Dim fluorescent cell-based method for detecting botulinum toxin and evaluating activity thereof by using anchor protein

Abstract

The present invention relates to a cell-based method for detecting botulinum toxin or measuring the activity thereof, and relates to: a genetically modified cell into which a gene construct consisting of an anchor protein group and a dim fluorescent peptide group is introduced; and a use thereof, and, more specifically, to: a genetically modified cell into which a gene construct consisting of a cell membrane-binding peptide and a recombinant fluorescent protein coding sequence, which form an anchor protein group, and a botulinum toxin recognition sequence and a dim fluorescence-inducing peptide coding sequence for fluorescent protein expression, which form a dim fluorescence-inducing peptide group, is introduced; and a use thereof. According to the method of the present invention, botulinum toxin can be detected or the activity thereof can be quantitatively analyzed through fluorescence measurement without using cell lines that are difficult to culture, such as stem cells.

Description

Detection and activity evaluation method of botulinum toxin using a light-sensitive cell-based anchor protein

[0001] The present invention relates to a method for detecting or measuring the activity of cell-based botulinum toxin, and to a genetically recombinant cell into which a genetic construct comprising an anchor protein group and a light-inducing peptide group is introduced, and to a use thereof.

[0002] More specifically, the anchor protein group is composed of a cell membrane binding peptide coding sequence and a recombinant fluorescent protein coding sequence, and the light-inducing peptide group is composed of a botulinum toxin recognition peptide coding sequence and a light-inducing peptide coding sequence for fluorescent protein expression. The present invention relates to a genetically recombinant cell and its use, wherein a genetic construct is introduced.

[0003] A generally accepted method for the detection of botulinum toxin (BoNT) in food, clinical, or environmental samples is the mouse LD 50 This is a bioassay (mLD50). In particular, in the pharmaceutical industry, mLD50 is used as a standard analytical method to determine the activity of botulinum toxin used for aesthetic or medical purposes. However, verifying botulinum toxin activity using mLD50 is highly influenced by factors such as testers, testing institutions, and facilities, making it difficult to accurately and reproducibly quantify the biological efficacy of botulinum toxin.

[0004] Therefore, the ZEBET meeting was held to minimize the number of animals used in experiments and their suffering, to standardize the determination of botulinum toxin activity, i.e., the potency measurement of botulinum toxin, and to encourage the development of alternative methods for measuring mLD50 (Adler et al., ATLA Alternatives to Laboratory Animals, Vol. 38(4), pp. 315-330, 2010). Many research institutes and industries in various countries have undertaken various studies to develop cell-based potency assays (CBPAs) or cell-based bioassays (CBB) that are satisfactory to replace mLD50 in terms of specificity, sensitivity, and reproducibility. For the successful implementation of CBPA or CBB, (1) SNAP25 197 It is required to obtain (1) cells that are highly sensitive to (2) monoclonal or polyclonal antibodies specific for botulinum toxin, and (3) low concentrations (~pM) of botulinum toxin. In early 2004, Dr. Chapman and his colleagues invented a fluorescent reporter assay using botulinum toxin fused to two fluorescent proteins (Dong et al., PNAS Vol. 101(41), pp. 14701-14706, 2004), and BoCell TM It was commercialized by naming it as an analytical method (BioSentinel Inc).

[0005] As described above, global efforts are ongoing to develop CBPA to replace mLD50, ultimately leading to the elimination of animal-based assays. The development of effective CBPA will facilitate the expansion of the utility of various botulinum toxin products, enhance quality control, and provide a higher level of consumer confidence, thereby enhancing the competitiveness of botulinum toxin products.

[0006] BOTOX ® The manufacturer, Allergan, has developed SNAP25 197A monoclonal antibody specific for SNAP25 and human neuroblastoma SiMa cells, an ideal host cell highly sensitive to botulinum toxin, were successfully constructed (Fernandez-Salas et al., PLoS ONE 7(11): e49516, 2012). In 2010, Allergan developed a new CBPA assay using the antibody and cells, which was approved by the FDA as the first CBPA that could replace mLD50 (US8455213B2 and US2010 / 0204559A1). Another botulinum toxin manufacturer, Merz of Germany, developed a CBA-ELISA in 2014 that uses a differential neuronal fixation method (in-situ) and is characterized by penetrating the cell membrane to immunologically detect endogenous SNAP25.

[0007] Allergan's CBPA and Merz's CBA-ELISA demonstrated EC50 levels of sub-picomolar (i.e. <1.0 U / well) comparable to the mouse assay. 50 It also exhibits excellent sensitivity. Allergan and Merz's technology platforms detect SNAP25 under optimal conditions using a common commercial rabbit polyclonal antibody (Sigma S9684). In terms of cells, Allergan's CBPA exclusively uses differentiated human glioma cells (SiMa), whereas Merz's CBA-ELISA uses differentiated human induced pluripotent stem cells (iPS) as the standardized and optimized host cell.

[0008] However, the above-mentioned developed CBPAs were analyzed using Western blotting analysis method using SNAP25 197 and SNAP25 FL Since it determines the endogenous level, it is difficult to apply it to high throughput assay.

[0009] Under this technical background, the present inventors have made efforts to develop a cell-based analysis system capable of determining the activity of botulinum toxin regardless of the existing cell line, and as a result, they have found that cells introduced with a genetic construct consisting of an anchor protein group and a light-inducing peptide group normally induce light-inducing fluorescence expression, but when treated with botulinum toxin, the intensity of fluorescence expression at sub-picomolar concentrations increases as in the existing analysis method, so that not only can the activity be detected, but the activity can also be quantitatively analyzed, and thus the present invention has been completed.

[0010] One object of the present invention is to provide a recombinant cell in which the expression of a fluorescent protein attached to a cell membrane is maintained at a constant level using a recombinant anchor peptide, thereby enabling quantitative analysis of the activity of botulinum toxin.

[0011] Another object of the present invention is to provide a recombinant cell for detecting or measuring botulinum toxin activity using a recombinant light-inducing peptide.

[0012] Another object of the present invention is to provide a method for measuring the activity of botulinum toxin using the recombinant cell.

[0013] Another object of the present invention is to provide a method for detecting or measuring the activity of botulinum toxin using the recombinant cell and a method for evaluating a botulinum toxin inhibitor.

[0014] Another object of the present invention is to provide a kit for detecting or measuring the activity of botulinum toxin.

[0015] Specifically, the following descriptions are provided. Meanwhile, each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions described below.

[0016] One aspect of the present invention relates to a recombinant cell for detecting or measuring the activity of botulinum toxin, into which a genetic construct comprising a cell membrane binding peptide coding sequence and a recombinant fluorescent protein coding sequence, which are anchor protein groups, and a botulinum toxin recognition peptide coding sequence and a light-inducing peptide coding sequence, which are light-inducing peptide groups, is introduced.

[0017] The genetic construct of the present invention may be operably linked to a cell membrane-binding peptide coding sequence, a recombinant fluorescent protein coding sequence, a botulinum toxin recognition peptide coding sequence, and a light-inducing peptide coding sequence, but is not limited thereto. The genetic construct of the present invention may be composed of a cell membrane-binding peptide coding sequence, a recombinant fluorescent protein coding sequence, a botulinum toxin recognition peptide coding sequence, and a light-inducing peptide coding sequence, but is not limited thereto.

[0018] The "botulinum toxin" of the present invention is a neurotoxic protein produced by the bacterium Clostridium botulinum. The genus Clostridium comprises more than 127 species, which are classified based on their morphology and function. Clostridium botulinum, an anaerobic, Gram-positive bacterium, produces botulinum toxin, a potent polypeptide neurotoxin that causes botulism, a neuroparalytic disease in humans and animals. Clostridium botulinum spores are found in the soil and can be cultured in improperly sterilized and sealed food containers, etc., which are the cause of many cases of botulism. Symptoms of botulism typically appear 18 to 36 hours after ingestion of food contaminated with Clostridium botulinum cultures or spores. Botulinum toxin appears to be able to pass through the intestinal lining without diminishing its toxicity and exhibits a high affinity for cholinergic motor neurons. Symptoms of botulinum toxin poisoning can progress to walking difficulties, swallowing and speech difficulties, respiratory muscle paralysis, and even death. Botulinum toxin is clinically used to treat neuromuscular disorders (i.e., movement disorders) characterized by hyperactive skeletal muscles.

[0019] In 1989, botulinum toxin type A complex was approved by the U.S. Food and Drug Administration for the treatment of essential blepharospasm, strabismus, and hemifacial spasm. Subsequently, botulinum toxin type A was also approved by the FDA for the treatment of cervical dystonia and glabellar lines, and botulinum toxin type B was also approved for the treatment of cervical dystonia. Botulinum serotypes other than type A toxin appear to have lower potency and / or shorter duration of activity compared to botulinum toxin type A. The clinical effects of peripherally injected intramuscular botulinum toxin type A usually appear within a week of injection. The typical duration of symptom relief from a single intramuscular injection of botulinum toxin type A averages about three months, but significantly longer durations of therapeutic activity have been reported. Although all botulinum toxin serotypes appear to inhibit the release of the neurotransmitter acetylcholine at the neuromuscular junction, they act on different neurosecretory proteins and cleave them at different sites. For example, botulinum toxin types A and E both cleave the 25-kDa synaptosome-associated protein (SNAP-25), but target different amino acid sequences within this protein.

