Rnai agents for inhibiting expression of myocilin (MYOC), compositions thereof, and methods of use

Abstract

Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of a Myocilin (MYOC) gene. The MYOC RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an MYOC gene. Pharmaceutical compositions that include one or more MYOC RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described MYOC RNAi agents to ocular tissue, in vivo, provides for inhibition of MYOC gene expression and a reduction in MYOC activity, which can provide a therapeutic benefit to subjects, including human subjects, for the treatment of various diseases including glaucoma, e.g., primary open-angle glaucoma (POAG).

Description

RNAi Agents for Inhibiting Expression of Myocilin (MYOC), Compositions Thereof, and Methods of Use CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to United States Provisional Patent Application Serial No. 63 / 639,045, filed on April 26, 2024, and United States Provisional Patent Application Serial No. 63 / 708,962, filed on October 18, 2024, the contents of each of which are incorporated herein by reference in their entirety. FIELD OF THE INVENTION

[0002] The present disclosure relates to RNA interference (RNAi) agents, e.g., double stranded RNAi agents, for inhibition of Myocilin (“MYOC”) gene expression, compositions that include MYOC RNAi agents, and methods of use thereof. SEQUENCE LISTING

[0003] This application contains a Sequence Listing (in compliance with Standard ST26), which has been submitted in xml format and is hereby incorporated by reference in its entirety. The xml sequence listing file is named 30732-WO_SeqListing.xml, created April 18, 2025, and is 2,962,965 bytes in size. BACKGROUND

[0004] The myocilin gene (MYOC) encodes a protein called myocilin, which is mainly expressed in the trabecular meshwork of the eye—an essential structure responsible for regulating intraocular pressure (IOP) through the drainage of aqueous humor.

[0005] In normal conditions, myocilin is secreted properly and plays a role in maintaining trabecular meshwork function. However, mutations in the MYOC gene lead to the production of abnormal, misfolded myocilin proteins. These mutant myocilin proteins are not secreted correctly. Instead, they accumulate inside the endoplasmic reticulum (ER) of trabecular meshwork cells, causing ER stress, cellular dysfunction, and eventually cell death. The loss and dysfunction of these cells impair aqueous humor outflow, resulting in elevated intraocular pressure (IOP)—a critical risk factor in the development and progression of primary open- angle glaucoma (POAG).

[0006] MYOC mutations are strongly associated with early-onset and familial POAG. The disease mechanism here is not simply a loss of myocilin function but rather a toxic gain-of- function from the accumulation of the mutant protein. Reducing or silencing the expression of the mutant MYOC allele is expected to reduce or eliminate production of the toxic misfolded protein, resume the normal aqueous humor outflow and eventually decrease the elevated IOP.

[0007] Mutations in myocilin commonly are seen in glaucoma patients, and are also implicated in juvenile-onset open-angle glaucoma (JOAG) and adult-onset primary open-angle glaucoma (POAG). Aggregation and aberrant mutations in myocilin are associated with glaucoma pathogenesis. Wang H, Li M, Zhang Z, Xue H, Chen X and Ji Y: Physiological function of myocilin and its role in the pathogenesis of glaucoma in the trabecular meshwork (Review). Int J Mol Med 43: 671-681, 2019. Therapeutics for reducing myocilin are thus expected to be effective in treating glaucoma in patients. SUMMARY

[0008] There exists a need for novel RNA interference (RNAi) agents (termed RNAi agents, RNAi triggers, or triggers), e.g., double stranded RNAi agents, that are able to selectively and efficiently inhibit the expression of a MYOC gene, including for use as a therapeutic or medicament. Further, there exists a need for compositions of novel MYOC-specific RNAi agents for the treatment of diseases or disorders associated mutant MYOC expression and / or disorders that can be mediated at least in part by a reduction in MYOC gene expression and / or MYOC receptor expression.

[0009] The nucleotide sequences and chemical modifications of the MYOC RNAi agents disclosed herein, as well as their combination with certain specific targeting ligands suitable for selectively and efficiently delivering the MYOC RNAi agents to relevant ocular cells in vivo, differ from those previously disclosed or known in the art. The MYOC RNAi agents disclosed herein provide for highly potent and efficient inhibition of the expression of a MYOC gene.

[0010] In general, the present disclosure features MYOC gene-specific RNAi agents, compositions that include MYOC RNAi agents, and methods for inhibiting expression of a MYOC gene in vitro and / or in vivo using the MYOC RNAi agents and compositions that include MYOC RNAi agents described herein. The MYOC RNAi agents described herein are able to selectively and efficiently decrease expression of a MYOC gene, and thereby reduce the expression of myocilin protein.

[0011] The described MYOC RNAi agents can be used in methods for therapeutic treatment (including preventative or prophylactic treatment) of symptoms and diseases including, but not limited to various ocular diseases including glaucoma, for example, primary open-angle glaucoma (POAG).

[0012] In one aspect, the disclosure features RNAi agents for inhibiting expression of a MYOC (or MYOC) gene, wherein the RNAi agent includes a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and the antisense strand can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense and antisense strands described herein each can be 16 to 49 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. The sense and antisense strands can be either the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein, upon delivery to a cell expressing MYOC such as an epithelial cell and / or a trabecular meshwork cell to inhibit the expression of one or more MYOC gene variants in vivo and / or in vitro.

[0013] The MYOC RNAi agents disclosed herein target a human MYOC gene (see, e.g., SEQ ID NO:1). In some embodiments, the MYOC RNAi agents disclosed herein target a portion of an MYOC gene having the sequence of any of the sequences disclosed in Table 1.

[0014] In another aspect, the disclosure features compositions, including pharmaceutical compositions, that include one or more of the disclosed MYOC RNAi agents that are able to selectively and efficiently decrease expression of an MYOC gene. The compositions that include one or more MYOC RNAi agents described herein can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of symptoms and diseases associated with MYOC receptor activity.

[0015] Examples of MYOC RNAi agent sense strands and antisense strands that can be used in a MYOC RNAi agent are provided in Tables 3, 4, 5, and 6. Examples of MYOC RNAi agent duplexes are provided in Tables 7A, 7B, 8, 9A, and 10. Examples of 19-nucleotide corestretch sequences that may consist of or may be included in the sense strands and antisense strands of certain MYOC RNAi agents disclosed herein, are provided in Table 2.

[0016] In another aspect, the disclosure features methods for delivering MYOC RNAi agents to epithelial cells or trabecular meshwork cells in a subject, such as a mammal, in vivo. Also described herein are compositions for use in such methods. In some embodiments, disclosed herein are methods for delivering MYOC RNAi agents to ocular cells to a subject in vivo. In some embodiments, the subject is a human subject.

[0017] The methods disclosed herein include the administration of one or more MYOC RNAi agents to a subject, e.g., a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein that include one or more MYOC RNAi agents can be administered in a number of ways depending upon whether local or systemic treatment is desired. Administration can be, but is not limited to, for example, intravitreal, intracameral, intravenous, and subcutaneous administration. In some embodiments, the pharmaceutical compositions described herein are administered by intracameral or intravitreal injection.

[0018] In some embodiments, it is desired that the MYOC RNAi agents described herein inhibit the expression of an MYOC gene in ocular cells.

[0019] The one or more MYOC RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, a MYOC RNAi agent is delivered to cells or tissues by covalently linking the RNAi agent to a targeting group or a lipid moiety.

[0020] A targeting group can be linked to the 3′ or 5′ end of a sense strand or an antisense strand of a MYOC RNAi agent. In some embodiments, a targeting group is linked to the 3′ or 5′ end of the sense strand. In some embodiments, a targeting group is linked to the 5′ end of the sense strand. In some embodiments, a targeting group is linked internally to a nucleotide on the sense strand and / or the antisense strand of the RNAi agent. In some embodiments, a targeting group is linked to the RNAi agent via a linker.

[0021] In another aspect, the disclosure features compositions that include one or more MYOC RNAi agents that have the duplex structures disclosed in Tables 7A, 7B, 8, 9A, and 10.

[0022] The use of MYOC RNAi agents provides methods for therapeutic (including prophylactic) treatment of diseases or disorders for which a reduction in MYOC receptor activity can provide a therapeutic benefit. The MYOC RNAi agents disclosed herein can be used to treat various ocular diseases, including glaucoma (e.g. POAG). Such methods oftreatment include administration of a MYOC RNAi agent to a human being or animal having elevated or mutant MYOC or MYOC activity beyond desirable levels.

[0023] As used herein, the terms “oligonucleotide” and “polynucleotide” mean a polymer of linked nucleosides each of which can be independently modified or unmodified.

[0024] As used herein, an “RNAi agent” (also referred to as an “RNAi trigger”) means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrades or inhibits under appropriate conditions) translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short (or small) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted (i.e. MYOC mRNA). RNAi agents can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0025] As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” when referring to expression of a given gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.

[0026] As used herein, the terms “sequence” and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature.

[0027] As used herein, a “base,” “nucleotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, anduracil. A nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley- VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds that include modified nucleobases) is known in the art.

[0028] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions)) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide that includes the second nucleotide sequence. The person of ordinary skill in the art would be able to select the set of conditions most appropriate for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.

[0029] As used herein, “perfectly complementary” or “fully complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0030] As used herein, “partially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0031] As used herein, “substantially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases ina contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0032] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of an MYOC mRNA.

[0033] As used herein, the term “substantially identical” or “substantial identity,” as applied to a nucleic acid sequence means the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed herein.

[0034] As used herein, the terms “treat,” “treatment,” and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” may include the prevention, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0035] As used herein, the phrase “introducing into a cell,” when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase “functional delivery,” means delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene expression.

[0036] Unless stated otherwise, use of the symbol as used herein means that any group or groups may be linked thereto that is in accordance with the scope of the inventions described herein.

[0037] As used herein, the term “isomers” refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another aretermed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four non- identical substituents is termed a “chiral center.”

[0038] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0039] As used in a claim herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.

[0040] The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art. Correspondingly, compounds described herein with labile protons or basic atoms should also be understood to represent salt forms of the corresponding compound. Compounds described herein may be in a free acid, free base, or salt form. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of the invention.

[0041] As used herein, the term “linked” or “conjugated” when referring to the connection between two compounds or molecules means that two compounds or molecules are joined by a covalent bond. Unless stated, the terms “linked” and “conjugated” as used herein may refer to the connection between a first compound and a second compound either with or without any intervening atoms or groups of atoms.

[0042] As used herein, the term “including” is used to herein mean, and is used interchangeably with, the phrase “including but not limited to.” The term “or” is used herein to mean, and is used interchangeably with, the term “and / or,” unless the context clearly indicates otherwise.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0044] Other objects, features, aspects, and advantages of the invention will be apparent from the following detailed description, accompanying figures, and from the claims. DETAILED DESCRIPTION RNAi Agents

[0045] Described herein are RNAi agents for inhibiting expression of the MYOC (or MYOC) gene (referred to herein as MYOC RNAi agents or MYOC RNAi triggers). Each MYOC RNAi agent disclosed herein comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 49 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 18 to 27 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 nucleotides in length. In some embodiments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.

[0046] Examples of nucleotide sequences used in forming MYOC RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. Examples of RNAi agent duplexes, that include the sense strandand antisense strand sequences in Tables 2, 3, 4, 5, 6, are shown in Tables 7A, 7B, 8, 9A, and 10.

[0047] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., this region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).

[0048] A sense strand of the MYOC RNAi agents described herein includes at least 16 consecutive nucleotides that have at least 85% identity to a core stretch sequence (also referred to herein as a “core stretch” or “core sequence”) of the same number of nucleotides in an MYOC mRNA. In some embodiments, a sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length (sometimes referred to, e.g., as a target sequence) present in the MYOC mRNA target. In some embodiments, this sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this sense strand core stretch is 17 nucleotides in length. In some embodiments, this sense strand core stretch is 19 nucleotides in length.

[0049] An antisense strand of a MYOC RNAi agent described herein includes at least 16 consecutive nucleotides that have at least 85% complementarity to a core stretch of the same number of nucleotides in an MYOC mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, an antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (e.g., target sequence) of the same length present in the MYOC mRNA target. In some embodiments, this antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this antisense strand core stretch is 19 nucleotides in length. In some embodiments, this antisense strand core stretch is 17 nucleotides in length. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length.

[0050] The MYOC RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of a MYOC RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense corestretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of a MYOC RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)

[0051] In some embodiments, the antisense strand of a MYOC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of a MYOC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0052] In some embodiments, the sense strand and / or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the MYOC mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the MYOC mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand’s additional nucleotides, if present.

[0053] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, a MYOC RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension. In some embodiments, the extension nucleotide(s) are unpairedand form an overhang. As used herein, an “overhang” refers to a stretch of one or more unpaired nucleotides located at a terminal end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein.

[0054] In some embodiments, a MYOC RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, a MYOC RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding MYOC mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding MYOC mRNA sequence.

[0055] In some embodiments, a MYOC RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to or are the identical to nucleotides in the MYOC mRNA sequence. In some embodiments, the 3′ sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5′ to 3′).

[0056] A sense strand can have a 3′ extension and / or a 5' extension. In some embodiments, a MYOC RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the MYOC mRNA sequence.

[0057] Examples of sequences used in forming MYOC RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, a MYOC RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2, 3, or 10. In certain embodiments, a MYOC RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. In some embodiments, a MYOC RNAi agent antisense strand includes the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21, of any of thein Tables 2 or 3. In some embodiments, a MYOC RNAi agent sense strand includes the sequence of any of the sequences in Tables 2, 4, 5, or 6. In some embodiments, a MYOC RNAi agent sense strand includes the sequence of nucleotides (from 5′ end ^ 3′ end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of thesequences in Tables 2, 4, 5, or 6. In certain embodiments, a MYOC RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4, 5, 6, or 10.

[0058] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a “blunt end” refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).

[0059] In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′ overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends. Typically, when present, overhangs are located at the 3’ terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0060] The MYOC RNAi agents disclosed herein may also be comprised of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand of the MYOC RNAi agent are modified nucleotides. The MYOC RNAi agents disclosed herein may further be comprised of one or more modified internucleoside linkages, e.g., one or more phosphorothioate or phosphorodithioate linkages. In some embodiments, a MYOC RNAi agent contains one ormore modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleotide is combined with modified internucleoside linkage.

[0061] In some embodiments, a MYOC RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, a MYOC RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, a MYOC RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms that are well known in the art are within the scope of the inventions disclosed herein. Modified Nucleotides

[0062] Modified nucleotides, when used in various oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administration of the oligonucleotide construct.

[0063] In some embodiments, a MYOC RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2′-modified nucleotides, inverted nucleotides, modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues), locked nucleotides, 3′-O-methoxy (2′ internucleoside linked) nucleotides, 2'-F- Arabino nucleotides, 5'-Me, 2'-fluoro nucleotide, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides. 2′-modified nucleotides (i.e., a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (also referred to as 2′-methoxy nucleotides), 2′-fluoro nucleotides (also referred to herein as 2′-deoxy-2′-fluoro nucleotides), 2′-deoxy nucleotides, 2′- methoxyethyl (2′-O-2-methoxylethyl) nucleotides (also referred to as 2′-MOE), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single MYOC RNAi agent or even in a single nucleotide thereof. The MYOC RNAi agentsense strands and antisense strands can be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

[0064] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6- methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2- methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0065] In some embodiments, the 5’ and / or 3′ end of the antisense strand can include abasic residues (Ab), which can also be referred to as an “abasic site” or “abasic nucleotide.” An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1′ position of the sugar moiety. (See, e.g., U.S. Patent No. 5,998,203). In some embodiments, an abasic residue can be placed internally in a nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3′ end of the antisense strand. In some embodiments, the 5′ end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab are added to the 3′ end of the sense strand. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0066] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the antisense strand beingunmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide. Chemical structures for certain modified nucleotides are set forth in Table 11 herein. Modified Internucleoside Linkages

[0067] In some embodiments, one or more nucleotides of a MYOC RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate or phosphorodithioate groups (represented herein as a lower case “s” for phosphorothioate and “ss” for phosphorodithioate), chiral phosphorothioates or phosphorodithioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl- phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter- sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2components.

[0068] In some embodiments, a sense strand of a MYOC RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages, an antisense strand of a MYOC RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages. In some embodiments, a sense strand of a MYOC RNAi agent can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages,an antisense strand of a MYOC RNAi agent can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages.

[0069] In some embodiments, a MYOC RNAi agent sense strand contains at least two phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments, the phosphorothioate or phosphorodithioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate or phosphorodithioate internucleoside linkage is at the 5’ end of the sense strand nucleotide sequence, and another phosphorothioate or phosphorodithioate linkage is at the 3’ end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate or phosphorodithioate internucleoside linkage are located at the 5’ end of the sense strand, and another phosphorothioate or phosphorodithioate linkage is at the 3’ end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate or phosphorodithioate internucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate or phosphorodithioate linkages between the terminal nucleotides on both the 5’ and 3’ ends and the optionally present inverted abasic residue terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate or phosphorodithioate linkage.

