Synthetic RNAS and uses thereof

Modified synthetic TERC with 2,2,7-trimethylguanosine cap and 2'-O-methyl-adenosine residues stabilizes telomerase, addressing the inadequacies of current therapies for telomere-related diseases by enhancing telomere length and cellular renewal.

WO2025231392A2PCT designated stage Publication Date: 2025-11-06CHILDRENS MEDICAL CENT CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/027543
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-05
Filing Date
2025-05-02
Publication Date
2025-11-06

AI Technical Summary

Technical Problem

Current medical therapies are inadequate for treating diseases associated with short telomeres, such as aplastic anemia, pulmonary fibrosis, and hepatic cirrhosis, due to the lack of effective methods to stabilize and enhance telomerase activity.

Method used

Development of synthetic telomerase RNA component (TERC) with modifications like 2,2,7-trimethylguanosine cap and 2'-O-methyl-adenosine residues at the 5' and 3' ends to increase stability and resistance to degradation, enhancing telomerase activity and telomere length.

Benefits of technology

The modified TERC increases telomerase activity and telomere length, effectively treating disorders associated with telomerase dysfunction and aging by rescuing cellular senescence and promoting self-renewal capacity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000042_0001
    Figure IMGF000042_0001
  • Figure IMGF000043_0001
    Figure IMGF000043_0001
  • Figure IMGF000049_0001
    Figure IMGF000049_0001
Patent Text Reader

Abstract

Provided herein are synthetic RNA (e.g., TERC) including one or more modifications that increase RNA (e.g., TERC) stability or resistance to degradation. The synthetic RNA (e.g., TERC) can be used for treating disorders associated with telomerase dysfunction (e.g., telomere biology disorders (TBD)), including aging.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] SYNTHETIC RNAS AND USES THEREOF

[0002] CLAIM OF PRIORITY

[0003] This application claims the benefit of U.S. Provisional Application Serial Nos. 63 / 642,292, filed on May 3, 2024, and 63 / 728,464, filed on December 5, 2024. The entire contents of the foregoing are incorporated herein by reference.

[0004] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with Government support under Grant Number DK107716 awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0006] TECHNICAL FIELD

[0007] This disclosure relates to modified synthetic RNAs and uses of the RNAs for treating telomerase- or telomere-associated diseases.

[0008] BACKGROUND

[0009] A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. The length of a telomere is a key determinant of cellular self-renewal capacity. The telomerase ribonucleoprotein maintains telomere length in tissue stem cells, and its function is critical for human health and longevity.

[0010] Short telomeres, due to genetic or acquired insults, cause a loss of cellular self-renewal and result in life-threatening diseases, for which there are few if any effective medical therapies. There is an unmet need in the art for new therapies for diseases involving short telomeres, e.g., aplastic anemia, pulmonary fibrosis, hepatic cirrhosis, and bone marrow' failure.

[0011] SUMMARY

[0012] Provided herein are synthetic telomerase RNA component (TERC) comprising one or more modifications that increase TERC stability or resistance to degradation. In some embodiments, the one or more modifications comprise a cap at the 5’ end, wherein the 5’ end cap is a 2,2,7-trimethylguanosine cap (5’ tmg cap), a 7- methylguanosine cap (5’ m7g cap), or a 5’ cap structure analog. In some embodiments, the one or more modifications comprise modifications at the 3’ end, wherein the 3’ end modifications are any one or more of: at least two 2'-O-methyl- adenosine residues (3’ 2 ’-OMe- A residues), at least two 2?-O-methyl-nucleotide residues (e.g., 2’-OMe-uridine (2’-0Me-U)), at least two nuclease-resistant nucleotide residues, and any combination thereof. In some embodiments, the one or more modifications comprise (a) a 5’ tmg cap: and (b) one or more modifications at the 3’ end comprising any one or more of: at least two 2 -OMe-A residues, at least two 2’- OMe-U residues, at least two 2’-OMe-nucleotide residues, at least two nuclease- resistant nucleotide residues, and any combination thereof In some embodiments, the one or more modifications comprise (a) a 5’ m7g cap; and (b) one or more modifications at the 3' end, such as at least two 2'-0Me-A residues, at least two 2'- OMe-U residues, at least two 2’-OMe-nucleotide residues, at least two nuclease- resistant nucleotide residues, and any combination thereof In some embodiments, the one or more modifications comprise (a) a 5’ cap structure analog; and (b) one or more modifications at the 3’ end comprising any one or more of: at least two 2'-0Me-A residues, at least two 2?-0Me-U residues, at least two 2?-OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, and any combination thereof.

[0013] Provided herein are methods of treating a disorder associated with telomerase dysfunction in a subject, the method comprising: a) identifying the subject as having a disorder associated with telomerase dysfunction; and b) administering to the subject an effective amount of a pharmaceutical composition comprising a synthetic TERC described herein, thereby treating the disorder associated with telomerase dysfunction in the subject.

