NO: 12 and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%. 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTATT (SEQ ID NO: 5);

[0174] (viii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTT ATTC (SEQ ID NO: 11); (ix) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%>, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least

[0175] 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTAT (SEQ ID NO: 14);

[0176] (x) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with ATATATAGTCA (SEQ ID NO: 15) and a H2 sequence at least 90 %,

[0177] 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTATTC (SEQ ID NO: 11);

[0178] (xi) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTA (SEQ ID NO: 8);

[0179] (xii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 %, 91 %, 92%. 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTATTC (SEQ ID NO: 11);

[0180] (xiii) an Hl sequence at least 90 %, 91 %, 92%. 93%, 94%. 95%, 96%. 97%, 98%, or 99% or even 100 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%>, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTATTC (SEQ ID NO: 11);

[0181] (xiv) an Hl sequence at least 90 %, 91 %, 92%, 93%>, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGAATGTTTAT (SEQ ID NO: 14);

[0182] Exemplary sequences of DNAzymes based on E5 catalytic core which cleave at position 2 of 5AR2 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with any one of SEQ ID NOs: 16-29.

[0183] According to a. particular embodiment, the DNAzyrne has a nucleic acid sequence which is at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%', 98%, or 99% or even 100 % identical with any one of SEQ ID NOs: 20 or 23.

[0184] In one embodiment, the DNAzyme hybridizes within position 3 of 5AR2 and more specifically within the sequence as set forth in SEQ ID NO: 3.

[0185] Exemplary sequences of hybridization arms of DNAzymes which are complementary to nucleic acids 5’ of the cleavage site within SEQ ID NO: 3 of 5AR2 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 %identical to those set forth in SEQ ID NOs: 108, 105, 106 or 107.

[0186] Exemplary sequences of hybridization arms of DNAzymes which are complementary to nucleic acids 3’ of the cleavage site within SEQ ID NO: 2 of 5AR2 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical to those set forth in SEQ ID NOs: 109, 102, 103 or 104.

[0187] Contemplated pairs of hybridization arms on one particular DNAzyme which cleave within SEQ ID NO: 3 of 5AR2 include:

[0188] (i) a first hybridization sequence (referred to herein as Hl) at least 90 % 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GAGGTAGAAC and a second hybridization sequence (referred to herein as H2) sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGGTGGTG;

[0189] (ii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%. 97%, 98%, or 99% or even 100 % identical with AGGTAGAAC and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%. 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGGTGGTG;

[0190] (iii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GGTAGAAC and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGGTGGTG;

[0191] (iv) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GTAGAAC and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGGTGGTG;

[0192] (v) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GAGGTAGAAC and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%. 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGGTGGT;

[0193] (vi) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GAGGTAGAAC and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGGTGG; or

[0194] (vii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%. 95%, 96%, 97%, 98%, or 99% or even 100 % identical with GAGGTAGAAC and a H2 sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with TGGTG.

[0195] Exemplary sequences of DNAzymes based on E5 catalytic core which cleave at position 3 of 5AR2 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with any one of SEQ ID NOs: 32-38. According to a particular embodiment, the DNAzyme has a nucleic acid sequence which is at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%', 98%, or 99% or even 100 % identical with any one of SEQ ID NO: 38.

[0196] The present inventors contemplate particular combinations of the above disclosed DNAzymes. Such combinations include the DNAzyme having the nucleic acid sequence as set forth in SEQ ID NO: 23 and the DNAzyme having the nucleic acid sequence as set forth in SEQ ID NO: 38.

[0197] Another contemplated combination includes the DNAzyme having the nucleic acid sequence as set forth in SEQ ID NO: 20 and the DNAzyme having the nucleic acid sequence as set forth in SEQ ID NO: 38.

[0198] Still another contemplated combination includes the DNAzyme having the nucleic acid sequence as set forth in SEQ ID NO: 20, the DNAzyme having the nucleic acid sequence as set forth in SEQ ID NO: 23, and the DNAzyme having the nucleic acid sequence as set forth in SEQ ID NO: 38.

[0199] In one embodiment, the DNAzyme is capable of cleaving 5 Alpha reductase 1 (5AR1) mRNA. This mRNA has a nucleic acid sequence as set forth in SEQ ID NO: 51.

[0200] The present inventors have found that there are at least two sequences within the full- length 5 ARI mRNA sequence which are particularly amenable to cleavage. Such target sequences fall within positions 712-739 (referred to herein as position 1) and 1006-1039 (referred to as position 2), wherein the numbering of the positions are according to the sequence set forth in SEQ ID NO: 51.

[0201] Depending on the catalytic core used in the DNAzyme, the cleavage site may be between G / C of SEQ ID NOs: 41 (e.g. in the case of 10-23 catalytic core) or between A / T of SEQ ID NOs: 42 (e.g. in the case of 10-23 catalytic core) of 5 ARI mRNA.

[0202] In one embodiment, the cleavage site for the DNAzyme falls within position 1 of 5AR1 and more specifically within the sequence as set forth in SEQ ID NO: 41 of 5AR1.

[0203] In another embodiment, the cleavage site for the DNAzyme falls within position 2 of 5 ARI and more specifically within the sequence as set forth in SEQ ID NO: 42 of 5AR1.

[0204] Exemplary sequences of hybridization arms of DNAzymes which are complementary to nucleic acids 5’ of the cleavage site within SEQ ID NO: 41 or SEQ ID NO: 42 of 5AR1 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 %identical to those set forth in SEQ ID NOs: 44 or 46.