[0070] In some embodiments, a MYOC RNAi agent antisense strand contains four phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments, the four phosphorothioate or phosphorodithioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphorothioate or phosphorodithioate internucleoside linkages are located between positions 1-4 from the 5’ end of the antisense strand, and a fourth phosphorothioate or phosphorodithioate internucleoside linkage is located between positions 20-21 from the 5’ end of the antisense strand. In some embodiments, a MYOC RNAi agent contains at least three or four phosphorothioate or phosphorodithioate internucleoside linkages in the antisense strand. Capping Residues or Moieties

[0071] In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as a “cap,” a “terminal cap,” or a “capping residue.” As used herein, a “capping residue” is a non-nucleotide compound or other moiety that can beincorporated at one or more termini of a nucleotide sequence of an RNAi agent disclosed herein. A capping residue can provide the RNAi agent, in some instances, with certain beneficial properties, such as, for example, protection against exonuclease degradation. In some embodiments, inverted abasic residues (invAb) (also referred to in the art as “inverted abasic sites”) are added as capping residues (see Table 11). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art, and include, for example, inverted abasic residues as well as carbon chains such as a terminal C3H7 (propyl), C6H13(hexyl), or C12H25(dodecyl) groups. In some embodiments, a capping residue is present at either the 5′ terminal end, the 3′ terminal end, or both the 5′ and 3′ terminal ends of the sense strand. In some embodiments, the 5’ end and / or the 3′ end of the sense strand may include more than one inverted abasic deoxyribose moiety as a capping residue.

[0072] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3′ end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.

[0073] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues may be linked via phosphate, phosphorothioate (e.g., shown herein as (invAb)s)), or other internucleoside linkages. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3′ end of the antisense strand core stretch sequence, or the 3′ end of the antisense strand sequence, may include an inverted abasic residue. The chemical structures for inverted abasic deoxyribose residues are shown in Table 11 below. MYOC RNAi Agents

[0074] The MYOC RNAi agents disclosed herein are designed to target specific positions on a MYOC gene (e.g., SEQ ID NO:1 (NM_000261.2)). As defined herein, an antisense strand sequence is designed to target a MYOC gene at a given position on the gene when the 5′ terminal nucleobase of the antisense strand is aligned with a position that is 21 nucleotides downstream (towards the 3′ end) from the position on the gene when base pairing to the gene. For example, as illustrated in Tables 1 and 2 herein, an antisense strand sequence designed to target a MYOC gene at position 304 requires that when base pairing to the gene, the 5′ terminal nucleobase of the antisense strand is aligned with position 324 of a MYOC gene.

[0075] As provided herein, a MYOC RNAi agent does not require that the nucleobase at position 1 (5′ ^ 3′) of the antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides. For example, for a MYOC RNAi agent disclosed herein that is designed to target position 304 of a MYOC gene, the 5′ terminal nucleobase of the antisense strand of the MYOC RNAi agent must be aligned with position 324 of the gene; however, the 5′ terminal nucleobase of the antisense strand may be, but is not required to be, complementary to position 324 of a MYOC gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene transcript across a core stretch sequence of at least 16 consecutive nucleotides. As shown by, among other things, the various examples disclosed herein, the specific site of binding of the gene by the antisense strand of the MYOC RNAi agent (e.g., whether the MYOC RNAi agent is designed to target a MYOC gene at position 304, at position 408, at position 971, or at some other position) is an important factor to the level of inhibition achieved by the MYOC RNAi agent. (See, e.g., Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off- Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0076] In some embodiments, the MYOC RNAi agents disclosed herein target a MYOC gene at or near the positions of the MYOC sequence shown in Table 1. In some embodiments, the antisense strand of a MYOC RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target MYOC 19-mer sequence disclosed in Table 1.Table 1. MYOC 19-mer mRNA Target Sequences (taken from Homo sapiens Myocilin (MYOC) transcript, GenBank NM_000261.2 (SEQ ID NO:1)) SEQ ID MYOC 19-mer Target Sequences Corresponding Targeted Gene NO. (5′ → 3′) Positions of Sequence Position (as E ID N 1 f t h in)SEQ ID MYOC 19-mer Target Sequences Corresponding Targeted Gene NO. (5′ → 3′) Positions of Sequence Position (as n SEQ ID NO: 1 r f rr d t h r in)ne transcript (2100 bases): 1 gagccagcaa ggccacccat ccaggcacct ctcagcacag cagagctttc cagaggaagc 61 ctcaccaagc ctctgcaatg aggttcttct gtgcacgttg ctgcagcttt gggcctgaga 121 tgccagctgt ccagctgctg cttctggcct gcctggtgtg ggatgtgggg gccaggacag 181 ctcagctcag gaaggccaat gaccagagtg gccgatgcca gtataccttc agtgtggcca 241 gtcccaatga atccagctgc ccagagcaga gccaggccat gtcagtcatc cataacttac 301 agagagacag cagcacccaa cgcttagacc tggaggccac caaagctcga ctcagctccc 361 tggagagcct cctccaccaa ttgaccttgg accaggctgc caggccccag gagacccagg 421 aggggctgca gagggagctg ggcaccctga ggcgggagcg ggaccagctg gaaacccaaa 481 ccagagagtt ggagactgcc tacagcaacc tcctccgaga caagtcagtt ctggaggaag 541 agaagaagcg actaaggcaa gaaaatgaga atctggccag gaggttggaa agcagcagcc 601 aggaggtagc aaggctgaga aggggccagt gtccccagac ccgagacact gctcgggctg 661 tgccaccagg ctccagagaa gtttctacgt ggaatttgga cactttggcc ttccaggaac 721 tgaagtccga gctaactgaa gttcctgctt cccgaatttt gaaggagagc ccatctggct 781 atctcaggag tggagaggga gacaccggat gtggagaact agtttgggta ggagagcctc 841 tcacgctgag aacagcagaa acaattactg gcaagtatgg tgtgtggatg cgagacccca 901 agcccaccta cccctacacc caggagacca cgtggagaat cgacacagtt ggcacggatg 961 tccgccaggt ttttgagtat gacctcatca gccagtttat gcagggctac ccttctaagg 1021 ttcacatact gcctaggcca ctggaaagca cgggtgctgt ggtgtactcg gggagcctct 1081 atttccaggg cgctgagtcc agaactgtca taagatatga gctgaatacc gagacagtga 1141 aggctgagaa ggaaatccct ggagctggct accacggaca gttcccgtat tcttggggtg 1201 gctacacgga cattgacttg gctgtggatg aagcaggcct ctgggtcatt tacagcaccg 1261 atgaggccaa aggtgccatt gtcctctcca aactgaaccc agagaatctg gaactcgaac 1321 aaacctggga gacaaacatc cgtaagcagt cagtcgccaa tgccttcatc atctgtggca 1381 ccttgtacac cgtcagcagc tacacctcag cagatgctac cgtcaacttt gcttatgaca 1441 caggcacagg tatcagcaag accctgacca tcccattcaa gaaccgctat aagtacagca 1501 gcatgattga ctacaacccc ctggagaaga agctctttgc ctgggacaac ttgaacatgg 1561 tcacttatga catcaagctc tccaagatgt gaaaagcctc caagctgtac aggcaatggc1621 agaaggagat gctcagggct cctgggggga gcaggctgaa gggagagcca gccagccagg 1681 gcccaggcag ctttgactgc tttccaagtt ttcattaatc cagaaggatg aacatggtca 1741 ccatctaact attcaggaat tgtagtctga gggcgtagac aatttcatat aataaatatc 1801 ctttatcttc tgtcagcatt tatgggatgt ttaatgacat agttcaagtt ttcttgtgat 1861 ttggggcaaa agctgtaagg cataatagtt tcttcctgaa aaccattgct cttgcatgtt 1921 acatggttac cacaagccac aataaaaagc ataacttcta aaggaagcag aatagctcct 1981 ctggccagca tcgaatataa gtaagatgca tttactacag ttggcttcta atgcttcaga 2041 tagaatacag ttgggtctca cataaccctt tacattgtga aataaaattt tcttacccaa

[0078] In some embodiments, a MYOC RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5′^3′) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a MYOC agent includes an antisense strand wherein position 1 of the antisense strand (5′^3′) is capable of forming a base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0079] In some embodiments, a MYOC agent includes an antisense strand wherein position 2 of the antisense strand (5′ ^ 3′) is capable of forming a base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a MYOC agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5′ ^ 3′) are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.

[0080] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) can be perfectly complementary to a MYOC gene, or can be non- complementary to a MYOC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) forms an A:U or U:A base pair with the sense strand.

[0081] In some embodiments, a MYOC RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. Ina MYOC RNAi sense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.

[0082] In some embodiments, a MYOC RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18 or 2-19 of any of theantisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.

[0083] In some embodiments, the MYOC RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.ed niethteengn oitnareiaGs5o75275275271211511 1 1 1 1 1 1 8 8 8 8 8 9 9 95151515060606066666666666868686x T P opydhe( gifeniitnno1:dn ucGG G N a G CC C C N rqu G G G N teSN GG G G AA A A A CC C N C C C GG G G GC C C U U U U U See dU U U AA A A GG G G G CC C C AA A A AU U U ssGG G G G CC GG G G GU U U na) ei)CC C C C C CC C C C GG G B′3fi eAA A A AA A A G GA A A esitddn→ocneG U U U U U G G G CC C C C U U U U U U U U U A A A U U U U U U U U U CC C C CC C C C U U U U A A A n Aa′mu qCC C C GG G G U C C C CC C trt 5(n nUeGG G G G AA A A U U U U U U U U U C CC C C U U U U U U U U U U eSS geGG G G snaU U U U U U U U U U U U G U U U U CC C C G G C CC C C C AniesC C C C CC C C U U U si aAA A A AA A A A GG G AA A A A n GG G G G G G G GG G G G AA A A AA A A AA A A AtGG G G U U U U U CC C C AA A A AA N n R AwA A o U U U U CC C C C U U U U GG G G GA A A h AA A A AA A A A CC C C A CSA A A AC C C O(U U U U AA A A A U U U U U U U U U C C C U A N N G U A N N U A N N G U A N N G U A Y M).esD 2aebI :.loQO344454647484940515253545556575859506162636belE N acuS Tn9898323232326262626234343 3 0 0 0 0 0 1 1 1 1 1 8 8 8 86 6 7 7 7 7 7 7 7 7 8 848485858585858585858585858585858C C AA A A CC C C GG G G GG G G G A A A AU U U U U U GG G G U U U U AA A A U U A U U U CC C C CG G G G U U GG G G CC C C CC C C CC C C C GG G G GU U A A CC C C G U U U U G G U U GG G G G G U U U U U U U U U U U U U A A U U U U AA A A CC C C U CC C C CA A A A CC C C U U U U U U U U U A A U U U U U U U U U A A A A C C GG G G U U U U U U U U U U U U U U U U U U U U U U C C AA A A GG G G GG G G U U U U U U U U U U U U AA A A U U U U U U G G G G U U U U U U U GG G G G G G G G U A A A A G G U U U U CC C C CC C C G U U U U C C C C U U GG G G U U U U GG G G U U U U U U U U U U C C C C G G AA A A U U U U U U U U U U U U U AA A A AG G G G A A CC C C CC C C CC C C AA A A A AA A A AU U U U A A U U U U AA A A U U U U AA A A A U U U U U U U U U A A U U U U AA A A U U U U U U U U U GG G G GC C C C C C CC C C GG G G U U U U GG G G G AA A A AA A A A C C AA A A GG G G GG G G AA A A A CC C C CU U U U N N A U N N A U N N U A N N C U A N N C U A N N A U N N 465666768696071727374757677787970818283848586878889809199595959526262626267 7 7 7 7 5 5 5 5 1 1 1 1 1606060608 8 8 8 8 8 8 8 8686868686869696969797979797901010101G GG G U U U U A AA A A CC C C CC C C C AA A A AU U U U A AA A A CC C C CC C C C CC C C CG G G G U U U U U U U U A A A A U U U U U G G G G A AA A U GG G G G A AA A G GG G G U U U U U A A A A CC C C CG G G G A AA A A U U U U U A A A A AA A A AA A A A U U U U C CC C C A A A A U U U U U A A A A G GG G C CC C C CC C C C A AA A G GG G G AA A A AA A A A AA A A AG G G G U U U U U C C C C CC C C CA A A A C CC C U U U U U U U U U U U U U U U U U C CC C U G U U U U U AA A A A C C C C C C GG G G GU U U U G GG C C C C CC C C CC C C CA A A A GG G G GC C C C U U U U A AA A A U U U U AA A A AC C C C U U U U AA A A A U U C C C CA A A A GG G G GA A A A C CC C U U U C A AA A A A A A AC C C C U U U U U A A A A A AA A A C CC C C CC C C CU U U U AA A A AG G G G U U U U C CC C C AA A A AG G G G GG G G GU U U U A AA A A AA A A CC C C CG G G G U U U U U G G G G U A N N C U A N N C U A N N A U N N C U A N N U A N N 39495969798999 001102103104105106 7 8 9 0 1 2 3 4 5 6 7 8 9101010101111111111111111111111111111169696969999999999960606 6 4 4 4 4 4 0 0 0 0 00 0 0 010101010100 0 6 6 6 6 6 9 9 9 9 91 1 1 1010101011111111121212121212121212121A AA A G GG G C CC C C GG G G G GG G G GG G G G G GG G G GG G U U U U U U U U U G A A A A A AA A U U GG G G A U U U U U U U AA A A U U U U U CC C C C U U U U C CC C G GG G G U U U U U U U U U U U U U U U U U U U U U U A AA A A U U U U U U U U U U U U C CC C CC C C U U G C U U U U C CC G G G C CC C C C CC C C G G GG G A AA A A U U C CC C C G G G G A AA A U U G G GG G G A AA A A G G G G A AA A A AA A AA A A G C CC C U U U U U U C CC C C U U U U G GG G U U U U A AA A A AA A A G GG G G C C C C U U U U AA A A C G GG G U U U U U CC C C G GG G G U U U U U G GG G U U U U U U U U U U U U U U U U U U CC C C C U U U U A AA A C CC C C CC C C A AA A A U U U U U A AA A U U U U U U U U U GG G G A AA A A U U U U U U U U U U U U U A AA A A AA A A C CC C C AA A A A G GG G C CC C U U U U U CC C C A AA A A GG G G G A AA A U U U U A AA A A U U U U G GG G G AA A A A U A N N A U N N C U A N N U A N N G U A N N C U A N N 12223242526272829203132 3 4 5 6 7 8 9 0 1 2 3 4 5 6 71 1 1 1 1 1 1 1 1 1 1313131313131313141414141414141415959595991919191911414141439393 3 4 4 4 4 4 7 7 7 7 0 02 2 2 214141414149 9 4 4 4 4 4 4 4 4 4 5 51 1 1 141414141414141415151515151515151515151G G GG C C CC C C CC C G GG G G G GG G G GG G C C G G GG A A AA A G GG U U U U U A AA A U U G G GG G G GG G G U U U U U U U U C CC C U U U U U A AA A U U U U U U U U U U U G GG G G GG G G G GG G C CC C G G C C CC U U U U U U U U U U U U U A A AA A U U U U U U U U U U G G GG G C CC C C CC C A A AA A U U U U A A C C CC A A AA A C CC C G GG G C C CC C G GG G C C U U U U A A AA A A AA A U U U U U U U U U U U U U C C U U U U A A AA A U U U U A AA A U U U U U A AA A A A A A AA C C CC C A AA A C CC C G G GG G C CC C G G G G GG G G GG G G GG G U U U U U U U U U C CC C U U A A AA A A AA A U U U U A AA A A A AA A A AA A G G C C CC A A AA A C CC C A AA A C C CC C G GG G A A C C CC U U U U U G GG G C CC C C C CC C U U U U A A U U U U A A AA A U U U U U U U U A A AA A G GG G U U U U U U C C CC C U U U U G GG G G G GG G A AA A A A G G GG U U U U U C CC C A AA A U U U U U A AA A C C A U N N G U A N N U A N N U A N N G U A N N U A N N U A 8494051525354555657585950 1 2 3 4 5 6 7 8 9 0 1 2 3 4 51 1 1 1 1 1 1 1 1 1 1 1616161616161616161617171717171710505151515151565656565474747471 1 1 1 1 2 2 2 2 6 6 6 65 5 5 515151515152 2 2 2 2 1 1 1 1 2 2 2 21 1 1 151515151515171717171718181818181818181C C U U U U U C C C CC C C C C C C C U U U C U U U U U U U U U U U U U C C CG G G G A A A A U U GG G G GA A A A U U U U U C C C C A A A AC C C C CG G G A A A A U U U U U G G G G G G G G G G GC C C C C A A A A U U U U U U U U U U AA A A A A A A AU U U U U U U U U A A CG G G A A A A CC C C GG G G GA A A A A U U U U C C CC C C CA A A A A A A A G G G GC C C C CA A A A A C C AA A A AA A A A A A A U U U U U U U U U C C C C A A GG G G GU U U U U U U U U U U U U U U U U U U U U G G U U U U U A A A A A A A A C C C CG G G G GC C C CG G G G U U GG G G GC C C CU U U U U U U U U C C C CU U U U G G AA A A AU U U U A A A AA A A A AC C C CA A A A A A AA A A AG G G GC C C CC C C C CU U U U U U U U A A U U U U U U U U U A A A AC C C C CA A A AC C C C U U AA A A AA A A AC C C CA A A A AC C C CA A A A A A CC C C CG G G GU U U U G G G G GA A A AA A A A C C U U U U U U U U U U U U U U U U U U A A A AG G G G N N G U A N N U A N N U A N N G U A N N A U N N U A N N 6777879708182838485868788 9 0 1 2 3 4 5 6 7 8 9 0 1 2 31 1 1 1 1 1 1 1 1 1 1 18181919191919191919191910202020263636363606060606031313131316 6 6 6 7 7 7 7 78 8 8 8 9 91919199 9 9 9 5 5 5 5 51 1 1 1 1 19191919191919191910202020202G GG N C CC C N GG G G N A A A N GG G G N U U U U G GG G G U U U U U U U U U U U U U U A AA A A GG G G G U U U U A A A A AA A A AU U U U C CC C G GG G G CC C C CC C C C U U U U U AA AA A A AA A A A AA A A A A AA A A A A AA A A AU U U U U U U A AA A A AA A A U U C CC C C U U U U U U U U U U U U U U G GG G G G G G U U U U G GG G G GG G G GC C C C G U U U U U U U U U U U U U U GG G G G U U U U A AA A A AA A A AA A A A GG G G G C CC C C CC C C CC C C CC C C C AA A A A A AA A A AA A A CC C C CG G G G AA A A A A AA A A AA A A AA A A AU U U U AA A A A A AA A U U U U U AA A A AA A A A U U U U U A AA A G GG G G U U U U U A A A A GG G G G G GG G U U U U U GG G G GA A A A U U U U U A AA A A AA A A GG G G GU U U U AA A A A A AA A C CC C C U U U U U G G G G AA A A A U A N N C U A N N G U A N N A U N N C U A N N 50607080900111213 4 5 6 7 8 9 0 1 2 3 4 5 6 72 2 2 2 2 2 2 2121212121212122222222222222222

[0084] The MYOC RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the MYOC RNAi agents having the sense and antisense strand sequences that comprise or consist of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

[0085] In some embodiments, the antisense strand of a MYOC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of a MYOC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0086] As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.

