Anti-bacterial metallothionein antibodies and uses thereof

Abstract

A system / agent / composition including a bacterial anti-metallothionein antibody and methods for their use to prevent and / or treat bacterial infections such as ESKAPE infections, for example, Pseudomonas aeruginosa infection are described.

Description

UCONN 24-028 MBHB 25-0252-WO ANTI-BACTERIAL METALLOTHIONEIN ANTIBODIES AND USES THEREOF FIELD OF THE DISCLOSURE

[0001] Described herein are a system / agent / composition including an anti-bacterial metallothionein antibody and methods for their use to prevent and / or treat bacterial infections such as ESKAPE infections, for example, Pseudomonas aeruginosa infection.

[0002] SEQUENCE LISTING STATEMENT

[0003] A computer readable form of the Sequence Listing is filed with this application by electronic submission and is incorporated into this application by reference in its entirety. The Sequence Listing is contained in this file created on April 22, 2025 having the file name “25- 0252-WO_SequenceListing” and is 21 kb in size. BACKGROUND

[0004] Pseudomonas aeruginosa is a non-fermenting, Gram-negative, opportunistic pathogen that ranks among the top five healthcare-associated infections nationwide. The wide arsenal of virulent factors found within P. aeruginosa make for a versatile pathogen that can effectively respond to immunological stressors. Most commonly, these bacteria are found in patients that are immunocompromised, have undergone invasive surgery or who have underlying conditions such as diabetes or cystic fibrosis. P. aeruginosa infections also frequently arise with the use of medical devices such as ventilators, central lines, urinary catheters and / or surgical / transplantation and have been implicated as the causative agent of a wide variety of infection types (e.g., pneumonia, sepsis, keratitis, skin, bone, joint, endocarditis, and meningitis). P. aeruginosa infections associated with chronic lung disease such as cystic fibrosis (CF) disease, ventilator-associated pneumonia (VAP), and individuals with chronic obstructive pulmonary disease (COPD) are persistent and are often linked with an increase in morbidity and mortality. COVID-19 patients who develop VAP are also coinfected with several microbes including Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, Staphylococcus aureus and P. aeruginosa and that SARS-CoV-2 infections provides a lung environment that is conducive for rapid adaptive evolution of chronic P. aeruginosa infections. In burn wounds, P. aeruginosa is prevalent in 59% of patients with extensive burns and also exacerbates morbidity and mortality in these patients as well. Quite often, these infections are recurrent from the ability of P. aeruginosa toUCONN 24-028 MBHB 25-0252-WO develop persister cells (slow or nondividing cells) within biofilms under environmental stressors like oxidative stress, nutrient deprivation, and antibiotic treatments. Therefore, there is an immediate need for novel systems / agents and methods for effective treatment for

[0005] bacterial infections, especially for infections associated with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacker baumannii, Pseudomonas aeruginosa, and Enterobacter specie (ESKAPE) pathogens. SUMMARY

[0006] In a first aspect, the disclosure provides methods for treating an infection caused by one or more pathogens comprising or consisting of Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species, and combinations thereof, comprising administering to a subject with the infection a therapeutically effective amount of an inhibitor of bacterial metallothionein (PmtA) to treat the infection. In one embodiment, the pathogen comprises Pseudomonas aeruginosa.

[0007] In another embodiment, the subject is immunocompromised, is hospitalized, has undergone invasive surgery, and / or is at risk of developing diabetes or cystic fibrosis; in one such embodiment, the subject has cystic fibrosis. In a further embodiment, the subject has a cystic fibrosis-associated infection. In another further embodiment, the infection comprises a lung infection, and wherein the method improves lung function in the subject.

[0008] In another embodiment, the subject has diabetes. In one such embodiment, the subject has a diabetic wound, and the method promotes diabetic wound healing in the subject. In a further embodiment, the diabetic wound comprises a foot ulcer.

[0009] In one embodiment, the inhibitor of PmtA comprises an anti-PmtA antibody or antigen-binding fragment thereof and / or an aptamer which specifically binds to PmtA. In one such embodiment, the inhibitor of PmtA comprises an anti-PmtA antibody or an antigen- binding fragment thereof. In a further embodiment, the anti-PmtA antibody or an antigen- binding fragment thereof comprises a humanized anti-PmtA antibody or antigen-binding fragment thereof. In a further such embodiment, the anti-PmtA antibody or antigen binding fragment comprises the following complementarity determining regions: heavy chain CDR1 comprises or consists of the amino acid sequence GFTFSSYA (SEQ ID NO: 1); heavy chain CDR2 comprises or consists of the amino acid sequence ISNGGSYT (SEQ ID NO: 2);UCONN 24-028 MBHB 25-0252-WO heavy chain CDR3 comprises or consists of the amino acid sequence SRLAFDY (SEQ ID NO: 3); light chain CDR1 comprises or consists of the amino acid sequence TGAVTISNY (SEQ ID NO: 4); light chain CDR2 comprises or consists of the amino acid sequence GTN; and light chain CDR3 comprises or consists of the amino acid sequence ALWYSNHLV (SEQ ID NO: 5). In some embodiments, the amino acid sequence of the heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 1. In one such embodiment, the amino acid sequence of the heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 2. In a further such embodiment, the amino acid sequence of the heavy chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 3. In another such embodiment, the amino acid sequence of the light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 4. In one such embodiment, the amino acid sequence of the light chain CDR2 is at least 67% or 100% identical to GTN. In a further such embodiment, the amino acid sequence of the light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 5.

[0010] In another such embodiment the anti-PmtA antibody or antigen binding fragment comprises the following complementarity determining regions: heavy chain CDR1 comprises or consists of the amino acid sequence GYSFTGYY (SEQ ID NO: 6); heavy chain CDR2 comprises or consists of the amino acid sequence INPSNGYS (SEQ ID NO: 7); heavy chain CDR3 comprises or consists of the amino acid sequence ATFAY (SEQ ID NO: 8); light chain CDR1 comprises or consists of the amino acid sequence SSLSY (SEQ ID NO: 9); light chain CDR2 comprises or consists of the amino acid sequence DTS; and light chain CDR3 comprises or consists of the amino acid sequence QQRNSYPFT (SEQ ID NO: 10). In some embodiments, the amino acid sequence of the heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 6. In one such embodiment, the amino acid sequence of the heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 7. In a further such embodiment, the amino acid sequence of the heavy chain CDR3 is at least 80%,UCONN 24-028 MBHB 25-0252-WO 90% or 100% identical to SEQ ID NO: 8. In another such embodiment, the amino acid sequence of the light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 9. In one such embodiment, the amino acid sequence of the light chain CDR2 is at least 67% or 100% identical to DTS. In a further such embodiment, the amino acid sequence of the light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 10.

[0011] In another such embodiment the anti-PmtA antibody or antigen binding fragment comprises the following complementarity determining regions: heavy chain CDR1 comprises or consists of the amino acid sequence GFTFSSYA (SEQ ID NO: 1); heavy chain CDR2 comprises or consists of the amino acid sequence ISSGGSYT (SEQ ID NO: 11); heavy chain CDR3 comprises or consists of the amino acid sequence ARLAMDY (SEQ ID NO: 12); light chain CDR1 comprises or consists of the amino acid sequence TGAVTISNY (SEQ ID NO: 13); light chain CDR2 comprises or consists of the amino acid sequence GTN; and light chain CDR3 comprises or consists of the amino acid sequence ALWYSNHLV (SEQ ID NO: 14). In some embodiments, the amino acid sequence of the heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 1. In one such embodiment, the amino acid sequence of the heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 11. In a further such embodiment, the amino acid sequence of the heavy chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 11. In another such embodiment, the amino acid sequence of the light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 12. In one such embodiment, the amino acid sequence of the light chain CDR2 is at least 67% or 100% identical to GTN. In a further such embodiment, the amino acid sequence of the light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 14.

[0012] In one embodiment, the anti-PmtA antibody is conjugated to a cross-linkingmoiety, wherein the cross-linking moiety is selected from the group comprising or consistingof (a) homobifunctional cross-linking agents such as sulfosuccinimidyl 4-(N- maleimidomethyl)cyclohexane-1-carboxylate (Sulfo-SMCC), glutaraldehyde, bis[sulfosuccinimidyl] suberate (BS3), disuccinimidyl suberate (DSP), disuccinimidyl succinate (DSS), ethylene glycol bis(succinimidyl succinate) (EGS), bis[sulfosuccinimidyl]UCONN 24-028 MBHB 25-0252-WO glutarate (BS2G), disuccinimidyl glutarate (DSG), formaldehyde or (b) heterobifunctionalcross-linking agents such as N-( -Maleimidocaproyloxy)succinimide ester) (EMCS), N- -Maleimidobutyryloxysuccinimide ester (GMBS), 5-Azido-2-nitrobenzoic acid N- hydroxysuccinimide ester (ANB-NOS) or (c) photoactivatable crosslinkers.

[0013] In one such embodiment, the anti-PmtA antibody is conjugated to a therapeutic,wherein the therapeutic is selected from the group comprising or consisting of smallmolecules (including but not limited to an anti-PmtA small molecule or a pharmaceutically acceptable salt, enantiomer, stereoisomer, solvate, polymorph or prodrug thereof which specifically binds to PmtA, antibiotics, phages, and colicin. In a further such embodiment, the therapeutic comprises an antibiotic, wherein the antibiotic is selected from the groupcomprising or consisting of oblitoxaximab, raxibacumab, bezlotoxumab, actozumab,edobacomab, nebacumab, colistin, and aurograb.

[0014] In another such embodiment, the subject is human. In another embodiment, thesubject is selected from the group comprising or consisting of cats, dogs, cattle, and pigs. In afurther embodiment, the subject is a bird.

[0015] In another aspect, the disclosure provides a composition comprising: (a) a peptide comprising or consisting of 3-12 contiguous amino acids selected from residues 35 to 46 of PmtA or the entire PmtA peptide; and (b) a moiety conjugated to the peptide, selected from the group comprising or consisting of a carrier and a cross-linking moiety.

[0016] In another embodiment, the moiety comprises a carrier wherein the carrier isselected from the group comprising or consisting of keyhole limpet hemocyanin (KLH),serum albumins, immunoglobulin molecules, ovalbumin, tetanus toxoid (TT), diphtheria toxoid (DT), meningococcal outer membrane protein complex (OMPC), H. influenza protein (HiD), and flagellin. In a further embodiment, the moiety comprises a cross-linking moiety,wherein the cross-linking moiety is selected from the group comprising or consisting of (a)homobifunctional cross-linking agents such as sulfosuccinimidyl 4-(N- maleimidomethyl)cyclohexane-1-carboxylate (Sulfo-SMCC), glutaraldehyde, bis[sulfosuccinimidyl] suberate (BS3), disuccinimidyl suberate (DSP), disuccinimidyl succinate (DSS), ethylene glycol bis(succinimidyl succinate) (EGS), bis[sulfosuccinimidyl] glutarate (BS2G), disuccinimidyl glutarate (DSG), formaldehyde or (b) heterobifunctionalcross-linking agents such as N-( -Maleimidocaproyloxy)succinimide ester) (EMCS), N- -Maleimidobutyryloxysuccinimide ester (GMBS), 5-Azido-2-nitrobenzoic acid N- hydroxysuccinimide ester (ANB-NOS) or (c) photoactivatable crosslinkers.UCONN 24-028 MBHB 25-0252-WO

[0017] In a further aspect, the disclosure provides a method of limiting development of an infection caused by one or more pathogen selected from the group comprising or consisting of Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species, comprising administering to a subject at risk of such infection a therapeutically effective amount of the composition to limit development of the infection. In one embodiment herein, the pathogen comprises Pseudomonas aeruginosa. In a further embodiment herein, the subject is immunocompromised, is hospitalized, has undergone invasive surgery, and / or has or is at risk of developing diabetes or cystic fibrosis. In another embodiment herein, the subject has cystic fibrosis. In another such embodiment herein, the subject has diabetes. In a further embodiment herein, the subject as a diabetic wound which comprises a foot ulcer. In another such embodiment herein, the subject is a mammal. In a further embodiment herein, the subject is human. In yet a further embodiment herein, thesubject is selected from the group comprising or consisting of cats, dogs, cattle, and pigs. Inone such embodiment herein, the subject is a bird.

[0018] Disclosed herein is the role of PmtA as a potential antioxidant for P. aeruginosa under exogenous oxidative stress. Using a clean deletion pmtA mutant and an overexpression mutant of PAO1 (PBAD pmtA) driven by an arabinose-inducible promoter, inventors examined PmtA’s importance in enhancing bacterial survival when encountering the host immune response.

[0019] In an aspect, disclosed is a system / agent / composition including an anti-bacterial metallothionein antibody as a therapeutic for bacterial infections such as Pseudomonas aeruginosa and other ESKAPE pathogens as shown and described herein.

