Rapid detection of active replicating coronavirus infection by lateral flow

Abstract

Methods and kits for the rapid detection of active coronavirus infection by specifically targeting the negative-sense RNA produced during viral replication. The method utilizes nucleic acid amplification techniques, such as RT-PCR and qPCR, with primers specific to the negative strand, which serves as a marker for active viral replication. The present disclosure also encompasses a rapid, user-friendly lateral flow test based on CRISPR-Cas13a technology that targets the negative-sense viral RNA. This LFT employs guide RNAs specific to the negative strand and a reporter system to visually indicate the presence of actively replicating viruses, thereby distinguishing active infections from the presence of non-replicating viral remnants. The methods and kits offer a more accurate means of determining infectivity, guiding public health measures, and monitoring antiviral therapies.

Description

RAPID DETECTION OF ACTIVE REPLICATING CORONAVIRUS INFECTION BY LATERAL FLOWCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No.63 / 637,025, filed on April 22, 2024, the entire disclosure of which is incorporated herein by reference.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been filed electronically in xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on April 22, 2025, is named F306815.xml and is 9.9kb in size.TECHNICAL FIELD

[0003] The present disclosure relates generally to the field of diagnostics, specifically to methods and devices / kits for the detection of active coronavirus infection.More particularly, the present disclosure relates to a novel approach that distinguishes between replicating and non-replicating coronaviruses by targeting the negative-sense RNA produced during viral replication, utilizing both nucleic acid amplification techniques and aCRISPR-based lateral flow assay.BACKGROUND

[0004] The COVID-19 pandemic, driven by the rapid global spread of SARS-CoV- 2, was significantly exacerbated by delays in the development of diagnostic tools that were rapid, accessible, and affordable. While traditional methods—such as reverse-transcription quantitative polymerase chain reaction (RT-qPCR), rapid antigen tests, and sequencing— were essential for tracking the initial outbreak, they lacked the capability to differentiate between active infections and residual, non-infectious viral material. Moreover, these tests were not designed to assess the dynamics of viral replication.

[0005] Positive-strand RNA viruses, including SARS-CoV-2, can persist in the host even after the active phase of infection has ended. This persistence limits the clinical utility of PCR-based methods, which are strand-agnostic and detect viral RNA regardless of its origin—whether from actively replicating cells, newly released viral particles, or neutralized fragments remaining after infection.

[0006] Antigen tests, while offering rapid results, suffer from lower sensitivity and specificity compared to nucleic acid-based methods and similarly fail to distinguish between infectious and non-infectious viral components. Although viral culture and certain sequencing techniques can determine infectivity and the replication status of the virus, their high cost and lengthy turnaround times make them impractical for timely clinical decision- making.

[0007] Clinical observations across the full spectrum of COVID-19 severity—from asymptomatic to severe cases—have shown that viral sequences and proteins can bedetected long after symptoms have resolved. However, it remains uncertain whether these signals indicate ongoing viral replication or simply the presence of persistent, non- replicating fragments. It is well established that a positive PCR result does not necessarily correlate with infectiousness, and that most individuals with mild symptoms are no longer contagious 10 days after symptom onset, even though viral RNA may still be detectable. This distinction between the presence of viral material and actual infectivity has significant implications for patient care, isolation guidelines, and broader public health strategies.

[0008] Some autopsy studies have provided evidence that viral replication in COVID-19 can persist for months after symptom onset, although such findings from fatal cases may not be applicable to individuals with less severe disease.

[0009] Additional evidence supports the notion that non-replicating viral fragments can remain detectable long after infection. Although culture-based methods are the gold standard for determining viral replication and infectivity, their time-consuming and technically demanding nature limits their usefulness in urgent clinical situations—such as making decisions about transplants or implementing real-time quarantine measures. This underscores the urgent need for a rapid and reliable method to determine whether an individual harbors actively replicating virus.

[0010] To address the above challenges, the inventors of the present application have developed a detection strategy that targets the negative-sense RNA strand of SARS- CoV-2, which is only produced during active viral replication. Unlike the more persistent positive-sense RNA strands, these antigenomic sequences are not expected to remaindetectable for long after infection has resolved, making them promising biomarkers of actively replicating virus. In a murine coronavirus model of SARS-CoV, the inventors previously demonstrated that both positive-sense genomic RNA (+ssRNA) and negative- sense antigenomic RNA (-ssRNA) are detectable in cells containing actively replicating virus. However, once viral replication ceases, only +ssRNA remains detectable in the virus- containing medium, while -ssRNA is no longer present—suggesting that detection of - ssRNA is indicative of ongoing replication and, therefore, potential infectivity.

[0011] Current diagnostic tools lack strand specificity and are not user-friendly, which limits the adoption of this approach in clinical practice. To overcome this limitation, the inventors have developed a CRISPR-based lateral flow detection system capable of distinguishing between +ssRNA and -ssRNA strands. The ability to detect actively replicating virus via -ssRNA holds considerable promise for more precise isolation protocols and better-informed clinical decision-making. This diagnostic tool enables rapid assessment of transmissibility. SUMMARY

[0012] The present disclosure addresses the aforementioned limitations by providing an alternative method for detecting active coronavirus infection that specifically targets the negative-sense viral RNA, a product unique to viral replication. By detecting the negative strand, the disclosed method can effectively distinguish between actively replicating viruses and non-replicating viral particles or remnants.