[0087] Certain modified MYOC RNAi agent sense and antisense strands are provided in Table 3, Table 4, Table 5, Table 6, and Table 10. Certain modified MYOC RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Certain modified MYOC RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Tables 4, 5, and 6. In forming MYOC RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3, 4, 5, and 6, as well as in Table 2, above, can be a modified nucleotide.

[0088] The MYOC RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0089] In some embodiments, a MYOC RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0090] In some embodiments, a MYOC RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, Table 4, Table 5, Table 6, or Table 10.

[0091] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Tables 4, 5 and 6.

[0092] As used in Tables 3, 4, 5, 6, and 10, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups: A = adenosine-3′-phosphate C = cytidine-3′-phosphate G = guanosine-3′-phosphate U = uridine-3′-phosphate I = inosine-3′-phosphate a = 2′-O-methyladenosine-3′-phosphate as = 2′-O-methyladenosine-3′-phosphorothioate c = 2′-O-methylcytidine-3′-phosphate cs = 2′-O-methylcytidine-3′-phosphorothioate g = 2′-O-methylguanosine-3′-phosphate gs = 2′-O-methylguanosine-3′-phosphorothioate i = 2′-O-methylinosine-3′-phosphate is = 2′-O-methylinosine-3′-phosphorothioate t = 2′-O-methyl-5-methyluridine-3′-phosphate ts = 2′-O-methyl-5-methyluridine-3′-phosphorothioate u = 2′-O-methyluridine-3′-phosphate us = 2′-O-methyluridine-3′-phosphorothioate Af = 2′-fluoroadenosine-3′-phosphate Afs = 2′-fluoroadenosine-3′-phosporothioate Cf = 2′-fluorocytidine-3′-phosphate Cfs = 2′-fluorocytidine-3′-phosphorothioate Gf = 2′-fluoroguanosine-3′-phosphate Gfs = 2′-fluoroguanosine-3′-phosphorothioate Tf = 2′-fluoro-5′-methyluridine-3′-phosphate Tfs = 2′-fluoro-5′-methyluridine-3′-phosphorothioate Uf = 2′-fluorouridine-3′-phosphate Ufs = 2′-fluorouridine-3′-phosphorothioate dN = 2′-deoxythy modified nucleotide dT = 2′-deoxythymidine-3′-phosphate dTs = 2′-deoxythymidine-3′-phosphorothioate dA = 2′-deoxyadenosine-3′-phosphatedAs = 2′-deoxyadenosine-3′- phosphorothioate dC = 2′-deoxycytidine-3′-phosphate dCs = 2′-deoxycytidine-3′- phosphorothioate dG = 2′-deoxyguanosine-3′-phosphate dGs = 2′-deoxyguanosine-3′- phosphorothioate AUNA= 2’,3’-seco-adenosine-3’-phosphate AUNAs = 2’,3’-seco-adenosine-3’-phosphorothioate CUNA= 2’,3’-seco-cytidine-3’-phosphate CUNAs = 2’,3’-seco-cytidine-3’-phosphorothioate GUNA= 2’,3’-seco-guanosine-3’-phosphate GUNAs = 2’,3’-seco-guanosine-3’-phosphorothioate UUNA= 2’,3’-seco-uridine-3’-phosphate UUNAs = 2’,3’-seco-uridine-3’-phosphorothioate a_2N = 2’-O-methyl-2-aminoadenosine-3’-phosphate, see Table 11 a_2Ns = 2’-O-methyl-2-aminoadenosine-3’-phosphorothioate, see Table 11 (invAb) = inverted abasic deoxyribonucleotide-5’- phosphate, see Table 11 (invAb)s = inverted abasic deoxyribonucleotide-5’- phosphorothioate, see Table 11 s = phosphorothioate linkage ss = phosphorodithioate linkage p = terminal phosphate (as synthesized) cPrpa = 5’-cyclopropyl phosphonate-2’-O-methyladenosine-3’-phosphate (see Table 11) cPrpas = 5’-cyclopropyl phosphonate-2’-O-methyladenosine-3’- phosphorothioate (see Table 11) cPrpu = 5’-cyclopropyl phosphonate-2’-O-methyluridine-3’-phosphate (see Table 11) cPrpus = 5’-cyclopropyl phosphonate-2’-O-methyluridine-3’- phosphorothioate (see Table 11) (NH2-C6) = see Table 11 (NH-C6) = see Table 11 (NH-C6)s = see Table 11 Alkyne-L4-(NH-C6)s = see Table 11 αvβ3-SM2 = see Table 11 αvβ3-SM2-L4-(NH-C6)s = see Table 11

[0093] As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate or phosphorodithioate linkage “s” or “ss”), when present in an oligonucleotide, the nucleotide monomers are mutuallylinked by 5’-3’-phosphodiester bonds. As the person of ordinary skill in the art would clearly understand, the inclusion of a phosphorothioate or phosphorodithioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides. Further, the person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3’ end of a given oligonucleotide sequence would typically have a hydroxyl (-OH) group at the respective 3’ position of the given monomer instead of a phosphate moiety ex vivo. Additionally, for the embodiments disclosed herein, when viewing the respective strand 5’ ^ 3’, the inverted abasic residues are inserted such that the 3’ position of the deoxyribose is linked at the 3’ end of the preceding monomer on the respective strand (see, e.g., Table 11). Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate or phosphorodithioate chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosed herein encompass all phosphorothioate or phosphorodithioate tautomers (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the MYOC RNAi agents and compositions of MYOC RNAi agents disclosed herein.