[0020] In an aspect, disclosed is a method for treatment for bacterial infections such as Pseudomonas aeruginosa and other ESKAPE pathogens using the disclosed system / agent / composition including the anti-bacterial metallothionein antibody as shown and described herein.

[0021] These and other aspects and embodiments of the disclosure are described in more detail below. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings are included to provide a further understanding of the methods and compositions of the disclosure and are incorporated in and constitute a part of this specification. The drawings illustrate one or more embodiment(s) of the disclosure,UCONN 24-028 MBHB 25-0252-WO and together with the description serve to explain the principles and operation of the disclosure.

[0023] Figure 1: Generation and validation of PBADpmtA (A) Plasmid map generated from Plasmidsaurus.com sequencing showing pmtA inserted into pTJ1 generating pBADpmtA. (B) PCR amplification of the glmS region from PBADpmtA showing a 3.2kb band (lane 2), PAO1 showing 300bp band (lane 3), and pmtA:pmtA showing 3kb band (lane 4). The band shift in PBADpmtA and pmtA:pmtA when compared to PAO1 indicates the Tn7 insertion. (C-F) Overnight cultures of P. aeruginosa strains were grown in M9 media (C), LB (D), TSB (E) and infection media (F). Total RNA was extracted from cells at 24 h and converted to cDNA. qPCR was performed on a CFX96 Real-Time Thermocycler and relative gene expression values for pmtA were calculated using the cycle threshold value compared to the RNA polymerase, subunit alpha. The expression of pmtA in PBADPmtA was significantly increased when compared to WT when arabinose is present in all media types indicating induction of pmtA. An unpaired t-test analysis was performed (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). The data are presented as the average of three biological replicates (± standard error of the mean) and are representative of three separate experiments.

[0024] Figure 2: In vitro Phenotypes from inducing overexpression of PmtA in P. aeruginosa with 0.5-1% Arabinose. (A) Pyocyanin was extracting using chloroform and absorbance of completely extracted pyocyanin was measured at OD520and the pyocyanin / cell value was calculated by dividing the pyocyanin at OD520by growth measured at OD600. (B) Biofilms were stained with crystal violet stain was measured at OD595. The OD reading after the addition of crystal violet was divided by the growth yield OD to calculate the relative biofilm formation. (C) Colony morphology on Congo red plates. The center density (black dotted line) indicates biofilm formation, PBAD pmtA is the densest. Data is presented as the average of three biological replicates (+ / - standard error of the mean), representative of three separate experiments. One-way ANOVA analysis was performed (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001.)

[0025] Figure 3: PmtA confers resistance to oxidative stress in vitro. (A-B) M9 media produces reduces pyocyanin levels in P. aeruginosa PAO1 strains. (A) Pyocyanin was extracted as follows: Chloroform was added to the supernatant from each strain, forming a bottom layer. Subsequently, hydrochloric acid (0.2 M) was added to the layer bringing it to a pH of 2. The absorbance of extracted pyocyanin was measured at OD520and the pyocyanin / cell density was calculated by dividing the pyocyanin at OD520by growth measured at OD600. (B) Image of growth showing lack of indicative staining in M9 media.UCONN 24-028 MBHB 25-0252-WO PmtA confers resistance to oxidative stress. (C) H2O2 and (D) NaOCl cultures were grown for 18hrs and 108cells were exposed to 40mM H202 or 0.3% NaOCl for 90 mins. Cultures were then plated on TSA agar. Percent survival was then calculated and is presented as the average of three biological replicates (+ / - standard error of the mean), representative of three separate experiments. One-way ANOVA analysis was performed (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001).

[0026] Figure 4: PmtA confers resistance to phagocytosis (A) Phagocytosis assay was performed for 30 mins using THP-1 differentiated into a macrophage-like cell using PMA. Using gentamicin and washing with PBS, extracellular pmtA, PBADpmtA and / or WT PAO1 strain was eliminated from the coculture. THP-1 cells were lysed, plated on TSA plates, and CFU / mL was calculated. PBADpmtA when compared to both pmtA and WT PAO1 had significantly less CFU / mL recovered indicating a role for PmtA in phagocytosis. (B) A 60 min phagocytosis time point was performed as described above and again, PBADpmtA when compared to both pmtA and WT PAO1 had significantly less CFU / mL recovered indicating a role for PmtA in phagocytosis. The data are presented as the average of three biological replicates (+ / - standard error of the mean) and are representative of three separate experiments. One-way ANOVA analysis was performed (A &B) (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001.)

[0027] Figure 5: Visualization of PmtA aiding in resistance to phagocytosis using a fluorescent Microscope. Using fluorescently tagged PAO1 strains, the above phagocytosis assay was performed and imaged using a fluorescence microscope, white line in lower rightcorner equals 10 m. At time 0, extracellular bacteria can be visualized. At 30 and 60 mins,after the addition of gentamicin and washing, one can visualize more pmtA in close proximity to the THP-1 cells when compared to both WT and PBADpmtA PAO1 underscoring the role of PmtA in phagocytosis.

[0028] Figure 6: Confocal microscopy of Phagocytosis assay. Using fluorescently tagged WT and pmtA PAO1 strains only, the phagocytosis assay was performed for 30mins, Z stacks were taken in .5 m steps using a confocal microscope, and a 3D image wasgenerated in ImageJ. At 30 mins, after the addition of gentamicin and washing, one can visualize more pmtA in close proximity (both internalized and attaching to the outside) of the THP-1 cells when compared to the WT.

[0029] Figure 7: PmtA increases survival once phagocytosed in THP-1 cells. The phagocytosis assay was performed for 60 mins. After the addition of gentamicin and washingUCONN 24-028 MBHB 25-0252-WO the cells, cells were incubated for an additional hr., then THP-1 cells were lysed, plated on TSA plates, and the survival rate was calculated. pmtA had a significantly lower percent survival when compared to PBADpmtA indicating a role for PmtA in intracellular macrophage survival. The data are presented as the average of three biological replicates (+ / - standard error of the mean) and are representative of three separate experiments One-way ANOVA analysis was performed (A &B) and unpaired T test was performed (D) (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001).

[0030] Figure 8: PmtA found in supernatant of PAO1. Western blot on supernatant from PAO1 strains using anti-pmtA, extra band found at approximately 25 KDa within WT and PBADpmtA and not in pmtA, indicating possible PmtA in supernatant. The bright band at the left of the image is an intrinsically fluorescent Odyssey® One-Color Marker 25kDa molecular weight marker.

[0031] Figure 9: PmtA on PAO1 cell surface. (A) Percentage of binding of PAO1 strains incubated with mouse IgG1 anti-PmtA with Alexa FluorTM647 labeled goat anti- mouse IgG. Binding was normalized to values for cells stained with Alexa FluorTM647 labeled goat anti-mouse IgG alone. (B) Surface binding was tested by ELISA using ImmulonTM2HB 96 well plates and PAO1 stains. Kinetic OD405 values were measured every 30s for 10m using a Spectramax® plate reader. One-way ANOVA analysis was performed (** p<0.01; *** p<.0005; **** p<0.0001).

[0032] Figure 10: Removal of intracellular PmtA from PA01 supernatant influences S. aureus growth in culture. S. aureus was grown in TSB containing ¼ supernatant fromPAO1, ¼ supernatant from PAO1 treated with 100 g / mL of Anti-PmtA for 1 hr prior toadding to media, and , ¼ supernatant from PAO1 treated with 100 g / mL of MOPC21 (thematched isotype for Anti-PmtA) 11hr prior to adding to media Error bars represent standard deviation.

[0033] Figure 11: 8-hour time point Removal of intracellular PmtA from PA01 supernatant influences S. aureus growth in culture. S. aureus was grown in TSBcontaining ¼ supernatant from PAO1, ¼ supernatant from PAO1 treated with 100 g / mL ofAnti-PmtA for 1 hr prior to adding to media, and , ¼ supernatant from PAO1 treated with100 g / mL of MOPC21 for 11hr prior to adding to media Error bars represent standarddeviation. One-way ANOVA analysis compared to ¼ supernatant from PAO1 was performed. (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001).UCONN 24-028 MBHB 25-0252-WO

[0034] Figure 12: Jurkat T cells have a small chemotaxis response to GST-PmtA.Jurkat T cells at 2x106 cells / mL were exposed to rabbit liver MT (10μM), SDF-1 (12.5nM),GST (14 M), GST-PmtA (14 M), and cell culture media for 3 hours at 37°C with 5% CO2in 96-well Boyden Chamber. Cells that passed through the 5μm pore membrane were stained and enumerated using a microscope. Error bars represent standard deviation. One-way ANOVA analysis (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001) unpublished data.

[0035] Figure 13: Anti-PmtA blocks PmtA inhibition of SDF-1 mediatedchemotaxis (RAW 264.7 Cells). GST-PmtA (14 M) was preincubated with (333 M) anti-PmtA or media for 1h at RT. RAW 264.7 cells at 2x106cells / mL were preincubated with GST or GST-PmtA or media alone (with or without preincubation) for 1h and then exposed to CCL2 and cell culture media for 3 hours at 37°C with 5% CO2in 96-well Boyden Chamber. Cells that passed through the 5μm pore membrane were stained and enumerated using a microscope. Error bars represent standard deviation. One-way ANOVA analysis (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001). Data is an average of three replicates and representative of 3 separate experiments.

[0036] Figure14: Complement killing assay. Anti-PmtA in combination with rabbit anti-IgG secondary antibody mediates killing of PAO1 WT in the presence of complement. WT P.a. cells were lysed after binding anti-PmtA IgG1 antibody when used in combination with rabbit anti-mouse-IgG antibody in the presence of guinea pig complement. Error bars represent standard deviation. One-way ANOVA analysis (*=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001). Data is an average of three replicates and representative of 3 separate experiments.

[0037] Figure 15: PBADpmtA growth curves compared to PAO1 Strains in TSB. Cultures were grown in a 24 well plate with TSB, with either 0.5% arabinose or 1%arabinose. Cultures were monitored over 15 hr at 37 C with 5 s shaking every 1 h in aSpectramax® microplate incubator / reader at OD600.

[0038] Figure 16: PBADpmtA growth curves compared to PAO1 Strains in LB. Cultures were grown in a 24 well plate with LB, 0.5% arabinose and 1% arabinose. Cultureswere monitored over 15 hr at 37 C with 5 s shaking every 1 hr in a Spectramax® microplateincubator / reader at OD600.

[0039] Figure17: PBADpmtA growth curves compared to PAO1 Strains in M9.Cultures were grown in a 24 well plate with M9 Media and monitored over 15 h at 37 C withUCONN 24-028 MBHB 25-0252-WO 5 s shaking every 1 h in a Spectramax® microplate reader at OD600. The data are presented as the average of three biological replicates.

[0040] Figure18: Visualization of Anti-PmtA binding to PAO1 cells. (A) Fixed cells stained only with FITC-labeled goat anti-mouse IgG secondary antibody visualized by fluorescence microscopy shows minimal binding, black arrows show individual bacterium. (B) Fixed cells stained with both mouse anti-PmtA and FITC-labeled goat anti- mouse IgG secondary antibody shows more binding. DETAILED DESCRIPTION

[0041] As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. “And” as used herein is interchangeably used with “or” unless expressly stated otherwise.

[0042] All embodiments of any aspect of the disclosure can be used in combination, unless the context clearly dictates otherwise.

[0043] Unless the context clearly requires otherwise, throughout the description and the claims, the words ‘comprise’, ‘comprising’, and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of “including, but not limited to”. Words using the singular or plural number also include the plural and singular number, respectively. Additionally, the words “herein,” “above,” and “below” and words of similar import, when used in this application, shall refer to this application as a whole and not to any particular portions of the application. The compositions and methods for their use can “comprise,” “consist essentially of,” or “consist of” any of the ingredients or steps disclosed throughout the specification.

[0044] The phrase "one or more," as used herein, means at least one, and thus includes individual components as well as mixtures / combinations of the listed components in any combination.

[0045] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients and / or reaction conditions are to be understood as being modified in all instances by the term "about," meaning within 10% of the indicated number (e.g., "about 10%" means 9%-11% and "about 2%" means 1.8%-2.2%).

[0046] As used herein, “optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.UCONN 24-028 MBHB 25-0252-WO

[0047] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While the specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize.

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein.

[0049] As used herein, the terms “amino acid,” “nucleotide,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein.

[0050] In a first aspect, disclosed here are methods for use in treating or limiting development of infections caused by one or more pathogens comprising or consisting of Klebsiella pneumoniae, Acinetobacter baumannii, Psuedomonas aeruginosa, and Enterobacter species, or combinations thereof, comprising administering to a subject with the infection or at risk of such infection a therapeutically effective amount of an inhibitor of bacterial metallothionein (PmtA) to treat or limit the development of the infection.