[0014] In some embodiments, the disorder associated with telomerase dysfunction is dyskeratosis congenita, Hoyeraal Hreidarsson syndrome, aplastic anemia, pulmonary fibrosis, idiopathic pulmonary fibrosis, hematological disorder, or hepatic disease. In some embodiments, the subject has short telomeres or compromised telomerase due to mutations in one or more genes necessary for telomerase-holoenzyme assembly, telomerase function, telomerase structure, or telomerase-holoenzyme trafficking and localization. In some embodiments, the mutations in the one or more genes include one or more mutations in TERC, one or more mutations in telomerase reverse transcriptase (TERT), one or mutations in Poly(A) specific ribonuclease (PARN), one or mutations in dyskerin pseudouridine synthase 1 (DKC1), one or more mutations in TERF-1 -interacting nuclear factor 2 (TINF2), one or mutations in regulator of telomere elongation helicase 1 (RTEL1), and any combination thereof. Additional mutations that cause or are related to numerous telomere biology disorders (TBDs) are known in the art; e.g., described in Revy P, et al., (2023) Nat Rev Genet. 24(2): 86- 108. In some embodiments, the telomerase dysfunction causes telomere shortening, telomere uncapping, telomere fusion, or telomere fragility.

[0015] In some embodiments, the synthetic TERC increases the level or activity of telomerase. In some embodiments, the synthetic TERC increases the length of telomere. In some embodiments, the synthetic TERC increases self-replicative capacity of cells and rescues the senescence.

[0016] Also provided herein are methods of treating a disorder associated with aging in a subject, the method comprising: a) identifying the subject as having a disorder associated with aging; and b) administering to the subject an effective amount of a pharmaceutical composition comprising a pharmaceutical composition comprising the synthetic TERC described herein, thereby treating the disorder associated with aging in the subject.

[0017] In some embodiments, the disorder associated with aging is macular degeneration, diabetes mellitus, osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular disease, hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, or age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, or hearing. In some embodiments, the disorder associated with aging is a neurodegenerative disorder.

[0018] Also provided herein are methods of modulating (e.g.. increasing) the level or activity of telomerase in a cell, the method comprising contacting the cell with the synthetic TERC as described herein. In some embodiments, the cell is an induced pluripotent stem cell (iPSC), a primary human cell, a genetically-modified primary human cell, a human cell line, or a somatic cell derived from a human tissue. In some embodiments, the cell is derived from skin, bone marrow, or blood or tissue, including hematopoietic stem or progenitor cells, immune cells, bone marrow mononuclear cells (BMMCs), or somatic cells, or engineered immune cells, such as chimeric antigen receptor T cells. In some embodiments, the cell is from a subject having or suspected of having a disorder associated with telomere or telomerase dysfunction. In some embodiments, the cell is in a human subject.

[0019] Also provided herein are synthetic RNAs comprising a cap at the 5’ end and / or modifications at the 3’ end, wherein the 5’ end cap is a 2,2,7-trimethylguanosine cap (5’ tmg cap), a 7-methylguanosine cap (5’ m7g cap), or a 5’ cap structure analog, wherein the 3‘ end modifications are at least two 2’-0-methyl-adenosine residues (3’ 2’ -OMe-A residues), at least two 2’-0Me-U residues, at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant residues, or any combination thereof.

[0020] In some embodiments, the synthetic RNA described herein is more than 150 nucleotides (nt) in length. In some embodiments, the synthetic RNA described herein comprise any one or more of telomerase RNA component (TERC). messenger RNA (mRNA), small interfering RNA (siRNA), microRNA (miRNA), long non-coding RNA (IncRNA), circular RNA (circRNA), antisense RNA (asRNA), ribosomal RNA (rRNA), prime editing guide RNA (pegRNA), guide RNA (gRNA). antisense oligonucleotide (ASO), aptamer, ribozyme, small nuclear RNA(snRNA). small nucleolar RNA (snoRNAs), small cajal body-specific RNA (scaRNA), viral RNA, and / or coding RNA and / or noncoding RNA (ncRNA).

[0021] In some embodiments, the synthetic RNA described herein is TERC. In some embodiments, the synthetic RNA described herein is a precursor TERC, a full-length TERC sequence, a fragment of TERC, a template variant of TERC, a sequence variant of TERC, or an extension of TERC or a combination of different domains of TERC.

[0022] Also provided herein is a pharmaceutical composition comprising the synthetic TERC described herein and / or the synthetic RNAs described herein.

[0023] Also provided herein are methods of making any synthetic TERC described herein. In some embodiments, the methods comprising (a) obtaining a TERC molecule; (b) adding a 2,2,7-trimethylguanosine cap (tmg) or a 7-methylguanosine cap (m7g) to the 5' end of the TERC molecule obtained in step (a); and (c) adding at least two 2?-O-methyl-adenosine residues, at least two 2’-OMe-uridine residues, at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, or any combination thereof, to the 3’ end of the TERC molecule obtained in step (a) or step (b); e.g., by using PAP Associated Domain Containing 5 (PAPD5) / TENT4B (Terminal Nucleotidyltransferase 4B; also called PAPD5, TRF4-2, and TUT3); poly(A) polymerases or poly(U) polymerases (PUPs); terminal uridyl transferases (TUTases); PAP Associated Domain Containing polymerases (PAPDs), TENTs (Terminal Nucleotidyltransferases); 2'-O-Methyladenosine-5'-Triphosphate (2'-0Me-ATP); a 2’-OMe-nucleotide-5'-Triphosphate (2’-OMe-NTP); a nuclease- resistant nucleotide triphosphate; or any combination thereof. In some embodiments, the method further comprises synthesizing a TERC molecule based on a nucleotide sequence of TERC or a fragment or a template or sequence variant of TERC thereof using chemical or enzy matic reactions. In some embodiments, the method further comprises purifying the synthesized TERC molecule.