[0094] Certain examples of targeting groups and linking groups used with the MYOC RNAi agents disclosed herein are included in the chemical structures provided below in Table 11. Each sense strand and / or antisense strand can have any targeting groups or linking groups listed herein, as well as other targeting or linking groups, conjugated to the 5’ and / or 3’ end of the sequence..O N DI435636637 8 9 0 1 5 5 5 2 8 5 3 4 5 6 7 8 9 4 063636364646363636463636464646464646464656( uduuuuu uguu ug uf acuu uguug ufung g gugss gs ggfgf ccgg uf guaufufuf fgu uT Uggfuf g guufuf gUuf uT Ug ufuu sauGuAf fg GaCuGfu C rtC S CgUgUg gfTd dggfUaCfuU UgUd fUgg gf fgfgfUc gf uc gfuAfGfGf fcC Cfg A ef f fUfUcs U n U U T U Tca Td feu uU U U cfcfUcUcfU Ucgcfuc gcufcAfgUfgf faU A UfA sfcUfuUfdUfcUfdUf gUug gcufUf fu ucg c c u cU Ufu uU Uu uagUufgf f f f fUfitu u u u u uAu uu ug uu uu uUfUUcUgU UuA nuAgu udug gu u uN Augug gA Ng Uf a ucuga ucuefufugfug gU fufufA daa guTuf f fuiUUfufU UuTfGAfguu u c g cacacauuuuauf UiaU U U U Ud aaaaaaaa aTd dgUa aaaaUuaaaUaadaaauuC aufaGfGfAf fC AfA ouguguguaguagugasfasau uggf gsu u u ufgfgfgfgfauacgufufafafafcUff f f f f fMAuA A A A ACCsdsfA AsAsAsAsAsAgsasgU asC asGsAs sUspusasasgrpurpurpurpurpurpu u u u a u u u u urprprprprprprprprprpr fsgsgsUfAfUf fAfPP P P P PcPcPcPc c c c c c c c csususG uasG cc c c cP P P P P P P P susadn 2 3 4 5 6 7 0 2 5 6 7a0rt60 0 0 0 0 3 3 2 2 2920313336777426 8 0 2 4D46 6 6 6 6 6 6 3 3 3 3 3 3 3 1 1 424243434340404040404 4 4 5 5 5 5 5 5 5 9 9 9 9 9 9 9 9SI 0 0 0 0 000000000000 0 0 0 0 0 0 0 0 0 0 0 0S A A A A A A A A A A0A0A0A0A0A0A0A9A9A9A9A9A9A A C C C C C C C C C C C C C C C C C C C C C C C.O N)'3→’5(ecneuqeSesaBgniylredn UdnaA C G C C AfCgC C U G C U U U G G U U A U C G rtgfafufcfafcfGafUcSAf fgUfa a c ufu afg u g c gfu u ufuUf f fCfAf f f fAf fUfu GuCgAgAaUcAcGcfcU fcfAaU fcfufAafufAcfUcAaU fufcfUcfUcfgfCues fn Uf f f f f fufU UfAfecU UcUgUuAuU AuGuGuCcGa gUgGaCgA G uaGa gUaCaGgCusfgitCf f f f funaA G A A AfaGf uga u u u u a c uuc c g u cgc cguacuucauau c u uua g cuaaaAgauaaucucuuAu uufacfgufggfafuf cgfuf caf caccgfufucfugfu cf gaducgcuacg gacaeuu gacccAaA fcAcAaCuCuUuUcUfa CaAaAuCuCfg AaUfu CcigfafiUfaAf faA Gf fafcf f f f f f f f f f f f f f f fU G GfUsUsU A U UsC A C C G U A A C A U daofuUfcfufcfufufUaf gsgsscs ssc c us ssa usscs s s s s s s ssa usc uscsasg uMsA U A Af f fsfsf fsf f fsf fsf f f fsfsfgs s sAs sGsCsA A U C A G U A A C G U A U G A G sf csf gsf gsf asf gsf asf asfsus s s s s s s s s s s s s s s spupu u a u a u u u u a u u u u aAsUsAsUsGsUsAsAsrPrpPrpPrpPrpPrpPrpPrpPrpPrpPrpPrpPrprprprpru u u u u u u a c c c c c c c c c c c cPcPcPcPcPcdn 6a38rt4304244 8 0 2 0 1 3 5 7 9 1 3 5 7 9 1 3 5 7 9 1D9409409440947098809880981 1 1 1 1 1 2 2 2 2 2 3 3 3 3 3 4094024124124124 4 4 4 4 4 4 4 4 4 4 4 4121212 2 2 2 2 2 2 2 2 2 2SI 9 9 9 9 9 9 9 9 9 9 9 9 9 91919191 1 1 1 1 1 1 1S A A A A A A A A A A A A A A A A A9A9A9A9A9A9A9A9A A C C C C C C C C C C C C C C C C C C C C C C C C C.O N)'3→’5(ecneuqeSesaBgniylredn UdnU U G A C U G C C CgCgg g g gufU Uf f fagrfgfufgfcfcfatfafCfCfu u u uC C CcSUcA AgfgfUgfUc c f fgfgfgfcfCgC C fgfgffaA fcA fgU fafAafAcfufUcUc cfUc cfgfgUfC C UgfgfUcUfc UUuUuU U U esC C C G C G nea u a u u uGuGuf fUU Uu fUc cu U uf uUcUcfUfcUfuucfcfcUgu ggsu uGG uiau gtgg uu u u a auuagc g cau uaac caaacuau uguug g u uUuf fu uu ufuggfuu ugU uu Uu uguuu uA ug gA NuN Ua ucaaccfn f f faA Cf f f f fuuUufUfg uuu uu uUuufUfdgCcA ef fuCaCcfAaUgAuaa afafUaUuaua aa gu guuf auaaa uaaGUaaaaac AaAaifiUsAf fs A CsAf f fs G U Gfs UAuA a a afsu u ususUsaa Uf faU Uf f f fU Uc csU Uu udu gsosfscsusgssassa gssgsgssgssgsgsgsgsfUausgssgs sis s s ssg g g g gM Cf f f f fsf f f f f f f f f f f fsfsfsfsfsfs U U U U A C U A A A A A A AgfgfA A A A A A A A ususususus s s s s s s s s s A A s s s s s s s sp p p p pupupupupupu u u u u u u u u u u u u u ur r r r r r r r r rprprprprprp p p p p p p p p pP P P P P P P P P P P P P P PrPrPrPrPrPr r r r rc c c c c c c c c c c c c c c c c c c cPcPcPcPcPcdn 3a45rt4474941 2 4 6 5 8 9 0 1 2 3 4 5 6 7 8 0 1 3 4 5D2412412451245124512451244 4 4 5 5 5 5 5 5 5 5 5 6 6 0 0 0129129129129129 9 9 9 9 9 9 9 9 9 1 1 1121212 2 2 2 2 2 2 2 3 3 3SI 9 9 9 9 9 9 9 9 9 9 9 9 9 91919191 1 1 1 1 1 1 1S A A A A A A A A A A A A A A A A A9A9A9A9A9A9A9A9A A C C C C C C C C C C C C C C C C C C C C C C C C C.O N)'3→’5(ecneuqeSesaBgniylredn Udn uagur ug fug f f fuf fufuf g g g g f f f g g gt fucCgUcgfufufCgCgCgCggfufCgCgCgCg ufufuCfCufAuAuAuufufAufS C egsfgf fU n U Uc cGuC C ggf f ffU U U UcCf fg U UfUfC UgfgfgfCgf f fA f U U UufufAuff gec uacfU UccfcGfcGf f fcG G UfcGfc cU UcGf fUc cfcfUcfcUfcUfUcUcUcsgit uGuacuAcNf fG GuauauauaccfuauaUuUu fUUuUfuU auaU uaf fuUfa UaU nacacuafUuauac c ccuauauauGc c ua ua u u guuguuu ugug uu acacac uaua auAuauaaaAAcac cu uaacacacac c auaacacfUf gUufufuf gu ucugcugcgcucu acdeicfucu fUfUaais cacf f f ffU U UUsaa fUfUaaaaUaUaUfaUf f f c caA A Agfg ufcifdgs s sosf gsgsgsfU Us s sggsgsgs fIcsfsgs u usgsgsgauauauauscscscA A A AfAfAfAgf fAfAfAfAfU Aif fAfAfsAfgAgf fgAfsAgf fsUfsUfcUfu cUf fMsusus s A s s s s s A s s s s A s s A s s s sUsUsp pupupupupupu u u u u u u u u u u u u u u u u ur r r r r r rprprprprprp p p p p p p p p p p p pP P P P P P P P P P P PrPrPrPrPrPrPr r r r r r rc c c c c c c c c c c c c c c c c cPcPcPcPcPcPcPcdn 6a07rt108 2 3 4 5 6 8 9 0 2 3 9 0 1 2 3 4 5 7 8 9 0 1D3101311131113111311 1 1 1 2 2 2 7 8 8 8 8 8 8 8 8 8 9 9131131131131131131 1 3 3 3 3 3 3 3 3 3 3 3 3131313 3 3 3 3 3 3 3 3 3 3 3SI 9 9 9 9 9 9 9 9 9 9 9 9 91919191 1 1 1 1 1 1 1 1S A A A A A A A A A A A A A A A A9A9A9A9A9A9A9A9A9A A C C C C C C C C C C C C C C C C C C C C C C C C C.O N)'3→’5(ecneuqeSesaBUgnSU A A A A A A A A C C C CnaA C C C CiysC U U U U U U U UlaU A A A A A A A Aren U A A A A A A A AdwnoG C C C C C C C C h A U U U U U U U U US(C G G G G G G G G U A A A A A A A A U U U U U U U U U . O N DI112131415161718191Q5 5 5 5 5 5 5 5 5E S )'3→’a g g5s(sc csggssss ssasagsdang aaurfuaguau gsuggsugsauugugsuaucsauf gtAfuCfCfuCggfugCgfSuefg uUuf fC s Ufgfgf ccUgfncefUcUcUgcf fC Gg cgU siUf f fUct afufaUuacf eenuGauGauGuc c cG Ac cacaGuuAguuAuaditdoitodueuucif gfu uacNacNcuel elAfAfAua AUua AUaacci f a a a ad A oc cfucgucucauca acucucu f un unUe)fgfgfgfgfgfgfgni enM UsuAuA A A A A AfAso insoprpupupupupupupup eniPrPrPrPrPrPrPrPr da(c c c c c c c cPc onenidn 2iha98393041434546474mtnrt3SDI 3413491349134 4 4 4 4 a-9139139139139131 2ax=oA9pS A A A A A A A9A) yA C C C C C C C C CN2hA(=I1 .1OelNbD091 2 3 4 5 5 4 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0aI696969696969696969 9 9 0 0 0 0 0 0 0 0 0 0 1TQ6 6 6 7 7 7 7 7 7 7 7 7 7 7eesE(SseiteioMgnippaCro,sdnagiLgnitegraTdetagujnoC,srekniLtuohtiwnwohS(s’ a auc c ue5c(gugu u a a a a a a a auunedauau u a a aua g aca uuauun aucaucuacu uacacuaca ucaauuaugucccu uaccu aacaguuca caa aguaccuu ugucqaertucuauauuuuuuguguuucca u uauc uuga caiua uaa g u c acuuu a afc guguuauguuSSdecua ans fcfagcaaacaucaugaagacaucg g afu a cuafG cfg uua a gAf gac g gUf f ca Af g ganrt eGfAf faAfaAfu u aAfAfAfAfaGfaCfuGfCAf fuGfuUfuUfAUfUf fuG Cf faAfASSGed fAf fAfAf f f f f f f fG fA CfC A AfAfAfAfaf f f fC cUfGfU CfaA cafuUA faf fgUfCfseniUe) fiaA fgffGaGfa GaGfa Gfa GaCuGaGaAgU GfCGu uAuU US). dCcuac u a a aggug ug uc u uoaA acc c c c c c g gggagagagag g uacccc a uugaNuauacccuga u uN Nag a aNcggatng cacac c 2gc 2 u aunoMu c c c c u g g u ga2 2 aeitu c aaaaaaa a aacgccg cc_aa u c _ _ u _ c cg aucaa g g gucuc g uga u gcccccguga a u a u aA mg c g c c g gCrofnL L L L L L L L L L L L L L L L L L L L L L eN N N N N N N N N N N NLOiD- - -N N N N N N N N N N NYrI921-38-22-34-75-73-75- -732527-29- - - - - - - - - - -2133353739314347 9 1 3Mu d6 6 3 3 7 7 2 1 47 7 8 8.tn4 4 4 4 4 4 4 4 4 4 8 8 8 84celurart404b tS 005S005S006S006S008S009 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9S00S00S90S90S90S90S90 0 0 0 0 0 0 0 0 0S9S9S9S9S9S9S9 9 9 9a srS S S S o C C C C C C C C C C C C C C C C C C C C C C C Tf.O NI)'3→’5(ecneuqeSesaBgniylredn U . I)'’5( a a u uugga a u a a u a a a a a ucdaggguagcaag uua gaaucaaaguaagcauuccaagaacaagaaacguac auaacuu acunaargu a atuu a agcuacucg gaagg gga uc aa gu auuu uaugcgguuauaaagagcuggugaguuuggagccaauu auu uaua a ccu auucS g auccgf fgg acagacg uca u u u uu ga faaes gaca canf fagfaf gu UfCf gguaauagu uaca c agg uauaccaaa acg cagugauca Af acfacaeSAffGfU C C CfGf fAfUfaUfCfUfaUfCfAfUfAfaUfAfAfAfAfAAfAf fA dC Gf f fAuGuf f f f f f f f f f f f f f f fAfAfef fCfAfAu cUfC CfU A G C G G G G C G CfCfA a AifG iaUuGaAfg UaaauGfa U Af fa G Gf f f f f f f fa G CaA G U G CUaGuAfG u Gaf fdu cGaGaguagcaugac uaa a aucccguacaaauaaag agaccu u uacaaccuggucuagcgf c co g a c u cN Ng c c a a c u c c a a c a u ugaAgagaMagggu c a 2 2 g a cug c c c c g caa g a c a c c c cg ugagcaga_a_ ucuca u g a a g g a g g c a a a ag g g g gac g gggccgcgaagagacggucacacucgcagagagagL N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L N L L L DI -d2- - - - - - - - - - - - - - - - - - - - - -N-N-N- n14a 4161810 2 4 6 8 0 2 4 6 8 0 2 4 6 8 0 3 5 4 6 7 9rt24124224242242242 224243 3 3 3 3 4 4 4 4 4 5 5 5 4 4 4 5242424 4 4 4 4 4 4 4 4 4 4 9 9 9 9919191919191919191912912912912912912912 2 2 2 2 2 2 2 291 1 1 1 1 1 1 1 1S S S S S S S S S S S S S S S S S S9S9S9S9S9S9S9S9S9S C C C C C C C C C C C C C C C C C C C C C C C C C C.O NI)'3→’5(ecneuqNeSdGG G G CG G U U U U GU Ueeis fiU U U U AU U AA GadA A A A oGG G G U AG G BgmU U U Unn AA A A U U U A AiylUCC C C AC CrGG G G GG GenaAA A A AA Ad CC C C A nsaC C GG G G U G G Un wAA A A AA A oCC C C CC C h AA A A U A A S(U U C U GU U G G G C U C C . O N DI960571 257573 457575575Q E S )'3→’a5u(caauaca a aaudgna u ag ucucaguuc cagr uta ua aug g c aggu uuS gf auguue au ag ua agsUf fUgaug ua gf f eeneAf fAfuf fUSC c AfAfUf fUfdi ditAAftoodfGfCfCfAfcfCfel eleifiaG cad gcG G GG Gcu cuofg acacaaacacnn)AfAgagauagag eneMcacuacac cucac is nisgugca a agucguucucone odni(L L L L L L LaeDIN-Nd9-N0-N-N-N-No-ninimhtn0 17 1 6 2 4 a na 1rt311121834444- ax1313131313131 2oS 9S9S9S9S9S9S9= S)pyC C C C C C CN2hA(=IDI.QO091692693694695695 4 6 7 8 9 0 1 2 3 4 5 6 7 869 9 9696969607070707070 0 0 0EN6 6 7 7 7 7Se) eA AA Ar' dutcurtsrof11elbaTees(dnagils)73GA N(rorekniL)6C-2HN(htiWnwohS(se tcSGfAf fnAfAAf f f f f f f fCA fC agacA A A AGa U G U C a a UAaeeusU Af fqnafgfG G GfaG uafaAf f f f f cACuG GaA gf f f f caUuGaCaG uuguf guAuuueeSCaAacac c cf fgag cuc cac g g gaga CfAf uaccc g au a aac gNu u c g ugug cNagaSd dn ei gguuaccaac c c c uucag 2g cuugacN2 2 uN2afaaaaaauGaGacgc g c _ga u c a _ _ u _ritducasasgsgsgscscgcggcsugsacsuasgcscc c u a a u ascsgsgscsgscscsSo)esMb)b)b)b)b)ba-ca-c) ) ) ) ) ) ) ) ) ) ) ) )A A AAA A auaa bAbAbAbAbAb b b b b b b bev v v vv vHcHg v v v v vAvAvAvAvAvAvA Ann n n nniniNS it(s i(s i(s i(s (s(s (-s4)bN(-s n n n n n n n n n n nvnvn4)bi(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(n )e 7) ) ))6)6LAg 37G37G37G3C C - G -2-2 e vL- An ni(e v )7) )nni(37G37) ) ) ) ) ) ) ) )s)G37G37G37 7 7 7 7 7 7 7G3 3 3 3 3 3 3 3AG GG G GG G G A A AA H Hy s ) y s)A A AA A A AA A AAON N N N(N(N k(lA6kClA6CNA A C( ( ( (N(N(N(N(N(N(N(N N N N NY)( ( ( ( ().Mn.o 9 1 8 2 4 55iDtI 2a d63623337773775273125427429421433435 7 9 1 3 7 9434343444447878n4l04050506 6 8 9 9 9 9 9 9 9 9 9 9 9 9 9 9e m abr r 0 0 0 000000000090909090 0 0 0 0 0 0 0 0aoftS S S S S S S S S S S S9S9S9S9S9S9S9S9S9S C C C C C C C C C C C C C C C C C C C C C Tni SDI.QO90011121314151617181910212223242526272829203132349)'3→’5(ecneuqeSesaBgniylrednU IrtAfAfAfGfUfCfCfA GAfUfUfC UfU C A U AfUfA AfAfAfASU C C G C A A u u U C CfUAfGfCfGfGG GfCG C Cfesf f fGfUf f f uacaf f f f f f f f f f f f f f fAfnU Ua uGaAgUa uGaU AaG G G C A G U G C U GuAuGeuaug u u g auc u auc gu aaaaaag acu u u au uaS c a g a c gaa a a c c aca u a gac acaaccugc gcg g a c u N N g c c a c c ag gd aua gcca u c a c a u u aeificaucaggguugcagaca2a_2 g aa_daucucug c c c c g cgacu g aaaag aa g a c a cgg a g g c aaogs) gsgsgsgsb)b)b)b) gsgsgscsgsgsb)b)b)b)b) ) gs) cgs) cgs) as) gs) gas) cs) gus) cas) cas) cu gs) cs) cs) gs)M A AA A A AA A AbAbAbAbAbAbAbAb b b b b b b b bvv v v v v v v v v v v v v v vAvAvAvAvAvAvAvA A n( n n n n n n n n n n n n nv vis i)(s i(s i(s i( n n n n n n n n n n nsi(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(s i(i(i(i(i(7) ) ) ) ) ) ) ) ) )s s s s s373737373737373737 7)7)7)7)7)7)7)7)7)7)7)7)7)7)7G GG G G GG G G3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G A N A N A N A N A N A N A N A A AA A A AA A A A AA A A AA (N(N(N(N(N(N(N(NA (( ( ( ( ( (N(N(N(N(N(N(N(N(N(N(DI183 2 4 6 8 0 2 4 6 8 0 2888141414142424242 2 3 3436383042444648405355544d4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 9n9r090212121212 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2at9 9 9 9 9 9191919191919191 1 1 1 1 1 1 1 1 1 1 1S S S S S S S S S S S S S S9S9S9S9S9S9S9S9S9S9S9S9S C C C C C C C C C C C C C C C C C C C C C C C C CDI.QO49493340404359535959)'3→’5(ecneuqeSesaBgniylredwnohC CC C C CC C C C A AA A A AA U USA A ( A AA U U CU G U U G G G G G G C U C C DI.O223242526 7 8 9 0 1Q2 2 2 2 3 3E N6 6 6 6 6 6 6 6 6 6S )b)Abv) A )b) ) ) )bnb)viA(sAbvAni v bAb b)A AbAAvnvn(snai( vnvnvnivn ni()'au i(3 ca si( ucsa i(s i(s(si(s sau ausauaguca auauaa au uc→u’a ca cauu gc c gua5a(c uu a gagucca aguf ucag uauuuugagudu uanA afacafafca Ufgfagaggu ag gfrAfAf fAfUfufufaf fUU Uf ftASAfAafACA fcfAfACfCfAAAfesG nafGfG GaGf f fcfCfec cacG G G G GSgf acac gfgf acacaaa auc cAgaga A Ag gag gd c c c c cacac ca aeifiaaadogaaaauauaca uc cga aed eds) gsgsgu u usgsgsc u c cit itMb)Ab)b)b) )s)s)s)s)oe oelvAA Ab b b b b b lcnv vAvAA A A Au cui( nvs i)( nv v v v vs i( nsi( nsi( n n n n nnnsi(s i(s i(s i(i(en )e7)37)37)37)37)37)37)s s37)37)i37sonisG GG G G GG G G3GnA AA A A AAe odni(N(N(N(N(N(N(NA A A (N(N(N(aoneiniDI647 9 9 0mht9495907 1 6 2 411 1 2 8 4 4a-nad 2 2 21 1 1 3 4 4 2 xn1 1 13 3 3 3 3 3 3=oart9SS9S91 1 1 1 1 1 1 pS9S9S9S9S9S9S9S) yC C C C C C C C C CN2hA(=I.seOta NgD495ujIn696oQcEdSnagilgnitegratehtfoqsedconU e A C Aer SemuGutscanuUqeA U S A ArtB nA Cs gaG GenisA Ah yl aC n CTrewG G).edoA Atnh C CagUS(A AuA UjnG Coc.dOnNagiD2lI 33636gQnitEeSgrat)b)bhtiAvAwnvn)'i( nis(swo 3a auhuc cS→ a a( ’u gs5e( ucndauaucage n au aq rfuAfeAS.t1Sf fd1 esAfCfnaerlneGaGatbSaS-cTdgesn eHa-cgNcHaa Ncani ifi (eSnd -a (-uo 4gs)4cs)twoL M - L 2b-2 bnehgs AeMvAnMvnArSa-3i( S- i(C)O2 β sv)α 63β s )Cvα 6CY MM S-.3 DI4556βed95696lvαb,n 0 0a . aert 0S0S T.i(S C C

[0095] The MYOC RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0096] As shown in Table 5 above, certain of the example MYOC RNAi agent nucleotide sequences are shown to further include reactive linking groups at one or both of the 5’ terminal end and the 3’ terminal end of the sense strand. For example, many of the MYOC RNAi agent sense strand sequences shown in Table 5 above have a (NH2-C6) linking group at the 5’ end of the nucleotide sequence. Other linking groups, such as a (6-SS-6) linking group or a (C6-SS- C6) linking group, may be present as well or alternatively in certain embodiments. Such reactive linking groups are positioned to facilitate the linking of targeting ligands, targeting groups, and / or PK / PD modulators to the MYOC RNAi agents disclosed herein. Linking or conjugation reactions are well known in the art and provide for formation of covalent linkages between two molecules or reactants. Suitable conjugation reactions for use in the scope of the inventions herein include, but are not limited to, amide coupling reaction, Michael addition reaction, hydrazone formation reaction, inverse–demand Diels–Alder cycloaddition reaction, oxime ligation, and Copper (I)- catalyzed or strain-promoted azide-alkyne cycloaddition reaction cycloaddition reaction.

[0097] In some embodiments, targeting ligands, can be synthesized as activated esters, such as tetrafluorophenyl (TFP) esters, which can be displaced by a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to the MYOC RNAi agents disclosed herein. In some embodiments, targeting ligands are synthesized as azides, which can be conjugated to a propargyl or DBCO group, for example, via Copper (I)- catalyzed or strain-promoted azide-alkyne cycloaddition reaction.

[0098] Additionally, certain of the nucleotide sequences can be synthesized with a dT nucleotide at the 3’ terminal end of the sense strand, followed by (3’ ^ 5’) a linker (e.g., C6-SS-C6). The linker can, in some embodiments, facilitate the linkage to additional components, such as, for example, a lipid or one or more targeting ligands. As described herein, the disulfide bond of C6- SS-C6 is first reduced, removing the dT from the molecule, which can then facilitate the conjugation of the desired component. The terminal dT nucleotide therefore is not a part of the fully conjugated construct.

[0099] In some embodiments, the antisense strand of a MYOC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3 or Table 10. In some embodiments, the sense strand of a MYOC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4, Table 5, Table 6, or Table 10.

[0100] In some embodiments, a MYOC RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, a MYOC RNAi agent antisense strand comprises the sequence of nucleotides (from 5’ end ^ 3’ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2, Table 3, or Table 10. In certain embodiments, a MYOC RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0101] In some embodiments, a MYOC RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, a MYOC RNAi agent sense strand comprises the sequence of nucleotides (from 5’ end ^ 3’ end) 1-17, 2-17, 3- 17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 4-20, 1-21, 2-21, 3-21,4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24, of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10. In certain embodiments, a MYOC RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0102] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5’ end ^ 3’ end) can be perfectly complementary to a MYOC gene, or can be non-to a MYOC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5’ end ^ 3’ end) is a U, A, or dT (or a modified version of U, A or dT). In some embodiments, theat position 1 of the antisense strand (from 5’ end ^ 3’ end) forms an A:U or U:A base pair with the sense strand.

[0103] In some embodiments, a MYOC RNAi agent antisense strand comprises the sequence of nucleotides (from 5’ end ^ 3’ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or10. In some embodiments, a MYOC RNAi sense strand comprises the sequence of nucleotides (from 5’ end ^ 3’ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0104] In some embodiments, a MYOC RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5’ end ^ 3’ end) 2-18 or 2-19 of any of the antisense strandsequences in Table 2, Table 3, or Table 10, and (ii) a sense strand comprising the sequence of nucleotides (from 5’ end ^ 3’ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0105] A sense stranda sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3 provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the MYOC RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10. Certain representative sequence pairings are exemplified by the Duplex ID Nos. shown in Tables 7A, 7B, 8, and 9A.

[0106] In some embodiments, a MYOC RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the Duplex ID Nos. presented herein. In some embodiments, a MYOC RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, a MYOC RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, a MYOC RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and / or other non- nucleotide group wherein the targeting group, linking group, and / or other non-nucleotide group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, a MYOC RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, a MYOC RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non- nucleotide group is covalently linked to the sense strand or the antisense strand.