[0013] In one aspect, the present disclosure provides a method for detecting active coronavirus infection in a sample comprising: obtaining a biological sample from a subject; extracting RNA from the sample; subjecting the extracted RNA to a strand-specific nucleic acid detection assay that specifically targets negative-sense RNA (-ssRNA antigenome) of the coronavirus; and detecting the presence or absence of the -ssRNA, wherein the presence of -ssRNA indicates active coronavirus infection.

[0014] In another aspect, the disclosure provides a kit for detecting active coronavirus infection comprising: at least one reagent for the strand-specific detection of coronavirus -ssRNA; and instructions for use. In certain embodiments, the reagent for strand-specific detection comprises at least one guide RNA designed to target the -ssRNA of the coronavirus and a Cas13 enzyme capable of cleaving a reporter molecule upon binding of the guide RNA to the target -ssRNA. The kit may further comprise a reporter molecule, such as a fluorescent reporter or a reporter for a lateral flow assay.

[0015] In a particular embodiment, the disclosure features a CRISPR-based lateral flow assay for the detection of active coronavirus infection, wherein the assay utilizes guide RNAs specific to the -ssRNA of the coronavirus and a Cas13 enzyme to cleave a reporter molecule, resulting in a detectable signal on a lateral flow strip.

[0016] The methods and kits of the present disclosure provide the advantage of distinguishing between active and inactive coronavirus infections, which can lead to more effective public health measures, such as targeted quarantine policies, and improvedtherapeutic decisions. The lateral flow assay format provides a user-friendly and rapid diagnostic tool suitable for widespread use.

[0017] Non-limiting embodiments of the disclosure include the following.

[0018] [1] A lateral flow assay kit for detecting active coronavirus infection in a biological sample, comprising: i) a first test strip; ii) a first capture zone disposed on the first test strip; iii) a first CRISPR-Cas13a system comprising a Cas13a enzyme and a first guide RNA that is specific for negative-sense coronavirus RNA; and iv) a first reporter molecule that is cleaved by the CRISPR-Cas13a system upon binding to the negative-sense coronavirus RNA, resulting in a detectable signal at the capture zone.

[0019] [2] The lateral flow assay kit of [1], wherein the first reporter molecule is labeled with a detectable moiety and a component that allows for capture at the first capture zone after cleavage.

[0020] [3] The lateral flow assay kit of [1], wherein the first guide RNA has a sequence complementary to a region of the negative-sense RNA of SARS-CoV, MERS- CoV, or SARS-CoV-2.

[0021] [4] The lateral flow assay kit of [1], wherein the first guide RNA comprises the nucleotide sequence of SEQ ID NO: 7 and / or 8.

[0022] [5] The lateral flow assay kit of [1], wherein the first guide RNA consists of the nucleotide sequence of SEQ ID NO: 7 and / or 8.

[0023] [6] The lateral flow assay kit of [1], wherein the first Cas13a enzyme is LbuCas13a, which recognizes and binds to the first guide RNA that contains a conserved direct repeat (DR) sequence of the nucleotide sequence of SEQ ID NO: 9.

[0024] [7] The lateral flow assay kit of [1], further comprising: v) a second test strip; vi) a second capture zone disposed on the second test strip; vii) a second CRISPR-Cas13a system comprising a Cas13a enzyme and a second guide RNA that is specific for negative-sense coronavirus RNA wherein the second guide RNA is different from the first guide RNA; viii) a second reporter molecule that is cleaved by the second CRISPR-Cas13a system upon binding to the negative-sense coronavirus RNA, resulting in a detectable signal at the second capture zone.

[0025] [8] The lateral flow assay kit of [7], wherein the second reporter molecule is labeled with a detectable moiety and a component that allows for capture at the second capture zone after cleavage.

[0026] [9] The lateral flow assay kit of [7], wherein the second guide RNA has a sequence complementary to a region of the negative-sense RNA of SARS-CoV, MERS- CoV, or SARS-CoV-2.

[0027]

[0010] The lateral flow assay kit of [7], wherein the second guide RNA comprises the nucleotide sequence of SEQ ID NO: 5 and / or 6.

[0028]

[0011] The lateral flow assay kit of [7], wherein the second guide RNA consists of the nucleotide sequence of SEQ ID NO: 5 and / or 6.

[0029]

[0012] The lateral flow assay kit of [7], wherein the second Cas13a enzyme is LbuCas13a, which recognizes and binds to the second guide RNA that contains a conserved direct repeat (DR) sequence of the nucleotide sequence of SEQ ID NO: 9.

[0030]

[0013] A method for distinguishing between replicating and non-replicating coronavirus in a sample using the kit of [7], the method comprising: i) obtaining a biological sample suspected of containing coronavirus; ii) contacting the sample with the first CRISPR-Cas13a system of the kit, wherein the first guide RNA is specific for negative-sense coronavirus RNA; iii) allowing the first CRISPR-Cas13a system to bind to any negative-sense coronavirus RNA present in the sample and cleave the first reporter molecule; iv) detecting a signal at the first capture zone, wherein the presence of the signal indicates the presence of replicating coronavirus in the sample; v) contacting the sample with the second CRISPR-Cas13a system of the kit, wherein the second guide RNA is different from the first guide RNA and is also specific for negative- sense coronavirus RNA; vi) allowing the second CRISPR-Cas13a system to bind to any negative-sense coronavirus RNA present in the sample and cleave the second reporter molecule; andvii) detecting a signal at the second capture zone, wherein detection of signal at both capture zones confirms the presence of replicating coronavirus. BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0031] Figure 1A is a flow chart depicting the experimental steps for detecting the mouse coronavirus MHV-A59 positive or negative RNA strand. Self-primed RNA-based cDNA, developed without any added primer, represents background levels of expression. RT-PCR refers to reverse transcriptase-based PCR, which generates cDNA from RNA templates. In contrast, real-time PCR, also known as quantitative PCR (qPCR), is used to quantify nucleic acids in real time during the amplification process.