[0024] Provided herein are compositions comprising any synthetic RNAs described herein (e.g., synthetic TERC, mRNA or cDNA of telomerase reverse transcriptase (TERT), and / or other agents of increasing TERT level, and / or thymidine. Also provided herein are pharmaceutical compositions comprising any synthetic RNAs described herein (e.g., synthetic TERC, mRNA or cDNA of telomerase reverse transcriptase (TERT)). In some embodiments, the pharmaceutical compositions also comprise other agents of increasing TERT level, and / or thymidine. Also provided herein are methods of treating a disorder associated with telomerase dysfunction in a subject, the method comprising: a) identify ing the subject as having a disorder associated with telomerase dysfunction; and b) administering to the subject an effective amount of the composition thereof or the pharmaceutical composition thereof, thereby treating the disorder associated with telomerase dysfunction in the subject.

[0025] Also provided herein are methods of modulating (e.g.. increasing) the level or activity of telomerase in a cell. In some embodiments, the method comprises contacting the cell with a synthetic TERC described here (e.g., a TERC comprising SEQ ID NO: 1). In some embodiments, the method comprises contacting the cell with a synthetic TERC as described herein and a mRNA or cDNA of telomerase reverse transcriptase (TERT). In some embodiments, the cell is an induced pluripotent stem cell (iPSC), a primary human cell, a genetically -modified primary’ human cell, a human cell line or a somatic cell derived from a human tissue. In some embodiments, the cell is derived from skin, bone marrow, or blood or tissue, including hematopoietic stem or progenitor cells (HSPCs), or bone marrow mononuclear cells (BMMCs), or somatic cells, or immune cells, or engineered immune cells such as chimeric antigen receptor T cells. In some embodiments, the cell is HSPC. In some embodiments, the cell is human and / or in a human.

[0026] DESCRIPTION OF DRAWINGS

[0027] FIG. 1 is a schematic representation of synthesis, modification, and functional outcomes of exogenous telomerase RNA component (TERC) introduced into human cells described herein.

[0028] FIGs. 2A-2D show the telomere length change observed in HEK293 TERC null cell line following the introduction of synthetic TERC with both a 5‘ tmg cap (green) and 3?2 ’-OMe-A residues (red), versus synthetic TERC with only a 5’ tmg cap, as demonstrated by Southern blot. Specifically, FIG. 2A demonstrates the telomere length changes when synthetic TERC RNAs were introduced in TERC null cells, and FIG. 2B shows telomere length changes when TERT synthetic mRNAis co-introduced with synthetic TERC RNAs in TERC null cells. These results demonstrate synergistic telomere elongation from a combination of synthetic TERT mRNA and TERC RNA transfected into human cells, FIG. 2C shows the telomere length change observed in HEK293 TERC null cell line following the introduction of the combination of mammalian TERT expression vector and TERC RNA, now further augmented by thymidine supplementation, as demonstrated by Southern blot. FIG. 2D shows the telomere length change observed in HEK293 TERC null cell line following the increasing TERT via expression from lentivirus mediated transduction (versus luciferase expression from lentivirus as a control), and synthetic TERC RNA transfection, now further augmented by thymidine supplementation, as demonstrated by Southern blot. These results demonstrate telomere elongation from a combination of thymidine supplementation and TERC RNA in human cells. These results also demonstrate telomere elongation after increasing TERT expression from infecting the human cells with a virus expressing TERT, in combination with transfection of synthetic TERC RNA, and supplementing with thymidine in human cells.

[0029] FIGs. 3A-3B show the amount of telomere repeats observed as a reflection of telomerase activity7in HEK293 TERC null cell line following the introduction of either synthetic TERC modified both a 5’ tmg cap (green) and 3’ 2'-0Me-A residues (red) versus synthetic TERC with only a 5’ tmg cap. as demonstrated by Telomere Repeat Amplification Protocol (TRAP) assay. Specifically, FIG. 3A displays the bands representing telomere repeats, and FIG. 3B provides the quantitation of these bands.

[0030] FIG. 4A shows the schematic representation indicating that mature synthetic TERC RNA can achieve partial protection through the addition of a 5’ m7g cap (yellow) or a 5’ tmg cap (green), while full protection is achieved only by incorporating 5’ tmg cap (green) with 3’ 2’-0Me-A residues.

[0031] FIG. 4B shows the telomere length Southern blot as a measure of functional telomerase in induced pluripotent stem cells (iPSCs) derived from / N / .V-mut ant patients following the introduction of mature synthetic TERC RNA with various modifications. The blot shows that telomerase activity7is maximal when the TERC RNA 5’ end is protected with a tmg cap and the 3‘ end is protected via incorporating 2’-0Me-A residues.

[0032] FIGs. 5A-5B show relative TERC RNA levels as a measure of TERC stability as demonstrated by northern blot (FIG. 5A) and the corresponding quantitation normalized to 18S rRNA (FIG. 5B) observed in iPSCs derived from / tt / W-mutant patients. TERC RNA was synthesized in vitro with a 5’ end tmg cap, with or without 3’ end protection with 2 ’-OMe-A residues. TERC RNAs were introduced in patient iPSCs and intact TERC levels were monitored to determine the relative stability of TERC with or without 3‘ end protection by 2 ’-OMe-A over time.