[0051] As disclosed in the examples that follow, PmtA plays a role both in protection from oxidative stress and in the host’s innate immune response, and that PmtA expression may also be important for establishing latent infections. Consequently, inhibitors of PmtA can be used to treat or limit development of infections caused by one or more pathogens comprising or consisting of Klebsiella pneumoniae, Acinetobacter baumannii, Psuedomonas aeruginosa, and Enterobacter species, which have been reported to have PmtA in their genomes (Tasleem M. et al. An In Silico Bioremediation Study to Identify Essential ResiduesUCONN 24-028 MBHB 25-0252-WO of Metallothionein Enhancing the Bioaccumulation of Heavy Metals in Pseudomonas aeruginosa. Microorganisms 11(9) (2023)).

[0052] As used herein, the term “administering” or “providing” means the actual physical introduction of a composition into or onto (as appropriate) a subject, a host, or cell. Any and all methods of introducing the composition into the subject, host or cell are contemplated according to the invention; the method is not dependent on any particular means of introduction and is not to be so construed. Means of introduction are well-known to those skilled in the art, and also are exemplified herein. “Providing” means giving, administering, selling, distributing, transferring (for profit or not), manufacturing, compounding, or dispensing.

[0053] As used herein, the term "effective amount" or “therapeutically effective amount” refers to the amount of a therapy, which is sufficient to reduce or ameliorate the severity and / or duration of a disorder or one or more symptoms thereof, inhibit or prevent the advancement of a disorder, cause regression of a disorder, inhibit or prevent the recurrence, development, onset or progression of one or more symptoms associated with a disorder, detect a disorder, or enhance or improve the prophylactic or therapeutic effect(s) of another therapy (e.g., prophylactic or therapeutic agent). An effective amount can require more than one dose.

[0054] As used herein, bacterial metallothionein means small cysteine-rich proteins that play important roles in metal homeostasis and protection against heavy metal toxicity, DNA damage, and oxidative stress and are expressed by Gram negative human pathogens.

[0055] As used herein, "treat" or "treating" means accomplishing one or more of the following in an individual that has one or more of the recited disorders: (a) reducing the severity of the disorder; (b) limiting or preventing development of symptoms characteristic of the disorder(s) being treated; (c) inhibiting worsening of symptoms characteristic of the disorder(s) being treated; (d) limiting or preventing recurrence of the disorder(s) in patients that have previously had the disorder(s); and / or (e) limiting or preventing recurrence of symptoms in patients that were previously symptomatic for the disorder(s). Any amount of such “treating” is of great benefit to a subject one of the recited disorders.

[0056] As used herein, "limit" or "limiting development of" means accomplishing one or more of the following in an individual that is at risk one or more of the recited disorders: (a) slowing progression to the disorder and / or (b) limiting or preventing development of symptoms characteristic of progression to the disorder. Any amount of such “limiting development” is of great benefit to a subject at risk of one of the recited disorders.UCONN 24-028 MBHB 25-0252-WO

[0057] Such treating or limiting development of may comprise use of the inhibitor of PmtA as the sole therapeutic, or may comprise its use to complement or augment other therapeutic interventions, as deemed appropriate by attending medical personnel.

[0058] In one embodiment, the pathogen comprises Pseudomonas aeruginosa (P. aeruginosa). As disclosed in the examples that follow, P. aeruginosa strain PAO1 (a wound isolate) overexpressing pmtA (PBAD pmtA) show that pmtA is important for pyocyanin and biofilm production, plays a role as an antioxidant in inflammation, and is essential for evasion of host phagocytosis and for subsequent bacterial survival after phagocytosis. In an embodiment, the bacterial infection is an infection by bacterial infections such as Klebsiella pneumoniae (K. pneumoniae). In an embodiment, the bacterial infection is an infection by bacterial infections such as Acinetobacter baumannii (A. baumannii). In an embodiment, the bacterial infection is an infection by bacterial infections such as Enterobacter species (E. species).

[0059] Using P. aeruginosa strain PAO1 (a wound isolate), inventors explored the role of PmtA in pathogenicity by generating a strain that overexpresses pmtA (PBADpmtA). Inventors generated this strain using the target site specific transposon Tn7 with a PBAD arabinose- inducible promoter and show that inducing pmtA increases levels of pyocyanin and biofilm compared to the wild-type strain. Inventors also demonstrated that overexpression of pmtA in vitro provides protection for cells exposed to oxidants characteristic of inflammation (e.g. H2O2 and NaOCl), indicating a role for PmtA). Finally, using differentiated THP-1 human macrophage cells, inventors found that a pmtA clean deletion mutant, pmtA, is phagocytized faster and is killed faster during co-culture than either wild-type or PBAD pmtA.

[0060] In another embodiment, the subject is immunocompromised, is hospitalized, has undergone invasive surgery, and / or is at risk of developing diabetes or cystic fibrosis; in one such embodiment, the subject has cystic fibrosis. In a further such embodiment, the subject has a cystic fibrosis-associated infection. Cystic fibrosis (CF) is a genetic disorder caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene which leads to an imbalance in chloride and water transport in cells. This further results in the production of thick, sticky mucus in organs such as the lungs. The accumulation of mucus results in infection and other complications. Treating CF associated infections involves use of antibiotics, anti-inflammatory medications, mucus-thinning agents, and bronchodilators along with therapies like physiotherapy and, for some, CTFR modulators to improve lung function and prevent complications. Subjects with CF may have symptoms or complicationsUCONN 24-028 MBHB 25-0252-WO including, but not limited to persistent, productive cough with thick, tenacious mucus, wheezing and shortness of breath, pneumonia, bronchitis, bronchiectasis, pneumothorax, foul-smelling stools, abdominal pain, bloating, gas, constipation, diarrhea, pancreatitis, malnutrition, and weight loss. Thus, in one such embodiment, the infection comprises a lung infection, and wherein the method improves lung function in the subject.

[0061] In another embodiment, the subject has diabetes. As used herein diabetes involves an inability of the body to produce enough insulin or a resistance to the effects of insulin leading to high blood sugar levels. Treating of diabetes thus involves administration of insulin, metformin, sulfonylureas, SGLT2 inhibitors, or GLP-1 agonists to the subject. Subjects with may have symptoms or complications including but not limited to frequent urination, excessive thirst, extreme hunger, weight loss, blurred vision, fatigue, numbness or tingling in hands or feet, nausea, vomiting, dry mouth, erectile dysfunction, frequent infections, foot ulcers and slow-healing wounds. Treatment of diabetic foot ulcers involves wound care, infection management, pressure relief and addressing underlying factors like blood sugar and circulation. Thus, in one such embodiment, the method promotes diabetic wound healing in the subject. In another such embodiment, the diabetic wound comprises a foot ulcer.

[0062] In another embodiment, the inhibitor of PmtA comprises an aptamer which specifically binds to PmtA. The terms “specifically” or “selectively” binding to metallothionein refer to a binding reaction that is determinative of the presence of a metallothionein in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay or other conditions, the specified inhibitors of PmtA such as antibodies or aptamers of the present invention bind to a metallothionein at least two times the background and do not substantially bind in a significant amount to proteins other than metallothioneins present in the sample. Specific binding to an antibody or aptamer under such conditions may thus involve use of an inhibitor selected from the group comprising or consisting of an antibody or aptamer that is selected for its specificity to a metallothionein.

[0063] In one embodiment, the inhibitor of PmtA comprises an anti-PmtA antibody or an antigen-binding fragment thereof. As used herein, "antibody" includes an immunoglobulin molecule immunologically reactive with PmtA or fragments thereof and includes monoclonal antibodies. Various isotypes of antibodies exist, for example IgG1, IgG2, IgG3, IgG4, and other Ig, e.g., IgM, IgA, IgE isotypes. The term also includes genetically engineered forms such as chimeric antibodies (e.g., humanized murine antibodies) and heteroconjugate antibodies (e.g., bispecific antibodies), fully humanized antibodies, and human antibodies.UCONN 24-028 MBHB 25-0252-WO As used throughout the application, the term "antibody" includes fragments with antigen- binding capability (e.g., Fab', F(ab')2, Fab, Fv and rIgG. See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL). See also, e.g., Kuby, J., Immunology, 3rdEd., W.H. Freeman & Co., New York (1998). The term also refers to recombinant single chain Fv fragments (scFv). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. Bivalent and bispecific molecules are described in, e.g., Kostelny et al. (1992) J Immunol 148:1547, Pack and Pluckthun (1992) Biochemistry 31:1579, Hollinger et al., 1993, supra, Gruber et al. (1994) J Immunol :5368, Zhu et al. (1997) Protein Sci 6:781, Hu et al. (1996) Cancer Res.56:3055, Adams et al. (1993) Cancer Res.53:4026, and McCartney, et al. (1995) Protein Eng.8:301. The antibodies may comprise heterobifunctional antibodies, for example, that might stabilize the PmtA in a particular location by way of the other arm of the antibody binding to a tissue specific determinant while the anti-PmtA arm blocks PmtA function. In one embodiment, the antibody comprises a monoclonal antibody. As disclosed in the examples that follow, nonlimiting examples of commercially available anti-bacterial metallothionein antibody include Anti-Metallothionein Antibody [1F5] (SMC-551); Anti-Metallothionein Antibody [2B5] (SMC-552); Anti-Metallothionein Antibody [8D8] (SMC-553) by StressMarq.

[0064] In one embodiment, the antibody used in the methods described herein is a humanized antibody. Humanized antibodies refer to forms of non-human (e.g. murine) antibodies that are specific chimeric immunoglobulins, immunoglobulin chains, or antigen- binding fragments thereof that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, the humanized antibody may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences but are included to further refine and optimize antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibodyUCONN 24-028 MBHB 25-0252-WO optimally also will comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Antibodies may have Fc regions modified as described in WO 99 / 58572. Other forms of humanized antibodies have one or more CDRs (one, two, three, four, five, six) which are altered with respect to the original antibody, which are also termed one or more CDRs "derived from" one or more CDRs from the original antibody. Humanized antibodies may also involve affinity maturation.

[0065] In another aspect, the anti-PmtA antibody or antigen-binding fragment comprises or consists of the following CDRs: Heavy chain CDR1: GFTFSSYA (SEQ ID NO: 1) Heavy chain CDR2: ISNGGSYT (SEQ ID NO: 2) Heavy chain CD3: SRLAFDY (SEQ ID NO: 3) Light chain CDR1: TGAVTISNY (SEQ ID NO: 4) Light chain CDR2: GTN Light chain CDR3: ALWYSNHLV (SEQ ID NO: 5) In some embodiments, the amino acid sequence of the heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 1. In one such embodiment, the amino acid sequence of the heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 2. In a further such embodiment, the amino acid sequence of the heavy chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 3. In another such embodiment, the amino acid sequence of the light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 4. In one such embodiment, the amino acid sequence of the light chain CDR2 is at least 67% or 100% identical to GTN. In a further such embodiment, the amino acid sequence of the light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 5.

[0066] In another aspect, the anti-PmtA antibody or antigen-binding fragment comprises or consists of the following CDRs: Heavy chain CDR1: GYSFTGYY (SEQ ID NO: 6) Heavy chain CDR2: INPSNGYS (SEQ ID NO: 7) Heavy chain CD3: ATFAY (SEQ ID NO: 8) Light chain CDR1: SSLSY (SEQ ID NO: 9) Light chain CDR2: DTS Light chain CDR3: QQRNSYPFT (SEQ ID NO: 10) In some embodiments, the amino acid sequence of the heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 6. In one such embodiment, the amino acid sequenceUCONN 24-028 MBHB 25-0252-WO of the heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 7. In a further such embodiment, the amino acid sequence of the heavy chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 8. In another such embodiment, the amino acid sequence of the light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 9. In one such embodiment, the amino acid sequence of the light chain CDR2 is at least 67% or 100% identical to DTS. In a further such embodiment, the amino acid sequence of the light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 10.

[0067] In another aspect, the anti-PmtA antibody or antigen-binding fragment comprises or consists of the following CDRs: Heavy chain CDR1: GFTFSSYA (SEQ ID NO: 1) Heavy chain CDR2: ISSGGSYT (SEQ ID NO: 11) Heavy chain CD3: ARLAMDY (SEQ ID NO: 12) Light chain CDR1: TGAVTISNY (SEQ ID NO: 13) Light chain CDR2: GTN Light chain CDR3: ALWYSNHLV (SEQ ID NO: 14) In some embodiments, the amino acid sequence of the heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 1. In one such embodiment, the amino acid sequence of the heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 11. In a further such embodiment, the amino acid sequence of the heavy chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 11. In another such embodiment, the amino acid sequence of the light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 12. In one such embodiment, the amino acid sequence of the light chain CDR2 is at least 67% or 100% identical to GTN. In a further such embodiment, the amino acid sequence of the light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 14.