[0032] Figure 1B shows the results of RT-PCR, demonstrating the detection of PCR products specific to both the negative RNA strand (lanes 1 and 2, in duplicate) and the positive RNA strand (lanes 3 and 4, in duplicate) following 2 hours of infection with mouse coronavirus MHV-A59 at a multiplicity of infection (MOI) of 1.0 in 17CL-1 cells. The lower panel shows a mouse actin band as a loading control.

[0033] Figure 2 illustrates the progression of infection in 17CL-1 host cells following exposure to MHV-eGFP-A59. Within 24 hours post-infection, the cells display extensive signs of infection, and by 72 hours, a near-complete cytopathic effect is observed, with very few host cells remaining visible. The panels D and E show the fluorescent signal from the GFP-tagged virus, highlighting infected cells during the early stages of cytopathic effect. Panels F and G present the same infected cells under brightfield microscopy, confirming the presence and extent of infection.

[0034] Figure 3A shows RT-PCR results detecting positive- and negative-strand RNA at 24 and 72 hours post-infection, along with self-priming controls. Lanes 1 and 4 correspond to cDNA generated without primers (self-priming) at 24 and 72 hours, respectively. Lanes 2 and 5 show results from negative-strand-specific cDNA, and lanes 3 and 6 show results from positive-strand-specific cDNA, each at 24 and 72 hours post- infection. The lower panel presents the mouse actin control (154 bp), confirming RNA quality and loading consistency.

[0035] Figure 3B shows a bar graph quantifying the normalized expression levels.

[0036] Figure 4A shows representative results from lateral flow tests comparing non-replicating and replicating coronavirus RNA samples. Two guide RNAs were used for each strand to enhance detection specificity. For non-replicating virus samples, a visible test band appears only on the positive strand-specific strip, indicating the presence of viral genomic RNA. No band appears on the negative strand-specific strip, confirming the absence of active viral replication. In contrast, the replicating virus samples produce visible test bands on both the positive and negative strand-specific strips, indicating the presence of both RNA strands and, thus, active viral replication.

[0037] Figure 4B shows fluorescent probe-based detection of the positive strand from a non-replicating virus. A guide RNA specific to the positive strand (+Guide 1) generates a cleaved FAM signal, resulting in increased fluorescence across triplicate samples. In contrast, the negative strand-specific guide RNA (-Guide 1) does not show an increase in fluorescence. A no-template control (NTC), containing no RNA, produces a flatbaseline signal around 23,000 fluorescence units—comparable to the negative strand- specific signal.

[0038] Figure 5 illustrates CRISPR-based detection of both positive and negative viral RNA strands in replicating coronavirus samples using a fluorescent reporter system.

[0039] Figure 5A shows the accumulation of fluorescence over time resulting from cleavage of an RNA reporter by the LbuCas13a complex bound to a guide RNA specific to the positive (+) strand of the viral genome. The increasing signal confirms the presence of positive-sense genomic RNA in the replicating virus.

[0040] Figure 5B displays a similar increase in fluorescence from a guide RNA targeting the negative (−) strand of the viral genome. The signal indicates the presence of the negative-strand RNA intermediate, a hallmark of active viral replication.

[0041] Figure 5C quantifies the fluorescence signals from Figures 5A and 5B, measured using a plate reader with excitation at 494 nm and emission at 518 nm for FAM detection. The graph compares signals from guide RNAs targeting the positive strand (2ndbar) and negative strand (4thbar) with no-RNA controls (1stbar for positive strand and 3rd for negative strand). The increase in fluorescence in both experimental groups confirms the presence of both RNA strands in the replicating virus. Data represent the mean of three technical replicates. Statistically significant differences between groups were confirmed by pairwise t-tests, with p-values shown above the corresponding bars.

[0042] Figure 6 illustrates the qPCR amplification, absorption spectra, and melting curve analysis of strand-specific cDNA samples derived from 72-hour post-infection samples.

[0043] Figure 6A shows qPCR amplification plots for both negative and positive RNA strand-specific cDNAs at two dilution levels (0.01 and 0.1). The purple and black amplification plots represent 0.01 dilutions of the self-priming and negative-strand-specific cDNAs, respectively, while the green curve corresponds to the positive-strand-specific cDNA at the same dilution. At the 0.1 dilution level, the red and blue curves represent the self-priming and negative-strand-specific cDNAs, and the turquoise curve represents the positive-strand-specific cDNA.

[0044] Figure 6B displays the absorption spectra of all three types of cDNA samples, confirming their presence and integrity.

[0045] Figure 6C shows the melting curves of the qPCR products from Figure 6A, demonstrating the specificity of amplification through distinct melt peaks for each product. DETAILED DESCRIPTION OF THE INVENTION

[0046] The coronavirus-negative mRNA strand can be established as a marker for replicating virus, which will aid in distinguishing replicating viruses from non-replicating viruses. As a model system for coronavirus replication, murine hepatitis virus, mouse coronavirus (MHV-A59), was used, and mouse fibroblast 17CL-1 cells were infected with the virus. qPCR was used to detect the negative strand from the MHV isolated from theinfected 17CL-1 cells. A flow chart, as depicted in Figure 1A, was developed to detect the presence of the negative or positive strand in the MHV-A59-infected 17CL-1 cell line.