[0107] In some embodiments, a MYOC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7A, 7B, 8, 9A, or 10, and comprises a targeting group. In some embodiments, a MYOC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7A, 7B, 8, 9A, or 10, and comprises one or more targeting group.

[0108] In some embodiments, a MYOC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7A, 7B, 8, 9A, or 10, and comprises a targeting group. In some embodiments, a MYOC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7A, 7B, 8, 9A, or 10, and comprises one or more targeting groups.

[0109] In some embodiments, a MYOC RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 7A, 7B, 8, 9A, and 10.

[0110] In some embodiments, a MYOC RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 7A, 7B, 8, 9A, and 10, and comprises a targeting group.

[0111] In some embodiments, a MYOC RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Tables 7A, 7B, 8, 9A, and 10.

[0112] Table 7A. MYOC RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. (Shown without Linking Agents or Conjugates) AS AS SS SS D l AS ID modified unmodified SS ID modified unmodifiedAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ ID

[0113] Table 7B. MYOC RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. AS AS SS SS Duplex AS ID modified unmodified SS I modified unmodified E ID E ID D E ID E IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ ID

[0114] Table 8. MYOC RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. (Shown with targeting ligand conjugates) AS AS SS SS Duplex AS ID modified unmodified modified unmodified E ID E ID SS ID E ID E IDin (MYOC) gene Targeted MYOC Gene Duplex AS ID SS ID Position)set .a O gujNnD4 3 8 9oI 1cQ5052424Eul e aac snicu ugaaaituac( ngAf fg uAAsasgs u uad pu unarprprprrtsPcPcPcPces.neO sdNnD aI332 2 3e 6363636s Q ne EsiStnadedie )ftab) ) )Ab b bido gujvA A A nvnvnvnmn iylloaC )(’s i(s i(is(s3aua a accucu ucihtmi^agacuauagew’h5 uc d( uu u uaaaa uaheti )dgucaacaguifiwdonf f f faA AfA Argi fCf fse MLfAfAfCfbymllgGaGaGaGau uni-cn Fg-cg-cg-cg( teHacHacHacHaDgN a N a N NcIdetn ra (-( (a(a4uc -ag -ag -ucaagrT t L-s)4Lsu2 b- )4Ls2 b- )4Ls2 b- )bjSn eosMAn SvMAvA2vAvCe -n3i(sS-n3iM (sS-n3iM (S-n3i(.Sβ0vα 6 ) β)sCvα 6 βv) s6 βv)61 CαCαC elbaT Dr5I e06701 274747]b 56C m05 7 710000001 A u C C C0C 0 N [ A A A A

[0117] In some embodiments, a MYOC RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, a MYOC RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, a MYOC RNAi agent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt The RNAi agents described herein, upon delivery to a cell expressing an MYOC gene, inhibit or knockdown expression of one or more MYOC genes in vivo and / or in vitro. Targeting Groups, Linking Groups, and Delivery Vehicles

[0118] In some embodiments, a MYOC RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, a linking group, a pharmacokinetic / pharmacodynamic (PK / PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or attachment of the RNAi agent. The non-nucleotide group can be covalently linked to the 3’ and / or 5’ end of either the sense strand and / or the antisense strand. In some embodiments, a MYOC RNAi agent contains a non-nucleotide group linked to the 3’ and / or 5’ end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5’ end of a MYOC RNAi agent sense strand. A non- nucleotide group can be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0119] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

[0120] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which in some instances can serve as linkers.

[0121] A targeting group, with or without a linker, can be attached to the 5’ or 3’ end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10. A linker, with or without a targeting group, can be attached to the 5’ or 3’ end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10.

[0122] The MYOC RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5’-terminus and / or the 3’- terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.

[0123] For example, in some embodiments, the MYOC RNAi agents disclosed herein are synthesized having an NH2-C6group at the 5’-terminus of the sense strand of the RNAi agent. The terminal amino group subsequently can be reacted to form a conjugate with, for example, a group that includes a lipid moiety or targeting group. In some embodiments, the MYOC RNAi agents disclosed herein are synthesized having one or more alkyne groups at the 5’-terminus of the sense strand of the RNAi agent.

[0124] In some embodiments, targeting groups are linked to the MYOC RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily present to facilitate the linkage to a MYOC RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents can be linked to their respective targeting groups using the same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.

[0125] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be linked to the 3’ and / or the 5’ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5’ or 3’ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5’ end of an RNAi agent sense strand. Examples of linking groups, include but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such a primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, tri-alkyne functionalized groups, ribitol, and / or PEG groups. Examples of certain linking groups are provided in Table 11.

[0126] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as atargeting group, pharmacokinetic modulator, or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and / or length to the linkage. Spacers include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description. In some embodiments, a MYOC RNAi agent is conjugated to a polyethylene glycol (PEG) moiety, or to a hydrophobic group having 12 or more carbon atoms, such as a cholesterol or palmitoyl group.

[0127] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which in some instances can serve as linkers. In some embodiments, a targeting group comprises an integrin targeting ligand.

[0128] In some embodiments, a targeting group comprises an integrin targeting ligand. In some embodiments, an integrin targeting ligand is an αvβ3 and / or αvβ5 integrin targeting ligand. The use of an αvβ3 and / or αvβ5 integrin targeting ligand facilitates cell-specific targeting to cells having αvβ3 and / or αvβ5 integrin receptor on its respective surface, and binding of the integrin targeting ligand can facilitate entry of the therapeutic agent, such as an RNAi agent, to which it is linked, into cells such as epithelial cells and trabecular meshwork cells. Integrin targeting ligands can be monomeric or monovalent (e.g., having a single integrin targeting moiety) or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3′ and / or 5′ end of the RNAi oligonucleotide using methods known in the art.

[0129] Any of the MYOC RNAi agent nucleotide sequences listed in Tables 2, 3, 4, 5, 6, and 10, whether modified or unmodified, can contain 3’ and / or 5’ targeting group(s) and / or linkinggroup(s). Any of the MYOC RNAi agent sequences listed in Tables 3, 4, 5, 6, and 10, or are otherwise described herein, which contain a 3’ or 5’ targeting group, and / or linking group can alternatively contain no 3’ or 5’ targeting group or linking group or can contain a different 3’ or 5’ targeting group or linking group including, but not limited to, those depicted in Table 11. Any of the MYOC RNAi agent duplexes listed in Tables 7A, 7B, 8, 9A and 10, whether modified or unmodified, can further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 11, and the targeting group or linking group can be attached to the 3’ or 5’ terminus of either the sense strand or the antisense strand of the MYOC RNAi agent duplex.

[0130] Examples of certain modified nucleotides, capping moieties, linking groups, and targeting groups are provided in Table 11. Table 11. Structures Representing Various Modified Nucleotides, Capping Moieties, Targeting Groups, and Linking Groups (wherein indicates the point of connection)O H2N P O O S / 126y, g g p y . y ces, linking groups can be commercially acquired or alternatively, are incorporated into commercially available nucleotide phosphoramidites. (See, e.g., International Patent Application Publication No. WO 2019 / 161213, which is incorporated herein by reference in its entirety).

[0132] In some embodiments, a MYOC RNAi agent is delivered without being conjugated to a targeting ligand or pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as being “naked” or a “naked RNAi agent”).

[0133] In some embodiments, a MYOC RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate delivery of the MYOC RNAi agent to the cell or tissue of choice, for example, to an ocular cell in vivo. In some embodiments, a MYOC RNAi agent is conjugated to a lipid moiety. In some embodiments, a MYOC RNAi agent is conjugated to a targeting group.

[0134] In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

[0135] In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art for nucleic acid delivery. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesteryl and cholesteryl derivatives), encapsulating in nanoparticles, liposomes, micelles, conjugating to polymers or DPCs (see, for example WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), by iontophoresis, or by incorporation into other delivery vehicles or systems available in the art such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors. In some embodiments the RNAi agents can be conjugated to antibodies having affinity for ocular cells. In some embodiments, the RNAi agents can be linked to targeting ligands that have affinity for ocular cells or receptors present on ocular cells.

[0136] To evaluate the activity of MYOC RNAi agents in a MYOC-AAV model as described in the Examples below, certain MYOC RNAi agents were conjugated to an N-acetyl-galactosamine (NAG) containing targeting ligand having the chemical structure referred to as NAG37 (see Table 11). NAG37 is known to have high affinity to bind to asialoglycoprotein receptors that are abundantly expressed on liver cells, including hepatocytes (see, e.g., International Patent Application Publication No. WO2018044350A1). The use of NAG37-conjugated MYOC RNAi agents was to evaluate the expression of AAV-MYOC in the liver.

[0137] In some embodiments, an MYOC RNAi agent is delivered without being conjugated to a targeting ligand or pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as being “naked” or a “naked RNAi agent”). Pharmaceutical Compositions and Formulations

[0138] The MYOC RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “medicaments”). In some embodiments, pharmaceutical compositions include at least one MYOC RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of MYOC mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. Thepharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering a MYOC RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical compositions that include a MYOC RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0139] The pharmaceutical compositions that include a MYOC RNAi agent and methods disclosed herein decrease the level of the target mRNA in a cell, group of cells, tissue, organ, or subject, including by administering to the subject a therapeutically effective amount of a herein described MYOC RNAi agent, thereby inhibiting the expression of MYOC mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder that can be mediated at least in part by a reduction in MYOC expression. In some embodiments, the subject has been previously diagnosed with having one or more ocular diseases such as glaucoma (e.g. POAG). In some embodiments the ocular disease is POAG.

[0140] In some embodiments the subject has been previously diagnosed with having ocular disease.

[0141] Embodiments of the present disclosure include pharmaceutical compositions for delivering a MYOC RNAi agent to an ocular cell in vivo. Such pharmaceutical compositions can include, for example, a MYOC RNAi agent conjugated to a targeting group.

[0142] In some embodiments, the described pharmaceutical compositions including a MYOC RNAi agent are used for treating or managing clinical presentations in a subject that would benefit from the inhibition of expression of MYOC. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed MYOC RNAi agents can be used to decrease the number, severity, and / or frequency of symptoms of a disease in a subject.

[0143] In some embodiments, the described MYOC RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutics. A second therapeutic can be another MYOC RNAi agent (e.g., a MYOC RNAi agent that targets a different sequence within a MYOC gene). In some embodiments, a second therapeutic can be an RNAi agent that targets the MYOC gene. An additional therapeutic can also be a small molecule drug, antibody, antibody fragment,and / or aptamer. The MYOC RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.

[0144] The described pharmaceutical compositions that include a MYOC RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of MYOC mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions that include a MYOC RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more MYOC RNAi agents, thereby preventing or inhibiting the at least one symptom.

[0145] In some embodiments, one or more of the described MYOC RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0146] The route of administration is the path by which a MYOC RNAi agent is brought into contact with the body. In general, methods of administering drugs, oligonucleotides, and nucleic acids, for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The MYOC RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, in some embodiments, the herein described pharmaceutical compositions are administered via intracameral or intravitreal administration. In some embodiments, the pharmaceutical compositions can be administered by intracameral administration.

[0147] The pharmaceutical compositions including a MYOC RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by intravitreal or intracameral administration. In some embodiments, the compositions are administered via intracameral administration. For example, in some embodiments, it is desired that the MYOC RNAi agents described herein inhibit the expression of an MYOC gene in ocular cells.

[0148] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0149] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds andone or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., MYOC RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0150] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti- foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.

[0151] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0152] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared byincorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0153] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.

[0154] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No.4,522,811.

[0155] The MYOC RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

[0156] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” orsimply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic, or preventive result.

[0157] In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another MYOC RNAi agent (e.g., a MYOC RNAi agent that targets a different sequence within the MYOC target). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0158] In some embodiments, described herein are compositions that include a combination or cocktail of at least two MYOC RNAi agents having different sequences. In some embodiments, the two or more MYOC RNAi agents are each separately and independently linked to lipids or targeting groups.

[0159] In some embodiments, described herein are compositions that include a combination or cocktail of at least two MYOC RNAi agents having different sequences. In some embodiments, the two or more MYOC RNAi agents are each separately and independently linked to targeting groups.

[0160] Described herein are compositions for delivery of MYOC RNAi agents to ocular cells. Furthermore, compositions for delivery of MYOC RNAi agents to cells, including epithelial cells, ocular cells, in vivo, are generally described herein.

[0161] Generally, an effective amount of a MYOC RNAi agent disclosed herein will be in the range of from about 0.0001 to about 20 mg / kg of body weight / deposited dose, e.g., from about 0.001 to about 5 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a MYOC RNAi agent will be in the range of from about 0.01 mg / kg to about 3.0 mg / kg of body weight per deposited dose. In some embodiments, an effective amount of a MYOC RNAi agent will be in the range of from about 0.03 mg / kg to about 2.0 mg / kg of body weight per deposited dose. In some embodiments, an effective amount of a MYOC RNAi agent will be in the range of from about 0.01 to about 1.0 mg / kg of deposited dose per body weight. In some embodiments, an effective amount of a MYOC RNAi agent will be in the range of from about 0.50 to about 1.0 mg / kg of deposited dose per body weight. In some embodiments, an effective amount of a MYOC RNAi agent will be in the range from 0.001 mg to 10 mg per eye. In some embodiments, an effective amount of a MYOC RNAi agent will be in the range from 0.1 mg to 5 mg per eye. In some embodiments, an effective amount of a MYOC RNAi agent will be in the range from 0.1 to 2 mg per eye. In some embodiments, an effective amount of aMYOC RNAi agent will be in the range from 0.1 to 1 mg per eye. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum. In some embodiments, a dose is administered daily. In some embodiments, a dose is administered weekly. In further embodiments, a dose is administered bi-weekly, tri-weekly, once monthly, or once quarterly (i.e., once every three months).

[0162] For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including a MYOC RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide, and / or an aptamer.

[0163] The described MYOC RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. Methods of Treatment and Inhibition of MYOC Expression

[0164] The MYOC RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a reduction and / or inhibition in expression of MYOC mRNA and / or a reduction in MYOC receptor levels.

[0165] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or disorder for which the subject would benefit from reduction in mutant MYOC, including but not limited to, glaucoma. Treatment of a subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more MYOC RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.

[0166] Mutant MYOC activity is known to promote ocular disorders. In some embodiments, the described MYOC RNAi agents are used to treat at least one symptom mediated at least inpart by a reduction in mutant MYOC levels, in a subject. The subject is administered a therapeutically effective amount of any one or more of the described MYOC RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.

[0167] In certain embodiments, the present disclosure provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by MYOC gene expression, in a patient in need thereof, wherein the methods include administering to the patient any of the MYOC RNAi agents described herein.

[0168] In some embodiments, the MYOC RNAi agents are used to treat or manage a clinical presentation or pathological state in a subject, wherein the clinical presentation or pathological state is mediated at least in part by a reduction in MYOC expression. The subject is administered a therapeutically effective amount of one or more of the MYOC RNAi agents or MYOC RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising a MYOC RNAi agent described herein to a subject to be treated.

[0169] In a further aspect, the disclosure features methods of treatment (including prophylactic or preventative treatment) of diseases or symptoms that may be addressed by a reduction in MYOC receptor levels, the methods comprising administering to a subject in need thereof a MYOC RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10. Also described herein are compositions for use in such methods.

[0170] The described MYOC RNAi agents and / or compositions that include MYOC RNAi agents can be used in methods for therapeutic treatment of disease or conditions caused by enhanced or elevated MYOC receptor activity levels. Such methods include administration of a MYOC RNAi agent as described herein to a subject, e.g., a human or animal subject.

[0171] In another aspect, the disclosure provides methods for the treatment (including prophylactic treatment) of a pathological state (such as a condition or disease) mediated at least in part by MYOC expression, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10.

[0172] In some embodiments, methods for inhibiting expression of an MYOC gene are disclosed herein, wherein the methods include administering to a cell an RNAi agent that includes anantisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10.

[0173] In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by MYOC expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0174] In some embodiments, methods for inhibiting expression of an MYOC gene are disclosed herein, wherein the methods comprise administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0175] In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by MYOC expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising the sequence of any of the sequences in Table 3 or Table 10.

[0176] In some embodiments, methods for inhibiting expression of a MYOC gene are disclosed herein, wherein the methods include administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising the sequence of any of the sequences in Table 3 or Table 10.

[0177] In some embodiments, methods of inhibiting expression of a MYOC gene are disclosed herein, wherein the methods include administering to a subject a MYOC RNAi agent that includes a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and the antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3 or Table 10. In other embodiments, disclosed herein are methods of inhibiting expression of a MYOC gene, wherein the methods include administering to a subject a MYOC RNAi agent that includes a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, or Table 10, and the antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10.

[0178] In some embodiments, methods for inhibiting expression of an MYOC gene in a cell are disclosed herein, wherein the methods include administering one or more MYOC RNAi agents comprising a duplex structure of one of the duplexes set forth in Tables 7A, 7B, 8, 9A, and 10.

[0179] In some embodiments, the gene expression level and / or mRNA level of an MYOC gene in certain ocular cells of subject to whom a described MYOC RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the MYOC RNAi agent or to a subject not receiving the MYOC RNAi agent. In some embodiments, MYOC mRNA or myocilin protein levels in certain ocular cells of a subject to whom a described MYOC RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the MYOC RNAi agent or to a subject not receiving the MYOC RNAi agent. The gene expression level, protein level, and / or mRNA level in the subject may be reduced in a cell, group of cells, and / or tissue of the subject. In some embodiments, the MYOC mRNA levels in certain ocular cells subject to whom a described MYOC RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the MYOC RNAi agent or to a subject not receiving the MYOC RNAi agent.