[0068] In one embodiment, the antibody or antigen-binding fragment thereof may be conjugated to a cross-linking moiety, wherein the cross-linking moiety is selected from the group comprising or consisting of (a) homobifunctional cross-linking agents (b) heterobifunctional cross-linking agents or (c) photoactivatable crosslinkers. Covalent binding can be achieved either by direct condensation of existing side chains or by the incorporation of external bridging molecules. Many bivalent or polyvalent linking agents are useful in coupling protein molecules, such as the antibodies, to other molecules. In some embodiments, the cross-linking moiety is an amine-reactive cross-linking moiety (crosslinks amines to amines). In exemplary embodiment, the amine-reactive cross-linking moiety may be selected from BS3 (Bis[sulfosuccinimidyl] suberate), DSP (Disuccinimidyl Suberate), DSSUCONN 24-028 MBHB 25-0252-WO (Disuccinimidyl Succinate), EGS (Ethylene Glycol Bis(Succinimidyl Succinate)), BS2G (Bis[Sulfosuccinimidyl] glutarate), DSG (Disuccinimidyl glutarate). In some embodiments, the cross-linking moiety is a sulfhydryl-reactive cross-linking moiety. In exemplary embodiment, the sulfhydryl-reactive cross-linking moiety may be selected from 1,2- Ethanediyl Bismethanethiosulfonate, DTSSP (Disuccinimidyl Thiosubinate), SMCC (Succinimidyl 4-(N-Maleimidomethyl)cyclohexane-1-carboxylate), Sulfo-SMCC (Sulfo- Succinimidyl 4-(N-Maleimidomethyl)cyclohexane-1-carboxylate), Sulfo-SANPAH (Sulfosuccinimidyl 6-(4'-Azido-2'-Nitrophenylamino)hexanoate), MBS (m- Maleimidobenzoyl-N-hydroxysuccinimide ester), SPDP (Succinimidyl 3-(2- Pyridyldithio)propionate), LC-SPDP (Long Chain SPDP), Sulfo-MBS (Sulfo-m- Maleimidobenzoyl-N-hydroxysuccinimide ester), Sulfo-LC-SPDP (Sulfo-Long Chain SPDP), SIA (Succinimidyl 6-Maleimidohexanoate), Sulfo-SIA (Sulfo-Succinimidyl 6- Maleimidohexanoate), SBA (Succinimidyl 4-Maleimidobutyrate), SMPB (Succinyl 4-(p-Maleimidophenyl)butyrate), EMCS (N-( -Maleimidocaproyloxy)succinimide ester), GMBS(N- -Maleimidobutyryloxysuccinimide ester), and ANB-NOS (5-Azido-2-nitrobenzoic acidN-hydroxysuccinimide ester).

[0069] In another embodiment, the antibody or antigen binding fragment thereof is conjugated to a therapeutic, wherein the therapeutic is selected from the group comprising or consisting of small molecules including but not limited to an anti-PmtA small molecule or a pharmaceutically acceptable salt, enantiomer, stereoisomer, solvate, polymorph or prodrug thereof which specifically binds to PmtA, antibiotics, phage and colicin. In one non-limiting embodiment, the therapeutic comprises an antibiotic such as obiltoxaximab, raxibacumab, bezlotoxumab, actozumab, edobacumab, nebacumab, colistin, aurograb, or any combinations thereof.

[0070] In one embodiment, the subject is mammal, including but not limited to a human, cat, dog, cattle or pig subject. In another embodiment, the subject is a bird. P. aeruginosa is a significant pathogen in poultry, causing infections like septicemia, respiratory issues, and high mortality, especially in young birds, and can lead to economic losses in the poultry industry. While birds of all ages are susceptible, young chickens are particularly vulnerable.

[0071] As used herein “bird” means any domesticated birds kept for eggs or meat, including but not limited to chickens, turkeys, duck, geese.

[0072] In another embodiment, compositions are provided comprising: (a) a peptide comprising or consisting of 3-12 contiguous amino acids selected from residues 35 to 46 ofUCONN 24-028 MBHB 25-0252-WO PmtA or the entire PmtA peptide; and (b) a moiety conjugated to the peptide, selected from the group comprising or consisting of a carrier and cross-linking moiety.

[0073] As shown in the examples that follow, inventors have identified antigenic epitopes in the PmtA sequence - mnsetcacpk ctcqpgadav erdgqhycca acagghpqge pcrdadcpcg gttrpqvaed rqlddalket fpasdpisp (SEQ ID NO: 15). The epitope includes residues 35 to 58 ghpqge pcrdadcpcg gttrpqva (SEQ ID NO: 16) or specifically residues 35 to 46 - ghpqge pcrdad (SEQ ID NO: 17). Compositions provided herein are used in treating or limiting development of an infection caused by one or more pathogens selected from the group comprising or consisting of Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species.

[0074] In a further embodiment, the peptide comprising or consisting SEQ ID NO 15 or SEQ ID NO 17 is conjugated to cross-linking moiety, wherein the cross-linking moiety is selected from the group comprising or consisting of (a) homobifunctional cross-linking agents (b) heterobifunctional cross-linking agents or (c) photoactivatable crosslinkers. Covalent binding can be achieved either by direct condensation of existing side chains or by the incorporation of external bridging molecules. In exemplary embodiment, the amine- reactive cross-linking moiety may be selected from BS3 (Bis[sulfosuccinimidyl] suberate), DSP (Disuccinimidyl Suberate), DSS (Disuccinimidyl Succinate), EGS (Ethylene Glycol Bis(Succinimidyl Succinate)), BS2G (Bis[Sulfosuccinimidyl] glutarate), DSG (Disuccinimidyl glutarate). In some embodiments, the cross-linking moiety is a sulfhydryl- reactive cross-linking moiety. In exemplary embodiment, the sulfhydryl-reactive cross- linking moiety may be selected from 1,2-Ethanediyl Bismethanethiosulfonate, DTSSP (Disuccinimidyl Thiosubinate), SMCC (Succinimidyl 4-(N-Maleimidomethyl)cyclohexane- 1-carboxylate), Sulfo-SMCC (Sulfo-Succinimidyl 4-(N-Maleimidomethyl)cyclohexane-1- carboxylate), Sulfo-SANPAH (Sulfosuccinimidyl 6-(4'-Azido-2'- Nitrophenylamino)hexanoate), MBS (m-Maleimidobenzoyl-N-hydroxysuccinimide ester), SPDP (Succinimidyl 3-(2-Pyridyldithio)propionate), LC-SPDP (Long Chain SPDP), Sulfo- MBS (Sulfo-m-Maleimidobenzoyl-N-hydroxysuccinimide ester), Sulfo-LC-SPDP (Sulfo- Long Chain SPDP), SIA (Succinimidyl 6-Maleimidohexanoate), Sulfo-SIA (Sulfo- Succinimidyl 6-Maleimidohexanoate), SBA (Succinimidyl 4-Maleimidobutyrate), SMPB(Succinyl 4-(p-Maleimidophenyl)butyrate), EMCS (N-( -Maleimidocaproyloxy)succinimideester), GMBS (N- -Maleimidobutyryloxysuccinimide ester), and ANB-NOS (5-Azido-2-nitrobenzoic acid N-hydroxysuccinimide ester). The peptide comprising or consisting of SEQ ID NO 15 or SEQ ID NO 17 conjugated to the cross-linking moiety can be further conjugatedUCONN 24-028 MBHB 25-0252-WO to a carrier protein to enhance immunogenicity and in vivo induction of anti-PmtA antibodies.

[0075] In another such embodiment, the peptide comprising or consisting SEQ ID NO 15 or SEQ ID NO 17 is conjugated to a carrier, wherein the carrier is selected from the groupcomprising or consisting of keyhole limpet hemocyanin (KLH), serum albumins,immunoglobulin molecules, ovalbumin, tetanus toxoid (TT), diphtheria toxoid (DT), meningococcal outer membrane protein complex (OMPC), H. influenza protein (HiD), and flagellin. In this embodiment, the peptide conjugated to the carrier would be used for a pharmaceutical composition comprising a therapeutic vaccine for use in helping generate anti- PmtA antibodies in a subject in need thereof.

[0076] As used herein, “carrier” means a diluent, excipient, or vehicle with which an active compound is administered.

[0077] As used herein, “pharmaceutical compositions” means compositions comprising at least one active agent and at least one other substance, such as a carrier. Pharmaceutical compositions meet the U.S. FDA’s GMP (good manufacturing practice) standards for human or non-human drugs.

[0078] As used herein, a “pharmaceutically acceptable carrier” means a substance, e.g., excipient, diluent, or vehicle, that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes a carrier that is acceptable for veterinary use as well as human pharmaceutical use. A “pharmaceutically acceptable carrier” includes both one and more than one such carrier.

[0079] In another embodiment, the disclosure provides methods to limit development ofan infection caused by one or more pathogens selected from the group comprising or consistingof Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species comprising administering to a subject at risk of such infection a therapeutically effective amount of the composition of the peptide comprising 3-12 contiguous amino acids from residues 35 to 46 of PmtA or the entire PmtA peptide conjugated to a cross- linking moiety or a carrier to limit development of the infection. In a further such embodiment, the pathogen comprises P. aeruginosa. In another such embodiment, the subject is immunocompromised, is hospitalized, has undergone invasive surgery, and / or is at risk of developing diabetes or cystic fibrosis.

[0080] Risk factors for diabetes include, but are not limited to, obesity, smoking, a sedentary lifestyle, a parent or sibling with type 2 diabetes, pre-diabetes, a parent or sibling with pre-diabetes, poor eating habits (ex: too much fat, not enough fiber, too many simpleUCONN 24-028 MBHB 25-0252-WO carbohydrates, etc.), age 50 or older, high blood pressure, high cholesterol, testosterone deficiency, metallothionein 1 A (MT1A) rs8052394 locus (G alteration) single nucleotide polymorphism, and a history of gestational diabetes.

[0081] In one such embodiment, the subject has a diabetic wound and the wound comprises a foot ulcer and the method limits development of the infection. As shown in the examples that follow, there is a role for PmtA as a potential antioxidant for P. aeruginosa under exogenous oxidative stress and importance in enhancing bacterial survival when encountering the host immune response. In a recently published study comparing genes expressed in log-phage cultures to genes expressed during the colonization of a skin wound, pmtA (Locus tag: PA2140) was shown to be up-regulated between 5- and 9-days post colonization, indicating a role for pmtA in progression of disease. PmtA has also been shown to be important for both burns and chronic surgical wound infections. These skin infections / damage elicit an immediate and severe innate immune response, including infiltration of immune cells like macrophages and neutrophils that produce oxygen free radicals to destroy pathogens. The survival of pathogens under oxidative stress depends on the ability to detoxify ROS environment.

[0082] In one embodiment, the subject has cystic fibrosis. In another embodiment of the foregoing, the subject is a mammal including but not limited to humans, cats, dogs, cattle and pigs. In another embodiment the subject is a bird.

[0083] In one embodiment, the methods to limit development of an infection caused by Pseudomonas aeruginosa, which is a highly problematic multidrug-resistant (MDR) pathogen with complex virulence networks. MDR P. aeruginosa strains have been associated with increased clinical visits, very poor healthcare outcomes, and P. aeruginosa infections are ranked as critical on priority lists of both the Centers for Disease Control and Prevention and the World Health Organization. Known P. aeruginosa virulence factors have been extensively studied and are implicated in counteracting host defenses, causing direct damage to the host tissues, and increased microbial competitiveness. Targeting virulence factors has emerged as a new line of defense in the battle against MDR P. aeruginosa strains. Bacterial metallothionein is a newly recognized virulence factor disclosed herein that enables evasion of the host immune response. As described herein inventors have identified mechanisms in which PmtA plays a part in P. aeruginosa pathogenicity and demonstrated that PmtA is a therapeutic target.

[0084] P. aeruginosa expresses a small molecular weight (about 9 kDa), cysteine-rich protein (PmtA) identified as a member of the stress response family of metallothionein (MT)UCONN 24-028 MBHB 25-0252-WO proteins. Recent bioinformatics analysis of the Pseudomonas genome database genomes has shown that bacterial MTs are highly conserved in 90% of Pseudomonas species and can be found in at least three other human pathogens; Acinetobacter baumannii, Mycobacterium tuberculosis, and Enterobacter cloacae; all of which are multidrug-resistant and share infection sites such as lungs, blood, urinary tract, and skin. As disclosed herein, the inventors have shown that Pseudomonas aeruginosa metallothionein (PmtA) plays a role in the expression of pyocyanin and in the formation of biofilms in P. aeruginosa. Finally, inventorshave found that a clean deletion mutant ( pmtA) displays increased susceptibility to theantibiotics that are currently used to treat P. aeruginosa infection.

[0085] In an aspect, disclosed is a use of a system / agent / composition including an anti- bacterial metallothionein antibody such as anti-PmtA antibodies or a pharmaceutically acceptable salt thereof for treating, ameliorating, or reducing bacterial infections. In an embodiment, the antibody interferes with the immunomodulatory roles of PmtA that is produced and released during infection.