[0033] FIG. 6 shows the telomere length observed in iPSCs derived from PARN- mutant patients following the introduction of TERC RNA synthesized in vitro with a 5’ tmg cap, with or without 3’ end protection using 2’ -OMe-A residues, as demonstrated by Southern blot.

[0034] FIG. 7 shows the telomere length observed in iPSCs derived from TERC- mutant patients following the introduction of TERC RNA synthesized in vitro with a 5' tmg cap. with or without 3' end protection using 2’-0Me-A residues, as demonstrated by Southern blot.

[0035] FIG. 8 shows the telomere length in iPSCs derived from / WCV-mutant patients following the introduction of TERC RNA synthesized in vitro with a 5’ tmg cap, with or without 3‘ end protection using 2‘-0Me-A residues as demonstrated by Southern blot.

[0036] FIG. 9 shows the telomere length in iPSCs derived from / / •7?7-mutant patients following the introduction of TERC RNA synthesized in vitro with a 5’ tmg cap, with or without 3‘ end protection using 2 -OMe-A residues, as demonstrated by Southern blot.

[0037] FIG. 10 shows the telomere length in iPSCs derived from R TEL 1 -mutant patients following the introduction of TERC RNA synthesized in vitro with a 5’ tmg cap, with or without 3’ end protection using 2 -OMe-A residues, as demonstrated by Southern blot.

[0038] FIG. 11 shows the telomere length in iPSCs derived from 77A7’’2-mutant patients following the introduction of TERC RNA synthesized in vitro with a 5’ tmg cap, with or without 3’ end protection using 2‘-OMe-A residues, as demonstrated by Southern blot.

[0039] FIG. 12 shows the telomere length in normal (WT) iPSCs, using a standard (WT) telomere repeat probe (TTAGGG; SEQ ID NO: 10), 5 days post-electroporation with synthetic TERC RNA with a 5’ tmg cap, with or without 3’ end protection using 2’-OMe-A-residues, as demonstrated by Southern blot. The telomere length in unmanipulated WT iPSCs was measured as a control for comparison.

[0040] FIG. 13 shows the telomere length in primary human stem and progenitor cells (HSPCs), measured by Southern blot using a standard (WT) telomere repeat probe (TTAGGG; SEQ ID NO: 10), 72 hours post-electroporation with synthetic TERC RNA and synthetic TERT mRNA. The synthetic TERC RNA used in the analysis has a 5’ tmg cap, with or without 3’ end protection using 2’-OMe-A-residues. The telomere length in unmanipulated HSPCs w as measured as a control for comparison. FIG. 14A shows the sequences of WT (TTAGGG, blue; SEQ ID NO: 10) and altered (TTAGGT, orange; SEQ ID NO: 11) telomere repeats in WT and altered TERC RNA templates, respectively.

[0041] FIG. 14B is a representative schematic showing the synthesis, modification, and functional outcomes of exogenous, syntheticTERC RNA with an altered template encoding the telomere sequence TTAGGT (SEQ ID NO: 11). The synthetic, engineered TERC RNA with altered template was introduced into healthy and patient stem cells to distinguish the nascent telomere repeats.

[0042] FIG. 15 shows the telomere length in PARN-mutant patient iPSCs, measured by Southern blot using an altered telomere repeat probe that detects TTAGGT (SEQ ID NO: 11) repeats, 72 hours post-electroporation with synthetic altered template TERC RNA encoding TTAGGT (SEQ ID NO: 11), with a 5’ tmg cap, with or without 3’ end protection using 2’-OMe-A-residues. The telomere length in unmanipulated patient iPSCs was measured as a control for comparison, The Southern blot membrane on the left was stripped and confirmed negative for any residual signal, followed by re-hybridization using the WT telomere repeat probe that detects TTAGGG (SEQ ID NO: 10), as shown on the right.

[0043] FIG. 16 show s the telomere length in normal (WT) iPSCs, measured by Southern blot using an altered telomere repeat probe that detects TTAGGT (SEQ ID NO: 11) repeats, 72 hours post-electroporation with synthetic altered template TERC RNA encoding TTAGGT (SEQ ID NO: 11). with a 5’ tmg cap, with or without 3’ end protection using 2’-OMe-A-residues. The telomere length in unmanipulated WT iPSCs was measured as a control for comparison. The Southern blot membrane on the left was stripped and confirmed negative for any residual signal, follow ed by rehybridization using the WT telomere repeat probe that detects TTAGGG (SEQ ID NO: 10).

[0044] FIG. 17 shows the telomere length in TERC -null 293T cells, measured by Southern blot using an altered telomere repeat probe that detects TTAGGT (SEQ ID NO: 11) repeats. The altered-template engineered TERC RNA (altered eTERC) used in the analysis has a 5’ tmg cap, with 3’ end protection using 2’-OMe-A-residues, and was used with synthetic TERT mRNA. The WT engineered TERC RNA plus synthetic TERT mRNA was used as a control. The telomere length in unmanipulated TERC-null 293T and normal (WT) 293T cells served as controls for comparison. The Southern blot membrane on the left was stripped and confirmed negative for any residual signal, followed by re-hybridization using the WT telomere repeat probe that detects TTAGGG (SEQ ID NOTO). N=3 biological replicates of the altered eTERC as shown.