[0205] Exemplary sequences of hybridization arms of DNAzymes which are complementary to nucleic acids 3’ of the cleavage site within SEQ ID NO: 41 or SEQ ID NO: 42 of 5AR1 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical to those set forth in SEQ ID NOs: 43 or 45.

[0206] Contemplated pairs of hybridization arms on one particular DNAzyme which cleave within 5AR2 at positions within SEQ ID NOs: 43 or 45 include:

[0207] (i) a first hybridization sequence (referred to herein as Hl) at least 90 % 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with SEQ ID NO: 43 and a second hybridization sequence (referred to herein as H2) sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%. 97%, 98%, or 99% or even 100 % identical with SEQ ID NO: 44;

[0208] (ii) an Hl sequence at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with SEQ ID NO: 45 and a H2 sequence at least 90 %, 91 %, 92%, 93%>, 94%, 95%, 96%, 97%, 98%, or 99% or even 100 % identical with SEQ ID NO: 46.

[0209] Exemplary sequences of DNAzymes based on 10-23 catalytic core which cleave at position 2 of 5AR2 are those that are at least 90 %, 91 %, 92%, 93%, 94%, 95%, 96%. 97%, 98%, or 99% or even 100 % identical with any one of SEQ ID NOs: 47 or 48.

[0210] The DNAzyme molecules described herein may comprise modified nucleic acids. As used herein the term “modified nucleotide” and “modified nucleic acid molecule” refers to all known modified nucleotides known in the art both naturally occurring and artificial such as chemically or biochemically modified, non-natural, or derivatized nucleotides.

[0211] One example of a modified nucleotide is a “locked nucleotide”. As used herein, the term “locked nucleotide” refers to modified nucleotides included in a polymer defined as a “locked nucleic acid molecule”. The ribose moiety of a locked nucleic acid nucleotide is modified with an extra bridge connecting the 2' and 4' carbons. The bridge “locks” the ribose in the 3'-endo structural conformation, which is often found in the A-form of DNA or RNA. Locked nucleic acid molecule nucleotides can be mixed with DNA or RNA or modified derivates there of forming a polymer. The locked ribose conformation may enhance base stacking and backbone pre-organization. This may increase the thermal stability of the polynucleotide.

[0212] Another example of a modified nucleic acid molecule includes the introduction of an inverted deoxy-thymidine (dT). Oligonucleotides can be designed to incorporate 5’ to 5’ or 3’ to 3’ linkages. Inverted dT can be introduced at the 3’-end of an oligonucleotide to create a 3’ to 3’ linkage which creates unique characteristics which include but are not limited to preventing DNA polymerase from further extending the DNA sequence and protecting the oligonucleotide from 3’ exonuclease cleavage.

[0213] In certain embodiments of the present invention, the biological activity of the enzymatic nucleic acid molecule is retained in physiological conditions. In some embodiments, the enzymatic nucleic acid molecule is for use with a divalent cation. As used herein, the term “divalent cation” refer to an ion, specifically a cation with a valence of two, wherein valence denotes the electrons available for chemical bond formation. In certain embodiments, the divalent cation is MgCh. Aptly, the divalent cation is an in vivo endogenous divalent cation. In another embodiment, the divalent cation is ZnCh. Other divalent ions contemplated for use with the DNAzymes disclosed herein include calcium or copper.

[0214] As used herein, the term "physiologic conditions" refers to reaction conditions emulating those found intracellularly in mammalian organisms, particularly humans. Variations in temperature, availability of cations, and pH ranges may be covered where referring to physiologic conditions. It is known in the art physiological conditions comprise a temperature of about 35°- 40° C as well as a pH of about 7.0-8.0 and further comprise the availability of cations, preferably divalent with a concentration of about 2-15 mM MgCh being particularly preferred.

[0215] As mentioned, the DNAzymes disclosed herein may be used for treating skin diseases or conditions associated with an overexpression of DHT.

[0216] The term “skin disease or condition” refers to a disease or condition of the skin in any area of the body including the scalp.

[0217] In one embodiment, the condition is androgenic alopecia (also known as baldness).

[0218] In another embodiment, the disease is acne or dandruff.

[0219] Thus according to another aspect of the invention, there is provided a method of treating a skin disease such as androgenic alopecia, acne or dandruff. The method comprises administering to a subject in need thereof an effective amount of a composition comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA, thereby treating the skin disease. Also contemplated are use of the DNAzymes for supporting hair transplantation success.

[0220] The DNAzymes may be provided per se to the subject or may be provided in a pharmaceutical composition, where it is mixed with suitable carriers or excipients.

[0221] As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0222] Herein the term "active ingredient" refers to the DNAzyme accountable for the biological effect.

[0223] Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

[0224] Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

[0225] In one embodiment, the DNAzyme is formulated with a nucleic acid or lipid- based delivery agent. Examples of such delivery agents include: lipids (e.g., a cationic lipid, virosome or liposome), nanoparticles, biomaterial nano-carriers and / or viral vectors such as adeno-associated virus vector. In certain embodiments, the delivery agent may be an aptamer or a nanostructure formed from a biomaterial. In certain embodiments, the delivery agent is a biomaterial nanocarrier.

[0226] Techniques for formulation and administration of drugs may be found in “Remington’s Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

[0227] Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections.

[0228] Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, directly into a tissue region of a patient (i.e. topically or subcutanously).