[0047] MHV has been widely used as a model for the family of enveloped plus RNA viruses from Coronaviridae, and the MHV-A59 strain is the prototype coronavirus (CoV). Strain MHV-A59 harboring an eGFP fluorescent tag inserted by replacing a pseudogene-ORF4 was used. The virus was obtained from NIAID BEI resources, and a stock was prepared in the laboratory by infecting the mouse fibroblast cell line 17CL-1.

[0048] Following the flow chart (Fig. 1A), strand-specific cDNA primers (SEQ ID NOs: 1 and 2) were used to develop positive and negative strand-specific cDNA libraries, and an approximately 600 bp long PCR product was amplified from the respective cDNA. As a control for loading, mouse actin primers (SEQ ID NOs: 3 and 4) were used to amplify a 154 bp long PCR product. Both PCR products are depicted in Fig. 1B, which shows that both the negative and the positive strand-specific bands could be easily detected from the cDNA synthesized two hours following viral infection.

[0049] Although the intensity of the negative strand-specific band indicated more negative strand synthesis immediately after infection, more studies are needed to determine any biological implications for this expression. However, as the detection system was able to detect the negative strand-specific band more easily, it can be safely inferred that this system can be robustly used to detect the negative strands of a coronavirus.

[0050] Because antigenome production is necessary to sustain the replication of the virus, detection of the negative strand was tested continuously during active infection. Asactive infection requires the presence of host cells and the virus’s cytopathic effect depletes the host cells over time, RNA samples were isolated at different time points of infection, as well as when almost all host cells were depleted due to the cytopathic effect of the infecting virus.

[0051] Although RNA was isolated from 2h until the end of the total cytopathic effect, Fig. 2 presents some of the stages of the cells from which total RNA was isolated for strand-specific RNA identification. Fig. 2 shows that after 3 days of infection with an MOI 1.0 MHV-eGFP-A59 virus, almost all the host cells were depleted due to the viral cytopathic effect. In all samples throughout the infection, both positive and negative RNA strands were detected (Fig. 1B).

[0052] However, both strands were tested in RNA samples isolated from host cell- depleted media collected after 72h post-infection. As no host cells were available, no active infection demonstrably occurred in those samples. Here, no-primer cDNA synthesis from the same RNA sample was used as a control for the widely reported ‘self-priming’-based cDNA synthesis. Fig. 3 shows the RT-PCR-based detection of MHV-A59 in the no-primer, negative, and positive cDNA from the 24h and 72h post-infection media. Similar to the samples in Fig. 1B, PCR amplification was carried out using the same two primers, NegcDNA.F and PoscDNA.R, which amplify a 600 bp product. Lanes 1, 2, and 3 represent cDNA synthesized 24h post-infection, while lanes 4, 5, and 6 represent cDNA synthesized 72h post-infection. Lanes 1 and 4 represent the band detected from the no-primer cDNA, showing the background level of the PCR band amplified from the self-primed cDNA. Lanes 2 and 5 represent the bands from the negative RNA-specific cDNA. Note that lanes4 and 5 show almost identical levels of expression at 72h post-infection—indicating that there was no amplification from the minus RNA strand, as the expression represents the background level of expression, similar to the no-primer expression. This establishes that no negative RNA strands can be detected when no host cells are available. On the contrary, an intense band was seen from the positive strand-specific cDNA at 72h post-infection. As there were no host cells available (Fig. 2) at 72h post-infection, this band likely originates from broken-down genome fragments, remnant / residual virus particles, or non-replicating virions in the media.

[0053] To confirm the RT-PCR results, the same cDNA (72h post-infection) was used in the qPCR experiment, and the results are depicted in Table I and Figs. 6A-6C. Table I Mean Ct F Mean Ct (01SEM old Tm(001SEM Fold Tm617Serial dilutions of no-primer (self-amplification), negative-strand-specific, and positive- strand-specific cDNA samples were analyzed by real-time PCR. Fold changes were calculated using the 2^−ΔΔCt method, with the No Template Control serving as the baseline. Mean Ct values were derived from three technical replicates, and the corresponding standard error of the mean (SEM) was also calculated.

[0054] In concordance with the RT-PCR experiment, serial dilution of the cDNA produced the same level of Cycle Threshold (Ct) values in the no-primer cDNA control (base-level expression) and in the negative strand-specific cDNA conditions, while the positive RNA-specific cDNA sample showed lower Ct values, indicating higher expression. A higher level of cDNA dilution (0.01 and 0.1 dilution, equivalent to 0.01 and 0.1 MOI) was used to obtain robust amplification. The three cDNA samples were quantified using a Nanodrop machine, and the same concentration levels in each of the cDNA samples are indicated in the Nanodrop light absorption chart (Fig. 6B). The melting curve for all samples clearly shows that all samples amplified the same targeted band without amplifying any non-specific bands (Fig. 6C). Thus, both RT-PCR and qPCR demonstrate that when the virus is not actively replicating, virus-positive strand-specific signals can still be detected, whereas only the background level of signal (similar to the no- primer cDNA) can be detected from the negative strand-specific RNA.

[0055] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the present specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a polynucleotide” includes one or more polynucleotides, and reference to “a vector” includes one or more vectors.

[0056] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains. Although other methods and materials similar, or equivalent, to thosedescribed herein can be useful in the present disclosure, preferred materials and methods are described herein.