[0086] In an embodiment, the anti-bacterial metallothionein antibody is a mouse anti- pseudomonas aeruginosa metallothionein monoclonal IgG1 antibody. In an embodiment, the anti-bacterial metallothionein antibody is a commercially available mouse anti-pseudomonas aeruginosa metallothionein monoclonal IgG1 antibody. In an embodiment, the anti-bacterial metallothionein antibody is Anti-Metallothionein Antibody [1F5] (SMC-551) by StressMarq. In an embodiment, the anti-bacterial metallothionein antibody is Anti-Metallothionein Antibody [2B5] (SMC-552) by StressMarq. In an embodiment, the anti-bacterial metallothionein antibody is Anti-Metallothionein Antibody [8D8] (SMC-553) by StressMarq. In an embodiment, the anti-bacterial metallothionein antibody is a commercially available anti-bacterial metallothionein antibody, synthetic anti-bacterial metallothionein antibody, or a combination thereof. Any suitable anti-bacterial metallothionein antibody can be used for this invention.

[0087] Inventors have shown that PmtA can influence the progression of inflammatory chemotaxis using a measure of chemotaxis in vitro, and that this PmtA influence can be suppressed by an anti-PmtA antibody. The antibody can thus be used in vivo, thereby preventing deleterious effects of PmtA in advancing the P. aeruginosa, K. pneumoniae, A. baumannii, and E. species infections. There are several other human pathogens known to make bacterial metallothioneins, and it is expected that the same use of anti-PmtA antibody will be valuable as a treatment during infection with these other pathogens. In anUCONN 24-028 MBHB 25-0252-WO embodiment, the antibody is a humanized antibody to the PmtA protein. In an embodiment, the antibody can be used diagnostically to identify instances where extracellular PmtA is present and / or it can be used therapeutically during P. aeruginosa, K. pneumoniae, A. baumannii, and E. species infections.

[0088] Inventors surprisingly discovered a novel therapeutic opportunity wherein a PmtA is acting as a virulence factor. The use of antibody against PmtA as a therapeutic for bacterial infection represents a novel therapeutic approach that can be used alone (a monotherapy) or may complement other therapeutic approaches when used in a combination therapy. Conventional treatments of bacterial infections such as P. aeruginosa infection do not address the various virulence factors that can interfere with the host response.

[0089] In an embodiment, the monoclonal antibody only targets the extracellular PmtA for treating an infection. Using crispr / Cas approaches would enable to target the critical role(s) played by PmtA inside the bacteria to interfere with other virulence factors as well.

[0090] In an aspect, disclosed is a composition including a therapeutically effective amount of an anti-bacterial metallothionein antibody such as anti-PmtA antibodies or a pharmaceutically acceptable salt thereof for treating, ameliorating, or reducing bacterial infections. In an embodiment, the anti-bacterial metallothionein antibody is a commercially available mouse anti-pseudomonas aeruginosa metallothionein monoclonal IgG1 antibody. The nonlimiting examples of commercially available anti-bacterial metallothionein antibody include Anti-Metallothionein Antibody [1F5] (SMC-551); Anti-Metallothionein Antibody [2B5] (SMC-552); Anti-Metallothionein Antibody [8D8] (SMC-553) by StressMarq. In an embodiment, the anti-bacterial metallothionein antibody is Anti- Metallothionein Antibody [1F5] (SMC-551) by StressMarq. In an embodiment, the anti- bacterial metallothionein antibody is Anti-Metallothionein Antibody [2B5] (SMC-552) by StressMarq. In an embodiment, the anti-bacterial metallothionein antibody is Anti- Metallothionein Antibody [8D8] (SMC-553) by StressMarq. In an embodiment, the anti- bacterial metallothionein antibody is a commercially available anti-bacterial metallothionein antibody, synthetic anti-bacterial metallothionein antibody, or a combination thereof. Any suitable anti-bacterial metallothionein antibody can be used for this composition. In an embodiment, the composition further includes a carrier such as a diluent, excipient, vehicle, or a combination thereof. In an embodiment, the composition is effective in treating or ameliorating the disease, disorder associated with bacterial infections, or at least one symptom of the disease or disorder associated with bacterial infections. In an embodiment, the bacterial infection is an infection by ESKAPE pathogens. In an embodiment, the bacterialUCONN 24-028 MBHB 25-0252-WO infection is an infection by bacterial infections such as Pseudomonas aeruginosa. In an embodiment, the bacterial infection is an infection by bacterial infections such as Klebsiella pneumoniae. In an embodiment, the bacterial infection is an infection by bacterial infections such as Acinetobacter baumannii. In an embodiment, the bacterial infection is an infection by bacterial infections such as Enterobacter species.

[0091] In an aspect, disclosed is a method for treating, ameliorating, or reducing bacterial infections in a subject, the method includes providing the system / agent / composition including a therapeutically effective amount of an anti-bacterial metallothionein antibody or a pharmaceutically acceptable salt thereof as described herein to the subject who is in need of such treatment. In an embodiment, the anti-bacterial metallothionein antibody is a commercially available mouse anti-pseudomonas aeruginosa metallothionein monoclonal IgG1 antibody. The nonlimiting examples of commercially available anti-bacterial metallothionein antibody include Anti-Metallothionein Antibody [1F5] (SMC-551); Anti- Metallothionein Antibody [2B5] (SMC-552); Anti-Metallothionein Antibody [8D8] (SMC- 553) by StressMarq. In an embodiment, the anti-bacterial metallothionein antibody is Anti- Metallothionein Antibody [1F5] (SMC-551) by StressMarq. In an embodiment, the anti- bacterial metallothionein antibody is Anti-Metallothionein Antibody [2B5] (SMC-552) by StressMarq. In an embodiment, the anti-bacterial metallothionein antibody is Anti- Metallothionein Antibody [8D8] (SMC-553) by StressMarq. In an embodiment, the anti- bacterial metallothionein antibody is a commercially available anti-bacterial metallothionein antibody, synthetic anti-bacterial metallothionein antibody, or a combination thereof. Any suitable anti-bacterial metallothionein antibody can be used for this method. In an embodiment, the bacterial infection is an infection by ESKAPE pathogens. In an embodiment, the bacterial infection is an infection by bacterial infections such as Pseudomonas aeruginosa. In an embodiment, the bacterial infection is an infection by bacterial infections such as Klebsiella pneumoniae. In an embodiment, the bacterial infection is an infection by bacterial infections such as Acinetobacter baumannii. In an embodiment, the bacterial infection is an infection by bacterial infections such as Enterobacter species. In an embodiment, the method is used as a standalone therapy or as a part of combination therapy along with other suitable methods. In an embodiment, the subject is a mammal. In an embodiment, the mammal is human.UCONN 24-028 MBHB 25-0252-WO

[0092] EXAMPLES

[0093] PmtA provides protection against phagocytic attack and enhances bacterial survival in human monocytes (THP-1 cells).

[0094] PmtA plays a role in oxidative stress protection and innate virulence and has effects on in vitro measures of phagocytosis and subsequent survival within human macrophages (Figures 8 and 9). These experiments were performed as follows: THP-1 cells were differentiated to a macrophage-like phenotype with phorbol-12-myristate-13-acetate (PMA) and cultured for 3 days prior to infection. A multiplicity of infection (MOI) of 10 was used to infect THP-1 cells (THP-1 is a human leukemia monocytic cell line) with pmtA, PBAD pmtA (an over-expression strain) or wildtype (WT) PAO1 strains. The PAO1 strains were all grown in M9 media overnight prior to infection and washed with PBS before being added to infection media. For phagocytosis assays, the THP-1 cells were incubated for 30 or 60 mins after infection; gentamicin was added after coincubation of bacteria to eliminate remaining extracellular bacteria and then THP-1 cells were then washed with PBS and lysed using Triton X-100 in PBS to recover viable intracellular bacteria. Lysates were plated ontoTBA plates, incubated overnight at 37 C and colonies of bacteria (CFU) were counted nextday. At 30 and 60 mins of infection, more pmtA were phagocytosed than both wild type and PBAD pmtA (Figure 4). These results indicate a role for PmtA in evasion of phagocytosis. Inventors also evaluated the role of PmtA in intracellular survival after phagocytosis. To do this, the above experiment was repeated with the following modification: at 60 mins post infection co-infections were treated with gentamicin and continued incubation another 60 mins before lysis of the THP-1 cells. The percentage survival was then calculated from starting CFU at 60 mins and ending CFU at 2 hrs. It was found that more pmtA were phagocytosed, and fewer survived in the cells after phagocytosis, indicating a role for PmtA in intracellular bacterial persistence that could relate to prolonged infection in vivo (Figure 7).

[0095] PmtA Found in supernatant of PAO1.

[0096] Using anti-PmtA mAb and PBADpmtA, PmtA was identified in cell culture supernatant. Concentrated supernatant from PAO1 grown for 24 hours and from and isogenic strains were run out on an SDS-page gel and a western blot using the Li-COR® system was performed (Figure 8). There is an extra band in the PBAD pmtA lane that is not present in the pmtA, and the same band is found faintly in WT. The band is larger than the size calculatedUCONN 24-028 MBHB 25-0252-WO from PmtA sequence data (9kD), but this band and others that appear in this blot could result from oligomerization or by forming multimers with other molecules in the supernatant.

[0097] Anti-PmtA binds to PAO1 Surface: To identify pathogens for phagocytosis, macrophages use pattern recognition receptors (PRR) to bind microbial-associated molecular patterns (MAMPs). Since more phagocytosis and close association of pmtA bacterial cells to THP-1 macrophages was observed, inventors next examined if PmtA can be found on the surface of WT PAO1. Using a commercially available anti-PmtA monoclonal antibody and FITC labeled goat anti-mouse IgG secondary antibody, binding of anti-PmtA to PAO1 WT strain was evaluated using fluorescence microscopy (Figure 18). It was observed that PAO1 cells first incubated with monoclonal mouse IgG1 anti-PmtA followed by a secondary FITC- labeled goat anti-mouse IgG antibody, stained the bacterial cells at a higher level than PAO1 cells exposed to the secondary antibody alone (Figure 18). This binding was quantified using both flow cytometry and ELISA (Figure 9). Anti-PmtA was incubated with each of the three isogenic strains and then binding was detected with Alexa FluorTM647 (Generic name: Alexa Fluor 647) labeled goat anti-mouse IgG. Flow cytometry revealed that monoclonal anti-PmtA antibody binds to PmtA that is available on the surface of WT PAO1 and other pmtA- expressing PAO1 strains (Figure 9A) while having significantly lower binding to pmtA. Surface binding of the anti-PmtA mAb can also be detected by ELISA using whole bacteria from PAO1 strains that have been immobilized on the ELISA microwell surface (Figure 9B). Significantly more binding of anti-PmtA on PAO1 was observed expressing strains then on pmtA. While monoclonal antibodies are designed to be specific, binding of antibodies to intact, live bacteria has been shown to occur at a lower level owing to nonspecific interactions of antibodies with components of the cell wall, extracellular polysaccharides, and / or extracellular DNA.

[0098] Removing PmtA from PAO1 supernatant can influence S. aureus growth

[0099] PAO1 and S. aureus were grown overnight in TSB. Overnight cultures of thePAO1 strains were spun down, supernatant was removed, and filter sterilized. 100 g / mL ofanti-PmtA or an isotype matched negative control antibody (MOPC21), was then added to the supernatant and incubated for 1 hr at room temperature. The supernatant was then added to TSB at a 1:3 ratio and then 1:1000 dilution of an overnight culture of S. aureus was added. Starting at 5 hrs, it was observed that S. aureus had a growth advantage when grown in thepresences of PAO1 supernatant with 100 g / mL of Anti-PmtA when compared to growth inthe presence of PAO1 supernatant only and / or with the matched isotype MOPC21 (FigureUCONN 24-028 MBHB 25-0252-WO 10). At 8 hrs this advantage continues and is significantly different (Figure 11). These data suggest that removing PmtA from the PAO1 supernatant can have an influence the growth of S. aureus suggesting that P. aeruginosa PmtA can influence other bacteria found in a polymicrobial environments.