[0180] A reduction in gene expression, mRNA, and protein levels can be assessed by any methods known in the art. Reduction or decrease in mutant myocilin activity level and / or myocilin protein levels are collectively referred to herein as a decrease in, reduction of, or inhibition of MYOC expression. The Examples set forth herein illustrate known methods for assessing inhibition of MYOC expression and MYOC gene expression. Cells, Tissues, Organs, and Non-Human Organisms

[0181] Cells, tissues, organs, and non-human organisms that include at least one of the MYOC RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.Additional Illustrative Embodiments

[0182] Provided here are certain additional illustrative embodiments of the disclosed technology. These embodiments are illustrative only and do not limit the scope of the present disclosure or of the claims attached hereto. 1. An RNAi agent for inhibiting expression of a Myocilin (MYOC) gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand. 2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2- 18 of any one of the sequences provided in Table 2 or Table 3. 3. The RNAi agent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand. 4. The RNAi agent of any one of embodiments 1-3, wherein at least one nucleotide of the MYOC RNAi agent is a modified nucleotide or includes a modified internucleoside linkage. 5. The RNAi agent of any one of embodiments 1-4, wherein all or substantially all of the nucleotides are modified nucleotides. 6. The RNAi agent of any one of embodiments 4-5, wherein the modified nucleotide is selected from the group consisting of: 2’-O-methyl nucleotide, 2’-fluoro nucleotide, 2’- deoxy nucleotide, 2’,3’-seco nucleotide mimic, locked nucleotide, 2’-F-arabino nucleotide, 2’-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2’-O- methyl nucleotide, inverted 2’-deoxy nucleotide, 2’-amino-modified nucleotide, 2’-alkyl- modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3’-O-methyl nucleotide. 7. The RNAi agent of embodiment 5, wherein all or substantially all of the nucleotides are modified with 2’-O-methyl nucleotides, 2’-fluoro nucleotides, or combinations thereof. 8. The RNAi agent of any one of embodiments 1-7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.The RNAi agent of any one of embodiments 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4. The RNAi agent of any one of embodiments 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length. The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length. The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length. The RNAi agent of embodiment 14, wherein the RNAi agent has two blunt ends. The RNAi agent of any one of embodiments 1-15, wherein the sense strand comprises one or two terminal caps. The RNAi agent of any one of embodiments 1-16, wherein the sense strand comprises one or two inverted abasic residues. The RNAi agent of embodiment 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9A, or Table 10. The RNAi agent of embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides. The RNAi agent of embodiment 1, comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5’ ^ 3’): UAGUAAUUGUUUCUGCUGUUC (SEQ ID NO: 644); or UAGUCAAUCAUGCUGCUGUAG (SEQ ID NO: 645).The RNAi agent of embodiment 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5’ ^ 3’): GAACAGCAGAAACAAUUACUA (SEQ ID NO: 694); or CUACAGCAGCAUGAUUGACUA (SEQ ID NO: 695). The RNAi agent of embodiment 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides. The RNAi agent of embodiment 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5’ ^ 3’): cPrpusAfguaaUfuguuUfcUfgCfuguussc (SEQ ID NO: 503); cPrpuAfgucaAfucauGfcUfgCfuguassg (SEQ ID NO: 514); or wherein a represents 2’-O-methyl adenosine, c represents 2’-O-methyl cytidine, g represents 2’-O-methyl guanosine, and u represents 2’-O-methyl uridine; Af represents 2’- fluoro adenosine, Cf represents 2’-fluoro cytidine, Gf represents 2’-fluoro guanosine, and Uf represents 2’-fluoro uridine; cPrpu represents 5’-cyclopropyl phosphonate-2’-O-methyl uridine; s represents a phosphorothioate linkage; ss represents a phosphorodithioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides. The RNAi agent of embodiment 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5’ ^ 3’): gaacagcaGfAfAfacaauuacua (SEQ ID; or cuacagcaGfCfAfugauugacua (SEQ ID NO: 572); wherein a represents 2’-O-methyl adenosine, c represents 2’-O-methyl cytidine, g represents 2’-O-methyl guanosine, and u represents 2’-O-methyl uridine; Af represents 2’- fluoro adenosine, Cf represents 2’-fluoro cytidine, Gf represents 2’-fluoro guanosine, and Uf represents 2’-fluoro uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.The RNAi agent of any one of embodiments 20-24, wherein the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both. The RNAi agent of any one of embodiments 1-25, wherein the RNAi agent is linked to a targeting ligand. The RNAi agent of embodiment 26, wherein the targeting ligand has affinity for a cell receptor expressed on an epithelial cell. The RNAi agent of embodiment 27, wherein the targeting ligand comprises an integrin targeting ligand. The RNAi agent of embodiment 28, wherein the targeting ligand comprises the structure: , or a pharmaceuticallywherein indicates the point of connection to the RNAi agent. The RNAi agent of any one of embodiments 26-29, wherein the targeting ligand has a structure: , or a pharmaceuticallywherein indicates the point of connection to the RNAi agent. The RNAi agent of embodiment 30, wherein the RNAi agent is conjugated to a targeting ligand having the structure:, or a pharmaceutically wherein indicates the point of connection to the RNAi agent. The RNAi agent of any one of embodiments 26-31, wherein the targeting ligand is conjugated to the sense strand. The RNAi agent of embodiment 32, wherein the targeting ligand is conjugated to the 5’ terminal end of the sense strand. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence (5’ ^ 3’): cPrpuAfgucaAfucauGfcUfgCfuguassg (SEQ ID NO: 514); and the sense strand comprises the nucleotide sequence (5’ ^ 3’): αvβ3-SM2-L4-(NH-C6)s(invAb)scuacagcaGfCfAfugauugacuas(invAb) (SEQ ID NO: 633); wherein a represents 2’-O-methyl adenosine, c represents 2’-O-methyl cytidine, g represents 2’-O-methyl guanosine, and u represents 2’-O-methyl uridine; Af represents 2’-fluoro adenosine, Cf represents 2’-fluoro cytidine, Gf represents 2’- fluoro guanosine, and Uf represents 2’-fluoro uridine; cPrpu represents 5’- cyclopropyl phosphonate-2’-O-methyl uridine; s represents a phosphorothioate linkage; ss represents a phosphorodithioate linkage; (invAb) represents (3'-3' linked) abasic deoxyribonucleotide; and αvβ3-SM2-L4-(NH-C6)s represents the following chemical structure:The RNAi agent of any one of embodiments 1-34, wherein the RNAi agent is a pharmaceutically acceptable salt. The RNAi agent of embodiment 35, wherein the RNAi agent is a sodium salt. A composition comprising the RNAi agent of any one of embodiments 1-36, wherein the composition further comprises a pharmaceutically acceptable excipient. The composition of embodiment 37, further comprising a second RNAi agent capable of inhibiting the expression of Myocilin gene expression. The composition of any one of embodiments 37-38, further comprising one or more additional therapeutics. The composition of any of embodiments 37-39, wherein the RNAi agent is a sodium salt. The composition of any of embodiments 37-40, wherein the pharmaceutically acceptable excipient is water for injection. The composition of any of embodiments 37-41, wherein the pharmaceutically acceptable excipient is a buffered saline solution. A method for inhibiting expression of a MYOC gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of embodiments 1-36 or the composition of any one of embodiments 37-42. The method of embodiment 43, wherein the cell is within a subject. The method of embodiment 44, wherein the subject is a human subject. The method of any one of embodiments 43-45, wherein following the administration of the RNAi agent the Myocilin (MYOC) gene expression is inhibited by at least about 30%. A method of treating one or more symptoms or diseases associated with enhanced or elevated membrane MYOC activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of embodiments 37-42.48. The method of embodiment 47, wherein the disease is an ocular disease. 49. The method of embodiment 48, wherein the ocular disease is glaucoma. 50. The method of any one of embodiments 43-49, wherein the RNAi agent is administered at a deposited dose of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject. 51. The method of any one of embodiments 43-50, wherein the RNAi agent is administered at a deposited dose of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject. 52. The method of any of embodiments 43-51, wherein the RNAi agent is administered in two or more doses. 53. Use of the RNAi agent of any one of embodiments 1-36, for the treatment of a disease, disorder, or symptom that is mediated at least in part by mutant MYOC activity and / or MYOC gene expression. 54. Use of the composition according to any one of embodiments 37-42, for the treatment of a disease, disorder, or symptom that is mediated at least in part by Myocilin (MYOC) activity and / or Myocilin (MYOC) gene expression. 55. Use of the composition according to any one of embodiments 37-42, for the manufacture of a medicament for treatment of a disease, disorder, or symptom that is mediated at least in part by Myocilin (MYOC) and / or Myocilin (MYOC) gene expression. 56. The use of any one of embodiments 53-55, wherein the disease is an ocular disease. 57. A method of making an RNAi agent of any one of embodiments 1-36, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule. 58. The method of embodiment 57, wherein the sense strand comprises a targeting ligand. 59. The method of embodiment 57, comprising conjugating a targeting ligand to the sense strand.

[0183] The above provided embodiments and items are now illustrated with the following, non-limiting examples.EXAMPLES Example 1. Synthesis of MYOC RNAi Agents.

[0184] MYOC RNAi agent duplexes disclosed herein were synthesized in accordance with the following:

[0185] A. Synthesis. The sense and antisense strands of the MYOC RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600Å, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2’-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2’-O-methyl phosphoramidites that were used included the following: (5’-O-dimethoxytrityl-N6-(benzoyl)-2’- O-methyl-adenosine-3’-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5’-O- dimethoxy-trityl-N4-(acetyl)-2’-O-methyl-cytidine-3’-O-(2-cyanoethyl-N,N-diisopropyl- amino) phosphoramidite, (5’-O-dimethoxytrityl-N2-(isobutyryl)-2’-O-methyl-guanosine-3’-O- (2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5’-O-dimethoxytrityl-2’-O- methyl-uridine-3’-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2’-deoxy-2’- fluoro-phosphoramidites carried the same protecting groups as the 2’-O-methyl RNA amidites. 5’-dimethoxytrityl-2’-O-methyl-inosine-3’-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia). The inverted abasic (3’-O- dimethoxytrityl-2’-deoxyribose-5’-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5’-(4,4'-Dimethoxytrityl)-N6-(benzoyl)-2’,3’-seco-adenosine, 2’- benzoyl-3’-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5’-(4,4'-Dimethoxytrityl)-N- acetyl-2’,3’-seco-cytosine, 2’-benzoyl-3’-[(2-cyanoethyl)-(N,N-diiso-propyl)]- phosphoramidite, 5’-(4,4'-Dimethoxytrityl)-N-isobutyryl-2’,3’-seco-guanosine, 2’-benzoyl-3’- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5’-(4,4'-Dimethoxy-trityl)-2’,3’- seco-uridine, 2’-benzoyl-3’-[(2-cyanoethyl)-(N,N- diiso-propyl)]-phosphoramidite. TFA aminolink phosphoramidites were also commercially purchased (ThermoFisher). Linker L6 was purchased as propargyl-PEG5-NHS from BroadPharm (catalog # BP-20907) and coupled to the NH2-C6group from an aminolink phosphoramidite to form -L6-C6-, using standard coupling conditions. The linker Alk-cyHex was similarly commercially purchased from Lumiprobe (alkyne phosphoramidite, 5’-terminal) as a propargyl-containing compound phosphoramiditecompound to form the linker -Alk-cyHex-. In each case, phosphorothioate or phosphorodithioate linkages were introduced as specified using the conditions set forth herein. The cyclopropyl phosphonate phosphoramidites were synthesized in accordance with International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et. al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)).

[0186] Tri-alkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2’ O-Me), and 60 seconds (2’ F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was employed.

[0187] Alternatively, tri-alkyne moieties were introduced post-synthetically (see section E, below). For this route, the sense strand was functionalized with a 5’ and / or 3’ terminal nucleotide containing a primary amine. TFA aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2’ O-Me), and 60 seconds (2’ F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was employed.

[0188] B. Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% to 31% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0189] C. Purification. Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13µm column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 fine with a running buffer of 100mM ammonium bicarbonate, pH 6.7 and20% Acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into an appropriate buffer or solvent system via tangential flow filtration.

[0190] D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1× PBS (Phosphate-Buffered Saline, 1×, Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25°C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1× PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor (0.050 mg / (mL∙cm)) and the dilution factor to determine the duplex concentration.

[0191] E. Synthesis of Linkers

[0192] Synthesis of Linker 4 Precursor (L4-p) added Cs2CO3(7.71 g) at roomresulting reaction mixture was stirred overnight under N2(g). Approximately full conversion to desired product by LC-MS was then confirmed. The reaction mixture was quenched with NaHCO3 (10 mL). The product was extracted with EtOAc (5 x 10 mL) and then washed with water (3 x 8 mL) and brine (8 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient of hexanes to EtOAc (0-30%), in which the product eluted at 14% B. Compound 3 was concentrated under vacuum to provide a white solid. LC-MS: calculated [M+H]+ 191.06 m / z, observed 191.23 m / z.was added LiOH (1.08 g) at room temperature under normal atmosphere. The reaction mixture was stirred until full conversion of compound 3 was observed by LC-MS. Residual starting material was extracted via EtOAc, and then aqueous phase was acidified with 6 N HCl to a pH of ~3. Compound 4 crashed out as a white solid and was filtered over vacuum and washed with water. Due to its wet / sticky nature, solvent was required to transfer the solid to a round bottom flask; material was transferred via MeOH and DCM. Due to poor solvation in either solvent and the combination, the materialcould not to be dried over Na2SO4. Compound 4 was concentrated under vacuum to provide a white, fluffy crystalline solid and was used directly without further purification. LC-MS: calculated [M+H]+ 177.05 m / z, observed 177.19 m / z. mL) under N2(g) wasroom was to stir until full conversion was observed by LC-MS. Due to an inability to successfully observe the product after overnight stirring, the reaction mixture was quenched with NaHCO3. The resulting precipitate was confirmed to contain starting materials via LC-MS and was filtered over vacuum, attempted to be re-suspended in MeOH / DCM, and then concentrated under vacuum. The mixture was then re-solvated in DMF, dried over Na2SO4, filtered over vacuum, and rinsed with DMF. EDC was re-added to the filtrate (i.e., compounds 4 and 5) in DMF, and the resultant mixture was allowed to stir overnight at room temperature. The reaction mixture was directly concentrated and azeotroped with MeOH and PhMe for isolation. The residue was purified by CombiFlash® using silica gel as the stationary phase and was eluted with 0-20% MeOH in DCM. L4 eluted at 0% B to provide a white solid. LC-MS: calculated [M+H]+ 325.04 m / z, observed 325.35 m / z.

[0196] F. Synthesis of Targeting Ligand αvβ3-SM2 precursor: ((S)-3-(4-(2-(2-(2-(2- azidoethoxy)ethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8- naphthyridin-2-yl)propyl)imidazolidin-1-yl)propanoic acid).compound 6 (21.1g, 0.17 mol), PPTS (0.55g, 2.2 mmol), and then acetic acid (1.24 mL, 21.7 mmol)). The reaction vessel was equipped with a Dean Stark trap and then heated to reflux overnight. Upon completion the reaction mixture was concentrated and dried onto 60 grams of silica and purified over SiO2with a gradient of ethyl acetate in hexanes, yielding compound 24 in 66% yield.1H NMR: 400 MHz CDCl3 δ 8.47 (s, 1 H), 7.68 (d, 1 H), 7.31 - 7.56 (m, 6 H), 6.98 - 7.16 (m, 1 H), 5.23 (s, 2 H), 1.26 (s, 9 H)., cooled to -20 C, and then charged with n-BuLi (2.5M, 34.2 mL, 85.6 mmol) via cannula. The solution was stirred for 10 min at -20 ºC then cooled to -78 ºC. Compound 8 (8 mL, 81.5 mmol) was added dropwise with vigorous stirring. After addition, stirred for 30 min at -78 ºC. Next, ClTi(iPrO)3 (44.6g, 0.171 mol) as solution in THF (40 mL) was added via addition funnel over 10 minutes. The reaction was stirred for 30 minutes at -78 ºC. Finally, compound 24 (9.06g, 27.2 mmol) was added dropwise as a suspension in THF (20 mL) and stirred at -78 ºC for 1.25 hour until the reaction was complete. To the reaction at -78 ºC was added saturated aqueous ammonium chloride. The reaction was then removed from cooling and the aqueous phase was allowed to gradually thaw and quench (yellow orange color disappears). The mixture was partitioned between EtOAc and saturated aqueous ammonium chloride. The organic phase was separated and aqueous was washed two times with EtOAc. The organic phases were combined and dried over brine, then over sodium sulfate, filtered, and concentrated. Compound 25 was obtained in 70% yield as a single diastereomer by separation on silica eluting a gradient of ethyl acetate in hexanes.1H NMR:400 MHz CDCl3δ 7.31 - 7.48 (m, 5 H), 7.09 (dd, 1 H), 6.89 - 7.04 (m, 2 H), 5.13 (s, 2 H), 4.59 - 4.76 (m, 2 H), 4.13 (q, 2 H), 2.81 (dd, 2 H), 1.21 - 1.25 (m, 12 H).