[0057] As used herein, “Coronaviridae”, known by the common name of “Coronavirus” or “CoV” are enveloped, positive sense, single-stranded RNA viruses. The family of Coronaviridae viruses belong to the broader realm of Riboviria viruses. The family Coronaviridae includes, but is not limited to, viruses such as Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), and Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2; the causative agent of COVID-19).

[0058] As used herein, “Mouse Hepatitis Virus” (MHV) refers to enveloped, positive sense RNA mouse coronaviruses (reviewed by Homberger FR, Lab Anim 1997 31 : 97 - 115). There are many different MHV strains that vary in virulence, organotropism and cell tropism, and are constantly evolving by naturally occurring mutation and recombination. Ubiquitous and highly contagious, MHVs typically infect the respiratory (respiratory tropic) or gastrointestinal tract (entro tropic) and cause a wide variety of diseases such as hepatitis, enteritis and encephalomyelitis. The severity of the disease depends on the strain, age and immune status of the infected mouse.

[0059] Polynucleotide sequences are displayed herein in the conventional 5’ to 3’ orientation unless otherwise indicated.

[0060] “Gene” as used herein refers to a polynucleotide sequence comprising exons and related regulatory sequences. A gene may further comprise introns and / or untranslated regions (UTRs).

[0061] “Infection has resolved” as used herein refers that the body has successfully cleared or controlled an infection, so the virus, bacteria, or other pathogen is no longer actively replicating or causing disease. At this stage, the person’s symptoms typically improve or go away, and they are generally no longer considered contagious. While the immune system may still be cleaning up lingering debris and the body may continue to heal from any damage caused by the infection, the active phase of the illness has ended.

[0062] “Symptoms have resolved,” as used herein, refers to the condition in which the clinical signs associated with the infection—such as fever, cough, fatigue, or other related manifestations—are no longer present, indicating that the patient has returned to a state of apparent health and is no longer experiencing discomfort or illness-related effects.

[0063] “Infectivity,” as used herein, refers to the ability of a virus or other pathogen to enter, survive, and replicate within a host organism, thereby establishing an infection and potentially being transmitted to other susceptible hosts.

[0064] “Cytopathic effect,” as used herein, refers to the observable structural and morphological changes in host cells resulting from viral infection, including but not limited to cell rounding, detachment, lysis, or fusion, which are indicative of viral replication and associated cellular damage.

[0065] Non-limiting embodiments of the present disclosure are illustrated in the following Examples. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, concentrations, percent changes, and the like), but some experimental errors and deviations should be accounted for.

[0066] Unless indicated otherwise, temperature is in degrees Centigrade and pressure is at or near atmospheric. It should be understood that these Examples are given by way of illustration only and are not intended to limit the scope of what the inventor regards as various embodiments of the present disclosure. Not all of the following steps set forth in each example are required nor must the order of the steps in each example be as presented. EXAMPLE: Development of CRISPR-based Diagnostic Lateral Flow Test Targeting the Negative Strand

[0067] To complement the qPCR-based approach for distinguishing between replicating and non-replicating coronaviruses, a rapid Lateral Flow Test (LFT) was developed to make the detection methods more efficient and user-friendly. Since the COVID pandemic, home testing has become the norm, and to support such testing environments, the LFT was designed using CRISPR guide RNA-based detection and subsequent nuclease activity by LbuCas13a on RNA reporter molecules.

[0068] The following experiment aimed to determine whether it could feasibly differentiate between samples containing only viral particles and those from cells with actively replicating viruses. Two guide RNAs were designed to detect the 5’ region of theMHV-A59 negative genome (minus RNA strand) and, as a control, two additional guide RNAs targeting the positive genome (plus RNA strand). They were fused with the Lbu Direct Repeat Sequence (SEQ ID NOs: 9) at their 5' ends.

[0069] After incubating LbuCas13a with the respective guide RNAs, the complex was added to RNA isolated from actively replicating viruses in the mouse 17CL-1 cell line or from non-replicating viruses released into the growth media after complete cytopathic effects on host cells. The incubation buffer contained FAM14UBio RNA for the LFT assay or 6UFAM RNA reporter for fluorescence-based nuclease activity measurement in a qPCR machine equipped to read FAM reporter fluorescence. Note that the FAM reporter is only activated when cleaved from the FAM14UBiotin reporter by guide RNA-based target binding and subsequent LbuCas13a nuclease activity, releasing the RNA reporter.

[0070] Fig. 4A shows that when using RNA (100 ng) from non-replicating viruses, the test band was only visible with guide RNAs 1 or 2 designed to bind the positive RNA genome. No detection band appeared with guide RNAs 1 or 2 designed to bind the negative RNA genome. Technically, it is impossible to rule out some residual replicating viruses with the cellular debris in the media, but the presence of the strong test band for the positive strand and absence of any negative strand test band indicate that this LFT can molecularly distinguish a positive genome from its antigenome. This confirms the hypothesis, based on the typical +RNA virus life cycle, that non-replicating viruses do not harbor the negative genome. Conversely, when using RNA (100 ng) from replicating viruses within the host cells, test bands were clearly observed from both the positive and the negative strand-specific guide RNA samples, indicating the presence of both genomesin replicating viruses. Note that the RNA was isolated 4 hours post-infection, and more than 99% originated from host cells. The identification of both viral positive and negative strands while containing an almost negligible amount of viral RNA in the original sample indicates that this LFT system is highly robust, sensitive, and specific to the respective viral strand. This will help minimize false positive signals that often complicate the interpretation of positive strand-based detection methods.