[0100] Exogenous PmtA influences cytokine mediated migration, while anti-PmtA blocks these effects in vitro

[0101] The similarities between mammalian MT and PmtA are described in Table 1. As shown in Table 1, MTs and PmtA contain a significant number of free thiols in their cysteine residues. Inventors have found that mammalian MT can alter immune cell behaviors like chemotaxis and proliferation and influence, for example, the SDF-1a / CXCR4 mediated chemotactic response. This is relevant to P. aeruginosa infections since CXCR4 is a regulator of neutrophil trafficking during bacterial infection. Interestingly, PmtA's cysteine residuesalign with cysteine motifs of several cytokines, including SDF-1 , CCL2, and IL-8. Thesecytokines have been shown to be essential in the host response to P. aeruginosa infection. Table 1: PmtA comparison with other MTs

[0102] Purified GST-PmtA was used to examine the effects of extracellular PmtA on chemotaxis by human Jurkat T cells. Using the Boyden assay, a widely used measure of chemotaxis across a porous membrane, it was found that Jurkat T cells respond modestly (but significantly) to a GST-PmtA gradient when compared to media or GST alone (Figure 12), but required higher concentrations than those required to produce movement by eukaryotic MT. It is possible that the GST-tag interfered with this result, diminishing the effect native PmtA structure could elicit, or that other responses by other inflammatory cells (neutrophils, for example) might be more robust. Inventors also evaluated the effect of pre-incubating Jurkat T cells with GST-PmtA followed by washing before the Jurkat T cells were exposed toa gradient the chemoattractant SDF-1 (also known as CXCL12). Movement was assessedUCONN 24-028 MBHB 25-0252-WO with both the Boyden chamber assay (Figure 12) and using an ECIS / taxis assay. In each of these assays, Jurkat T cells that had been pre-exposed to PmtA were significantly lessresponsive to an SDF-1 gradient than those preincubated in vehicle alone. Incubation withGST-PmtA or GST did not affect the viability of Jurkat T cells.

[0103] During thermal injury, macrophages are involved in the release of inflammatory cytokines, antigen presentation, and phagocytosis immediately upon injury and can last approximately 5-7 days P. aeruginosa induces many cytokines and chemokines within burnsincluding, MIP-3 , MIP-1 , TNF- , IL-1 , IL-1 , IL-8, IL-6, IFN- , IL-11, IL-3, IL-13, andIL-10. After initial thermal injury, monocytes influx into the wound and differentiate into macrophages acting as a central host response in burns and to early evaders, like P. aeruginosa. To investigate whether the inhibition of chemotaxis by PmtA was unique to Jurkat T cells, chemotaxis studies were also done with RAW 264.7 cells, a macrophage cell line derived from an Abelson murine leukemia virus-induced tumor. CCL2 is a known chemoattractant for macrophages and was used as the chemoattractant in these experiments (Figure 13). RAW 264.7 cells were preincubated with GST-PmtA, GST, or cell culture media for one hour, and the chemotactic response towards CCL2 was measured using the Boyden chamber assay. Preincubation with GST-PmtA led to a significant reduction in RAW 264.7 cells' chemotactic response toward CCL2 (Figure 13). It was also shown that anti- PmtA incubated with GST-PmtA for 1 hr prior to exposing them to CLL2 reverses the cell migration phenotype. This indicates that anti-PmtA can reduce the effects of PmtA, further supporting the potential of PmtA antagonists as a therapeutic intervention.

[0104] Characterization of overexpression of pmtA in PAO1

[0105] Overexpression of a wildtype gene can be a powerful tool to identify mutant phenotypes that may be missed by observing phenotypes associated with a clean deletion. Inventors constructed a pmtA overexpressing mutant (PBADpmtA) using a broad-host range Tn7 transposon with a PBADarabinose-inducible promoter, pTJ19 (Figures 1 A-B). No growth changes were observed when PBADpmtA was grown in either TSB or M9 media when compared to the wildtype strain (Figures 15-16). Using qPCR, inventors tested promotor activation in PBADpmtA grown in 1 % arabinose in M9, LB, TSB or infection media and found that in the presence of arabinose PBADpmtA resulted in a 15 to 30-fold increase in pmtA expression when compared to wildtype (Figures 1 C-F). Since inventors have previously shown that the deletion of pmtA in PAO1 results in diminished pyocyanin production and biofilm formation, they investigated these same phenotypes in PBADpmtA (Figures 2 A-C).UCONN 24-028 MBHB 25-0252-WO Inducing overexpression of PmtA in TSB with either 0.5 or 1% arabinose leads to more pyocyanin production (Figure 2A) and greater biofilm formation (Figure 2 B and C) when compared to similarly treated WT (PAO1). Interestingly, the overproduction of pyocyanin in PBADpmtA does not lead to a decrease in the growth rate when compared to WT as has been seen in other studies where pyocyanin was induced, suggesting that PmtA can provide endogenous protection from pyocyanin-induced oxidative stress.

[0106] Overexpression of PmtA confers resistance to oxidative stress.

[0107] A variety of reactive oxygen species (ROS) are produced by the host immune system as a defense mechanism against invading pathogens. The damage to cells by the oxidation of proteins, lipids or nucleic acids can be extensive, causing metabolic processes disruptions, membrane destabilization and other effects. P. aeruginosa employs several mechanisms to respond to ROS stress. Given its intrinsic thiol content, PmtA may contribute to antioxidant mechanisms that protect against immune-derived oxidants. Inventors examined the effects of PmtA on the cellular response to ROS exposure by first growing cultures in a minimal media (M9) with arabinose as the sole carbon source. Using this media, inventors observed that pyocyanin is not secreted at detectable levels when pmtA is overexpressed (Figure 3 A and B). Cultures were grown in M9 media, and 108cells were exposed to 40 μM H202 or 0.3% NaOCl for 90 mins and percent survival was calculated (Figure 3 C and D). When PBADpmtA to the other PAO1 strains was compared, overexpression of pmtA resulted in a higher percent survival when exposed to these two different oxidizing agents, indicating a role for PmtA in relieving oxidative stress. Thedeletion mutant ( pmtA) was not significantly different from WT in oxidant sensitivity,indicating that when PmtA is not present P. aeruginosa uses other mechanisms to address oxidative stress.

[0108] PmtA provides protection from phagocytosis.

[0109] Since inventors have demonstrated that PmtA plays a role in the management of oxidative stress and in a model of innate virulence, the effect of PmtA on phagocytosis in co- culture with a human macrophage cell line (THP-1, ATCC TIB-202TM) was explored. For these experiments, THP-1 cells that had been treated to differentiate to an adherent macrophage-like cell were seeded and cultured for 3 days prior to infection and cultures were then infected with pmtA, PBAD pmtA, or wild type PAO1 strains at an MOI of 10. Live, intracellular bacteria in these infected cultures were determined by plating and counting CFU / mL obtained from cultures that had been antibiotic treated and washed. At both timeUCONN 24-028 MBHB 25-0252-WO points of infection (30 and 60 mins), significantly more live intracellular pmtA were observed when compared to both wild type and PBAD pmtA PAO1 strains (Figure 4A & B). Significantly lower amounts of live intracellular PBAD pmtA was observed when compared to both pmtA and wildtype PAO1 strains at these time points (Figure 4A & B). This data indicates that the loss of pmtA expression results in increased phagocytosis while overexpressing pmtA reduces the frequency of phagocytic engulfment. Table 2: Bacterial strains and plasmids used in the present studyUCONN 24-028 MBHB 25-0252-WO

[0110] Visualization of PmtA Phagocytosis protection

[0111] Inventors visualized phagocytosis of P. aeruginosa by tagging each of the PAO1 strains with fluorescent markers encoded on Tn7 with a PBAD arabinose-inducible promoter controlling ORFs encoding the fluorescent proteins dTomato or sfGFP associated with constitutively active PTac promoters (Table 2). The dTomato fluorescent marker Tn7s was conjugated into P. aeruginosa pmtA and wildtype PAO1 strains as described herein and verified with PCR. It was also verified that the pmtA mutation was still present in pmtA:dtomato after selection of the fluorescent marker transformants. PBAD pmtA was labeled with sfgfp fluorescent protein using the same approach. The phagocytosis assay was performed using tagged pmtA:dtomato, PBADpmtA:sfgfp, and WTPAO1:dtomato strains, taking fluorescent images at time 0, 30 min, and 60 mins (Figure 5). At time 0, the extracellular bacteria are visible. Gentamicin was added to coincubations of bacteria and THP-1 at 30 and 60 mins, after which the cultures were washed and imaged. Most of the extracellular bacteria were removed by this treatment except for a few that remained attached to the glass bottom of the dish. More pmtA bacterial cells were closely associated with THP- 1 cells when compared to wild type and PBADpmtA PAO1 strains, indicating a role of pmtA in attachment and phagocytosis.

[0112] The phagocytosis assay was repeated at the 30-minute timepoint and visualized the cultures using confocal microscopy, capturing images across the focal planes that span the THP-1 cell volume (Figure 6). At 30 mins, more pmtA bacterial cells were observed both inside the THP-1 cells and at the surface when compared to the wildtype strain.

[0113] PmtA increases survival within macrophages.

[0114] Also evaluated was the role of PmtA as a contributor to intracellular survival after phagocytosis. To do this, the phagocytosis assay was repeated as described herein, but at 60 mins post infection gentamicin was treated with and continued the THP-1 / P. aeruginosa co- incubation for another 60 mins (Figure 7). The THP-1 cells were then lysed and the lysate plated on TSA. The percent survival was calculated by comparing CFU numbers at 60 minsUCONN 24-028 MBHB 25-0252-WO and ending CFU numbers at 2 hrs. Significantly fewer intracellular pmtA bacterial cells were recovered after this 2-hour incubation when compared to similarly treated PBAD pmtA and wild type P. aeruginosa. This data indicates a role for PmtA in intracellular bacterial persistence that could relate to prolonged or chronic infection in vivo.

[0115] Anti-PmtA monoclonal antibody dependent, complement mediated killing of Pseudomonas aeruginosa in vitro: Finally, antibody dependent, complement-mediated killing of P.a. in vitro (Figure 14) was evaluated. P.a. was initially incubated with one of the monoclonal anti-PmtA antibodies, then washed and incubated with a secondary, anti-mouse IgG antibody in the presence of guinea pig serum used as a source of complement. The secondary antibody is necessary since mouse IgG1 is not itself capable of activating complement. Neither complement alone, nor complement in the presence of the secondary (2o) anti-IgG were able to kill significant number of bacteria (as measured by plating colonies from the treated cells in comparison to PBS-treated cells) while the presence of anti-PmtA, anti-IgG secondary antibody and complement together resulted in a significant reduction in CFU.

[0116] Discussion

[0117] This study shows that PmtA enhances bacterial survival under stressful conditions that mimic the innate immune response. ROS plays a central role in the innate immune response against pathogens and the ability to overcome these defenses can play a key role in infection. The over-expression of pmtA in P. aeruginosa data indicates a role for this novel protein in protection from oxidative stress and could be relevant to virulence factors, pyocyanin, and / or its role in generating oxidative stresses for the host immune cells. Pyocyanin is known to act as a virulence factor by generating superoxide and H2O2by reducing oxygen, causing damage to the host and to nearby bacteria. This redox stress in turn induces biofilm formation and de novo expression of antioxidant enzymes by the infectious bacteria and subsequently blocks bacterial uptake of pyocyanin. PmtA serving as an antioxidant agent could allow for more pyocyanin production without affecting growth. Inventors’ past study also links PmtA to oxidative stress since inventors were able to restore the pyocyanin and biofilm defect with the addition of the antioxidant glutathione, showing further support for PmtA playing a role in oxidative stress (Thees, A. V et al., Front. Microbiol.12, 3422 (2021)). Notably, P. aeruginosa has an arsenal of mechanisms to respond to and manage oxidative damage, and PmtA could also moderate oxidative stress by potentially interacting with other well-known redox management systems such as catalase, peroxidase, and superoxide dismutase.UCONN 24-028 MBHB 25-0252-WO

[0118] This study also reveals an interesting and unexpected new phenotype, the deletion of pmtA causes an increase in phagocytosis by THP-1 macrophages. P. aeruginosa is well known for effective phagocytic evasion mechanisms, including the loss of swimming motility to escape phagocytosis and secretion of proteins that can impair the function of macrophages (accomplished by a putative zinc metalloprotease, ImpA) by cleaving multiple macrophage surface proteins (e.g. CD43, CD44, and CD55). Inventors were able to visualize this new phenotype using fluorescent and confocal microscopy and found greater association of pmtA with the THP-1 cells when compared to either WT or PBADPmtA. These data indicate that PmtA might play a role in blocking macrophage pattern recognition receptors.

[0119] Bacteria have been known to disguise their MAMPs by modifying the pattern recognition receptor (PRR) ligands and / or other extracellular proteins that they produce. While PmtA lacks a signal peptide (as shown by in silico evaluation using SignalP software), it does appear to share molecular motifs with other extracellular Gram-negative bacterial proteins using SecretomeP software. In this analysis, the PmtA produces a SecP neural network score of 0.662902 (where any score over 0.5 exceeds the threshold as a secreted protein). It is probable that PmtA uses a non-classical secretion pathway or exits during autolysis that occurs during P. aeruginosa oxidative stress.

[0120] Both ELISA and flow cytometry can be used to detect PmtA on the surface of P. aeruginosa. The path that PmtA uses to arrive at the cell surface remains unknown: PmtA released from cells via non-classical secretion pathways may result in secondary binding to the cell surface from the outside, or PmtA may use as yet undefined cytosolic pathway to reach the bacterial cell surface. Once at the surface, PmtA may block ligands that are detected by PRR-mediated binding used by macrophages to phagocytize certain bacteria. Recently, persister cells have been shown to have similar phenotypes to what was observed in these studies. Persister cells are variants of normal cells, elicited by stress, that are resistant to antibiotics and provide protection from innate immune response; including slow engulfment rates in macrophage phagocytosis and high redox activity upon ceftazidime treatment. It is reasonable to speculate on PmtA involvement in persister cell morphology.