[0229] Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0230] Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

[0231] By selecting the appropriate carrier and optionally other ingredients that can be included in the composition, as is detailed herein, the DNAzymes described herein may be formulated into any form typically employed for topical application such as application to skin (e.g. scalp). Hence, the DNAzyme compositions can be, for example, in a form of a cream, an ointment, a paste, a gel, a lotion, a milk, a suspension, an aerosol, a spray, a foam, a shampoo, a hair conditioner, a swab, a pledget, a pad, and a soap. Ointments are semisolid preparations, typically based on vegetable oil (e.g. shea butter and / or cocoa butter), petrolatum or petroleum derivatives. The specific ointment base to be used is one that provides for optimum delivery for the DNAzyme chosen for a given formulation, and, preferably, provides for other desired characteristics as well (e.g., emolliency). As with other carriers or vehicles, an ointment base should be inert, stable, nonirritating and nonsensitizing.

[0232] Lotions are preparations that may to be applied to the skin (e.g. scalp) without friction. Lotions are typically liquid or semiliquid preparations in which solid particles, including the DNAzyme, are present in a water or alcohol base. Lotions are typically preferred for treating large areas, due to the ease of applying a more fluid composition. Lotions are typically suspensions of solids, and oftentimes comprise a liquid oily emulsion of the oil-in-water type. It is generally necessary that the insoluble matter in a lotion be finely divided. Lotions typically contain suspending agents to produce better dispersions as well as compounds useful for localizing and holding the DNAzyme in contact with the skin (e.g. scalp).

[0233] Creams are viscous liquids or semisolid emulsions, either oil-in-water or water-in-oil. Cream bases typically contain an oil phase, an emulsifier and an aqueous phase. The oil phase, also called the “internal” phase, is generally comprised of petrolatum and / or a fatty alcohol such as cetyl or stearyl alcohol. The aqueous phase typically, although not necessarily, exceeds the oil phase in volume, and generally contains a humectant. The emulsifier in a cream formulation is generally a nonionic, anionic, cationic or amphoteric surfactant.

[0234] Pastes are semisolid dosage forms in which the DNAzymes are suspended in a suitable base. Depending on the nature of the base, pastes are divided between fatty pastes or those made from a single-phase aqueous gels. The base in a fatty paste is generally petrolatum, hydrophilic petrolatum and the like. The pastes made from single-phase aqueous gels generally incorporate carboxymethylcellulose or the like as a base.

[0235] Gel formulations are semisolid, suspension-type systems. Single -phase gels contain organic macromolecules distributed substantially uniformly throughout the carrier liquid, which is typically aqueous, but also, preferably, contains a non-aqueous solvent and, optionally, an oil. Preferred organic macromolecules, i.e., gelling agents, are crosslinked acrylic acid polymers such as the family of carbomer polymers, e.g., carboxypolyalkylenes that may be obtained commercially under the trademark CARBOPOL™. Other types of preferred polymers in this context are hydrophilic polymers such as polyethylene oxides, polyoxyethylene-polyoxypropylene copolymers and polyvinylalcohol; cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and methyl cellulose; gums such as tragacanth and xanthan gum; sodium alginate; and gelatin. In order to prepare a uniform gel, dispersing agents such as alcohol or glycerin can be added, or the gelling agent can be dispersed by trituration, mechanical mixing or stirring, or combinations thereof.

[0236] Sprays generally provide the DNAzymes in an aqueous and / or volatile solvent solution which can be misted onto the skin (e.g. scalp) for delivery. Such sprays include those formulated to provide for concentration of the DNAzyme solution at the site of administration following delivery, e.g., the spray solution can be primarily composed of a volatile liquid in which the DNAzyme can be dissolved. Upon delivery to the scalp or other skin area, the carrier evaporates, leaving concentrated DNAzyme at the site of administration.

[0237] Foam compositions are typically formulated in a single or multiple phase liquid form and housed in a suitable container, optionally together with a propellant which facilitates the expulsion of the composition from the container, thus transforming it into foam upon application. Other foam forming techniques include, for example the “Bag-in-a-can” formulation technique. Compositions thus formulated typically contain a low-boiling hydrocarbon, e.g., isopropane. Application and agitation of such a composition at the body temperature cause the isopropane to vaporize and generate the foam, in a manner similar to a pressurized aerosol foaming system. Foams can be water-based or hydroalcoholic, but are typically formulated with high volatile solvent content which, upon application to the scalp region of a user, quickly evaporates, leaving concentrated DNAzyme on the skin (e.g. scalp).

[0238] Representative examples of suitable carriers according to embodiments of the present invention therefore include, without limitation, water, liquid alcohols (optionally ethanol), liquid glycols, liquid polyalkylene glycols, liquid esters, liquid amides, liquid protein hydrolysates, liquid alkylated protein hydrolysates, liquid lanolin and lanolin derivatives, and like materials commonly employed in cosmetic compositions.

[0239] The chemical composition of the carrier is typically selected according to the desired form of the DNAzyme composition. Further, the chemical composition of the carrier is selected so as to suit the desired purpose of the DNAzyme. For example, a composition for maintenance by repeated application (according to any of the respective embodiments described herein) may be selected to be milder (e.g., less irritating upon repeated application) and / or more convenient for use (e.g., home use) than a DNAzyme composition utilized in a single treatment (e.g., a treatment performed by a professional).

[0240] The carrier is optionally selected such that the composition is quick-drying, non-harmful; and does not cause the hair to have an unappealing feel, appearance or aroma. For example, dripping may be prevented by using a viscous carrier (e.g. cream, gel, foam), which is fluid enough to facilitate spreading through the hair, but sufficiently viscous so as to avoid dripping, as well as by using a quick-drying spray carrier, in which the carrier is sprayed onto the desired location, and then dries up before dripping out of the desired location.