[0071] Additionally, the LFT results were confirmed using a fluorescent RNA probe. In this case, instead of FAM14UBio RNA, 5’FAM6U3’IABkFQ reporter RNA was used, where IABkFQ (Iowa Black FQ) served as the 3’ quencher with the 5’ FAM reporter. After incubating the respective guide RNAs (15 ng) with 200 ng of LbuCas13a at 37°C for 10 minutes, the complex was added to RNA from non-replicating viruses containing 10 picomoles of the RNA reporter. Fig. 4B shows the results obtained from a qPCR machine that reads cleaved FAM fluorescence every 5 minutes for two hours using RNA from non- replicating viruses (10 and 50 ng). The figure clearly shows that when guide RNA targeting the positive RNA strand was used, only then did the fluorescent intensity increase over time in a concentration-dependent manner (+Guide 1 in triplicates). When the guide RNA targeting the negative strand was used, no fluorescent intensity increased, as it remained at a similar level (-Guide1) to the no-RNA control lines (in triplicates). However, when the replicating viruses’ RNA was isolated from the host cells, a negligible amount of viral RNA was present in the sample, making such clear separation of signal intensity in the replicating virus less prominent (Fig. 5A and 5B). Despite the low viral RNA concentration, steady increases in fluorescent signal intensity were shown from samplesprepared with the positive strand-specific guide RNA (Fig. 5A) and from the negative strand-specific guide RNA (Fig. 5B). The upward trend of the signal is compared with no viral RNA control samples that showed a flat line below the increasing signal curve. The extremely low level of viral RNA in replicating virus samples isolated from host cells prevented strong separation of signals from no-template signals. However, combining the clear positive LFT test—even with such a negligible level of viral RNA from the replicating virus—with strong signal separation in the RNA from non-replicating viruses clearly establishes this LFT system as a useful tool for distinguishing replicating coronaviruses from non-replicating viruses. These findings highlight the specificity and utility of the LTF system in discriminating between non-replicating and replicating coronavirus infections based on strand-specific detection.

[0072] Cells and Viruses: The murine 17CL-1 cell line (derived from 3T3 cells) was obtained through BEI Resources, NIAID, NIH (catalog number: NR-53719). The cells were maintained as monolayer cultures in Minimum Essential Medium (MEM; Sigma Aldrich- M4655) containing 10% fetal bovine serum (FBS; Life Technologies), 100 IU / ml penicillin, and 100 μg / ml streptomycin (both from Life Technologies) in a 37^°C humidified incubator supplemented with 5% CO₂. MHV strain A59-eGFP, which expresses Enhanced Green Fluorescent Protein (eGFP) inserted in place of the Ns4 gene, was obtained through BEI Resources, NIAID, NIH (catalog number: NR-53716).

[0073] Infection method: 17CL-1 cells at 70–80% confluency were infected with MHV-A59-eGFP at a multiplicity of infection (MOI) of 0.5 to 1.0. After one hour of adsorption, the medium was removed, and the cells were washed three times with PBSbuffer. Fresh MEM containing either oligo plus polymer or polymer only was added to the virus-treated cells, which were then incubated for the indicated duration.

[0074] RNA isolation and RT-qPCR experiments: Viral RNA was isolated using the PureLink Viral RNA / DNA Kit (Cat# 12280) following the manufacturer’s instructions (Thermo Fisher, Carlsbad, CA). Following the workflow, 500 ng of total RNA from virus- infected cells was used to synthesize strand-specific cDNA using the High Capacity cDNA Reverse Transcription Kit (Cat# 4368814) (Thermo Fisher, Carlsbad, CA). The negative- strand cDNA primer sequence, named NegcDNA.F, spans positions 30691 to 30713 of the complete genome of murine hepatitis virus (accession #AY910861) and has the sequence: 5’-TGAACCCACCAAAGATGTGTATG-3’ (SEQ ID NO: 1). For the positive RNA strand, the primer (PoscDNA.R) spans positions 31251 to 31273 of the same genome (accession #AY910861) and has the sequence: 5’-ACCCTGATGTGAGCTCTTCCCAG-3’ (SEQ ID NO: 2). Using the two primers, NegcDNA.F and PoscDNA.R, an approximately 600 bp RT-PCR product was generated from the respective cDNA. As a loading control, mouse actin primers named mActin.F (5’-GGCTGTATTCCCCTCCATCG-3’) (SEQ ID NO: 3) and mActin.R (5’-CCAGTTGGTAACAATGCCATGT-3’) (SEQ ID NO: 4) were used to amplify a 154 bp PCR product. Real-time PCR was performed using the SYBR Select Master Mix (Cat# 4472908; Thermo Fisher, Carlsbad, CA) on a StepOnePlus Real- Time PCR System (Applied Biosystems), with 40 cycles of 95^°C for 15 seconds and 60^°C for 1 minute, followed by melting curve analysis. A single cycle of 50^°C for 2 minutes (UDG inactivation) and 95^°C for 2 minutes (AmpliTaq Fast DNA Polymerase, UP activation) was run before the start of the 40 amplification cycles.