[0121] Once inside the macrophage, pmtA survival is significantly reduced when compared to both WT and PBadPmtA. A key compound of macrophage associated phagocytic killing are oxidants that enter the phagosome to kill ingested bacteria. While there was no significant difference in pmtA sensitivity to oxidative stress in vitro when compared to WT, PBADPmtA is more resistant to oxidative stress in vitro. The co-culture survival data indicated that once ingested by phagocytic cells PmtA may be a leading mechanism forUCONN 24-028 MBHB 25-0252-WO oxidative stress relief, whether this is by modulating other genes important for resistance or acting as an antioxidant alone remains unknown. All in all these findings, along with inventors previous study, indicate an important role for bacterial MT in pathogenicity.

[0122] The present disclosure is illustrated and further described in more detail with reference to the following additional non-limiting examples. Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.

[0123] Methods and Materials

[0124] Reagents.

[0125] All chemicals and reagents were purchased from Fisher Scientific (Pittsburgh, PA) unless otherwise stated.

[0126] THP-1 cells (Human monocytes), Media and Supplements

[0127] THP-1 cells were cultivated in RPMI-1640 medium (ATCC 30-2001TM) supplemented with 10% fetal bovine serum, 100U / mL penicillin and 100mg / mL of streptomycin. The cells were grown in tissue culture flasks, multi well plates, or Glass bottom dishes (WillCo-dish® ,GWSt-3533) at 37°C and 5% CO2. Differentiation into macrophages was induced by treatment with 40 ng / mL of phorbol 12-myristate 13-acetate (PMA) (Thermo scientific ® J63916.M resuspended in DMSO) for 72 hours.

[0128] Bacterial strains and growth conditions.

[0129] P. aeruginosa strain PAO1 was used as the wild-type strain, and all P. aeruginosa strains were grown at 37°C in Luria-Bertani (LB) containing 10 g Bacto Tryptone, 5 g yeast extract, and 10 g NaCl per liter or Tryptic Soy Broth (TSB) or M9 salt liquid media or on agar-solidified plates. For agar plates, 15 g / liter Bacto Agar (BA) was added. BA contained 44 g Columbia BA base per liter. For each assay, overnight cultures were established from a single colony. All relevant bacterial strains and plasmids are described in Table 2. Antibiotic selection for conjugations was performed with 1.5 mg / mL trimethoprim and 25 mg / mL spectinomycin as previously described (Thees, A. V et al., Front. Microbiol.12, 3422 (2021)). Plasmids were maintained in Escherichia coli using 100 mg / mL trimethoprim, 100 mg / mL of ampicillin and 100 mg / mL of kanamycin.

[0130] Generation of Over-expressing pmtA P. aeruginosa strain PAO1 and Fluorescently tagged PAO1 strains

[0131] The full-length of the pmtA gene (258bp) was PCR amplified from P. aeruginosa strain PAO1 genomic DNA (gDNA) using the primer pairs pmtAFEcoR1 (TACCCATGGGATCTGATAAGAATTCATGAACAGCGAAACCTGTGC (SEQ ID NO:UCONN 24-028 MBHB 25-0252-WO 18)) and pmtARHindIII (GTACCGGGCCCGCGGCCGCAAGCTTGCTCCTCAGGGCGAGATC (SEQ ID NO: 19)). The PCR mixture contained 2 x Phusion® High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs, (NEB®); Cat.#: M0531S / L), 10 mM pmtAF, 10mM pmtAR, 25 ng / mL of gDNA in a final volume of 50mL. The amplification conditions were as follows: (i) 4 mins at 98°C and (ii) 30 cycles of 25 s at 98°C, 30 s at 63°C and 60 s at 72°C and (iii) 10 mins at 72°C. Simultaneously, pTJ19 was linearized using EcoRI-HRÒ(NEB® R3101T) and HindIII-HFÒ(NEB® R3104T) following manufacturer conditions. Amplification fragments were assembled using Gibson assembly (NEB® E2611S) and transformed into NEB5-alpha (NEB® C2987H) competent E.coli cells following manufacture conditions yielding pBADPmtA. This plasmid was verified for correct fragment orientation by sequencing using Plasmidsaurus.com. A quadriparental mating was performed to conjugally transfer the Tn7 with a PBAD arabinose-inducible promoter in front of the pmtA gene into PAO1, yielding strain PBADpmtA. The insertion of the Tn7 downstream of glmS was verified by PCR of the glmS region.

[0132] PAO1 strains were also fluorescently tagged by generated a Tn7 with trimethoprim plus ORFs encoding the fluorescent proteins dTomato or sfGFP. Expression scaffolds and Tac promoters were PCR amplified from pTW4156and pTW4166using the following primer sets respectively and as described above; GFPpmtAF (GCCTTCGCGAGGTACCAAGGGCAGATTGTGTCGACC (SEQ ID NO: 20)) and GFPpmtAR (TTGCGGCCGCGGGCCCGCTAATTCGATCATGCATGAGCTCAC (SEQ ID NO: 21)) dtomatoR (ACCGGGCCCGCGGCCGCAAGCTTGCATGAGCTCACTAAATTCTTGACAATTAAT (SEQ ID NO: 22)) and dtomatoF (TCGACCTGCAGGCATGCAAGCTTGACCATGTGGTCACGCTTTTCG (SEQ ID NO: 23) ). For the overexpressing PAO1 strain using a GFP tag, pBADPmtA was linearized using restriction enzymes ApaI (NEB® R0114S) and KpnI (R3142S) following manufacturer conditions. For both WT PAO1 and DpmtA using the dTomato tag, pTJ19 was linearized using HindIII-HFÒ(NEB® R3104T) following manufacturer’s recommended conditions. Amplification fragments were assembled using Gibson assembly (NEB® E2611S) and transformed into NEB5-alpha (NEB® C2987H) competent E.coli cells following manufacture’s conditions yielding pPBADpmtAGFP or pdTomatoPBADTpTn7. These plasmids were verified for correct fragment orientation by sequencing using Plasmidsaurus.com (Figure 17). A quadriparental mating was performed as described aboveUCONN 24-028 MBHB 25-0252-WO in WT PAO1 and DpmtA yielding; PAO1dtomato, DpmtAdtomato and PBADpmtAGFP. The insertion of the Tn7 downstream of glmS was verified in paragraph

[0133] . To reverify that DpmtAdtomato maintained the clean deletion, pmtA was PCR amplified as described in paragraph

[0133] herein from all new strains.

[0133] Pyocyanin quantification

[0134] Pseudomonas aeruginosa strains were grown for 30 hrs in triplicate, and 1 mL of cell-free supernatants were obtained. Pyocyanin was extracted as follows, chloroform was added to the supernatant from each strain, forming a blue bottom layer. Subsequently, hydrochloric acid (0.2 M) was added to the layer bringing it to a pH of 2 shifting the color to pink. The absorbance of extracted pyocyanin was measured at OD520, and the normalized pyocyanin / cell density was calculated by dividing the pyocyanin at OD520 by growth measured at OD600 as previously described with no modifications [Thees, A. V et al. PmtA Regulates Pyocyanin Expression and Biofilm Formation in Pseudomonas aeruginosa. Front. Microbiol.12, 3422 (2021)].

[0135] Biofilm formation assay

[0136] Biofilm formation was quantified using a previously described microtiter plate assay with no modifications [Thees, A. V et al. Front. Microbiol.12, 3422 (2021)]. In brief, overnight cultures were diluted at 1:10 in fresh LB medium and grown for 24 h at 37°C without shaking. Growth yields were determined by measuring the absorbance at 595 nm. The medium was removed, and the biofilms were fixed to the sides of the microtiter wells with 90% methanol before being stained with 0.1% crystal violet (Fisher Science®, Waltham, MA, United States, S25275A). The crystal violet was solubilized in ethanol:acetone (4:1, v / v) and measured at 595 nm using an ethanol solution as blank. P. aeruginosa PAO1 was used as a positive control, with three biological replicates and eight technical replicates performed for each strain. The relative biofilm formation (RBF) for each well was determined by dividing the crystal violet absorbance reading by the growth yield absorbance reading.

[0137] Congo Red Colony Morphology assay

[0138] Colony morphology assays were performed as follows: Congo red (Fisher Scientific®, S70401-1) and 20mg / mL Brilliant Blue Coomassie (Fisher Scientific®, BP101- 25) were added into 500mL of DI water and autoclaved for 20 mins. Overnight cultures of DpmtA, PBADpmtA and WT PAO1 strains were grown for 24 hrs in M9 media. Five microliters of overnight cultures were spotted on colony morphology assay media andUCONN 24-028 MBHB 25-0252-WO incubated at 25°C, >95% humidity for 5 days. The pink centers from the biofilm were analyzed using ImageJ software.

[0139] Oxidative in vitro exposure assay

[0140] Overnight cultures of DpmtA, PBADpmtA and WT PAO1 strains were grown for 24 hrs in M9 media.108cells from each strain were added to 1 mL of fresh M9 media and starting CFU / mL was verified by serial dilutions and plating. Cells were exposed to either 40mM of H2O2or 0.3% NAOCl for 90 mins at 37°C, then cultures were serial diluted and plated for end point CFU / mL. Percent survival was calculated using end point CFU / mL / starting CFU / mL.

[0141] Quantitative PCR (qPCR) PBADarabinose-inducible promoter verification

[0142] Overnight cultures of DpmtA, PBADpmtA and WT PAO1 strains were grown for 24 hr in M9, TSB, LB, or infection media (RPMI-1640 medium 236.25mL (ATCC 30-2001TM), 3.5 % FBS , 20 mM HEPES). Total RNA was extracted using manufactures RNA extraction protocol from MasterPureTMDNA and RNA purification kit (BiosearchTMtechnologies). RNA was converted to cDNA with an iScriptTMcDNA synthesis kit (Bio-Rad® , 1708890). Gene specific primers to pmtA and the housekeeping ribosomal gene (RNA polymerase, subunit alpha) were used as previously described for qPCR with the following modification. All reactions were setup in 20 mL volume including the following: iTaqTMUniversal SYBR® Green Supermix (50% of reaction) (Bio-rad® 1725120) 10 mM forward and reverse primers (15% of reaction), nuclease-free H2O (10% of reaction) and 100 ng of cDNA. Negative controls with no template were prepared and tested with each set of reactions. Reactions were amplified in triplicate using a CFX96 Real-Time Thermocycler (Bio-Rad®) following the thermal cycle protocol as recommended by the manufacturer. The relative gene expression for pmtA was calculated using the cycle threshold value compared to RNA polymerase, alpha subunit gene as the internal reference standard. Fold changes were expressed as 2-DDCtvalues.

[0143] Phagocytosis assay

[0144] THP-1 cells were differentiated using PMA and seeded in 24-well plates (1x105cells / well), 3 days before infection with PAO1 strains at a MOI of 10. Phagocytosis assays were carried out by growing PAO1 strains in M9 media with arabinose as the sole carbon source for 24 hrs.108cells were washed 2 x times with PBS and serial diluted in infection media containing 1% arabinose. Cells were then incubated for 30 or 60 mins at 37°C in 5% CO2 in air. 300mg / mL of gentamicin was then added to each well and an additional 30 min incubation was performed. Afterwards, the cells were gently washed 3 times with PBS andUCONN 24-028 MBHB 25-0252-WO macrophages were detached with 2mM EDTA and lysed with 0.1% Triton-X 100. The lysed cells were serial diluted and plated on TSA and CFU / mL was calculated.

[0145] For imaging, the differentiated THP-1 cells (1x106) were plated 3 days before infection on Bioptechs 30 mm glass bottom culture dishes. Cells were exposed to PAO1 strains at a MOI of 10 and gentamicin treated / washed as described above. Cells were imaged on a Zeiss AxiovertTM100 fluorescence microscope with a 63x oil immersion objective or on Nikon AXRTMconfocal with 66x oil immersion objective. Images were acquired using an Imaging QIClickTMcamera and processed using ImageJ.

[0146] P. aeruginosa Intracellular Macrophage Survival assay

[0147] THP-1 cells were differentiated using PMA and seeded in 24-well plates (1x105cells / well), 3 days before infection with PAO1 strains at a MOI of 10. The phagocytosis assay was performed as described above

[0143] and infected cells were incubated for 60 mins at 37°C in 5% CO2 then 300 mg / mL of gentamicin was added to each well. For selected wells, an additional 30 min incubation was performed. Cells were gently washed 3 times with PBS, and macrophages were detached with 2mM EDTA and lysed with 0.1% Triton-X 100 marking time zero (CFUt0). In the remaining wells, cells were treated with gentamycin and then incubated for addition 60 mins (CFUt60). At the end of the incubation, the cells were gently washed 3 times with PBS and macrophages were detached with 2mM EDTA and lysed with 0.1% Triton-X 100. The lysed cells were serial diluted and plated on TSA and CFU / mL and percent survival was calculated.