[0045] FIG. 18 shows the telomere length in primary human stem and progenitor cells (HSPCs), measured by Southern blot using the altered telomere repeat probe that detects TTAGGT (SEQ ID NO: 11) repeats, 72 hours post-electroporation with engineered altered template TERC RNA encoding TTAGGT (SEQ ID NO: 11), with a 5’ tmg cap. with or without 3‘ end protection using 2’-OMe-A-residues, plus synthetic TERT mRNA. The WT engineered TERC RNA plus, together with synthetic TERT mRNA was used as a control. The telomere length in unmanipulated HSPCs was measured for comparison. The Southern blot membrane on the left was stripped and confirmed negative for any residual signal, followed by re-hybridization using the WT telomere repeat probe detecting TTAGGG (SEQ ID NOTO). N=3 biological replicates of the altered eTERC as shown.

[0046] FIG. 19 Telomere length in WT iPSCs or iPSCs derived from a patient with PARN mutations, following the introduction of TERC RNA synthesized in vitro with a 5’ tmg cap. with 3’ end modification by rTENT4B using 2’-OMeUTP or 2’-OMe- ATP, compared to 2’aS-UTP as modified-NTP control, as demonstrated by Southern blot.

[0047] FIG. 20 Quantification of telomerase activity by TRAP assay in primary human CD34+ HSPCs 72 h after CRISPR / Cas9-mediated disruption of the / T / W gene (93% indels), followed by eTERC or eGFP mRNA electroporation or RG7834 (concentration IpM) treatment for 48 h. Lysate concentration 0.5 pg, n=2 biological replicates. Mean + S.D. is shown, ns= not significant, *p<0.05, calculated by one-way ANOVA. a.u., arbitrary units.

[0048] FIG. 21 Frequency of erythroid (E). granulocyte (G), monocyte (M). granulocyte-monocyte (GM) and granulocyte-erythroid-monocyte-macrophage (GEMM) colony -forming units (CFU) and erythroid blast forming units (BFU-E) after in vitro culture in methylcellulose and cytokines. Primary human CD34+ HSPCs were electroporated with CRISPR / Cas9 ribonucleoproteins with guide RNAs targeting TERC or PARN loci, followed by eTERC electroporation versus eGFP mRNA electroporation as control, and cultured for 12 days (PARN) or 14 days (TERC). n=2 biological replicates with 3 technical replicates as shown mean + S.D., ****p<0.001 calculated by 2way-AN0VA.

[0049] DETAILED DESCRIPTION

[0050] Provided herein are synthetic RNA (e.g.. telomerase RNA component (TERC)) including one or more modifications that increase RNA (e.g., TERC) stability or resistance to degradation.

[0051] Provided herein are synthetic RNA (e.g., synthetic TERC) including a cap at the 5' end and / or modifications at the 3' end, wherein the 5' end cap is a 2,2,7- trimethylguanosine cap (5’ tmg cap), a 7-methylguanosine cap (5’ m7g cap), or a 5’ cap structure analog, wherein the 3’ end modifications are selected from at least two 2’-O-methyl-adenosine residues (3’ 2’ -OMe-A residues), at least two 2’-O-methyl- uridine residues (2’-0Me-U residues), at least two 2’-O-methyl-nucleotide residues, at least two nuclease-resistant nucleotide residues, and any combination thereof.

[0052] Also provided herein are pharmaceutical compositions including any synthetic RNA (e.g., synthetic TERC) described herein.

[0053] Also provided herein are compositions including any synthetic RNA (e.g., synthetic TERC) described herein, a mRNA or cDNA of telomerase reverse transcriptase (TERT), and / or other agents of increasing TERT level (e.g., expression or amount), and / or thymidine. Also provided herein are pharmaceutical compositions including the composition described herein.

[0054] Also provided herein are methods of treating a disorder associated with telomerase dysfunction in a subject. In some embodiments, the method including identifying the subject as having a disorder associated with telomerase dysfunction; and administering to the subject an effective amount of a pharmaceutical composition including the synthetic RNA (e.g., synthetic TERC) described herein, or a pharmaceutical composition including the synthetic RNA (e.g., synthetic TERC). a mRNA or cDNA of TERT (e.g., synthetic TERT mRNA) or other agents of increasing TERT level (e.g., expression or amount), and / or thymidine, thereby treating the disorder associated with telomerase dysfunction in the subject. Also provided herein are methods of treating a disorder associated with aging in a subject, the method including a) identifying the subject as having a disorder associated with aging; and b) administering to the subject an effective amount of a pharmaceutical composition including a pharmaceutical composition including the synthetic RNA (e.g., synthetic TERC) described herein, or a pharmaceutical composition including the synthetic RNA (e.g., synthetic TERC). and / or a mRNA or cDNA of TERT (e g., synthetic TERT mRNA) and / or other agents of increasing TERT level (e.g., expression or amount), and / or thymidine, thereby treating the disorder associated with aging in the subject.

[0055] Also provided herein are methods of modulating (e.g.. increasing) the level or activity of telomerase in a cell, the method including contacting the cell with the synthetic RNA (e.g., synthetic TERC) described herein.