[0020] Botulinum toxin types B, D, F, and G act on vesicle-associated protein (VAMP, synaptobrevin), and each serotype cleaves this protein at a different site.

[0021] Finally, botulinum toxin type C1 appears to cleave both syntaxin and SNAP-25. These differences in mechanism of action may influence the relative potency and / or duration of action of the various botulinum toxin serotypes. Notably, botulinum toxin substrates can be found in a variety of cell types. Furthermore, in vitro studies have shown that botulinum toxin inhibits potassium cation-induced release of acetylcholine and norepinephrine from primary cell cultures of brainstem tissue. Furthermore, botulinum toxin has been reported to inhibit the evoked release of glycine and glutamate from primary cultures of spinal cord neurons, and to inhibit the release of the neurotransmitters acetylcholine, dopamine, norepinephrine, CGRP, substance P, and glutamate from brain synaptosome preparations. Thus, at appropriate concentrations, botulinum toxin inhibits stimulus-induced release of most neurotransmitters.

[0022] In the present invention, “activity of toxin” means mouse LD, which is a standard assay method. 50 When measured by a bioassay (mLD50), 1U (1 unit) of botulinum toxin shows a 50% mortality rate in mice weighing about 20g, which means the inherent toxicity potency of botulinum toxin. The botulinum toxin, particularly botulinum toxin serotype A, is distributed as a product in a frozen or decompressed dried state, and the potency of the botulinum toxin may decrease depending on the dilution process performed immediately before clinical application or the storage time of the diluted solution. In this case, when the potency of the botulinum toxin decreases, it is difficult to show the expected effect of the botulinum toxin, so it is absolutely necessary to accurately predict the potency of the botulinum toxin.

[0023] In the present invention, the recombinant cell may be a prokaryotic cell, an animal cell, or a plant cell.

[0024] In the present invention, the prokaryotic cell is Escherichia coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheumia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhizobium, Rhodobacter, Zymomonase, It may be selected from the group consisting of, but is not limited to, Bacillus, Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, and Cyclobacterium.

[0025] In the present invention, the animal cell may be a cell derived from primary neurons, cultured neurons (established neurons and human neurons), non-neuronal cells, neuroblastoma, spinal cord neurons, dorsal root ganglion neurons, cerebral cortex neurons, cerebellar neurons, hippocampal neurons, or motor neurons, and more preferably, may be selected from the group consisting of SiMa, N2042F clonal cell lines, SH-SY5Y cell lines, Neuro2A cell lines, N1E-115 cell lines, IMR-32 cell lines, NG108-15 cell lines, and SH-N-SH cell lines, and may be selected from animal cancer cells used for general experimental research such as HeLa cell lines, HEK293 cell lines, A549 cell lines, and U2OS cell lines, but is not limited thereto.

[0026] In the present invention, any recombinant fluorescent protein that exhibits fluorescence through intracellular protein expression may be used without limitation, and any recombinant fluorescent protein that can emit light without affecting fluorescence expression may be used. Preferably, the recombinant fluorescent protein may be selected from the group consisting of green fluorescent protein (GFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), and orange fluorescent protein (OFP), or may be recombinantly produced therefrom, but is not limited thereto.

[0027] In the present invention, the GFP may be, but is not limited to, AGFP (480, 505 nm), AzamiGreen (492, 505 nm), EGFP (484, 507 nm), Emeraid (487, 509 nm), GFP (475, 509 nm), GFP_uv (395, 509 nm), GFP_S65T (488, 510 nm), mWasabi (493, 509 nm), Stemmer (395, 509 nm), sfGFP (485, 510 nm), TagGFP (482, 505 nm), T-Sapphire (399, 511 nm), TurboGFP (482, 502 nm), or ZsGreen (493, 505 nm), and the nm of each GFP represents an absorption wavelength and an emission wavelength, respectively.

[0028] In the present invention, the BFP may be, but is not limited to, Azurite (384, 459 nm), EBFP (383, 445 nm), EBFP2 (383, 448 nm), mTagBFP (399, 456 nm), or Y66H (382, 459 nm), and the nm of each BGP represents the absorption wavelength and the emission wavelength, respectively.

[0029] In the present invention, the CFP may be, but is not limited to, ECFP (439, 476 nm), AmCyanl (458, 489 nm), Cerulean (433, 475 nm), CyPet (435, 477 nm), mECFP (433, 475 nm), MidoriishiCyan (472, 495 nm), mTEP1 (462, 492 nm), or TagCFP (458, 480 nm), and the nm of each CFP represents the absorption wavelength and the emission wavelength, respectively.

[0030] In the present invention, the YFP may be, but is not limited to, EYFP (514, 527 nm), mBanana (540, 553 nm), mCitrine (516, 529 nm), PhiYFP (525, 537 nm), TagYFP (508, 524 nm), Topaz (514, 527 nm), Venus (515, 528 nm), YPet (517, 530 nm) or ZsYellow1 (529, 539 nm), and the nm of each YFP represents the absorption wavelength and the emission wavelength, respectively.

[0031] In the present invention, the RFP may be, but is not limited to, AQ143 (595, 655 nm), AsRed2 (576, 592 nm), dKeima-Tandem (440, 620 nm), HcRed1 (588, 618 nm), tHcRed (590, 637 nm), JRed (584, 610 nm), mApple (568, 592 nm), mCherry (587, 610 nm), mPlum (590, 637 nm), mRaspberry (598, 625 nm), mRFP1 (584, 607 nm), mRuby (558, 605 nm), or mStrawberry (574, 596 nm), and the nm of each REP represents an absorption wavelength and an emission wavelength, respectively.

[0032] In the present invention, the OFP may be, but is not limited to, DsRed / RFP (558, 583 nm), DsRed2 (563, 582 nm), DsRed-Express (555, 584 nm), DsRed-Monomer (556, 586 nm), Tomato (554, 581 nm), tdTomato (554, 581 nm), Kusabira orange (548, 559 nm), mKO2 (551, 565 nm), mOrange (548, 562 nm), mOrange2 (549, 565 nm), mTangerine (568, 585 nm), TagRFP (555, 584 nm), or TagREP-T (555, 584 nm), and the nm of each OFP represents an absorption wavelength and an emission wavelength, respectively.

[0033] In the present invention, the recombinant fluorescent protein coding sequence may include a nucleic acid sequence encoding green fluorescent protein (GFP), specifically, a nucleic acid sequence encoding EGFP (Enhanced Green Fluorescent Protein), and more specifically, a nucleic acid sequence represented by SEQ ID NO: 9, but is not limited thereto.

[0034] In the present invention, the “cell membrane binding peptide coding sequence” of the anchor protein group means a sequence in which a gene construct encodes a peptide that binds to a cell membrane.

[0035] In the present invention, the cell membrane binding peptide may be characterized by including amino acids at positions 83 to 92 of the amino acid sequence represented by SEQ ID NO: 1, and additionally including adjacent amino acids or amino acids at different positions and adjacent amino acids. Preferably, it may be characterized by including amino acids at positions 83 to 92 of the amino acid sequence represented by SEQ ID NO: 1 and including 28 adjacent amino acids, but is not limited thereto. The cell membrane binding peptide of the present invention may include two or more cysteine ​​amino acids, but is not limited thereto.