[0075] CRISPR-based LFT development: Guide RNAs targeting the MHV-A59 positive- or negative-sense genomes were designed using the NCBI reference sequence for Murine Hepatitis Virus Strain A59 (Accession number: AY700211.1). The sequences of the four guide RNAs are:

[0076] Positive sense: Guide 1: GACCACCCCAAAAAUGAAGGGGACUAAAACACGAUGUUAAGAGGUUCAUUG AA CCCAA (Reference sequence AY700211.1: 22670–22697) (SEQ ID NO: 5) Guide 2: GACCACCCCAAAAAUGAAGGGGACUAAAACGUUAGGAACACGCCGGUACAC AA CUCCA (Reference sequence AY700211.1: 24877–24904) (SEQ ID NO: 6)

[0077] Negative sense: Guide 1: GACCACCCCAAAAAUGAAGGGGACUAAAACUUUAUGAAGGAGUUAAUUUUA GU CCCCAA (Reference sequence AY700211.1: 22913–22939) (SEQ ID NO: 7) Guide 2: GACCACCCCAAAAAUGAAGGGGACUAAAACGUGUGUAUAUUGGCGACAUUU UA ACACA (Reference sequence AY700211.1: 24615–24642) (SEQ ID NO: 8)

[0078] The Lbu direct repeat sequence used was: GACCACCCCAAAAAUGAAGGGGACUAAAAC (SEQ ID NO: 9).

[0079] The RNA reporter sequences were: • 6U-FAM reporter: 5’-FAM / rUrUrUrUrUrU / 3’IABkFQ• FAM / Biotin RNA reporter: 5’-Biotin / rUrUrUrUrUrUrUrUrUrUrUrUrUrU / 3’-6- FAM (SEQ ID NO: 10)

[0080] These sequences are instrumental in the described RT-PCR, qPCR, and CRISPR-based LFT methods for the specific and rapid detection of actively replicating coronaviruses by targeting the negative RNA strand. The use of these sequences allows for the differentiation between active infections and the presence of non-replicating viral remnants. The guide RNAs (Sequence ID NOs: 5-8) are designed to target both the positive and negative strands of the murine hepatitis virus (MHV-A59) genome, which serves as a model for SARS-CoV-2. The RNA reporters (Sequence ID NOs: 10 and 11) are used in conjunction with the LbuCas13a nuclease for the CRISPR-based detection assay.

[0081] Study Using Lateral Flow Assay The method utilizes the HybriDetect Universal Lateral Flow Assay Kit, which was obtained from Milenia Biotec, and follows the publicly available protocol provided by the manufacturer. Reaction conditions were further performed in accordance with a protocol supplied by GenScript for the Cas13a detection system. The method comprises a strand-specific detection assay involving reverse transcription, optional amplification, CRISPR-Cas13a-mediated recognition, and signal detection using either fluorescence or lateral flow analysis.

[0082] The protocols provided by the manufacturer and implemented by the inventors are as follows. A biological sample suspected of containing coronavirus, such as a nasal swab, throat swab, or saliva sample, is collected and subjected to total RNA extraction using a commercially available RNA extraction kit. The extracted RNA is then divided into two separate aliquots. A strand-specific reverse transcription reaction isperformed on each aliquot using strand-specific primers. One aliquot is subjected to reverse transcription using a primer that selectively hybridizes to the positive-sense genomic RNA of the coronavirus. The second aliquot is subjected to reverse transcription using a primer that hybridizes specifically to the negative-sense RNA, which corresponds to the replicative intermediate of the virus. This step generates two distinct cDNA populations, each corresponding to a specific viral strand, thereby enabling differential detection of replicating versus non-replicating viral RNA.

[0083] Following reverse transcription, the resulting cDNA may optionally be amplified using a suitable nucleic acid amplification method such as polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), or other appropriate techniques. Where lateral flow detection is used, amplification primers may be designed to include labels such as fluorescein (FAM), biotin, or digoxigenin (DIG) to facilitate visual readout on the lateral flow strip.

[0084] The Cas13a-based detection system is then prepared in two steps. In the first step, a ribonucleoprotein complex is assembled by combining 1 µl of 10× Cas13a reaction buffer, 2 µl of crRNA (15 ng, at a concentration of 7.5 ng / µl), 2 µl of LbuCas13a nuclease (200 ng, at a concentration of 100 ng / µl, obtained from GenScript under catalog number Z03742), and 5 µl of DEPC-treated nuclease-free water. The mixture is incubated at 37^°C for 10 minutes in a thermal cycler to allow for proper folding and binding of the guide RNA (also known as crRNA) to the LbuCas13a enzyme.

[0085] In the second step, the detection assay is assembled by adding 2 µl of ssRNA target (10–100 ng, at a concentration of 5 ng / µl), 4 µl of 10× Cas13a reactionbuffer, 29 µl of DEPC-treated nuclease-free water, 10 µl of the pre-assembled Cas13a / crRNA complex, and 5 µl of a fluorescent RNA reporter (10 pmol). This reaction mixture is incubated at 37^°C for 120 minutes. The assay can be monitored for fluorescence over time using a qPCR instrument with FAM detection settings or alternatively analyzed in a fluorescence plate reader set to 494 nm excitation and 518 nm emission.

[0086] For lateral flow-based visualization, the reaction mixture may be directly applied to a HybriDetect lateral flow strip. The presence of activated Cas13a results in cleavage of the labeled reporter molecule, thereby generating a visible test line. A separate control line is included to confirm proper function of the strip and migration of the reagents.