[0148] Immunostaining with anti-pmtA

[0149] PAO1 was grown overnight in M9 media, and 108cells were washed twice with PBS. The bacteria were resuspended in 20mL PBS. Bacteria were then heat fixed onto the slide and 20mM of mouse monoclonal IgG1anti-PmtA (StressMarq Biosciences Inc. SMC- 553, clone 8D8) in 50mL of PBS was incubated on the fixed cells for 1 hr at RT. The slide was washed 3x with 1000mL of PBS. FitC- labeled goat anti-mouse IgG secondary antibody (SouthernBiotech®, 1030-02) was diluted 1:400 in PBS, added to the slide and incubated 1 hr at RT in the dark. The slide was washed 3x with 1000mL of PBS and then cells were imaged on a Zeiss AxiovertTM100 fluorescence microscope with a 63x oil immersion objective or on Nikon AXRTMconfocal with 66x oil immersion objective. Images were acquired using a Imaging QIClickTMcamera and processed using ImageJ.

[0150] Flow cytometry PmtA binding assay.

[0151] The flow cytometry binding assay was performed as follows, P. aeruginosa strains were grown overnight in M9 media and 107bacterial cells were washed twice withUCONN 24-028 MBHB 25-0252-WO 1mL of PBS. Cells were then resuspended in 100mL with 1.67x 10-5M of mouse anti-PmtA. Bacteria-antibody mixtures were incubated for 1 hr at 4°C then spun down for 5 mins at 15,000g. Bacterial cells were then washed with 1 mL of PBS. Bacteria were then resuspended, pelleted and then resuspended in 1:400 Alexa FluorTM647 labeled goat anti- mouse IgG for 1 hr at 4°C in the dark. Bacteria were then spun down for 5 mins at 15,000g and washed with 1 mL of PBS. Cells were then fixed for 1 hr at 4°C with 4% v / v paraformaldehyde. After fixation, cells were centrifuged at 15,000g for 5 mins and resuspended in 300mL pf PBS. Samples were analyzed by flow cytometry on a BD FortessaTM. Bacteria were gated using their forward and side scatter profile and analyzed for Alexa-Fluor 647 intensity.

[0152] PmtA surface binding characterization by ELISA

[0153] PmtA accessibility on the surface of intact bacterial cells was tested with monoclonal anti-PmtA binding by ELISA in ImmulonTM2HB 96 well plates as follows; P. aeruginosa strains were grown overnight in M9 media and 108bacterial cells were washed twice with 1mL of PBS. Microtiter plates then were coated with 100mL of 5 x 107CFU prewashed cells resuspended in PBS and incubated overnight at 4°C. Plates were then washed and blocked with 2% BSA overnight at 4°C. Following another wash step, the plate was then incubated with 5 mg / mL of anti-PmtA for 1.5 hrs at RT, subsequently washed, and incubated with goat anti-mouse Ig-AP (SouthernBiotech®, 1010-04) for 1.5 hr at RT. After the final wash, 1mg / mL pNPP substrate was added to the plates and OD405 values were measures every 30s for 10m using a Spectramax® (Molecular Devices) plate reader. Incorporation by Reference

[0154] All U.S. and PCT patent publications and U.S. patents mentioned herein are hereby incorporated by reference in their entirety as if each individual patent publication or patent was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control. Other Embodiments

[0155] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following claims.

Claims

UCONN 24-028 MBHB 25-0252-WO CLAIMS What is claimed is:

1. A method for treating an infection caused by one or more pathogen comprising or consisting of Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species, and combinations thereof, comprising administering to a subject with the infection a therapeutically effective amount of an inhibitor of bacterial metallothionein (PmtA) to treat the infection. The method of claim 1, wherein the pathogen comprises Pseudomonas aeruginosa.

3. The method of claim 1 or 2, wherein the subject is immunocompromised, is hospitalized, has undergone invasive surgery, and / or has or is at risk of developing diabetes or cystic fibrosis.

4. The method of claim 3, wherein the subject has cystic fibrosis.

5. The method of claim 4, wherein the subject has a cystic fibrosis-associated infection.

6. The method of claim 5, wherein the infection comprises a lung infection, and wherein the method improves lung function in the subject. The method of claim 3, wherein the subject has diabetes.

8. The method of claim 7, wherein the subject has a diabetic wound, and the method promotes diabetic wound healing in the subject.

9. The method of claim 8, wherein the diabetic wound comprises a foot ulcer.

10. The method of any one of claims 1-9, wherein the inhibitor of PmtA comprises an anti-PmtA antibody or an antigen-binding fragment thereof and / or an aptamer which specifically binds to PmtA.UCONN 24-028 MBHB 25-0252-WO 11. The method of any one of claims 1-10, wherein the inhibitor of PmtA comprises an anti-PmtA antibody or an antigen-binding fragment thereof.

12. The method of claim 11, wherein the anti-PmtA antibody or an antigen-binding fragment thereof comprises a monoclonal antibody or an antigen-binding fragment thereof.

13. The method of claim 11 or 12, wherein the anti-PmtA antibody or an antigen-binding fragment thereof comprises a humanized anti-PmtA antibody, or an antigen-binding fragment thereof.

14. The method of any one of claims 11-13, wherein the anti-PmtA antibody or an antigen-binding fragment comprises the following complementarity determining regions: heavy chain CDR1 comprises or consists of the amino acid sequence GFTFSSYA (SEQ ID NO: 1); heavy chain CDR2 comprises or consists of the amino acid sequence ISNGGSYT (SEQ ID NO: 2); heavy chain CDR3 comprises or consists of the amino acid sequence SRLAFDY (SEQ ID NO: 3); light chain CDR1 comprises or consists of the amino acid sequence TGAVTISNY (SEQ ID NO: 4); light chain CDR2 comprises or consists of the amino acid sequence GTN; and light chain CDR3 comprises or consists of the amino acid sequence ALWYSNHLV (SEQ ID NO: 5), wherein heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 1; heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 2; heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 3; light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 4; light chain CDR2 is at least 67% or 100% identical to GTN; and light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO:

5.

15. The method of any one of claims 11-13, wherein the anti-PmtA antibody or an antigen-binding fragment comprises the following complementarity determining regions:UCONN 24-028 MBHB 25-0252-WO heavy chain CDR1 comprises or consists of the amino acid sequence GYSFTGYY (SEQ ID NO: 6); heavy chain CDR2 comprises or consists of the amino acid sequence INPSNGYS (SEQ ID NO: 7); heavy chain CDR3 comprises or consists of the amino acid sequence ATFAY (SEQ ID NO: 8); light chain CDR1 comprises or consists of the amino acid sequence SSLSY (SEQ ID NO: 9); light chain CDR2 comprises or consists of the amino acid sequence DTS; and light chain CDR3 comprises or consists of the amino acid sequence QQRNSYPFT (SEQ ID NO: 10), wherein heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 6; heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 7; heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 8; light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 9; light chain CDR2 is at least 67% or 100% identical to DTS; and light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO:

10.

16. The method of any one of claims 11-13, wherein the anti-PmtA antibody or an antigen-binding fragment comprises the following complementarity determining regions: heavy chain CDR1 comprises or consists of the amino acid sequence GFTFSSYA (SEQ ID NO: 1); heavy chain CDR2 comprises or consists of the amino acid sequence ISSGGSYT (SEQ ID NO: 11); heavy chain CDR3 comprises or consists of the amino acid sequence ARLAMDY (SEQ ID NO: 12); light chain CDR1 comprises or consists of the amino acid sequence TGAVTISNY (SEQ ID NO: 13); light chain CDR2 comprises or consists of the amino acid sequence GTN; and light chain CDR3 comprises or consists of the amino acid sequence ALWYSNHLV (SEQ ID NO: 14), wherein heavy chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 1;UCONN 24-028 MBHB 25-0252-WO heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 11; heavy chain CDR2 is at least 80%, 90% or 100% identical to SEQ ID NO: 12; light chain CDR1 is at least 80%, 90% or 100% identical to SEQ ID NO: 13; light chain CDR2 is at least 67% or 100% identical to GTN; and light chain CDR3 is at least 80%, 90% or 100% identical to SEQ ID NO: 14; 17. The antibody of any of claims 11-16 conjugated to a cross-linking moiety, wherein the cross-linking moiety is selected from the group comprising or consisting of (a) homobifunctional cross-linking agents such as sulfosuccinimidyl 4-(N- maleimidomethyl)cyclohexane-1-carboxylate (Sulfo-SMCC), glutaraldehyde, bis[sulfosuccinimidyl] suberate (BS3), disuccinimidyl suberate (DSP), disuccinimidyl succinate (DSS), ethylene glycol bis(succinimidyl succinate) (EGS), bis[sulfosuccinimidyl] glutarate (BS2G), disuccinimidyl glutarate (DSG), formaldehyde or (b) heterobifunctionalcross-linking agents such as N-( -Maleimidocaproyloxy)succinimide ester) (EMCS), N- -Maleimidobutyryloxysuccinimide ester (GMBS), 5-Azido-2-nitrobenzoic acid N- hydroxysuccinimide ester (ANB-NOS) or (c) photoactivatable crosslinkers.

18. The antibody of any of claims 11-16 conjugated to a therapeutic, wherein the therapeutic is selected from the group comprising or consisting of small molecules, antibiotics, phages, and colicin.

19. The composition of claim 18, wherein the therapeutic comprises an antibiotic, wherein the antibiotic is selected from the group comprising or consisting of obiltoxaximab, raxibacumab, bezlotoxumab, actozumab, edobacumab, nebacumab, colistin, and aurograb.

20. The method according to any one of claims 1-19, wherein the subject is a mammal.

21. The method according to any one of claims 1-20, wherein the subject is a human.

22. The method according to any one of claims 1-19, wherein the subject is selected from the group comprising or consisting of cats, dogs, cattle, and pigs. The method according to any one of claims 1-19, wherein the subject is a bird.UCONN 24-028 MBHB 25-0252-WO 24. A composition, comprising: (a) a peptide comprising or consisting of 3-12 contiguous amino acids selected from residues 35 to 46 of PmtA or the entire PmtA peptide; and (b) a moiety conjugated to the peptide, selected from the group comprising or consisting of a carrier, and a cross-linking moiety.

25. The composition of claim 24, wherein the moiety comprises a carrier, wherein the carrier is selected from the group comprising or consisting of keyhole limpet hemocyanin (KLH), serum albumins, immunoglobulin molecules, ovalbumin, tetanus toxoid (TT), diphtheria toxoid (DT), meningococcal outer membrane protein complex (OMPC), H. influenza protein (HiD), and flagellin.

26. The composition of claim 24, wherein the moiety comprises a cross-linking moiety, wherein the cross-linking moiety is selected from the group comprising (a) homobifunctional cross-linking agents such as sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1- carboxylate (Sulfo-SMCC), glutaraldehyde, bis[sulfosuccinimidyl] suberate (BS3), disuccinimidyl suberate (DSP), disuccinimidyl succinate (DSS), ethylene glycol bis(succinimidyl succinate) (EGS), bis[sulfosuccinimidyl] glutarate (BS2G), disuccinimidylglutarate (DSG), formaldehyde or (b) heterobifunctional cross-linking agents such as N-( -Maleimidocaproyloxy)succinimide ester) (EMCS), N- -Maleimidobutyryloxysuccinimideester (GMBS), 5-Azido-2-nitrobenzoic acid N-hydroxysuccinimide ester (ANB-NOS) or (c) photoactivatable crosslinkers.

27. A method of limiting development of an infection caused by one or more pathogen selected from the group comprising or consisting of Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species, comprising administering to a subject at risk of such infection a therapeutically effective amount of the composition of any one of claims 24-26 to limit development of the infection.

28. The method of claim 27, wherein the pathogen comprises Pseudomonas aeruginosa.UCONN 24-028 MBHB 25-0252-WO 29. The method of any of claims 27 or 28, wherein the subject is immunocompromised, is hospitalized, has undergone invasive surgery, and / or has or is at risk of developing diabetes or cystic fibrosis. The method of claim 29, wherein the subject has cystic fibrosis.

31. The method of claim 29, wherein the subject has diabetes.

32. The method of claim 31, wherein the subject has a diabetic wound. The method of claim 32, wherein the diabetic wound comprises a foot ulcer 34. The method of any one of claims 27-33, wherein the subject is a mammal.

35. The method of any one of claims 27-34, wherein the subject is a human.

36. The method of any one of claims 27-34, wherein the subject is selected from the group comprising or consisting of cats, dogs, cattle, and pigs.

37. The method of any one of claims 27-33, wherein the subject is a bird.

Images