[0056] Also provided herein are methods of making any synthetic RNA (e.g., synthetic TERC) described herein. In some embodiments, the methods include (a) obtaining a TERC molecule; (b) adding a 2.2.7-trimethylguanosine cap (tmg), a 7- methylguanosine cap (m7g), or a 5’ cap structure analog to the 5’ end of the TERC molecule obtained in step (a); and (c) adding at least one or two 2’-O-methyl- adenosine residues, at least one or two 2’-O-methyl-uridine residues (2’-0Me-U residues), at least one or two 2?-O-methyl-nucleotide residues, at least one or two nuclease-resistant nucleotide residues, and / or any combination thereof, to the 3’ end of the TERC molecule obtained in step (a) or step (b); e.g., using PAP Associated Domain Containing 5 or Terminal Nucleotidyltransferase 4B (PAPD5, TUT3, TRF4- 2, TENT4B). poly(A) polymerases or poly(U) polymerases (PUPs), terminal uridyl transferases (TUTases), PAP Associated Domain Containing polymerases (PAPDs), TENTs (Terminal Nucleotidyltransferases), 2'-O-Methyladenosine-5'-Triphosphate (2'-0Me-ATP), a 2’-OMe-nucleotide-5'-Triphosphate (2’-0Me-NTP), a nuclease- resistant nucleotide triphosphate, and / or any combination thereof.

[0057] Synthetic RNA and telomerase RNA component (TERC)

[0058] Provided herein are synthetic RNA (e.g., synthetic TERC) including one or more modifications. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes a 5’ end cap. In some embodiments, the synthetic RNA includes 3?end modifications. In some embodiments, the synthetic RNA includes a 5' end cap or 3' end modifications. In some embodiments, the synthetic RNA includes a 5’ end cap and 3’ end modifications. In some embodiments, the 5’ end cap is a 2,2,7- trimethylguanosine cap (5‘ tmg cap), a 7-methylguanosine cap (5’ m7g cap), or a 5’ cap structure analog. In some embodiments, the 3’ end modifications are selected from: at least two 2’-0-methyl-adenosine residues (3’ 2 -OMeA residues), at least two 2’-O-methyl-uridine residues (2’-OMe-U residues), at least two 2’-O-methyl- nucleotide residues, at least two nuclease-resistant nucleotide residues, and any combination thereof.

[0059] As used herein, a “synthetic RNA" refers to a ribonucleic acid (RNA) molecule that are produced or synthesized, such as in a laboratory setting rather than being naturally occurring. These synthetic RNA (e.g., synthetic TERC) molecules are designed to have specific sequences (e.g., a precursor TERC, a full-length TERC sequence, a fragment of TERC, a sequence variant of TERC, or an extension of TERC) and structures; e.g., for various research or therapeutic purposes. Synthetic RNAs can be customized with modifications or alterations (e.g., 5’ tmg cap, 5’ m7g cap, a 5’ cap structure analog, 3’-2’-OMe-A residues, 3’-2’-OMe-U residues, at least two 2’-O-methyl-nucleotide residues, at least two nuclease-resistant nucleotide residues, and any combination thereof) to suit particular applications. The synthetic RNA can be telomerase RNA component (TERC), messenger RNA (mRNA), small interfering RNA (siRNA), microRNA (miRNA), long non-coding RNA (IncRNA), circular RNA (circRNA), antisense RNA (asRNA), ribosomal RNA (rRNA), prime editing guide RNA (pegRNA). guide RNA (gRNA), antisense oligonucleotide (ASO), aptamer, ribozyme, small nuclear RNA(snRNA), small nucleolar RNA (snoRNAs), small cajal body-specific RNA (scaRNA), viral RNA, coding RNA or noncoding RNA, and any combination thereof.

[0060] The synthetic RNA can have any suitable length. In some embodiments, the synthetic RNA has a length of about 50 to about 500, about 50 to about 450, about 50 to about 400, about 50 to about 350, about 50 to about 300, about 50 to about 250, about 50 to about 200, about 50 to about 150, about 50 to about 100 nucleotides (nt). In some embodiments, the synthetic RNA has a length of more than 150 nt. In some embodiments, the synthetic RNA is a precursor TERC. In some embodiments, the synthetic RNA is a full-length TERC sequence. In some embodiments, the synthetic RNA is a fragment of TERC. In some embodiments, the synthetic RNA is a template variant of TERC. In some embodiments, the synthetic RNA is a sequence variant of TERC (e.g., TERC (e.g, SEQ ID NOT) with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide modifications; such as deletions, insertions, or substitutions). In some embodiments, the synthetic RNA is an extension of TERC. In some embodiments, the synthetic RNA is a combination of different domains of TERC.

[0061] The TERC RNA template refers to the sequence that telomerase reverse transcriptase (TERT) uses to synthesize the telomeric repeats. For example, in humans, the TERC RNA contains a sequence that directs the addition of the repetitive sequence TTAGGG (SEQ ID NO: 10) to the ends of chromosomes.

[0062] In some embodiments, a template variant of TERC can be an altered TERC RNA. In some embodiments, a template variant of TERC contains a sequence that directs the addition of the repetitive sequence that is different from TTAGGG (SEQ ID NOTO). In some embodiments, a template variant of TERC contains a sequence that directs the addition of the repetitive sequence TTAGGT (SEQ ID NO: 11). In some embodiments, a template variant of TERC contains a sequence that directs the addition of the repetitive sequence that is any six nucleotide long, cell tolerable, combination of nucleotides (e.g., A, C, T, and / or G).