[0241] Reflective compounds, such as silicone oils (e.g., disiloxane, dimethicone, and cyclomethicone), may be included in a carrier to provide hair with a glossy appearance.

[0242] Compositions of the present invention may, if desired, be presented (e.g., packaged) in a pack or dispenser device, such as an FDA (the U.S. Food and Drug Administration) approved kit, which may contain one or more compositions described herein. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accompanied by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of cosmetics and / or pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions for human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration. Compositions comprising cellulose nanocrystals and / or resilin (according to any of the respective embodiments described herein) may also be prepared, placed in an appropriate container (individually and / or together in a kit), and labeled for treatment of hair (e.g., according to any of the embodiments described herein).

[0243] Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (DNAzyme) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., minimize hair loss).

[0244] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0245] For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0246] Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-l).

[0247] Dosage amount and interval may be adjusted individually to provide levels of the active ingredient that are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0248] Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

[0249] The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

[0250] METHOD OF TREATING

[0251] The term “treating” refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and / or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.

[0252] As used herein, the term “preventing” refers to keeping a disease, disorder or condition from occurring in a subject who may be at risk for the disease, but has not yet been diagnosed as having the disease.

[0253] According to a particular embodiment, the method is a non-therapeutic method (e.g. a cosmetic method).

[0254] As used herein, the term “subject” includes mammals, preferably human beings at any age which suffer from the pathology. In one embodiment, the subject is a male subject. In another embodiment, the subject is a female subject. Preferably, this term encompasses individuals who are at risk to develop the pathology.

[0255] When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 1 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

[0256] In accordance with the present invention, any nucleotide sequence provided herein as a DNA sequence is understood to also encompass the corresponding RNA sequence. Specifically, where a sequence is represented using DNA nucleotides (adenine [A], cytosine [C], guanine [G], and thymine [T]), it is to be interpreted as also covering the analogous RNA sequence, wherein thymine (T) is replaced with uracil (U). This equivalence applies to all described sequences, including but not limited to coding regions, primers, probes, and synthetic constructs, unless explicitly stated otherwise. This provision ensures that the disclosed sequences retain their intended functional and informational roles regardless of whether they are utilized or interpreted in the context of DNA or RNA.

[0257] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0258] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

[0259] EXAMPLES

[0260] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting fashion.

[0261] EXAMPLE 1

[0262] IN-VITRO ANALYSIS OF DNAZYME ACTIVITY AGAINST 5AR2

[0263] Leveraging 3D simulations, the present inventors identified three cleavage sites within the 5AR2 mRNA sequence and two cleavage sites within the 5AR2 sequence.

[0264] DNAzymes having a nucleic acid sequence as set forth in SEQ ID NOs: 16-29 (which include an E5 catalytic core) were tested using gel-based assays to determine whether they cleave within positions 512-540, as summarized in Table 1. Table 1

[0265] DNAzymes having a nucleic acid sequence as set forth in SEQ ID NOs: 32-38 (which include an E5 catalytic core) were tested using gel-based assays to determine whether they cleave within positions 721-756, as summarized in Table 2. Table 2

[0266] The DNAzyme’s efficacy in cleaving mRNA was also tested in human follicle dermal papilla cells (HFDPC) from a male donor suffering from alopecia by qRT-PCR, using actin GAPDH and Ubiquitin as housekeeping genes.

[0267] RESULTS

[0268] 1. Significant reduction in 5AR2 mRNA levels after DNAzyme treatment in human dermal papilla cells (male, balding) for the DNAzymes tested. 2. DHT levels were significantly reduced after DNAzyme treatment in human dermal papilla cells (male, balding) for all the DNAzymes tested.

[0269] Up to 80% (vs. Actin) cleaving activity of 5AR2 was measured using qRT-PCR in human scalp 48 hours after application test.

[0270] The best DNAzymes were as follows: SEQ ID NO: 20, SEQ ID NO: 23. CONCLUSION

[0271] Treatment with DNAzymes in Androgenic Alopecia resulted in reduced mRNA levels of 5AR2 enzyme, which is responsible for converting testosterone to DHT. This reduction in DHT is known to slow down hair loss and promote hair regrowth.

[0272] EXAMPLE 2

[0273] CLINICAL STUDY OF TREATMENT OF BALDNESS USING DNAZYMES WHICH CLEAVE BETWEEN POSITIONS 512-540 OF 5AR2

[0274] MATERIALS AND METHODS

[0275] A combination of three DNAzymes was tested in plucked hairs: SEQ ID NO: 20, SEQ ID NO: 23 and SEQ ID NO: 38.

[0276] A 3 day study was conducted to prove the safety and efficacy of our the DNAzymes.

[0277] The study was carried out to determine whether application of the 5AR2 DNAzymes to the scalp affect androgen blood levels.

[0278] Method: Triple blind placebo control clinical Dermo-cosmetic trial.

[0279] 5 patients received 5AR2 DNAzymes to the scalp one time.

[0280] 5 patients received placebo as per above.

[0281] Statistical methods

[0282] Data was analyzed using excel spreadsheets to assess the data as difference from baseline and longitudinal change. Percent reduction from baseline was calculated for the ordinal data. Blood tests, 5AR2 mRNA, 5AR2 protein and DHT levels measurements were analyzed as change from baseline per each patient comparing the mean results of the treated (DG1) to the mean results of the untreated (placebo) groups utilizing a two sample Welch’s T test analysis.