[0199] To20.7 mL, 0.124 mol) followed by MeOH (60 mL). THF was added until homogenous solution was obtained and the reaction mixture was stirred for 6 hours at room temperature. The reaction mixture was basified to a of pH 10 with aqueous 2 N NaOH and then was extracted three times with EtOAc. The combined organic phases were dried with brine, filtered over sodium sulfate, and concentrated. Compound 26 was obtained in 95% yield and was subsequently used without further purification.1H NMR: 400 MHz CDCl3 δ 7.28 - 7.46 (m, 6 H), 7.18 (d, 1 H), 6.99 (t, 1 H), 5.11 (s, 2 H), 4.57 (t, 1 H), 4.09 (q, 2 H), 2.97 - 3.09 (m, 1 H), 2.81 - 2.93 (m, 1 H), 1.18 (t, 3 H).in final addition cooling was removed and the mixture was stirred for approximately 2.5 hours to completion. The reaction mixture was quenched by addition of saturated aqueous sodium bicarbonate. The mixture was extracted three times with EtOAc. The combined organic phases were dried with brine, filtered over sodium sulfate, and concentrated. Compound 28 was isolated in 73% yield by separation on silica eluting a gradient of ethyl acetate in hexanes.1H NMR: 400 MHz CDCl3δ 7.30 - 7.49 (m, 5 H), 7.11 (dd, 1 H), 6.88 - 7.02 (m, 2 H), 5.13 (s, 2 H), 4.40 (t, 1 H), 4.10 (q, 2 H), 4.00 (dd, 1 H), 3.35 (s, 3 H), 3.31 (s, 3 H), 2.47 - 2.75 (m, 4 H), 1.20 (t, 3 H).at - 10 ºC was added dropwise a solution of compound 19 (3.64 g, 8.99 mmol) and TEA (1.94 mmol, 13.9 mmol) in THF (6 mL). The reaction mixture was warmed to room temperature. After TLC indicated a complete reaction, additional TEA (3.3 mL, 23.6 mmol) was added followed by the addition of compound 28 (2.61 g, 13.7 mmol) as a solid. The heterogenous mixture was heated at 50 ºC for 2 hours with vigorous stirring. Upon completion, the reaction mixture was quenched with 1 volume of water and extracted three times with EtOAc. The combined organic phase was dried with brine, filtered over sodium sulfate and concentrated. Compound 29 was obtained assuming 100% yield and the crude was subsequently used without further purification.[ (0.8 mL) and H2SO4(2M, 8.07 ml, 16.2 mmol) and the reaction mixture was stirred at 28 ºC overnight. The following morning, the pH of the mixture was adjusted to 9 using sodium bicarbonate and extracted three times with DCM. The combined organic phases were dried with brine, filtered over sodium sulfate, and concentrated. Compound 30 was isolated in 82% yield by separation on silica eluting a gradient of MeOH in DCM containing 1% TEA.palladium (10 wt%, 3.15 g, 2.96 mmol) and hydrogen to 50psi. The mixture was stirred at room temperature overnight. The next day, reaction was 64% complete. The reaction mixture was filtered over Celite® and concentrated. The residue was dissolved in EtOH and charged with palladium (10 wt%, 1.57 g, 1.48 mmol)) and hydrogen to 50 psi. After stirring for 48 hours the reaction mixture was heated to 30 ºC and stirred for a further 24 hours. Upon completion the suspension was filtered over Celite® and all volatiles were removed in vacuo. The residue was purified over silica eluting a gradient of MeOH in DCM, yielding compound 31 in 72% yield. 1H NMR: 400 MHz DMSO-d6 δ 9.88 (s, 1 H), 7.02 - 7.14 (m, 2 H), 6.86 - 6.93 (m, 2 H), 6.50 - 6.76 (m, 1 H), 6.31 (d, 1 H), 5.17 (t, 1 H), 4.00 (q, 2 H), 3.23 - 3.28 (m, 4 H), 2.79 - 3.18 (m, 7 H), 2.61 (t, 2 H), 2.41 (t, 2 H), 1.65 - 1.78 (m, 4 H), 1.09 (t, 3 H).dropwise a solution of DEAD. The mixture was warmed to room temperature and added to aneat mixture of compound 31 (600mg, 1.33 mmol) and HO-PEG4-N3, (466 mg, 3.06 mmol) and stirred overnight. The reaction mixture was then concentrated under reduced pressure, and the residue was purified over silica eluting a gradient of MeOH in DCM, yielding compound 32 in 50% yield.1H NMR: 400 MHz DMSO-d6δ 7.10 - 7.19 (m, 2 H), 6.97 - 7.06 (m, 2 H), 6.18 - 6.31 (m, 2 H), 5.20 (t, 1 H), 4.13 - 4.16 (m, 1 H), 3.98 - 4.04 (m, 2 H), 3.71 - 3.80 (m, 2 H), 3.52 - 3.61 (m, 8 H), 3.38 - 3.37 (m, 5 H), 3.10 - 3.25 (m, 5 H), 2.79 - 3.08 (m, 5 H), 2.59 (t, 2 H), 2.31 - 2.42 (m, 2 H), 1.65 - 1.75 (m, 4 H), 1.10 (t, 3 H). ,mg, . was completion the mixture was neutralized to pH=5 using 6 M aqueous HCl and concentrated. The residue was purified by reverse phase HPLC with a Phenomenex Gemini C18, 50 x 250 mm, 10 µm column eluting a gradient of acetonitrile in water containing 0.1%, yielding compound 33 (Structure 2c) in 81% yield.1H NMR: 400 MHz D2O δ 7.30 (d, 1 H), 7.01 - 7.19 (m, 3 H), 6.45 (d, 1 H), 5.24 (t, 1 H), 4.14 - 4.32 (m, 2 H), 3.84 - 3.92 (m, 2 H), 3.59 - 3.77 (m, 10 H), 3.14 - 3.45 (m, 8 H), .02 - 3.12 (m, 1 H), 2.97 (d, 2 H), 2.85 (q, 1 H), 2.50 - 2.72 (m, 4 H), 1.68 - 1.94 (m, 4 H).

[0001] G. Conjugation of Activated Ester Linkers

[0002] The following procedure was used to conjugate a linking group such as L4-p as shown in Table 11 above to an RNAi agent with an amine-functionalized sense strand, such as C6-NH2, NH2-C6, or (NH2-C6)s, as shown in Table 1, above. An annealed RNAi Agent dried by lyophilization was dissolved in DMSO and 10% water (v / v%) at 25 mg / mL. Then 50-100 equivalents of TEA and 3 equivalents of activated ester linker were added to the solution. The solution was allowed to react for 1-2 hours, while monitored by RP-HPLC-MS (mobile phase A 100 mM HFIP, 14 mM TEA; mobile phase B: acetonitrile on an Waters™ XBridge C18 column, Waters Corp.)

[0003] The product was then precipitated by adding 12 mL acetonitrile and 0.4 mL PBS and centrifuging the solid to a pellet. The pellet was then re-dissolved in 0.4 mL of 1XPBS and 12 mL of acetonitrile. The resulting pellet was dried on high vacuum for one hour.

[0206] Conjugation of Targeting Ligands

[0207] One molar equivalent of TG-TBTA resin loaded with Cu(I) was weighed into a glass vial. The vial was purged with N2 for 15 minutes. Then, functionalized sense strand was dissolved in a separate vial in sterilized water at a concentration of 100 mg / mL. Then two equivalents of the azide-containing Compound 33 (50 mg / mL in DMF) is added to the vial. Then TEA, DMF and water are added until the final reaction conditions are 33 mM TEA, 60% DMF, and 20 mg / mL of the conjugated product. The solution was then transferred to the vial with resin via a syringe. The N2purge was removed and the vial was sealed and moved to a stir plate at 40°C. The mixture was allowed to react for 16 hours. The resin was filtered off using a 0.45 μm filter.

[0208] The product was purified using AEX purification (mobile phase A: 25 mM TRIS pH=7.2, 1mM EDTA, 50% acetonitrile; mobile phase B: 25mM TRIS pH=7.2, 1mM EDTA, 500mM NaBr, 50% acetonitrile solid phase TSKgel®-30; 1.5 cmx10 cm.) The acetonitrile was removed using a rotary evaporator, and desalted with a 3K spin column using 2x10 mL exchanges with sterilized water. The solid product was dried using lyophilization and stored for later use. Example 2. AAV8-TBG-hMYOC Mouse Model.

[0209] The following procedure was used to evaluate MYOC RNAi agents in an AAV mouse model. To evaluate certain MYOC RNAi agents, an AAV8-TBG-hMYOC (Adeno-associated virus AAV) mouse model was used. Five- (5) to six- (6) week old male C57BL / 6J mice were transduced with 1) AAV8-TBG-hMYOC and 2) AAV8-TBG-eGFP. AAV8-TBG-hMYOC is of AAV serotype 8, driven by the thyroxin binding globulin (TBG) promoter, the transgenic sequence includes the human myocilin hMYOC cDNA (GenBank NM_000261.2 (SEQ ID NO:1)). AAV8-TBG-eGFP is of AAV serotype 8, driven by the thyroxin binding globulin (TBG) promoter, the transgenic sequence includes eGFP. The AAV8-TBG-hMYOC and AAV8-TBG-EGFP were both formulated in PBS and diluted at AAV / 25 g in a total volume of 250 µl, and delivered via the low pressure tail vein (LPTV) injection to create hMYOC-AAV model mice.

[0210] On Day -14, mice were administered 1) AAV8-TBG-hMYOC (5x10^12 GC / kg) and 2) AAV8-TBG-eGFP (1x10^12 GC / kg) (GC / kg = genome copies per kg animal body weight), via the low-pressure tail vein (LPTV) injection. On Day 1, the mice were administered, via subcutaneous (SQ) injection, MYOC RNAi agents (formulated in saline) or saline.

[0211] Liver tissue samples were collected. Liver hMYOC expression was quantified via qPCR, and eGFP was used as a control to normalize human MYOC mRNA expression.

[0212] To evaluate the activity of MYOC RNAi agents in a MYOC-AAV model as described in the Examples below, certain MYOC RNAi agents were conjugated to an N-acetyl-galactosamine containing targeting ligand having the chemical structure referred to as NAG37 (see Table 11). NAG37 is known to have high affinity to bind to asialoglycoprotein receptors that are abundantly expressed on liver cells, including hepatocytes (see, e.g., International Patent Application Publication No. WO2018044350A1). The use of NAG37-conjugated MYOC RNAi agents was to evaluate the expression of AAV-MYOC in the liver. Example 3. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0213] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, with ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8- TBG-eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 3.0 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 12 below.

[0214] Table 12. Dosing for mice of Example 3. Group Dose (RNAi Agent) # of Animals12.3.0 mg / kg AC907271 Day 1: Single SQ Injection n = 4 13.3.0 mg / kg AC907585 Day 1: Single SQ Injection n = 4 ted

[0215] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 13 below.

[0216] Table 13. Average relative expression of hMYOC in mice liver of Example 3. Day 15 Gr ID Avg Error Error

[0217] Groups 2-11 and 14 showed reductions in MYOC in comparison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC907265 at 3 mg / kg dose achieved ~83% MYOC inhibition (0.163) on Day 15.Example 4. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0218] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, with ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8- TBG-eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 1.0 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 14 below.

[0219] Table 14. Dosing for mice of Example 4. Group Dose (RNAi Agent) # of Animals 1 Saline Da 1: Sin le SQ Injection n =4 tedto the MYOC RNAi agents, including (NAG37)s ligand).

[0220] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 15 below.

[0221] Table 15. Average relative expression of hMYOC in mice liver of Example 4. Day 15 Group ID Avg MY Low High

[0222] Groups 2-5 and 10 showed reductions in MYOC in comparison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC907265 at 1.0 mg / kg dose achieved ~70% MYOC inhibition (0.292) on Day 15. Example 5. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0223] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, with ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8- TBG-eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 1.0 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 16 below.

[0224] Table 16. Dosing for mice of Example 5. Group Dose (RNAi Agent) # of Animals 1. Saline Day 1: Single SQ Injection n =4 ted

[0225] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 17 below.

[0226] Table 17. Average relative expression of hMYOC in mice liver of Example 5. Day 15 A5.1.0 mg / kg AC909667 0.560 0.069 0.079 6.1.0 mg / kg AC909668 0.995 0.071 0.076son to Group 1 dosed with no MYOC RNAi agent. More specifically, AC909654 at 1.0 mg / kg dose achieved ~71% MYOC inhibition (0.282) on Day 15. Example 6. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0228] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG- eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.75 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 18 below.

[0229] Table 18. Dosing for mice of Example 6. Group Dose (RNAi Agent) # of Animals6.0.75 mg / kg AC910082 Day 1: Single SQ Injection n =4 7.0.75 mg / kg AC910083 Day 1: Single SQ Injection n =4 ted[ ] n ay , ver ssue samp es were co ec e rom eac mouse. n ay , p asma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 19 below.

[0231] Table 19. Average relative expression of hMYOC in mice liver of Example 6. Day 15 ID Avg L Hi h

[0232] Groups 2-11 showed reductions in MYOC in comparison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC910082 at 0.75 mg / kg dose achieved ~76% MYOC inhibition (0.237) on Day 15. Example 7. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0233] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG-eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.75 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 20 below.

[0234] Table 20. Dosing for mice of Example 7. Group Dose (RNAi Agent) # of Animals 1 Saline Day 1: Single SQ Injection n =4 ted

[0235] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 21 below.

[0236] Table 21. Average relative expression of hMYOC in mice liver of Example 7. Day 152.0.75 mg / kg AC909654 0.280 0.069 0.092 3.0.75 mg / kg AC910071 0.289 0.079 0.110ison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC910074 at 0.75 mg / kg dose achieved ~75% MYOC inhibition (0.241) on Day 15. Example 8. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0238] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG- eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.75 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 22 below.

[0239] Table 22. Dosing for mice of Example 8. Group Dose (RNAi Agent) # of Animals7.0.75 mg / kg AC910207 Day 1: Single SQ Injection n =4 8.0.75 mg / kg AC910208 Day 1: Single SQ Injection n =4 ted

[0240] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 23 below.

[0241] Table 23. Average relative expression of hMYOC in mice liver of Example 8. Day 15 Gr ID Avg L w Hi h

[0242] Groups 2-11 showed reductions in MYOC in comparison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC910207 at 0.75 mg / kg dose achieved ~71% MYOC inhibition (0.284) on Day 15. Example 9. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0243] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG- eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.75 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 24 below.

[0244] Table 24. Dosing for mice of Example 9. Group Dose (RNAi Agent) # of Animals 1 Saline Day 1: Single SQ Injection n =4 tedto the MYOC RNAi agents, including (NAG37)s ligand).

[0245] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 25 below.

[0246] Table 25. Average relative expression of hMYOC in mice liver of Example 9. Day 153.0.75 mg / kg AC910213 0.062 0.006 0.007 4.0.75 mg / kg AC910214 0.121 0.071 0.170ison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC910213 at 0.75 mg / kg dose achieved ~93% MYOC inhibition (0.062) on Day 15. Example 10. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0248] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG- eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.50 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 26 below.

[0249] Table 26. Dosing for mice of Example 10. Group Dose (RNAi Agent) # of Animals9.0.50 mg / kg AC910431 Day 1: Single SQ Injection n =4 10.0.50 mg / kg AC910432 Day 1: Single SQ Injection n =4 ted

[0250] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 27 below.

[0251] Table 27. Average relative expression of hMYOC in mice liver of Example 10. Day 15 Avg14.0.50 mg / kg AC910436 1.145 0.118 0.132 15.0.50 mg / kg AC910437 1.013 0.307 0.440in comparison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC910430 at 0.75 mg / kg dose achieved ~61% MYOC inhibition (0.387) on Day 15. Example 11. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0253] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG- eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.50 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 28 below.

[0254] Table 28. Dosing for mice of Example 11. Group Dose (RNAi Agent) # of Animals14.0.5 mg / kg AC910203 Day 1: Single SQ Injection n =4 15.0.5 mg / kg AC910213 Day 1: Single SQ Injection n =4 ted

[0255] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 29 below.

[0256] Table 29. Average relative expression of hMYOC in mice liver of Example 11. Day 15 Group ID Avg Low High

[0257] Groups 2-15 showed reductions in MYOC in comparison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC910473 at 0.5 mg / kg dose achieved ~80% MYOC inhibition (0.197) on Day 15. Example 12. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0258] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG- eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.50 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 30 below.

[0259] Table 30. Dosing for mice of Example 12. Group Dose (RNAi Agent) # of Animals 1 Saline Day 1: Single SQ Injection n =4 tedto the MYOC RNAi agents, including (NAG37)s ligand).

[0260] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 31 below.

[0261] Table 31. Average relative expression of hMYOC in mice liver of Example 12. Day 154. 0.5 mg / kg AC0037350.506 0.148 0.2085. 0.5 mg / kg AC0037360.935 0.089 0.098mparison to Group 1 dosed with no MYOC RNAi agent. Groups 5 and 8-10 showed little to no MYOC reduction. More specifically, AC910082 at 0.5 mg / kg dose achieved ~61% MYOC inhibition (0.387) on Day 15. Example 13. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0263] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG- eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.50 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 32 below.