[0063] Telomerase has been a therapeutic target of great interest for over two decades, based on its activity7in numerous cancers. Much of the focus has been on telomerase reverse transcriptase (TERT), given its restricted expression in selfrenewing cells, and its ability7to confer immortality and transformation when introduced into non-self-renewing cells. The delivery of mRNA encoding TERT to human cells to increase telomerase activity and extend telomeres is described, e.g., in Ramunas et al. “Transient delivery7of modified mRNA encoding TERT rapidly extends telomeres in human cells,'’ FASEB J. 2015 May; 29(5): 1930-1939, which is incorporated by reference in its entirety.

[0064] The telomerase RNA component (TERC) is expressed more broadly and has largely been overlooked as a potential target for manipulation. TERC serves two critical functions: it encodes the template sequence used by telomerase reverse transcriptase (TERT) for the addition of hexanucleotide repeats to telomeres, and it is the scaffold that nucleates multiple proteins that target telomerase to the Cajal body, where telomeres are extended.

[0065] In addition, TERC contains a box H / ACA domain at its 3' end, a motif that is functionally separable from the template domain and dispensable for telomerase activity in vitro. In vivo, the H / ACA motif is bound by a heterotetramer - dyskerin, NOP 10, NHP2, and GAR1 (GAR1 replaces NAF1) which stabilize TERC. and also by TCAB1, which is responsible for localizing the telomerase complex to Cajal bodies (Venteicher, A.S. et al. A human telomerase holoenzyme protein required for Cajal body localization and telomere synthesis. Science 323, 644-8 (2009)). Disruption of any of these interactions can also compromise telomere maintenance and cause telomere disease (Mitchell, J.R., Wood, E. & Collins, K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature 402, 551- 5 (1999); Vulliamy, T. et al. Mutations in the telomerase component NHP2 cause the premature ageing syndrome dyskeratosis congenita. Proceedings of the National Academy of Sciences of the United States of America 105, 8073-8 (2008); Walne.

[0066] A. J. et al. Genetic heterogeneity in autosomal recessive dyskeratosis congenita with one subtype due to mutations in the telomerase-associated protein NOP 10. Human molecular genetics 16, 1619-29 (2007)). The H / ACA motif serve as guides for pseudouridylation of other RNAs by dyskerin (Kiss, T.. Fayet-Lebaron, E. & Jady.

[0067] B.E. Box H / ACA small ribonucleoproteins. Molecular cell 37, 597-606 (2010)). Interestingly, the 3' ends of snoRNAs and TERC terminate in a similar context - precisely 3 nt downstream of the ACA sequence. How ever, most snoRNAs are encoded in the introns of other genes, whereas TERC is an autonomous RNA pol II transcript, indicating major differences in the initial and possibly latter stages of biogenesis.

[0068] Provided herein are synthetic RNA (e.g., synthetic TERC) including one or more modifications that increase the synthetic RNA stability or resistance to degradation. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30 or more modifications. The modifications can occur at various positions within the synthetic RNA (e.g., synthetic TERC), including nucleobases, ribose sugars, phosphate groups, 5’ cap, 3’ end modifications, and within the sequence. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes a modification at 5’ end. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes a modification at 3’ end. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes modifications at both the 5’ end and the 3’ end.

[0069] Any suitable RNA modifications (e.g.. TERC modifications) can be used in the synthetic RNA (e.g., TERC) described herein. The synthetic RNA modifications in the synthetic RNA (e g., synthetic TERC) can include any of: 2'-O-Methylation (2’-0Me), pseudouridine, 5’ tmg cap, 5’ m7g cap, a 5’ cap structure analog, 3’ end modifications (e.g., 2’-0MeA residues, 2’-0MeU residues, at least two 2’-0Me- nucleotide residues, and / or at least two nuclease-resistant nucleotide residues), base modifications (e.g., methylation or hydroxylation), and any combination thereof. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes a 5’ tmg cap. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes a 5’ m7g cap. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes a cap structure analog at the 5’ end. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes multiple 3’ 2’-0MeA residues. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes multiple 3’ 2’-0MeU residues. In some embodiments, the synthetic RNA (e.g. synthetic TERC) includes multiple 2’-O- methylated nucleotide residues at the 3’ end. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes multiple nuclease-resistant nucleotide residues at the 3’ end. In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes both a 5’ tmg cap and multiple 3‘ modifications (e.g., at least one, two, or three 2 -OMeA residues, at least one, two. or three 2’-0MeU residues, at least one, two, or three 2’-OMe-nucleotide residues, at least one, two, or three nuclease-resistant nucleotide residues, and / or any combination thereof). In some embodiments, the synthetic RNA (e.g., synthetic TERC) includes both a 5’ m7g cap and multiple 3’ modifications (e.g., at least two 2’-0MeA residues, at least two 2’-OMe-nucleotide residues (e.g., 2’-0MeU residues), at least two nuclease-resistant nucleotide residues, and / or any combination thereof). In some embodiments, the synthetic RNA (e g., synthetic TERC) includes both a 5’ cap structure analog and multiple 3’ modifications (e.g., at least two 2’-0MeA residues, at least two 2’-0MeU residues, at least two 2’- OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, and / or any combination thereof). As used herein, a cap structure analog refers to chemically modified derivatives of the unique cap structure present at the 5' end of all eukaryotic mRNAs and several non-coding and viral RNAs.