[0283] Randomization procedures

[0284] The study coordinator developed a randomization schedule. The subject number and the randomization numbers were identical.

[0285] Significance level

[0286] Significance was defined at the p value =0.05 or less level based on a two-group test.

[0287] RESULTS

[0288] Blood DHT / bioavailable testosterone ratio over time is illustrated in FIG. 1. following administration of the DNAzyme combination. No substantial decrease in the DHT / Bioavailable ratio was observed in the treatment group compared to placebo. Reduction of 5AR2 mRNA levels in plucked hairs 48 hours following administration of the DNAzyme combination is illustrated in FIG. 2.

[0289] 5AR2 mRNA Expression: A mean 45.81% (STD=22.15%) reduction in the treatment group from TO to T48, compared to almost no change -0.44% (STD=7.67%) in the placebo group. qRT-PCR was used to measure the levels of 5AR2 mRNA compared to at least 2 HKGs. These results were statistically significant with a P-value = 0.0077

[0290] Reduction of 5AR2 protein levels in plucked hairs 72 hours following administration of the DNAzyme combination is illustrated in FIG. 3.

[0291] 5AR2 Protein Levels: A mean 39.46% (STD=10.91%) reduction in the treatment group versus a 25.93% (STD=38.63%) increase in the placebo group, as measured by WES relative to GAPDH. These results were statistically significant with a P-value = 0.017

[0292] In summary:

[0293] Blood Analysis: No substantial decrease in the DHT / Bioavailable ratio was observed in the treatment group compared to placebo.

[0294] *5AR2 mRNA Expression: A mean 45.81% (STD=22.15%) reduction in the treatment group from TO to T48, compared to almost no change -0.44% (STD=7.67%) in the placebo group. qRT-PCR was used to measure the levels of 5AR2 mRNA compared to at least 2 HKGs. These results were statistically significant with a P-value = 0.0077

[0295] *5AR2 Protein Levels: A mean 39.46% (STD=10.91%) reduction in the treatment group versus a 25.93% (STD=38.63%) increase in the placebo group, as measured by WES by simple protein, relative to GAPDH. These results were statistically significant with a P- value = 0.017

[0296] *DHT Levels: A mean 44.10% (STD=13.01%) reduction in the treatment group versus a 28.61% (STD=16.75) increase in the placebo group, DHT was measured using a commercial DHT ELISA kit. Lysate amount was normalized to GAPDH (measured by WES). These results were statistically significant with a P-value < 0.001.

[0297] EXAMPLE 3

[0298] IN-VITRO ANALYSIS OF DNAZYME ACTIVITY AGAINST 5AR1

[0299] MATERIALS AND METHODS

[0300] The DNAzyme (SEQ ID NO: 48) efficacy in cleaving mRNA was also tested in human follicle dermal papilla cells (HFDPC) from a male donor suffering from alopecia by qRT-PCR, using actin GAPDH and Ubiquitin as housekeeping genes. The DNAzyme was applied daily to a 10 cm2area on the frontal scalp at a dose of 33 picomoles in 50 pl PBS for 3 weeks. Hairs were plucked from both the treated frontal area and the untreated back area before and following treatment.

[0301] RESULTS Figure 4 illustrates the effect DNAzyme (SEQ ID NO: 48) on 5AR1 mRNA levels in hair follicles plucked from the scalp of volunteers as measured by qRT-PCR and normalized to the housekeeping genes GAPDH and Actin. The DNAzyme was applied daily to a 10 cm2area on the frontal scalp at a dose of 33 picomoles in 50 pl PBS for 3 weeks. Hairs were plucked from both the treated frontal area and the untreated back area before and following treatment. The results show a 40 % reduction in 5AR1 mRNA levels in the frontal area after 3 weeks indicating effective mRNA cleavage by the DNAzyme. In contrast, the back area showed no change in 5AR1 mRNA levels.

[0302] In addition, any priority document(s) of this application is / are hereby incorporated herein by reference in its / their entirety.

[0303] REFERENCES

[0304] 1. Price VH. Treatment of hair loss. N Engl J Med 1999; 341: 964-73

[0305] 2. Koo JY, Shellow WV, Hallman CP, Edwards JE. Alopecia areata and increased prevalence of psychiatric disorders. Int J Dermatol 1994; 33: 849-50

[0306] 3. Cech, T. R. (1992). Ribozyme engineering. ( hirrent Opinion in Structural Biologv, 2(4), Flory CM, Pavco PA Jarvis TC, Lesch ME, Wincott FE, Beigelman L, Hunt SW 3rd, Schrier DJ- Nuclease-resistant ribozymes decrease stromelysin mRNA levels in rabbit synovium following exogenous delivery to the knee joint. Proc Natl Acad Sci U S A. 1996 Jan 23;93(2):754-8

[0307] 4. Santoro, S. W. and G. F. Joyce. (1997) Proc. Nut / . Acad. Sci. USA, 9434262-4266).

[0308] 5. Hall, J., D. Husken, and R. Haner. (1996); Nucleic Acids Research, 24(18), 3522-3526.

[0309] 6. Haner, R. and J. Hall. (1997) Antisense Nucleic Acid Dev, 7(4), 423-430.

[0310] 7. Baker, B. F., et al. (1999) Nucleic Acids Research- 27(6), 1547-51.

[0311] 8. Porta H, Lizardi PN / I. An allosteric hammerhead ribozyme. Biotechnology 1995, 13: 161 ...164.