[0264] Table 32. Dosing for mice of Example 13. Group Dose (RNAi Agent) # of Animals11.0.5 mg / kg AC004293 Day 1: Single SQ Injection n =4 12.0.5 mg / kg AC004294 Day 1: Single SQ Injection n =4 ted

[0265] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP or mActinB as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 33 below.

[0266] Table 33. Average relative expression of hMYOC in mice liver of Example 13. Day 15 eGFP Reference Gene mActinB Reference Gene 510155158893

[0267] With eGFP as reference gene, Groups 2-9, 11, and 12 showed reductions in MYOC in comparison to Group 1 dosed with no MYOC RNAi agent. Group 10 showed no MYOC reduction. More specifically, AC910082 at 0.5 mg / kg dose achieved ~62% MYOC inhibition (0.380) on Day 15.

[0268] With mActinB as reference gene, Groups 2-12 showed reductions in MYOC in comparison to Group 1 dosed with no MYOC RNAi agent. More specifically, AC004293 at 0.5 mg / kg achieved ~71% MYOC inhibition (0.285) on Day 15.Example 14. In Vivo Testing of MYOC RNAi Agents in MYOC-AAV Mice.

[0269] The MYOC-AAV mouse model described in Example 2, above, was used. On Day -14, four (n=4) male C57bl / 6 mice in each group were administered, via low pressure tail vein (LPTV) injection, ~5x10^12 GC / kg AAV8-TBG-hMYOC and ~1x10^12 GC / kg AAV8-TBG- eGFP, in accordance with Example 2, as described above. On Day 1, the mice were given a single subcutaneous (SQ) injection of 250 μl per 25g body weight containing either 0.25 mg / kg, 0.50 mg / kg, or 1.0 mg / kg (mpk) of a MYOC RNAi agent or saline. Dosing was in accordance with Table 34 below.

[0270] Table 34. Dosing for mice of Example 14. Group Dose (RNAi Agent) # of Animals 1 Saline Da 1: Sin le SQ Injection n =4 tedto the MYOC RNAi agents, including (NAG37)s ligand).

[0271] On Day 15, liver tissue samples were collected from each mouse. On Day 15, plasma was collected from each mouse. Expression of hMYOC was determined via TaqMan assay, with eGFP as reference gene. Average MYOC expression for each animal in liver tissue was normalized to Group 1 (saline, no RNAi agent). Results are shown in Table 35 below.

[0272] Table 35. Average relative expression of hMYOC in mice liver of Example 14. Day 154. 1.0 mg / kg AC9104730.117 0.027 0.0355. 0.25 mg / kg AC9104300.655 0.057 0.063son to Group 1 dosed with no MYOC RNAi agent. More specifically, AC910473 at 1.0 mg / kg dose achieved ~88% MYOC inhibition (0.117) on Day 15. A dose response was observed for both AC910473 and AC910430. Example 15. In Vivo Testing of MYOC RNAi Agents in Cynomolgus Monkeys.

[0274] MYOC RNAi agents were evaluated in vivo in Cynomolgus monkeys for inhibition of MYOC. On Day 1, three (n=3) male Cynomolgus monkeys for each test group were dosed with MYOC RNAi agents formulated in saline (at 20 µg / µL or 50 µg / µL), via intracameral (IC) injection, at 20 µL / eye (oculus uterque OU) dose volume. The dosing regimen was in accordance with Table 36 below.

[0275] Table 36. Dosing for Cynomolgus monkeys of Example 15. # of Dose Group Dose (RNAi Agent) Dosing Route Dose e e e tedto the MYOC RNAi agents; see Table 11 for structures of αvβ3-SM2 and L4-C6).

[0276] The test animals were of naïve Cynomolgus monkey (non-human primate) (NHP), male, body weight approximately 3.0-8.0 kg, and approximately 3-7 years of age.

[0277] The test animals were anesthetized, and 50 µL of aqueous humor was collected from each eye of all test animals, prior to dosing between Day -14 and Day -5, and prior to termination on Day 28.

[0278] The test animals were euthanized at Day 35. Exsanguination and necropsy were performed. The right eye from each animal of all test groups were collected, trimmed for external tissues, and placed in 10% formalin. The left eye was frozen in LN2 for dissection into trabecular meshwork,cornea, iris / ciliary body, lens, retina / retinal pigment epithelium (RPE) / choroid (as one sample) and sclera. Frozen vitreous humor from each eye was collected separately.

[0279] The eye biopsies collected from the test animals were used for analysis for MYOC expression and additional biological parameters.

[0280] Of the collected Cynomolgus monkey eye biopsies, MYOC mRNA expression levels were quantified via qPCR, using cActinB as the endogenous control gene, normalized to the PBS control Group 1. The data is shown in the following Table 37.

[0281] Table 37. MYOC expression in eye tissues (trabecular meshwork TM) of Cynomolgus monkeys at Day 35, of Example 15. Day 35 Fresh TM FFPE TM - 2599[ ] roups - s owe n on ou o a eas ay . oa y, a snge µg / µL dose of AC005706 achieved ~73% inhibition (0.268) in the fresh TM samples. A single 50 µg / µL dose of AC005705 achieved ~88% inhibition (0.119) in the FFPE TM samples. Dose response was observed for AC005705 in both the fresh TM and FFPE TM samples.

[0283] Of the collected Cynomolgus monkey eye biopsies, MYOC mRNA levels were quantified via RNAscope assay, normalized to the PBS control Group 1. The data is shown in the following Table 38.

[0284] Table 38. MYOC mRNA count levels in eye tissues of Cynomolgus monkeys at Day 35, of Example 15. Day 35

[0285] Groups 2-4 showed reduction in MYOC mRNA levels out to at least Day 35. Notably, a single 50 µg / µL dose of AC005705 achieved ~62% inhibition (37.913). Dose response was observed for AC005705. A single 25 µg / µL dose of AC005706 achieved ~56% inhibition (43.773).

[0286] Of the collected Cynomolgus monkey eye biopsies, myocilin protein levels were quantified via JessTMprotein assay, normalized to the PBS control Group 1. The data is shown in the following Table 39.

[0287] Table 39. Myocilin protein levels in eye tissues (TM) of Cynomolgus monkeys at Day 35, of Example 15. Day 35 Group ID Rel. Exp. Std Dev + / -oup - s o e e uc o yoc p o e e e s ou o at least Day 35. Notably, a single 50 µg / µL dose of AC005705 achieved ~66% inhibition (0.343). A dose-response was also observed for AC005705. Example 16. In Vivo Testing of MYOC RNAi Agents in Cynomolgus Monkeys.

[0289] MYOC RNAi agents were evaluated in vivo in Cynomolgus monkeys for inhibition of MYOC. On Day 1, three (n=3) male Cynomolgus monkeys for each of Groups 2-5 were dosed with MYOC RNAi agents formulated in saline (at 0.5 mg or 1.5 mg per eye; at 25 mg / mL or 75 mg / mL dose concentration), via intracameral (IC) injection, at 20 µL / eye (oculus uterque OU) dose volume; four (n=4) male Cynomolgus monkeys in Group 1 were dosed with PBS. The dosing regimen was in accordance with Table 40 below.

[0290] Table 40. Dosing for Cynomolgus monkeys of Example 16. Group Dose (RNAi Agent) # of Animals Dosing Route Dose Volume2 0.5 mg AC005705 n = 3 Day 1 IC injection, OU 20 µL / eye 3 1.5 mg AC005705 n = 3 Day 1 IC injection, OU 20 µL / eye edy g q p P) monkeys, male.

[0292] Aqueous humor was collected after ophthalmic examination.

[0293] The test animals were euthanized at Day 36. Exsanguination and necropsy were performed. Enucleated whole globes were collected. The whole eye was collected.

[0294] The eye biopsies collected from the test animals were used for analysis for MYOC expression and additional biological parameters.

[0295] MYOC mRNA expression levels in biopsy samples were quantified using qPCR, using cActinB as the endogenous control gene, normalized to the PBS control Group 1. The data is shown in the following Table 41.

[0296] Table 41. MYOC mRNA expression in trabecular meshwork of test animals at Day 36. Day 36 TM

[0297] Groups 2-5 showed inhibition of MYOC mRNA transcript levels out to at least Day 36. Notably, a single 1.5 mg dose of AC005705 achieved ~77% inhibition (0.231) of MYOC mRNA in the trabecular meshwork. A dose response was observed for AC005705.

[0298] Myocilin protein levels in biopsy samples were quantified via JessTMprotein assay, normalized to the PBS control Group 1. The data is shown in the following Table 42.

[0299] Table 42. Myocilin protein levels in trabecular meshwork of test animals at Day 36. Day 36 TM R l E t Dtified via JessTMprotein assay, normalized to the PBS control Group 1. The data is shown in the following Table 43.

[0301] Table 43. Myocilin protein levels in aqueous humor of test animals at Day 36. Day 36 Aqueous Humor

[0302] Group 2-5 showed reduction in myocilin protein levels in the aqueous humor out to at least Day 36. Notably, a single 1.5 mg dose of AC005705 achieved ~79% inhibition (0.207). A dose-response was also observed for AC005705. OTHER EMBODIMENTS

[0303] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Claims:

1. An RNAi agent for inhibiting expression of a Myocilin (MYOC) gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.

3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.

4. The RNAi agent of any one of claims 1-3, wherein at least one nucleotide of the MYOC RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.

5. The RNAi agent of any one of claims 1-4, wherein all or substantially all of the nucleotides are modified nucleotides.

6. The RNAi agent of any one of claims 4-5, wherein the modified nucleotide is selected from the group consisting of: 2’-O-methyl nucleotide, 2’-fluoro nucleotide, 2’-deoxy nucleotide, 2’,3’-seco nucleotide mimic, locked nucleotide, 2’-F-arabino nucleotide, 2’-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2’-O-methyl nucleotide, inverted 2’-deoxy nucleotide, 2’-amino-modified nucleotide, 2’-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3’-O-methyl nucleotide.

7. The RNAi agent of claim 5, wherein all or substantially all of the nucleotides are modified with 2’-O-methyl nucleotides, 2’-fluoro nucleotides, or combinations thereof.

8. The RNAi agent of any one of claims 1-7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.

9. The RNAi agent of any one of claims 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

10. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strandcomprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

11. The RNAi agent of any one of claims 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.

12. The RNAi agent of claim 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.

13. The RNAi agent of claim 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.

14. The RNAi agent of claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

15. The RNAi agent of claim 14, wherein the RNAi agent has two blunt ends.

16. The RNAi agent of any one of claims 1-15, wherein the sense strand comprises one or two terminal caps.

17. The RNAi agent of any one of claims 1-16, wherein the sense strand comprises one or two inverted abasic residues.

18. The RNAi agent of claim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9A, or Table 10.

19. The RNAi agent of claim 18, wherein all or substantially all of the nucleotides are modified nucleotides.

20. The RNAi agent of claim 1, comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5’ ^ 3’): UAGUAAUUGUUUCUGCUGUUC (SEQ ID NO: 644); or UAGUCAAUCAUGCUGCUGUAG (SEQ ID NO: 645).

21. The RNAi agent of claim 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5’ ^ 3’):(SEQ ID NO: 694); or CUACAGCAGCAUGAUUGACUA (SEQ ID NO: 695).

22. The RNAi agent of claim 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides.

23. The RNAi agent of claim 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5’ ^ 3’): cPrpusAfguaaUfuguuUfcUfgCfuguussc (SEQ ID NO: 503);cPrpuAfgucaAfucauGfcUfgCfuguassg ID NO: 514); or wherein a represents 2’-O-methyl adenosine, c represents 2’-O-methyl cytidine, g represents 2’-O-methyl guanosine, and u represents 2’-O-methyl uridine; Af represents 2’- fluoro adenosine, Cf represents 2’-fluoro cytidine, Gf represents 2’-fluoro guanosine, and Uf represents 2’-fluoro uridine; cPrpu represents 5’-cyclopropyl phosphonate-2’-O-methyl uridine; s represents a phosphorothioate linkage; ss represents a phosphorodithioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

24. The RNAi agent of claim 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5’ ^ 3’): gaacagcaGfAfAfacaauuacua (SEQ ID NO: 565); or cuacagcaGfCfAfugauugacua (SEQ ID NO: 572); wherein a represents 2’-O-methyl adenosine, c represents 2’-O-methyl cytidine, g represents 2’-O-methyl guanosine, and u represents 2’-O-methyl uridine; Af represents 2’- fluoro adenosine, Cf represents 2’-fluoro cytidine, Gf represents 2’-fluoro guanosine, and Uf represents 2’-fluoro uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.

25. The RNAi agent of any one of claims 20-24, wherein the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both.

26. The RNAi agent of any one of claims 1-25, wherein the RNAi agent is linked to a targeting ligand.

27. The RNAi agent of claim 26, wherein the targeting ligand has affinity for a cell receptor expressed on an epithelial cell.

28. The RNAi agent of claim 27, wherein the targeting ligand comprises an integrin targeting ligand.

29. The RNAi agent of claim 28, wherein the targeting ligand comprises the structure: , or a pharmaceuticallywherein indicates the point of connection to the RNAi agent.

30. The RNAi agent of any one of claims 26-29, wherein the targeting ligand has a structure: , or a pharmaceuticallywherein indicates the point of connection to the RNAi agent.

31. The RNAi agent of claim 30, wherein the RNAi agent is conjugated to a targeting ligand having the structure: , or a pharmaceuticallywherein indicates the point of connection to the RNAi agent.

32. The RNAi agent of any one of claims 26-31, wherein the targeting ligand is conjugated to the sense strand.

33. The RNAi agent of claim 32, wherein the targeting ligand is conjugated to the 5’ terminal end of the sense strand.

34. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence (5’ ^ 3’): cPrpuAfgucaAfucauGfcUfgCfuguassg (SEQ ID NO: 514); and the sense strand comprises the nucleotide sequence (5’ ^ 3’): αvβ3-SM2-L4-(NH-C6)s(invAb)scuacagcaGfCfAfugauugacuas(invAb) (SEQ ID NO: 633); wherein a represents 2’-O-methyl adenosine, c represents 2’-O-methyl cytidine, g represents 2’-O-methyl guanosine, and u represents 2’-O-methyl uridine; Af represents 2’-fluoro adenosine, Cf represents 2’-fluoro cytidine, Gf represents 2’- fluoro guanosine, and Uf represents 2’-fluoro uridine; cPrpu represents 5’- cyclopropyl phosphonate-2’-O-methyl uridine; s represents a phosphorothioate linkage; ss represents a phosphorodithioate linkage; (invAb) represents (3'-3' linked) abasic deoxyribonucleotide; and αvβ3-SM2-L4-(NH-C6)s represents the following chemical structure:

35. The RNAi agent of any one of claims 1-34, wherein the RNAi agent is a pharmaceutically acceptable salt.

36. The RNAi agent of claim 35, wherein the RNAi agent is a sodium salt.

37. A composition comprising the RNAi agent of any one of claims 1-36, wherein the composition further comprises a pharmaceutically acceptable excipient.

38. The composition of claim 37, further comprising a second RNAi agent capable of inhibiting the expression of Myocilin gene expression.

39. The composition of any one of claims 37-38, further comprising one or more additional therapeutics.

40. The composition of any of claims 37-39, wherein the RNAi agent is a sodium salt.

41. The composition of any of claims 37-40, wherein the pharmaceutically acceptable excipient is water for injection.

42. The composition of any of claims 37-41, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

43. A method for inhibiting expression of a MYOC gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of claims 1-36 or the composition of any one of claims 37-42.

44. The method of claim 43, wherein the cell is within a subject.

45. The method of claim 44, wherein the subject is a human subject.

46. The method of any one of claims 43-45, wherein following the administration of the RNAi agent the Myocilin (MYOC) gene expression is inhibited by at least about 30%.

47. A method of treating one or more symptoms or diseases associated with enhanced or elevated membrane MYOC activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 37-42.

48. The method of claim 47, wherein the disease is an ocular disease.

49. The method of claim 48, wherein the ocular disease is glaucoma.

50. The method of any one of claims 43-49, wherein the RNAi agent is administered at a deposited dose of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject.

51. The method of any one of claims 43-50, wherein the RNAi agent is administered at a deposited dose of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject.

52. The method of any of claims 43-51, wherein the RNAi agent is administered in two or more doses.

53. Use of the RNAi agent of any one of claims 1-36, for the treatment of a disease, disorder, or symptom that is mediated at least in part by mutant MYOC activity and / or MYOC gene expression.

54. Use of the composition according to any one of claims 37-42, for the treatment of a disease, disorder, or symptom that is mediated at least in part by Myocilin (MYOC) activity and / or Myocilin (MYOC) gene expression.

55. Use of the composition according to any one of claims 37-42, for the manufacture of a medicament for treatment of a disease, disorder, or symptom that is mediated at least in part by Myocilin (MYOC) and / or Myocilin (MYOC) gene expression.

56. The use of any one of claims 53-55, wherein the disease is an ocular disease.

57. A method of making an RNAi agent of any one of claims 1-36, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

58. The method of claim 57, wherein the sense strand comprises a targeting ligand.

59. The method of claim 57, comprising conjugating a targeting ligand to the sense strand.

Images