[0036] The above "adjacent amino acid" means, when including 28 adjacent amino acids centered on the 83rd to 92nd positions of the amino acid sequence represented by SEQ ID NO: 1, including 1 amino acid toward the N-terminus and 27 amino acids toward the C-terminus, or including 2 amino acids toward the N-terminus and 26 amino acids toward the C-terminus, or including 3 amino acids toward the N-terminus and 25 amino acids toward the C-terminus, or including 4 amino acids toward the N-terminus and 24 amino acids toward the C-terminus, or including 5 amino acids toward the N-terminus and 23 amino acids toward the C-terminus, or including 6 amino acids toward the N-terminus and 22 amino acids toward the C-terminus, or including 7 amino acids toward the N-terminus and 21 amino acids toward the C-terminus, or including 8 amino acids toward the N-terminus and 20 amino acids toward the C-terminus, or including 9 amino acids toward the N-terminus. Means 19 amino acids towards the N-terminus and C-terminus, or 10 amino acids towards the N-terminus and 18 amino acids towards the C-terminus, or 11 amino acids towards the N-terminus and 17 amino acids towards the C-terminus, or 12 amino acids towards the N-terminus and 16 amino acids towards the C-terminus, or 13 amino acids towards the N-terminus and 15 amino acids towards the C-terminus, or 14 amino acids towards the N-terminus and 14 amino acids towards the C-terminus, or 15 amino acids towards the N-terminus and 13 amino acids towards the C-terminus, or 16 amino acids towards the N-terminus and 12 amino acids towards the C-terminus, or 17 amino acids towards the N-terminus and 11 amino acids towards the C-terminus, or 18 amino acids towards the N-terminus and 10 amino acids towards the C-terminus, or N-terminus 19 amino acids and 9 amino acids towards the C-terminus, orIt may mean 20 amino acids towards the N-terminus and 8 amino acids towards the C-terminus, or 21 amino acids towards the N-terminus and 7 amino acids towards the C-terminus, or 22 amino acids towards the N-terminus and 6 amino acids towards the C-terminus, or 23 amino acids towards the N-terminus and 5 amino acids towards the C-terminus, or 24 amino acids towards the N-terminus and 4 amino acids towards the C-terminus, or 25 amino acids towards the N-terminus and 3 amino acids towards the C-terminus, or 26 amino acids towards the N-terminus and 2 amino acids towards the C-terminus, or 27 amino acids towards the N-terminus and 1 amino acid towards the C-terminus, or 28 amino acids towards the N-terminus and 4 amino acids towards the C-terminus, or it may mean including.

[0037] Sequence number 1 (SNAP25 full sequence):

[0038] MAEDADMRNELEEMQRRADQLADESLESTRRMLQLVEESKDAGIRTLVMLDEQGEQLDRVEEGMNHINQDMKEAEKNLKDLGKCCGLFICPCNKLKSSDAYKK AWGNNQDGVVASQPARVVDEREQMAISGGFIRRVTNDARENEMDENLEQVSGIIGNLRHMALDMGNEIDTQNRQIDRIMEKADSNKTRIDEANQRATKMLGSG

[0039] The cell membrane binding peptide coding sequence of the present invention may include a nucleic acid sequence encoding a SNARE protein, specifically a nucleic acid sequence encoding a portion of a SNAP25 peptide, and more specifically a nucleic acid sequence represented by SEQ ID NO: 8, but is not limited thereto.

[0040] In the present invention, the cell membrane binding peptide may be characterized by essentially including three or four or more cysteine ​​amino acids and including five or four or more amino acids other than cysteine, for a total of eight or more amino acids, but is not limited thereto.

[0041] In the present invention, the cell membrane binding peptide includes amino acids at positions 83 to 92 of the amino acid sequence represented by SEQ ID NO: 1, and the amino acids at positions 83 to 92 (KCCGLFICPC) contain a total of four cysteine ​​amino acids, which correspond to major amino acids involved in cell membrane binding. Furthermore, among the total of four cysteine ​​amino acids, the third and fourth cysteine ​​amino acids play a major role in cell membrane binding.

[0042] In the present invention, the cell membrane binding peptide may include a peptide in which 2 to 8 cysteine ​​amino acids are repeatedly linked by a linker. The linker includes a combination of one or more of the amino acids Gly, Asn, and Ser. Other adjacent neutral amino acids, such as Thr and Ala, may also be used in the linker sequence. Specifically, the linker may be, for example, a GlySer linker, GGS, GGGS, or GSG, and the cysteine ​​amino acids may be positioned between the linkers, so that the number of linkers is one more than the number of cysteine ​​amino acids.

[0043] In the cell membrane binding peptide, the cysteine ​​amino acid plays a major role, and when it is linked as a linker, the sensitivity of botulinum toxin is greatly improved compared to the cell membrane binding peptide containing amino acids at positions 83 to 92 of the amino acid sequence represented by sequence number 1.

[0044] In the present invention, the cell membrane binding peptide coding sequence may include a nucleic acid sequence encoding a peptide in which 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, or 2 to 3 cysteine ​​amino acids are repeatedly linked by a linker, and specifically, may be a nucleic acid sequence encoding a peptide in which 4 cysteine ​​amino acids are repeatedly linked by a linker, and more specifically, may be a nucleic acid sequence represented by SEQ ID NO: 12, but is not limited thereto.

[0045] Sequence number 12:

[0046] GGCGGAGGGCTCGTGTGGCGGAGGCTCGTGTGGCGGAGGCTCGTGTGGCGGAGGCTCGTGTGGCGGAGGCTCG

[0047] Therefore, in the present invention, the cell membrane binding peptide may include an amino acid sequence represented by SEQ ID NO: 13.

[0048] Sequence number 13:

[0049] GGGSCGGGSCGGGSCGGGSCGGGS

[0050] In the present invention, the botulinum toxin recognition peptide coding sequence refers to a sequence encoding a peptide that acts as a substrate of botulinum toxin and is decomposed or cleaved by botulinum toxin. Preferably, the botulinum toxin recognition peptide of the present invention may be characterized by including an amino acid at position 197 of the amino acid sequence represented by SEQ ID NO: 1, and 6 to 56 adjacent amino acids, and may be characterized by including amino acids up to position 202 toward the N-terminus, but is not limited thereto. Specifically, the botulinum toxin recognition peptide of the present invention may be characterized by including amino acids at positions 193 to 202 of the amino acid sequence represented by SEQ ID NO: 1.

[0051] In the present invention, the botulinum toxin recognition peptide may be characterized by additionally including an amino acid at position 197 of the amino acid sequence represented by sequence number 1 and an adjacent amino acid at a position other than the adjacent amino acid and an adjacent amino acid.

[0052] The above "adjacent amino acids" may mean including 1 amino acid toward the N-terminus and 5 amino acids toward the C-terminus when including 6 adjacent amino acids centered on the 197th position of the amino acid sequence represented by sequence number 1, or may mean including 2 amino acids toward the N-terminus and 4 amino acids toward the C-terminus, or may mean including 3 amino acids toward the N-terminus and 3 amino acids toward the C-terminus. For example, if it includes 20 adjacent amino acids centered on the 197th position of the amino acid sequence represented by SEQ ID NO: 1, it may include 1 amino acid toward the N-terminus and 19 amino acids toward the C-terminus, it may include 2 amino acids toward the N-terminus and 18 amino acids toward the C-terminus, it may include 3 amino acids toward the N-terminus and 17 amino acids toward the C-terminus, it may include 4 amino acids toward the N-terminus and 16 amino acids toward the C-terminus, and it may include 5 amino acids toward the N-terminus and 15 amino acids toward the C-terminus.

[0053] The botulinum toxin recognition peptide coding sequence of the present invention may include a nucleic acid sequence encoding a SNARE protein, specifically a nucleic acid sequence encoding a portion of a SNAP25 peptide, and more specifically a nucleic acid sequence represented by SEQ ID NO: 10, but is not limited thereto.

[0054] In the present invention, the light-inducing peptide may be used without limitation as long as it is a peptide capable of quenching the recombinant fluorescent protein of the present invention. Preferably, it may be a transmembrane domain (TMD) of influenza M2, or may be characterized by being structurally structured as an α-helix to induce binding of identical domains, but is not limited thereto. Specifically, the light-inducing peptide of the present invention may be a quencher peptide, and more specifically, it may be a peptide expressed by a nucleic acid sequence represented by SEQ ID NO: 11, but is not limited thereto.

[0055] In the present invention, the gene construct may be introduced using a cell-transducing peptide, a lipid gene carrier, or a combination thereof, or by a method such as lentivirus infection, electroporation, or magnetofection, and may also be introduced using a method known in the art.

[0056] The genetic construct of the present invention may be characterized by including a nucleic acid sequence represented by SEQ ID NOs: 8 to 11, but is not limited thereto.

[0057] Alternatively, the genetic construct may be characterized by including a nucleic acid sequence represented by SEQ ID NO: 9 to 12, but is not limited thereto.

[0058] The genetic construct of the present invention may be contained in a vector. The term "vector" as used herein refers to a genetic product containing a genetic sequence operably linked to a suitable regulatory sequence capable of expressing the gene in a suitable host. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, can integrate into the genome itself. Since plasmids are currently the most commonly used form of vector, the terms "plasmid" and "vector" are sometimes used interchangeably herein. However, the present invention encompasses other forms of vectors known or becoming known in the art that have equivalent functionality.

[0059] Any of a wide variety of expression control sequences may be used in the vector to express the gene sequence of the present invention. Examples of useful expression control sequences include the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the T3 and T7 promoters, the major operator and promoter region of phage lambda, the regulatory region of the fd-encoded protein, the promoter for 3-propoglycerate kinase or other glycolytic enzymes, the promoters of the phosphatases, e.g., Pho5, the promoter of the yeast alpha-mating system, and any other sequence known to regulate the expression of genes in prokaryotes or eukaryotes or their viruses, and any combination thereof. The T7 RNA polymerase promoter Φ can be usefully used to express proteins in Escherichia coli.