[0312] 9. Huang X, Wang M, Liu Y, Gui Y. Synthesis of RNA-based gene regulatory devices for redirecting cellular signaling events mediated by p53. Theranostics. 2021 Mar 4;11(10); 4688-4698

[0313] 10. Tang J, Breaker RR. Rational design of allosteric Ribozymes. Chem Bio 1997, 4453 — 459.

[0314] 11. Juniin (2011) W02011106997A1. Rosenbach H, Victor J, Etzkom M, Steger G. Riesner D Span I. Molecular Features and Metal Ions That Influence 10-23 DNAzyme Activity. Molecules. 20'20 Jul '7;25(13):'3100.

[0315] 12. Bayat P, R, Alibolandi M, Rafatpanah H, Abnous K, Khedri Ma Ramezani M. SELEX methods on the road to protein targeting with nucleic acid aptamers. Biochimie.2018 Nov: 154

[0316] 13. Wan DYA Lai Bf-I, Feldman AR, Sen D A general approach for the use of oligonucleotide effectors to regulate the catalysis of RNA-cleaving ribozymes and DNAzymes. Nucleic Acids Res. 2002 Apr 1735-42.

[0317] 14. Wang Y, Nguyen K, Spitale RC, Chaput JC. A biologically stable DNAzsme that efficiently silences gene expression in cells. Nat Chem. 2021 Apr: 13(4):319-326. 15. Silverman, S. K. (2007). Control of macromolecular structure and function using covalently attached double-stranded DNA constraints. Mol. BioSyst., 3( / ), 24 29. US2013123480A1. US8962238B2. Mokany et al. (2010). Moon WJ, Yang Y, Liu J. Zn2+ -Dependent DNAzymes: From Solution Chemistry to Analytical. Materials and Therapeutic Applications. Chemhiochem. 2021 Mar 2;22(5):779-789 Inomata R, Zhao J, Miyagishi M. Zn2+-dependent DNAzymes that cleave all combinations of ribonucleotides. Commun Biol. 2021 FebI6.4( 1): Steers, W. D. (2001). 5a-reductase activity in the prostate. Urology, 58(6), 17. Doi: 10- 1016 / s0090-4295(01 )01299-7 El-Naggar M, El-Ali ASA, El-Naem SIA- Abdalla MM- Rashdan HRM. New Potent5a- Reductase and Aromatase Inhibitors Derived from 1 ,2,3 -Inazole Derivative. Molecules. 2020 Feb5i25( ): Enjoji, Me, Wang, F., Nakamuta, Nt., Chan, L, & Teng. B.-B. (2000). Hammerhead Ribozyme as a Therapeutic Agent for Hyperlipidemia: Production of Truncated Apolipoprotein B and Hypolipidemic Effects in a Dyslipidemia Murine Model Human Gene Therapy, 11(17), 2415-2430. Sugiyama R, Hayafune M, Habu Y, Yamamoto N, Takaku H. HIV-I RT-dependent DNAzyme expression inhibits HIV- 1 replication without the emergence of escape viruses. Nucleic Acids Res. 2011 Jan;39(2):589-98 LI, S. & BLACKBURN E H. (2006). Expression and Suppression of Human Telomerase RNA. (old Spring Harbor Symposia on Quan / ila / ive Bio / ogp, 71 (0), 211 — 215. W02020089646A1 US2008051342A1 W02020089646A1 US2008051342A1

Claims

WHAT IS CLAIMED IS:

1. A composition comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA for use in treating a skin disease associated with over-expression of Dihydrotestosterone (DHT).

2. A pharmaceutical composition formulated for topical delivery comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA.

3. A cosmetic composition comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA.

4. A method of treating a skin disease associated with over-expression of Dihydrotestosterone (DHT) comprising administering to a subject in need thereof a cosmetically effective amount of a composition comprising at least one DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA and / or at least one DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA, thereby treating the skin disease associated with over-expression of Dihydrotestosterone (DHT).

5. The method of claim 4, wherein the method is a non-therapeutic method.

6. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 1-5, wherein the DNAzyme is capable of cleaving said 5AR2 mRNA.

7. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 6, wherein a cleavage site of the DNAzyme is comprised within positions 512- 540, 721-756 or 463-493 of 5AR2, wherein the numbering of the positions is according to a nucleic acid sequence as set forth in SEQ ID NO: 50.

8. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 7, wherein said cleavage site resides within SEQ ID NO: 2, 3 or 1 of said 5AR2 gene.

9. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 8, wherein the cleavage site is between TA / G of said SEQ ID NOs: 1-3.

10. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 8, wherein the cleavage site is between T / AG of said SEQ ID NOs: 1-3.

11. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 1-9, wherein the DNAzyme has a nucleic acid sequence represented by the following formula:Hl - C - H2, wherein Hl is a first hybridization arm;C is a catalytic core; andH2 is a second hybridization arm wherein Hl fully hybridizes with at least four nucleic acids which are no more than 10 nucleic acids 3’ to the cleavage site and H2 fully hybridizes with at least four nucleic acids which are no more than 10 nucleic acids 5’ to the cleavage site.

12. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 11, wherein no more than 25 nucleic acids of said first or said second hybridization arm are complementary to their target mRNA.

13. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 11, wherein the at least one DNAzyme cleaves between TA / G or T / AG of SEQ ID NO: 2.

14. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 13, wherein the at least one DNAzyme comprises:(i) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);(ii) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 6);(iii) an Hl sequence at least 90 % identical with ATATATAGTCA (SEQ ID NO: 7) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);(iv) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTA (SEQ ID NO: 8);(v) an Hl sequence at least 90 % identical with TATATAGTCA (SEQ ID NO: 9) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);(vi) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTT;(vii) an Hl sequence at least 90 % identical with GCA ATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);(viii) an Hl sequence at least 90 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 % identical with TGAATGTTT ATTC (SEQ ID NO: 11);(ix) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 14);(x) an Hl sequence at least 90 % identical with ATATATAGTCA (SEQ ID NO: 15) and a H2 sequence at least 90 % identical with TGAATGTTT ATTC (SEQ ID NO: 11);(xi) an Hl sequence at least 90 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 % identical with TGAATGTTTA (SEQ ID NO: 8);(xii) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11);(xiii) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11); or(xiv) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 14);15. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 11-14, wherein the DNAzyme has a sequence at least 90 % identical to the sequence as set forth in SEQ ID NO: 20, 16-19 or 21-29.

16. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 15, wherein the at least one DNAzyme has a sequence at least 90 % identical to SEQ ID NO: 20 or 23.

17. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 11, wherein the at least one DNAzyme cleaves between TA / G or T / AG of SEQ ID NO: 3.

18. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 17, wherein the at least one DNAzyme comprises:(i) an Hl sequence at least 90 % identical with GAGGTAGAAC and a H2 sequence at least 90 % identical with TGGTGGTG;(ii) an Hl sequence at least 90 % identical with AGGTAGAAC and a H2 sequence at least 90 % identical with TGGTGGTG;(iii) an Hl sequence at least 90 % identical with GGTAGAAC and a H2 sequence at least 90 % identical with TGGTGGTG;(iv) an Hl sequence at least 90 % identical with GTAGAAC and a H2 sequence at least 90 % identical with TGGTGGTG;(v) an Hl sequence at least 90 % identical with GAGGTAGA AC and a H2 sequence at least 90 % identical with TGGTGGT;(vi) an Hl sequence at least 90 % identical with GAGGTAGAAC and a H2 sequence at least 90 % identical with TGGTGG; or(vii) an Hl sequence at least 90 % identical with GAGGTAGAAC and a H2 sequence at least 90 % identical with TGGTG.

19. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 18, wherein the at least one DNAzyme has a sequence which is at least 90 % identical with a sequence as set forth in SEQ ID NOs 32-38 or a sequence having up to four modifications as compared to the nucleic acid sequence as set forth in SEQ ID NOs: 32-38.

20. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 19, wherein the at least one DNAzyme has a sequence as set forth in SEQ ID NO: 38.

21. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 11-14 and 17-18, wherein a sequence of said catalytic core is at least 90 % identical as the sequence as set forth in SEQ ID NO: 39 or SEQ ID NO: 40.

22. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 11-21, wherein said at least one DNAzyme comprises at least two DNAzymes having a sequence as set forth in SEQ ID NO: 23 and SEQ ID NO: 38 or at least two DNAzymes having a sequence as set forth in SEQ ID NO: 20 and SEQ ID NO: 38.

23. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 11-22, wherein said at least one DNAzyme comprises at least three DNAzymes having a sequence as set forth in SEQ ID NO: 20, SEQ ID NO: 23 and SEQ ID NO: 38.

24. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 1-4, wherein the DNAzyme is capable of cleaving said 5 ARI gene.

25. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 24, wherein a cleavage site of the DNAzyme is comprised within positions 712-739 or 1006-1039 of 5AR1, wherein the numbering of the positions is according to a nucleic acid sequence as set forth in SEQ ID NO: 51.

26. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 25, wherein said cleavage site resides within SEQ ID NO: 41 or SEQ ID NO: 42 of said 5AR1 gene.

27. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 26, wherein the cleavage site is between G / C of said SEQ ID NO: 41 or A / T of said SEQ ID NO: 42.

28. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 24-27, wherein the DNAzyme has a nucleic acid sequence represented by the following formula:Hl - C - H2, wherein Hl is a first hybridization arm;C is a catalytic core; andH2 is a second hybridization armwherein Hl fully hybridizes with at least four nucleic acids which are no more than 10 nucleic acids 3’ to the cleavage site and H2 fully hybridizes with at least four nucleic acids which are no more than 10 nucleic acids 5’ to the cleavage site.

29. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 28, wherein no more than 25 nucleic acids of said first or said second hybridization arm are complementary to their target mRNA.

30. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 28, wherein the at least one DNAzyme comprises:(i) an Hl sequence at least 90 % identical with GGACGATGAAATAG (SEQ ID NO: 43) and a H2 sequence at least 90 % identical with AAAAGTTCTACAGGA (SEQ ID NO: 44); or(ii) an Hl sequence at least 90 % identical with TATGCATTGACGT (SEQ ID NO: 45) and a H2 sequence at least 90 % identical with GGTTGATAAAACCT (SEQ ID NO: 46).

31. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 28-30, wherein the DNAzyme has a sequence at least 90 % identical to the sequence as set forth in SEQ ID NOs: 47 or 48 or a sequence having up to four modifications as compared to the nucleic acid sequence as set forth in SEQ ID NOs: 47 or 48.

32. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 11-14 and 17-18, wherein a sequence of said catalytic core is at least 90 % identical as the sequence as set forth in SEQ ID NO: 49.

33. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 1-32, wherein said at least one DNAzyme is chemically modified.

34. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 33, wherein said chemical modification comprises phosphorothioate linkages, 2’-O-methyl ribonucleotides, inverted 5’ & inverted 3'-3' thymidine nucleotides, phosphoramidite linkages and locked nucleic acids (LNAs) or Xeno Nucleic Acids (XNAs).

35. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of the claims 1-34, wherein the composition further comprises a divalent cation.

36. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 35, wherein said divalent cation is Mg2+or Zn2+.

37. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 35, wherein a concentration of said Mg2+is between 1-4 mM.

38. The composition for use according, cosmetic composition, pharmaceutical composition or method according to any one of claims 1-37, wherein the composition is comprised in a delivery agent.

39. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 38, wherein said delivery agent comprises a cationic lipid.

40. The composition for use, cosmetic composition, pharmaceutical composition or method according to claim 39, wherein said lipid is a phospholipid.

41. The composition for use or method according to any one of claims 1, 4 and 6-40, wherein the skin disease is androgenic alopecia, acne or dandruff.

42. The composition for use and cosmetic composition according to any one of claims 1-41, formulated for topical delivery.

43. The composition for use, cosmetic composition, pharmaceutical composition or method according to any one of claims 1-42, wherein the composition is formulated as a shampoo, a cream, a gel, a foam, a spray, a hair mask or a conditioner.

44. A DNAzyme capable of cleaving 5 Alpha reductase type 2 (5AR2) mRNA, wherein a cleavage site of the DNAzyme is comprised within positions 463-493, 512-540 or 721-756 of 5AR2 , wherein the numbering of the positions is according to a nucleic acid sequence as set forth in SEQ ID NO: 50.

45. The Dnazyme of claim 44, wherein said cleavage site resides within SEQ ID NO: 1, 2 or 3 of said 5AR2 gene.

46. The DNAzyme of claims 44 or 45, being represented by the following formula:Hl - C - H2, wherein Hl is a first hybridization arm;C is a catalytic core; andH2 is a second hybridization arm,Wherein the DNAzyme has:(i) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);(ii) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 6);(iii) an Hl sequence at least 90 % identical with ATATATAGTCA (SEQ ID NO: 7) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);(iv) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTA (SEQ ID NO: 8);(v) an Hl sequence at least 90 % identical with TATATAGTCA (SEQ ID NO: 9) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);(vi) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTT;(vii) an Hl sequence at least 90 % identical with GCA ATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTATT (SEQ ID NO: 5);(viii) an Hl sequence at least 90 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 % identical with TGAATGTTT ATTC (SEQ ID NO: 11);(ix) an Hl sequence at least 90 % identical with GCA ATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 14);(x) an Hl sequence at least 90 % identical with ATATATAGTCA (SEQ ID NO: 15) and a H2 sequence at least 90 % identical with TGAATGTTT ATTC (SEQ ID NO: 11);(xi) an Hl sequence at least 90 % identical with AATATATAGTCA (SEQ ID NO: 13) and a H2 sequence at least 90 % identical with TGAATGTTTA (SEQ ID NO: 8);(xii) an Hl sequence at least 90 % identical with GCA ATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11);(xiii) an Hl sequence at least 90 % identical with CAATATATAGTCA (SEQ ID NO: 4) and a H2 sequence at least 90 % identical with TGAATGTTTATTC (SEQ ID NO: 11); or(xiv) an Hl sequence at least 90 % identical with GCAATATATAGTCA (SEQ ID NO: 12) and a H2 sequence at least 90 % identical with TGAATGTTTAT (SEQ ID NO: 14).

47. The DNAzyme of claim 46, wherein a sequence of said catalytic core is at least 90 % identical as the sequence as set forth in SEQ ID NO: 39 or SEQ ID NO: 40.

48. The DNAzyme of claims 44-47, having a nucleic acid sequence as set forth in SEQ ID NO: 16- 29, 32-38 or a sequence having up to four modifications as compared to the nucleic acid sequence as set forth in SEQ ID NOs: 16-29 or SEQ ID NO: 32-38.

49. A DNAzyme capable of cleaving 5 Alpha reductase type 1 (5AR1) mRNA, wherein a cleavage site of the DNAzyme is comprised within positions 712-739 or 1006-1039 of 5AR1, wherein the numbering of the positions is according to a nucleic acid sequence as set forth in SEQ ID NO: 51.

50. The DNAzyme of claim 44, wherein said cleavage site resides within SEQ ID NO: 41 or SEQ ID NO: 42 of said 5AR1 gene.

51. The DNAzyme of claims 49 or 50, being represented by the following formula:Hl - C - H2, wherein Hl is a first hybridization arm;C is a catalytic core; andH2 is a second hybridization arm, wherein the DNAzyme has:(i) an Hl sequence at least 90 % identical with GGACGATGAAATAG (SEQ ID NO: 43) and a H2 sequence at least 90 % identical with AAAAGTTCTACAGGA (SEQ ID NO: 44); or(ii) an Hl sequence at least 90 % identical with TATGCATTGACGT (SEQ ID NO: 45) and a H2 sequence at least 90 % identical with GGTTGATAAAACCT (SEQ ID NO: 46);52. The DNAzyme of claims 49-51, wherein the DNAzyme has a sequence at least 90 % identical to the sequence as set forth in SEQ ID NOs: 47 or 48 or a sequence having up to four modifications as compared to the nucleic acid sequence as set forth in SEQ ID NOs: 47 or 48.

53. The DNAzyme of claim 51, wherein a sequence of said catalytic core is at least 90 % identical as the sequence as set forth in SEQ ID NO: 49.

Images