[0087] The results of the assay allow for discrimination between replicating and non-replicating virus. Detection of both positive-sense and negative-sense viral strands indicates active viral replication, while detection of only the positive-sense strand indicates the presence of non-replicating viral genomic RNA. If neither strand is detected, the virus is either absent or below the limit of detection. This method provides a rapid and sensitive approach to assess viral replication status, which is relevant for diagnostics, monitoring of disease progression, or evaluation of antiviral treatment efficacy.

[0088] The method in accordance with the present disclosure provides several advantages over existing diagnostic approaches. First, the method enables distinction between active and inactive coronavirus infections by specifically detecting negative-sense RNA, which is present only during active viral replication. As such, the detection of thenegative strand serves as a reliable indicator of current infection and potential for transmissibility.

[0089] Second, by focusing on the replicative intermediate rather than the more abundant positive-sense genomic RNA, the method reduces the risk of false-positive results caused by residual, non-replicating viral RNA that may persist following the resolution of infection. This specificity enhances the diagnostic accuracy of the assay.

[0090] Third, the method achieves high sensitivity and specificity through the combination of nucleic acid amplification and CRISPR-based detection using a lateral flow test (LFT) format. This allows for reliable identification of replicating virus even in samples containing low viral loads.

[0091] Fourth, the method may be employed to monitor the effectiveness of antiviral therapy. A decrease in negative-sense RNA levels over time can indicate a therapeutic response, thereby providing valuable clinical information during the course of treatment.

[0092] Fifth, the lateral flow assay format renders the test rapid and user-friendly, enabling deployment in point-of-care or non-clinical settings. This accessibility supports timely decision-making and broader population-level screening.

[0093] Finally, although the method is exemplified herein for coronavirus detection, the underlying principle of targeting the negative-sense RNA strand for identifying actively replicating virus is broadly applicable and may be extended to the detection of other positive-sense RNA viruses.

Claims

CLAIMS 1. A lateral flow assay kit for detecting active coronavirus infection in a biological sample, comprising: i) a first test strip; ii) a first capture zone disposed on the first test strip; iii) a first CRISPR-Cas13a system comprising a Cas13a enzyme and a first guide RNA that is specific for negative-sense coronavirus RNA; and iv) a first reporter molecule that is cleaved by the CRISPR-Cas13a system upon binding to the negative-sense coronavirus RNA, resulting in a detectable signal at the capture zone.

2. The lateral flow assay kit of claim 1, wherein the first reporter molecule is labeled with a detectable moiety and a component that allows for capture at the first capture zone after cleavage.

3. The lateral flow assay kit of claim 1, wherein the first guide RNA has a sequence complementary to a region of the negative-sense RNA of SARS-CoV, MERS-CoV, or SARS-CoV-2.

4. The lateral flow assay kit of claim 1, wherein the first guide RNA comprises the nucleotide sequence of SEQ ID NO: 7 and / or 8.

5. The lateral flow assay kit of claim 1, wherein the first guide RNA consists of the nucleotide sequence of SEQ ID NO: 7 and / or 8.

6. The lateral flow assay kit of claim 1, wherein the first Cas13a enzyme is LbuCas13a, which recognizes and binds to the first guide RNA that contains a conserved direct repeat (DR) sequence of the nucleotide sequence of SEQ ID NO:

9.

7. The lateral flow assay kit of claim 1, further comprising: i) a second test strip; ii) a second capture zone disposed on the second test strip; iii) a second CRISPR-Cas13a system comprising a Cas13a enzyme and a second guide RNA that is specific for negative-sense coronavirus RNA wherein the second guide RNA is different from the first guide RNA; iv) a second reporter molecule that is cleaved by the second CRISPR-Cas13a system upon binding to the negative-sense coronavirus RNA, resulting in a detectable signal at the second capture zone.

8. The lateral flow assay kit of claim 7, wherein the second reporter molecule is labeled with a detectable moiety and a component that allows for capture at the second capture zone after cleavage.

9. The lateral flow assay kit of claim 7, wherein the second guide RNA has a sequence complementary to a region of the negative-sense RNA of SARS-CoV, MERS-CoV, or SARS-CoV-2.

10. The lateral flow assay kit of claim 7, wherein the second guide RNA comprises the nucleotide sequence of SEQ ID NO: 5 and / or 6.

11. The lateral flow assay kit of claim 7, wherein the second guide RNA consists of the nucleotide sequence of SEQ ID NO: 5 and / or 6.

12. The lateral flow assay kit of claim 7, wherein the second Cas13a enzyme is LbuCas13a, which recognizes and binds to the second guide RNA that contains a conserved direct repeat (DR) sequence of the nucleotide sequence of SEQ ID NO:

9.

13. A method for distinguishing between replicating and non-replicating coronavirus in a sample using the kit of claim 7, the method comprising: i) obtaining a biological sample suspected of containing coronavirus; ii) contacting the sample with the first CRISPR-Cas13a system of the kit, wherein the first guide RNA is specific for negative-sense coronavirus RNA; iii) allowing the first CRISPR-Cas13a system to bind to any negative-sense coronavirus RNA present in the sample and cleave the first reporter molecule; iv) detecting a signal at the first capture zone, wherein the presence of the signal indicates the presence of replicating coronavirus in the sample; v) contacting the sample with the second CRISPR-Cas13a system of the kit, wherein the second guide RNA is different from the first guide RNA and is also specific for negative-sense coronavirus RNA; vi) allowing the second CRISPR-Cas13a system to bind to any negative-sense coronavirus RNA present in the sample and cleave the second reporter molecule; andvii) detecting a signal at the second capture zone, wherein detection of signal at both capture zones confirms the presence of replicating coronavirus.

Images