[0060] In the present invention, the term "expression vector" generally refers to a recombinant carrier into which a fragment of a heterologous gene is inserted, typically a double-stranded fragment of a gene. Here, the heterologous gene refers to a heterologous gene that is not naturally found in the host cell. Once inside the host cell, the expression vector can replicate independently of the host chromosomal genes, producing multiple copies of the vector and its inserted (heterologous) gene.

[0061] As is well known in the art, to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences that function within the selected expression host. Preferably, the expression control sequences and the gene are contained within a single expression vector that also includes a bacterial selection marker and an origin of replication. If the expression host is a eukaryotic cell, the expression vector must further include an expression marker useful in the eukaryotic expression host.

[0062] A host cell transformed or transfected with the expression vector described above constitutes another aspect of the present invention.

[0063] As used herein, the term "transformation" refers to the introduction of a gene into a host cell, thereby rendering the gene replicable either as an extrachromosomal element or through chromosomal integration. The term "transfection" refers to the uptake of an expression vector by a host cell, regardless of whether any coding sequence is actually expressed.

[0064] The host cell of the present invention may be a prokaryotic or eukaryotic cell. Furthermore, a host cell with high gene introduction efficiency and high expression efficiency of the introduced gene is typically used. Examples of host cells include well-known eukaryotic and prokaryotic cells such as E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, and yeast.

[0065] Of course, it should be understood that not all vectors and expression control sequences are equally effective in expressing the gene sequences of the present invention. Likewise, not all hosts are equally effective. Similarly, not all hosts function equally well in the same expression system. However, those skilled in the art can appropriately select from among various vectors, expression control sequences, and hosts without undue experimental burden and without departing from the scope of the present invention. For example, when selecting a vector, consideration should be given to the host, as the vector must replicate within it. The vector's copy number, its ability to control copy number, and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered. When selecting an expression control sequence, several factors should be considered, such as the relative strength of the sequence, its controllability, and its compatibility with the gene sequences of the present invention, particularly with respect to potential secondary structures. The unicellular host should be selected taking into account factors such as the selected vector, the toxicity of the product encoded by the gene sequence of the present invention, secretion characteristics, the ability to accurately fold the protein, culture and fermentation requirements, and the ease of purifying the product encoded by the gene sequence of the present invention from the host.

[0066] In the present invention, botulinum toxin is a neurotoxic protein produced by Clostridium botulium, and can be classified into a total of seven serotypes: A, B, C (C1, C2), D, E, F, and G. The botulinum toxin acts on different neurosecretory proteins depending on the type of the serotype and cleaves different parts. Specifically, botulinum toxin serotypes A and E both cleave SNAP25 (Synaptosomal nerve-associated protein 25), botulinum toxin serotypes B, D, F, and G cleave VAMP (Vesicle-associated membrane protein), and botulinum toxin serotype C1 cleaves syntaxin and SNAP25, thereby causing neurotoxicity.

[0067] In the present invention, the botulinum toxin recognition sequence for each vertical type is as shown in Table 1 below.

[0068] TYPE Sequence number recognition sequence A2 (SNAP25 protein) IMEKADSNKTRIDEANQ / RATKMLGSGB3 (VAMP protein) LSELDDRADALQAGASQ / FETSAAKLC2 (SNAP25 protein) IMEKADSNKTRIDEANQR / ATKMLGSG4 (Syntaxin protein) EHAVDYVERAVSDTKK / AVKYQSKARRKKIMD5 (VAMP protein) VNVDKVLERDQK / LSELDDRADALQAGASQFETSAAKLE6(SNAP25 protein) HMALDMGNEIDTQNRQIDR / IMEKADSNKTRIDEANQRATKMLGSGF5(VAMP protein) VNVDKVLERDQ / KLSELDDRADALQAGASQFETSAAKLG7(VAMP protein) DKVLERDQKLSELDDRADALQAGASQFESSA / AKLKRKKYWW

[0069] In the amino acid sequence of Table 1 above, “ / ” indicates the action site where each botulinum toxin cuts.

[0070] In the present invention, the botulinum toxin may preferably be botulinum toxin serotype A, botulinum toxin serotype B, or botulinum toxin serotype E, and more preferably botulinum toxin serotype A, but is not limited thereto.

[0071] That is, the recombinant cell into which the genetic construct of the present invention has been introduced can express a fusion protein in which a cell membrane binding peptide, a recombinant fluorescent protein, a botulinum toxin recognition peptide, and a light-inducing peptide are sequentially linked. The expressed fusion protein may be characterized in that when botulinum toxin is not present, fluorescence or color expression is inhibited in a light-inducing form, but when it comes into contact with botulinum toxin, the botulinum toxin recognition peptide is cleaved, separating the fluorescent protein and the light-inducing peptide, thereby increasing the intensity of fluorescence expression or color expression.

[0072] Another aspect of the present invention relates to a cell-based method for detecting or measuring the activity of botulinum toxin, comprising the steps of: culturing a recombinant cell of the present invention; treating the cultured recombinant cell with botulinum toxin; and measuring the intensity of fluorescence or the number of cells expressing fluorescence in the recombinant cell treated with the botulinum toxin.

[0073] Another aspect of the present invention relates to a method for evaluating a cell-based botulinum toxin inhibitor, comprising the steps of: culturing a recombinant cell of the present invention; treating the cultured recombinant cell with a botulinum toxin and an inhibitor candidate; and measuring the intensity of fluorescence or the number of cells expressing fluorescence in the recombinant cell, and then determining the activity of the botulinum toxin by comparing it with a control group.

[0074] In the present invention, the step of culturing recombinant cells can be performed in a commonly used medium. For example, the medium that can be used in the present invention may be any medium commonly used for culturing animal cells, for example, Eagle's MEM (Eagle's Minimum Essential Medium, Eagle, H Science 130:432(1959)), α-MEM (Stanner, CP et al., Nat. New Biol. 230:52(1971)), Iscove's MEM (Iscove, N. et al., J Exp. Med. 147:923(1978)), 199 medium (Morgan et al., Proc Soc. Exp Bio Med., 73:1(1950)), CMRL 1066, RPMI 1640 (Moore et al., J. Amer. Med. Assoc. 199:519(1950)), F12 (Ham, Proc. Natl. Acad. Sci. USA 53:288(1965)), F10 (Ham, RG Exp. Cell Res. 29:515(1963)), DMEM (Dulbecco's Modification Eagle's Medium, Dulbecco, R.et al., Virology 8:396(1959)), a mixture of DMEM and F12 (Barnes, D.et al., Anal, Biochem. 102:255(1980)), Way-mouth's MB752 / 1 (Waymouth, CJ Natl. Cancer Inst. 22:1003(1959)), McCoy's 5A (McCoy, TA, et al., Proc. Soc. Exp. Biol. Med. 100:115(1959)) and MCDB series (Ham, RG et al., In Vitro 14:11(1978)) can be used. For a description of the badge, see R. Ian Freshney, Culture of Animal Cells.A Manual of Basic Technique, Alan R. Liss, Inc., New York, which is incorporated herein by reference.

[0075] Another aspect of the present invention relates to a kit for detecting or measuring the activity of botulinum toxin, comprising a probe comprising a cell membrane binding peptide, a fluorescent substance, a botulinum toxin recognition peptide, and a light-inducing peptide.

[0076] In the present invention, the fluorescent substance may be one or more selected from the group consisting of FAM (6-carboxylfluorescein), HEX, ATAATCAGGAC, JOE, CY5, CY3, and Alexa680, but is not limited thereto.

[0077] In the present invention, the light-induced peptide is TAMRA (6-carboxyltetramethyl-rhodamine), BHQ1 (Black Hole Quencher) ® 1), BHQ2 or Dabcyl, but is not limited thereto.

[0078] In the present invention, the probe may be a protein or chemical substance that directly contacts a specimen, but is not limited thereto.

[0079] In the present invention, the kit may take the form of a bottle, a tub, a sachet, an envelope, a tube, an ampoule, a test kit, or the like, which may be formed partly or wholly from plastic, glass, paper, foil, wax, or the like. The container may be equipped with a completely or partially detachable stopper, which may initially be part of the container or may be attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, the contents of which may be accessible by means of a syringe needle. The kit may include an outer package, which may include instructions for use regarding the use of the components.

[0080] In the present invention, the kit may be characterized in that, when botulinum toxin is present in a specimen sample, the botulinum toxin recognition peptide is decomposed by the botulinum toxin, and the quenched fluorescent substance exhibits fluorescence.

[0081] In the present invention, the "specimen sample" includes various samples, and specifically, may be a sample collected from at least one of liquid, soil, air, food, waste, animal or plant intestines, and animal or plant tissues, but is not limited thereto. Specifically, the liquid may be characterized as being water, blood, urine, tears, sweat, saliva, lymph, cerebrospinal fluid, etc., and the water includes river water, sea water, lake water, rainwater, etc., the waste includes sewage, wastewater, etc., and the animal or plant includes a human body. In addition, the animal or plant tissues include tissues of mucous membranes, skin, integument, hair, scales, eyes, tongue, cheek, hoof, beak, snout, foot, hand, mouth, nipple, ear, nose, etc.

[0082] Meanwhile, when analyzing a sample of mammalian or human origin, the sample may be derived from a specific tissue or organ. Representative examples of tissues include connective, skin, muscle, or nervous tissue. Representative examples of organs include the eye, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testis, ovary, uterus, rectum, nervous system, gland, and internal blood vessels. The biological sample to be analyzed includes any cell, tissue, fluid, or other medium derived from a biological source that can be well analyzed by the present invention, including samples obtained from human animals, food prepared for human or animal consumption.

[0083] Additionally, biological samples analyzed include body fluid samples, including but not limited to blood, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extracts (e.g., brain pulverize), spinal fluid, appendix, spleen, and tonsil tissue extracts.

[0084] The present invention relates to a cell or protein-based analysis system for determining botulinum toxin activity and a method for detecting and measuring botulinum toxin activity using the same, which can detect botulinum toxin or quantitatively analyze its activity through fluorescence measurement without using cell lines that are difficult to culture, such as stem cells.

[0085] Figure 1 is information about the genetic construct and vector of the present invention.

[0086] Figure 2 is a diagram showing the results of inducing the microscopic expression of a fluorescent protein using cells into which the genetic construct of the present invention has been introduced.

[0087] Figures 3 and 4 show the results of confirming the activity of botulinum toxin by treating cells into which the genetic construct of the invention was introduced with botulinum toxin.

[0088] Figure 5 shows the results of an efficacy analysis of botulinum toxin using cells into which the genetic construct of the present invention has been introduced.

[0089] Figure 6 is a result of comparing the expression of recombinant fluorescent protein in cells according to the activity of botulinum toxin using the inventor's existing test method and the test method of the present invention.

[0090] Figure 7 shows the results of comparing the expression pattern of a recombinant fluorescent protein in cells according to the activity of botulinum toxin using the inventor's existing test method and the test method of the present invention.

[0091] Figure 8 is a diagram comparing the results of measuring botulinum toxin using the inventor's existing test method and the test method of the present invention.

[0092] Figure 9 shows the results of comparing the expression patterns of recombinant fluorescent proteins according to modifications in the cell membrane binding peptide coding sequence.

[0093] Figure 10 shows the results of comparing the expression patterns of recombinant fluorescent proteins according to modifications in the cysteine ​​amino acid sequence among the cell membrane binding peptide coding sequences.

[0094] Figure 11 is a diagram schematically illustrating a cell-based botulinum toxin analysis method of the present invention.

[0095] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0096]

[0097] Example 1. Preparation of gene constructs

[0098] A plasmid containing a gene construct containing the sequence in Table 2 below was constructed.

[0099] 서열번호이름서열8Membrane binding peptideAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTA9Recombinant fluorescence (EGFP)ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG10Botulinum toxin type A (BoNT / A) recognition peptideGATGAGGCCAACCAACGTGCAACAAAGATG11Glimmer inducedpeptideTGCAATGATTCGTCAGACCCTCTGGTCGTGGCTGCCTCCATTATTGGTATTCTGCACCTGATCCTGTGGATTCTGGATCGTCTG

[0100] After synthesizing the gene in the order of cell membrane binding peptide - recombinant fluorescent protein - botulinum toxin A recognition peptide - light-inducing peptide coding sequence as shown in Figure 1, sub-cloning was performed using a multi-cloning site (MCS).

[0101] The specific method is as follows.

[0102] Preparation of lysogenic medium for bacterial culture (LB) (based on 1 liter): In a 2-liter glass bottle, add 25 grams (g) of the lysogenic medium reagent and 1 liter of distilled water. Add a magnetic stirrer and stir until completely dissolved. Remove the magnetic stirrer, leave the lid slightly ajar, and sterilize in an autoclave at 121°C for 15 minutes. Cool the sterilized medium, divide it into portions, and store in the refrigerator. (Allow the medium to come to room temperature before use.)

[0103] Preparation of LB agar plates for bacterial lysogenicity studies (for 1 L): In a 2 L glass bottle, add 25 g of the lysogenicity study medium reagent and 12 g of agar to 1 L of distilled water, cover, and sterilize in an autoclave at 121°C for 15 minutes. In a 2 L glass bottle, add 25 g of the lysogenicity study medium reagent and 12 g of agar to 1 L of distilled water, add a magnetic bar, and stir until completely dissolved. Remove the magnetic bar, leave the cap slightly ajar, and sterilize in an autoclave at 121°C for 15 minutes. When the sterilized medium has cooled to a warm state, add 1 mL of a 100 mg / mL solution of ampicillin antibiotic to the sterilized medium and mix well. Add 20 mL of ampicillin antibiotic medium to each bacterial Petri dish and leave at room temperature until completely solidified. Place the completely solidified bacterial lysogenic agar (LB) plate upside down in a 37℃ incubator to dry for 8–10 hours, seal with parafilm, and store in the refrigerator (before using the plate, place it in a 37℃ incubator for at least 30 minutes).

[0104] Preparation of 0.1 molar concentration (M) calcium chloride: Put 1.11 g of calcium chloride in a 200 mL glass bottle, add 100 mL of distilled water, mix, then sterilize in an autoclave at 121°C for 15 minutes with the lid slightly open. After cooling, close the lid and store in the refrigerator.

[0105] 50% concentration (%) glycerol preparation: Mix 25 mL of glycerol and 25 mL of distilled water in a 100 mL glass bottle, then sterilize in an autoclave at 121°C for 15 minutes with the lid slightly open. Once cooled, close the lid and store in the refrigerator.

[0106] Preparation of competent cell concentrate: Remove competent cells from -80℃ and thaw on ice for 5-10 minutes. Add 50-100μL of the thawed competent cells to a 50mL conical tube containing 10mL of a medium for studying bacterial lysogenicity without antibiotics, mix well, slightly open the lid, and incubate in a 37℃ shaking incubator for more than 16 hours. After 16 hours of incubation, when the culture has grown cloudy, add 1mL of the culture to a 250mL Erlenmeyer flask containing 100mL of a pre-sterilized medium for studying bacterial lysogenicity, and incubate in a 37℃ shaking incubator for 2 hours. After 2 hours, remove 100μL of the culture and measure the bacterial cell concentration (OD600). At this time, the appropriate optical density (OD) value is 0.4 to 0.6 (if it is lower than 0.4, measure again every 30 minutes to 1 hour and culture until the optical density (OD) value reaches 0.4 to 0.6). If the optical density (OD) standard is suitable, leave the culture on ice for 10 minutes. After 10 minutes, dispense 50 mL of the culture into pre-chilled sterilized 5 mL conical tubes and centrifuge at 5,000 rpm for 10 minutes. Discard the supernatant of the centrifuged culture, add 20 mL of cold 0.1 molar (M) calcium chloride, gently lyse the bacterial cells, leave on ice for 15 minutes, dispense, and centrifuge at 5,000 rpm for 10 minutes. Discard the supernatant of the centrifuged culture, add 4 mL of cold 0.1 M calcium chloride, gently suspend the bacterial cells, and leave on ice for 30 minutes. While the bacterial cells are leaving on ice for 30 minutes, dispense 100 μL of cold 50% glycerol into sterile microtubes chilled on ice and refrigerate (keep the tube as cold as possible). After 30 minutes, mix the bacterial cells in 4 mL well, dispense 100 μL each into sterile e-tubes that have already been dispensed 100 μL of 50% glycerol, close the lid, and place in liquid nitrogen.After dividing all bacterial cells, discard the liquid nitrogen and store the frozen bacterial cell concentration solution at -80℃ and use it when needed (when using, place on ice and thaw before use).

[0107] Preparation of 1 molar concentration trisaminomethane (hydrogen ion concentration index pH 7.5): Put 12.11 g of trisaminomethane in a beaker, add 70 mL of distilled water to dissolve, then add hydrochloric acid to adjust the hydrogen ion concentration index pH to 7.5, make the final volume 100 mL, filter, and store in the refrigerator.

[0108] Preparation of 1 molar concentration magnesium chloride: Put 2.03 g of magnesium chloride in a 50 mL Conical tube, add 10 mL of distilled water, dissolve, filter, and store in the refrigerator.

[0109] Preparation of 0.5 molar concentration dithiothreitol: Put 0.7712 g of dithiothreitol in a 50 mL conical tube, add 10 mL of distilled water, dissolve, filter, and store in the refrigerator.

[0110] Preparation of 5x T5 exonuclease-dependent mixed buffer solution (1 mL): In a 1.5 mL conical tube, add 500 μL of 1 M trisaminomethane (pH 7.5), 50 μL of 1 M magnesium chloride, and 100 μL of 0.5 M dithiothreitol. Add 0.25 g of polyethylene glycol 8000 and heat to completely dissolve. Place the completely dissolved solution on ice and add 350 μL of distilled water to bring the final volume to 1 mL. Add 1 μL of T5 exonuclease (final concentration: units per 10 mL (U / mL)), mix well, and aliquot the concentrated solution into 100 μL portions. Store at -80°C and use as needed (keep on ice and thaw before use).

[0111] Method for preparing polymerase chain reaction products: Place primers (forward, reverse) in distilled water at a picomole concentration per 100 microliters (pmole / μL). Dilute each primer at 100 pmole / μL 10-fold with distilled water to obtain a concentrated solution of 10 pmole / μL. Dilute the final volume of template to a nanogram concentration per microliter (ng / μL) with distilled water to obtain a 5 μL solution. Add 13 μL of distilled water to a microtube containing 20 μL of polymerase chain reaction reagent mixture. Add 1 μL of each primer (forward, reverse) at a 10 pmole / μL concentrated solution to the polymerase chain reaction reagent mixture tube containing distilled water. Add an additional 5 μL of template diluted to a 1 ng / μL concentration solution, tap the polymerase chain reaction mixture tube with your finger, and then place it in a small centrifuge to settle the solution before placing it in the polymerase chain reaction apparatus. The final sample volume is 20 μL, and the polymerase chain reaction is performed under the circulation conditions of the polymerase chain reaction reagent mixture as shown in Table 3 below.

[0112] Step Temperature Reaction Time Number of Cycles Pre-denaturation 95℃ 5 minutes 1 Denaturation 95℃ 30 seconds 30~35 Primer binding 55℃ 30 seconds Elongation reaction 72℃ 1 minute For less than 1000 base pairs Final elongation reaction 72℃ 5 minutes 1 Hold 4℃ Infinite Infinite

[0113] Method for producing linear forms of pcDNA3.1 vectors: Place 700 to 800 nanograms (ng) of circular pcDNA3.1 vector into a sterile micropolymerase chain reaction tube. Prepare the reaction mixture as shown in Table 4 below.

[0114] Sample volume (μL) PCDNA 3.1 Vector (1000 nanograms (ng)) 0.8-10 times concentrated Quickcut solution (Quickcut Buffer) 3 Nhe I (restriction enzyme) 1 Kpn I (restriction enzyme) 1 Distilled water 24.2 Final volume 30

[0115] Add a final volume of 30 μL of sample, mix thoroughly with a pipette, and centrifuge to allow the solution to settle. Incubate at 37°C for 15 minutes. After 15 minutes of reaction, purify the cleaved vector using the DokdoPrap Gel / Polymerase Chain Reaction Purification Kit, following the steps below.

[0116] Add 30 μL of the cleaved vector to a sterilized microtube, add 150 μL of the polymerase chain reaction binding solution, gently tap with your finger to mix, and centrifuge the solution to settle (the ratio of the cleaved vector sample to the polymerase chain reaction binding solution is 1:5). Add 180 μL of the mixture to a spin column and centrifuge for 1 minute at room temperature and 13,000 rpm. Discard the flow-through collected in the recovery tube of the spin column and place the spin column back into the recovery tube. Add 750 μL of the washing solution and centrifuge for 1 minute at 13,000 rpm at room temperature. Discard the flow-through collected in the recovery tube of the spin column, place the spin column back into the recovery tube, and centrifuge for 1 minute at room temperature and above 13,000 rpm to remove the remaining washing solution. Place a spin column in a sterilized microtube, add 15-20 μL of distilled water, and leave to stand at room temperature for 1 minute. After 1 minute, centrifuge at 13,000 rpm or higher for 1 minute to obtain the purified vector, and check the concentration using a NanoDrop.

[0117] Cloning-Gibson Assembly Test Method (Standard Test Method): In a sterile micro-polymerase chain reaction tube, react the linearized fragmented vector and the gene construct, and add the reaction reagents as follows in a final volume of 20 μL of the sample (at this time, take a 5-fold volume of T5 exonuclease-dependent mixing buffer solution from -80°C and thaw it on ice before use). Prepare the Gibson Assembly reaction mixture as follows.

[0118] Sample volume (μL) 5x T5 exonuclease-dependent mixing buffer solution 4 PCDNA 3.1 Vector (100 ng) 3.66 Gene construct 1 Distilled water 11.34 Final volume 20

[0119] The order of addition is distilled water > green fluorescent protein > gene > vector > 5x buffer solution, mix gently with a pipette, and centrifuge to settle the solution. Incubate in a polymerase chain reaction device at 37℃ for 40 minutes.

[0120] Transformation: Ten minutes before the completion of the Gibson Assembly reaction, remove bacterial cells from -80°C and thaw them on ice. Add 2 μL of the Gibson Assembly-reacted vector gene to 200 μL of the pre-thawed bacterial cells, mix with a pipette, and centrifuge the solution to settle. Incubate on ice for 10 minutes. After 10 minutes, incubate on a 42°C heating block for 1 minute and 30 seconds, then incubate on ice for another 5 minutes. After 5 minutes, add 800 μL of antibiotic-free bacterial lysogenic medium to the 200 μL and incubate in a 37°C shaking incubator for 1 hour. After 1 hour, centrifuge the culture and let it settle at 5,000 rpm for 3 minutes. Discard 800 μL of the supernatant from the culture with the pellet at the bottom, and gently disperse the pellet with the remaining 200 μL. Add 200 μL of culture solution to an agar plate for bacterial lysogenicity studies containing ampicillin antibiotic, spread the solution with a spreader, and incubate the plate upside down in a 37°C incubator for 16 hours. After 16 hours, confirm colonies on the plate, seal the plate, and store it at 4°C.

[0121] Culture and purification of recombinant vector gene: After colony confirmation, prepare a lysogenic medium for bacteria with antibiotics by adding 5 μL of 100 mg / mL ampicillin antibiotic (final concentration: micrograms per 100 mL) to 10 mL of a lysogenic medium for bacteria without antibiotics. Add 5 mL of the lysogenic medium for bacteria with antibiotics to a 14 mL round-bottomed tube, pick up one colony on the plate with a tip, add it to the medium, and mix with a pipette. Close the cap of the medium tube with the colony inoculated and incubate in a 37°C shaking incubator for 16 hours. After 16 hours of incubation, close the cap of the 14 mL round-bottomed tube tightly and centrifuge at 5000 rpm for 10 minutes. Purify the plasmid according to the test method of the plasmid mini prep kit. Based on a 5 mL culture, store the cell resuspension solution (Sol I) (+ RNA A solution) refrigerated. Addition) Add 250 μL of cell lysis solution (Sol II) and gently mix the pellet with a pipette and transfer to a sterilized microtube. Add 250 μL of cell lysis solution (Sol II) to the microtube, gently invert it up and down 5 to 6 times, and centrifuge it to settle the solution. Add 350 μL of neutralization solution (Sol III) to the tube where the solution has settled, gently invert it up and down 5 to 6 times, and centrifuge it at 13,000 rpm for 10 minutes to settle the solution. After centrifugation, transfer only the supernatant to a spin column and centrifuge it at 13,000 rpm for 1 minute. Discard the flow-through in the recovery tube, replace it, add 75 μL of washing solution, and centrifuge it at 13,000 rpm for 1 minute. Discard the flow-through in the recovery tube, replace it, and centrifuge it at 13,000 rpm to remove residue. Centrifuge for 1 minute. Transfer only the spin column to a sterilized microtube, open the column lid for 30 seconds to evaporate the ethanol, then add 25-30 μL of distilled water to the center of the spin column and leave it at room temperature for 1 minute.After 1 minute, the plasmid was collected by centrifugation at >13,000 rpm for 1 minute, and the concentration was measured using a nanodrop. A portion of the collected plasmid was transferred to a sterilized microtube and sequence information was confirmed through sequence analysis.

[0122] The method for producing a genetically transformed cell line is as follows.

[0123] Preparation of cell culture medium: In a biological safety cabinet, add 50 mL of 10% fetal bovine serum (FBS) to 500 mL of cell culture medium (MEM and DMEM) used for cell culture, add 5 mL of 1% penicillin antibiotic, close the lid, mix well, seal the lid with parafilm, and store in a refrigerator at 4℃ (use within one month of cell culture medium preparation and warm in a 37℃ constant temperature water bath before use).

[0124] Preparation of cell culture medium used for transformation: In a biological safety cabinet, add 25 mL of 5% fetal bovine serum to 500 mL of Opti-MEM, mix well, seal the lid with parafilm, and store in a refrigerator at 4℃ (use within one month of cell culture medium preparation and warm in a 37℃ constant temperature water bath before use).

[0125] Preparation of Cell Adhesion Compound (Poly-D-Lysine, PDL) Coated Plates: In a biological safety cabinet, dilute a 1 mg / mL solution of cell adhesion compound 1:50 with distilled water. Add 800 μL to each of the 6-well plates and leave at room temperature for 1 hour. After 1 hour, discard the cell adhesion compound solution and wash with 4 mL of phosphate-buffered saline (PBS) twice. Repeat this process. Blot off excess water with a towel and dry at room temperature for at least 45 minutes.

[0126] Preparation of culture medium for screening transformed cell lines: In a biological safety cabinet, add 50 mL of 10% fetal bovine serum to 500 mL of cell culture medium (MEM and DMEM) and 5 mL of 1% penicillin antibiotic. Add 5 mL of geneticin (G418), an antibiotic resistant to the transformed plasmid, mix well, seal the lid with parafilm, and store in a refrigerator at 4℃. (Use within one month of preparing the cell culture medium and warm it in a 37℃ water bath before use.)

[0127] Cell thawing and cell culture: Frozen normal cells SH-SY5Y, Neuro2A, and IMR-32 were quickly thawed in a constant temperature water bath and then placed in a 25 cm plate with 7 mL of warmed prepared cell culture medium. 2 Place the cells in a flask container and culture in an incubator with 5% carbon dioxide at 37°C. After thawing the cells, check the growth status of the cells for 1-2 days, and when the cell density is 70-80%, the cells are attached to a 25cm 2 Remove all the cell culture medium from the flask using a pipette. 25 cm from which the cell culture medium has been removed 2 Slowly add 5 mL of phosphate-buffered saline to the flask, wash the cell culture medium on the surface where the cells are attached, remove it with a pipette, add 1 mL of protease solution, and leave it in an incubator with 5% carbon dioxide at 37°C for 3-5 minutes. Take out the flask left in the incubator, gently tap the side, and check under a microscope whether all the attached cells have fallen off, then add 5 mL of the prepared cell culture medium, and transfer the cell culture medium containing the cells to a 15 mL conical tube. 75 cm 2Add 12 mL of cell culture medium to the flask, add 2 mL of cell culture medium containing cells, close the flask lid, spread the medium well at the bottom, and culture for 2-3 days in an incubator with 5% carbon dioxide at 37°C (the ratio can be adjusted from 1:2 to 1:5 depending on the cell growth rate, and it is recommended to subculture the cells twice for at least 7 days after thawing before using them for cell experiments).

[0128]

[0129] Example 2: Production of Heterogeneous Transformed Cell Lines

[0130] After encoding extracellular matrix proteins in 6 well plates to culture transformed cells, they are dried and prepared.

[0131] Preparation of gene sample for transformation (based on 1 well plate): Add the gene and pre-OptiMM sample to sterilized microtube 1 and react at room temperature for 5 minutes. Add Lipofectamine 3000 and pre-OptiMM sample to sterilized microtube 2 and react at room temperature for 5 minutes. After the reaction in tube 2 is complete, add 125 μL of the tube 2 solution to the sterilized microtube, add 125 μL from tube 1, gently tap with a finger, centrifuge the solution to settle, and react at room temperature for 20 minutes. While the transformation sample mixture is reacting, the density of normal cells cultured in an incubator is 75 cm. 2When the confluency of the flask is 80-90%, slowly add 5 mL of phosphate-buffered saline, wash the cell culture medium on the surface where the cells are attached, remove it with a pipette, add 1 mL of protease solution, and leave it in a 5% carbon dioxide incubator at 37℃ for 3-5 minutes. Take out the flask left in the incubator, gently tap the side, and check under a microscope whether all the attached cells have fallen off, then add 5 mL of the prepared transformation medium, OptiMM, and transfer the cell culture medium containing the cells to a 15 mL conical tube using a pipette. Mix 6 mL of OptiMM containing the cells well with a pipette, and then add 100 μL to a sterilized microtube. Add 100 μL of trypan blue dye in a 1:1 ratio to a microtube containing cells, mix well, and then add 10 μL to the groove between the hemocytometer and the glass cover, and count the cells under a microscope. After confirming the cell count, add 1.0 X 10 to one well plate. 6 Prepare cells for attachment. After the 20-minute transformation sample mixture reaction, add 250 μL of sample to one well plate and add 1.0 X 10 6Add 1750 μL of 5% OptiM calculated as cells and spread the final volume of 2 mL evenly on the plate, then incubate in a 5% carbon dioxide incubator at 37°C for 24-48 hours (the transformation time varies depending on the cell type). After 16 hours of transformation reaction, slowly remove the medium containing the transformed sample mixture in the 6 well plates using a pipette. To select only cells inserted with the gene vector, slowly add 2 mL of the transformed cell line selection culture medium containing 0.1 mg / mL of geneticin antibiotic to each well plate, and then incubate in a 5% carbon dioxide incubator at 37°C for 24-48 hours (the transformation time varies depending on the cell type). After culturing, slowly remove the culture medium from the 6-well plate with a pipette to select the transformed cells and remove dead cells, then slowly add 2 mL of new transformed cell line selection culture medium and culture for 2-4 days in a 5% carbon dioxide incubator at 37°C (the culture time may vary depending on the cell type). Next, when the density of transformed cells in the 6-well plate is 90% or higher, remove the medium on the well plate with a pipette. Slowly add 1 mL of phosphate-buffered saline, wash the cell culture medium on the surface where the cells are attached, add 1 mL of protease solution, and leave in a 5% carbon dioxide incubator at 37°C for 3-5 minutes. Take out the flask, gently tap the side, and check under a microscope whether all the attached cells have fallen off. Add 3 mL of transformed cell line selection culture medium and dilute the cells in the well plate with a pipette. 75 cm 2Add 12 mL of cell culture medium to the flask, add all 3 mL of cell culture medium from the well plate containing the cells, close the flask lid to ensure that the medium spreads well at the bottom, and culture for 2-3 days in a 5% carbon dioxide incubator at 37°C (the ratio can be adjusted from 1:2 to 1:5 depending on the cell growth rate). As a result of confirming the fluorescence expression of the cell line into which the recombinant gene construct was inserted using image analysis equipment, a faint expression of the fluorescent protein was induced in the cell line into which the gene construct was introduced (Fig. 2).

[0132]

[0133] Example 3. Expression analysis to confirm the efficacy of botulinum toxin in transformed cell lines.

[0134] 75cm from the biological safety cabinet 2When the density of the heterogeneous transformed cell line cultured in two flasks is 80-90%, slowly add 5 mL of phosphate-buffered saline to each flask, wash the cell culture medium on the surface where the cells are attached, add 1 mL of protease solution, and leave in a 5% carbon dioxide incubator at 37℃ for 3-5 minutes. Take out the flask left in the incubator, gently tap the side, and check under a microscope whether all the attached cells have fallen off, then add 5 mL to each flask, pipette the cell culture medium containing the cells in the flask to a 50 mL conical tube, and centrifuge at 1500 rpm for 3 minutes. Remove only the supernatant from the centrifuged 15 mL conical tube with a pipette, gently tap it with your finger to loosen it, and then add 5 mL of cell culture medium containing 10% fetal bovine serum to each flask to loosen the pellet well. After mixing 5 mL of cell culture medium containing cells well, put 100 μL into a sterilized microtube. Add 100 μL of trypan blue dye in a 1:1 ratio to the microtube containing cells, mix well, and put 10 μL into the groove between the hemocytometer and the glass cover, and count the cells under a microscope. After confirming the cell number in the cell culture medium containing cells, plate 1.8 X 10 in a 1-well circular plate in a 96-well plate with a final volume of 100 μL. 4 Dilute with cell culture medium to allow cell attachment and prepare in 10 mL. Prepare consecutive concentration samples of botulinum toxin to be processed with cells as shown in Table 6 below, and make the final volume 300 μL.

[0135] Number Concentration (μg / mL) Serial dilution stock solution Botulinum toxin type A (μL) Cell culture medium by fetal bovine serum concentration (μL) Final volume (μL) 11000----211 stock solution 0.329 9.7300 30.332 stock solution 100200300 40.113 stock solution 100200300 50.0374 stock solution 100200300 60.0125 stock solution 100200300 70-0300300

[0136] For each concentration of the diluted botulinum toxin sample prepared in advance in a 96-well plate, 10 μL is dispensed into two well plates, and an additional 90 μL of cell culture medium for each concentration of fetal bovine serum is dispensed. After reacting for 48 hours in a 5% carbon dioxide incubator at 37°C, the expression amount for evaluating the efficacy of botulinum toxin is confirmed through a fluorescence microscope and analyzed as in the analysis process. As a result, it was confirmed that the intensity of fluorescence expression induced by light within the cell increases when botulinum toxin is treated (see Fig. 3).

[0137] Additionally, protein quantitative evaluation was performed to analyze the cleavage of the botulinum toxin recognition peptide of the photoinducible peptide group in genetically recombinant cells by the activity of botulinum toxin.

[0138] As above, remove the cell culture medium from the well plate in which the botulinum toxin sample was reacted for 48 hours, add phosphate-buffered saline, wash, add 60 uL of RIPA to each well, scrape it with a scraper, transfer it to a 1.5 ml tube, place it on ice, and vortex it twice at 10-minute intervals. Centrifuge at 4℃, 13,000 rpm, for 10 minutes, transfer the supernatant to a new 1.5 ml tube, add an equal volume of 2X cell lysate (w / 0.1 M DTT), and boil at 95℃ for 5 minutes to prepare a sample for protein quantitative analysis. Load the sample prepared in the acrylamide gel kit through an electrophoresis device, and transfer the separated proteins in the acrylamide to a PVDF membrane using a protein transfer kit. 1 st Antibody (SNAP25_cleaved, GAPDH) and 2 nd After sequential reaction with the antibody, a detection solution (ECL) is added and the amount of luminescence is analyzed using Western analysis equipment.

[0139] Through protein quantitative evaluation, it was confirmed that the botulinum toxin recognition peptide of the photoinducible peptide group was cleaved in genetically recombinant cells by the activity of botulinum toxin (see Fig. 4).

[0140] An analysis process was developed to confirm the efficacy of botulinum toxin through these genetically recombinant cells. 1) Target detection (fluorescent protein expression detection), 2) Expression analysis (calculation of the average value of total fluorescence expression), 3) Expression analysis (calculation of the average value of total fluorescence expression after removing the basal expression fluorescence value), 4) Expression analysis (four parameter statistical analysis). The results of analyzing the fluorescence analysis values ​​obtained through the analysis equipment as the average value of total fluorescence expression after removing the basal expression fluorescence analysis value are presented.

[0141] Total fluorescence expression average value calculated concentration (ng / mL) Image 1 Image 2 Average standard deviation 1,000 34,189,115 36,118,009 35,153,56 21,363,934 200 51,814,919 65,380,960 58,597,939 9,592,640 40 54,481,736 36,559,442 45,520,589 12,672,975 861,676,97 131,552,019 46,614,49 5 21,301,55 81.644,52 1,09227,743,01436,132,05311,863,8920.3239,728,78721,350,84330,539,81512,995,1690.0621,508,77612,187,78616,848,2816,590,9350.0111,922,4184,077,0657,999,7415,547,5020.0022,348,4302,592,5592,470,494172,625

[0142] After removing the basal expression fluorescence value, the average value of total fluorescence expression was calculated. Concentration (ng / mL) Image 1 Image 2 Mean standard deviation 1,000 33,338,126 35,267,020 34,302,57 31,363,934 200 50,963,930 64,529,970 57,746,95 09,592,640 40 53,630,747 35,708,45 344,669,600 12,672,975 860,825,98 230,701,030 45,763,50 621,301,55 81.64 3,67 0,10326,892,02535,281,06411,863,8920.3238,877,79820,499,85429,688,82612,995,1690.0620,657,78711,336,79715,997,2926,590,9350.0111,071,4293,226,0757,148,7525,547,5020.0021,497,4411,741,5701,619,505172,625

[0143] Based on the analyzed results, the EC was statistically analyzed using the Four parameter analysis method. 50 The values ​​were derived (see Fig. 5). As shown in Fig. 5, it was confirmed that botulinum toxin at a concentration level of nanograms per milliliter (ng / mL) or less could be detected.

[0144]

[0145] Example 4. Comparative analysis of the efficacy evaluation of botulinum toxin using the existing test method and the improved evaluation method of the present invention.

[0146] Additionally, a comparative experiment was conducted to confirm the improved evaluation method for the previously developed test method of the present inventor. First, the fluorescence expression pattern upon botulinum toxin treatment was compared using the previous test method and the improved test method. While the previous test method showed that fluorescent proteins were expressed throughout the cell upon botulinum toxin treatment, the improved test method confirmed that fluorescent proteins were expressed around the cell membrane by the cell membrane-binding peptide upon botulinum toxin treatment (see Fig. 6).

[0147] In addition, the expression patterns of fluorescent proteins were compared when treated with low concentrations of botulinum toxin for comparative analysis between the previous and improved test methods. While no increase in expression was observed when treated with 0.1 or 1 ng / mL of botulinum toxin using the previous test method, the improved test method confirmed that the expression of fluorescent proteins increased depending on the concentration when treated with 0.1 or 1 ng / mL of botulinum toxin (see Figure 7).

[0148] The results obtained through the previous and improved test methods were compared and analyzed through a normalization graph according to the analysis process (see Fig. 8). As a result, the EC of the improved test method of the present invention using a genetic construct including a cell membrane-binding peptide sequence was higher than that of the previous test method that did not use a cell membrane-binding peptide. 50 It was confirmed that the value was significantly lower. That is, the botulinum toxin detection method of the present invention can quantitatively analyze trace amounts of botulinum toxin at a concentration of nanograms per milliliter (ng / mL) or less compared to conventional test methods, including anchor peptides that bind to cell membranes.

[0149]

[0150] Example 5. Analysis to confirm the effect of cysteine ​​amino acid in cell membrane binding peptide sequences.

[0151] At this time, among the main recombinant gene sequences of the improved test method, the cell membrane binding peptide sequence contains four cysteine ​​amino acids, which are the main amino acids for cell membrane binding, and in order to verify that this is the main effect of the improved test method, each or multiple cysteine ​​amino acids were replaced with other amino acids through modification of the coding sequence and the expression pattern of fluorescent protein was compared when botulinum toxin was treated. When modifying the coding sequence of each or multiple cysteine ​​amino acids, it was confirmed that the third and fourth cysteine ​​amino acids were the most effective (see Fig. 9).

[0152] In addition, to confirm the effect of cysteine ​​amino acid among the cell membrane binding peptide sequences, cysteine ​​amino acid was synthesized using a flexible linker, 'GGGS' peptide linker, and the expression pattern of fluorescent protein was compared with the sequence existing in the existing target sequence. It was confirmed that the sensitivity effect of botulinum toxin was increased in the cysteine ​​amino acid sequence synthesized through the peptide linker compared to the sequence existing in the existing target sequence (see Fig. 10).

[0153] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A recombinant cell for detecting or measuring the activity of botulinum toxin, into which a genetic construct is introduced, which includes a cell membrane binding peptide coding sequence and a recombinant fluorescent protein coding sequence, which are anchor protein groups, and a botulinum toxin recognition peptide coding sequence and a light-inducing peptide coding sequence, which are light-inducing peptide groups.

2. A recombinant cell according to claim 1, characterized in that the cell is a prokaryotic cell, an animal cell, or a plant cell.

3. A recombinant cell according to claim 1, wherein the cell membrane binding peptide comprises 2 to 8 cysteine ​​amino acids.

4. A recombinant cell according to claim 3, wherein the cell membrane binding peptide comprises amino acids 85 to 92 of the amino acid sequence represented by SEQ ID NO:

1.

5. A recombinant cell in the third paragraph, wherein the two to eight cysteine ​​amino acids are repeatedly linked by a linker.

6. A recombinant cell according to claim 1, wherein the cell membrane binding peptide comprises an amino acid sequence represented by SEQ ID NO:

13.

7. A recombinant cell according to claim 1, wherein the recombinant fluorescent protein is selected from the group consisting of green fluorescent protein (GFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), and orange fluorescent protein (OFP), or is recombinantly produced therefrom.

8. A recombinant cell according to claim 1, wherein the botulinum toxin is botulinum toxin serotype A.

9. A recombinant cell according to claim 8, wherein the botulinum toxin recognition peptide comprises the 197th amino acid of the amino acid sequence represented by SEQ ID NO: 1 and 6 to 15 adjacent amino acids thereof.

10. In the first paragraph, the recombinant cell, wherein the light-induced peptide is a transmembrane domain (TMD) of influenza M2 11. A recombinant cell according to claim 10, wherein the light-induced peptide is expressed by a nucleic acid sequence represented by SEQ ID NO:

11.

12. A step of culturing a recombinant cell of any one of claims 1 to 11; A step of treating the above cultured recombinant cells with botulinum toxin; and A method for detecting or measuring the activity of a cell-based botulinum toxin, comprising the step of measuring the intensity of fluorescence or the number of cells expressing fluorescence in a recombinant cell treated with the botulinum toxin.

13. A step of culturing a recombinant cell of any one of claims 1 to 11; A step of treating the cultured recombinant cells with botulinum toxin and a botulinum toxin inhibitor candidate; and A method for evaluating a cell-based botulinum toxin inhibitor, comprising the step of measuring the intensity of fluorescence or the number of cells expressing fluorescence in the recombinant cells and then comparing the intensity with a control group to determine the activity of the botulinum toxin.

14. A kit for detecting or measuring the activity of botulinum toxin, comprising a probe comprising a cell membrane binding peptide, a fluorescent substance, a botulinum toxin recognition peptide, and a light-inducing peptide.

Images