[0070] As used herein, RNA stability (e.g., TERC stability) refers to the ability of the RNA molecule to resist degradation and maintain its structural integrity over time. Stability is essential for the proper functioning of RNA (e.g., TERC). In some embodiments, TERC stability is essential for the proper functioning of telomerase, as TERC sen es as the template for telomere extension. Factors such as proper folding, protection from nucleases, and interaction with protein components contribute to RNA stability (e.g., TERC stability). Modifications to RNA (e.g.. TERC), such as the addition of protective caps or chemical modifications, can enhance its stability and prolong its functional lifespan.

[0071] As used herein, RNA degradation (e.g., TERC degradation) refers to the breakdown of the RNA molecule into smaller fragments by cellular nucleases. Degradation can occur due to various factors, including cellular stress, dysregulation of RNA processing pathways, or mutations affecting RNA structure (e.g., TERC structure). In some embodiments, degradation of TERC leads to reduced telomerase activity, which can result in telomere shortening and cellular senescence. In some embodiments, dysregulated TERC degradation has been implicated in aging-related diseases and cancer.

[0072] Methods to measure RNA stability (e.g., TERC stability) or degradation can include, for example, Northern blotting, Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR), RNA (e.g., TERC) stability assay (measuring the decay rate of RNA (e.g., TERC) using RT-qPCR), Pulse-chase assays, in vitro degradation assays, and computational modeling. In some embodiments, TERC stability or degradation is measured by Northern blotting.

[0073] In some embodiments, the modifications to the synthetic RNA (e.g., synthetic TERC) can increase the RNA stability (e.g.. TERC stability) or resistance to degradation by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100% or more, compared to the stability of an unmodified RNA (e.g., an unmodified TERC). In some embodiments, the modifications to RNA (e.g., TERC) can increase RNA stability (e.g., TERC stability) or resistance to degradation by about 2-fold, about 3-fold, about 4-fold, 5-fold, about 10-fold or more, compared to the stability of an unmodified RNA (e.g., an unmodified TERC).

[0074] Also provided herein are methods of making the synthetic RNA (e.g., a synthetic TERC). In some embodiments, the methods include (a) obtaining an RNA molecule (e.g., TERC molecule); (b) adding a 2,2,7-trimethylguanosine cap to the 5’ end of the RNA molecule (e.g., TERC molecule) molecule obtained in step (a); and (c) adding at least two 2'0-methyl-adenosine residues to the 3’ end of the RNA molecule (e.g., TERC molecule) molecule obtained in step (a) or step (b).

[0075] In some embodiments, the methods of making the synthetic RNA (e.g., a synthetic TERC) comprise (a) obtaining a RNA molecule; (b) adding a 2,2,7- trimethylguanosine cap (tmg) or a 7-methylguanosine cap (m7g) to the 5’ end of the RNA (e.g., a synthetic TERC) molecule obtained in step (a); and (c) adding at least two 2’-O-methyl-adenosine residues, at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, or any combination thereof, to the 3’ end of the RNA (e.g., a synthetic TERC) molecule obtained in step (a) or step (b); e.g., by using PAP Associated Domain Containing 5 (PAPD5; also called TENT4B, Terminal Nucleotidyltransferase 4B), poly(A) polymerases or poly(U) polymerases (PUPs), terminal uridyl transferases (TUTases), PAP Associated Domain Containing polymerases (PAPDs), TENTs (Terminal Nucleotidyltransferases), 2'-O- Methyladenosine-5 '-Triphosphate (2'-OMe-ATP), a 2’-OMe-nucleotide-5'- Triphosphate (2’-0Me-NTP), a nuclease-resistant nucleotide triphosphate, and / or any combination thereof

[0076] A TERC molecule (also called TERC RNA) refers to a precursor TERC, a full-length TERC sequence (NCBI Reference Sequence: NR_001566.1), a fragment of TERC, a template variant of TERC. a sequence variant of TERC, or an extension of TERC. In some embodiments the full-length TERC sequence is 5’- GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUA ACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCU GUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUGCCGCCU UCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGCCCGU UCGCCCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAACC CCGCCUGGAGGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUG CCACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAG GGCGAGGUUCAGGCCUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUC CCCGCGCGCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUC GGCUCACACAUGC- 3’ (SEQ ID NO: 1).

[0077] In some embodiments, the TERC molecules include 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide mutations (e.g., SEQ ID NO: 1 with 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide mutations). In some embodiments, the TERC molecules include 0, 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, or more nucleotide insertions (e.g., SEQ ID NO: 1 with 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide insertions). In some embodiments, the TERC molecules include 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide deletions (e.g., SEQ ID NO: 1 with 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide deletions).

[0078] In some embodiments, the TERC molecules include about 1, 2. 3. 4, 5, 6. 7, 8, 9, 10, 20, 30 or more modifications (e.g., as compared to SEQ ID NO: 1). The modifications can occur at various positions within the synthetic TERC, including nucleobases, ribose sugars, phosphate groups, 5’ cap, 3‘ end modifications, and within the sequence or within the template. In some embodiments, the synthetic TERC includes a modification at 5’ end. In some embodiments, the synthetic TERC includes a modification at 3’ end. In some embodiments, the synthetic TERC includes modifications at both the 5’ end and the 3‘ end. In some embodiments, the synthetic TERC includes a 5’ tmg cap. In some embodiments, the synthetic TERC includes a 5' m7g cap. In some embodiments, the synthetic TERC includes a cap structure analog at the 5’ end. In some embodiments, the synthetic TERC includes multiple 3’ 2’- OMe-A residues. In some embodiments, the synthetic TERC includes multiple 3’ 2’- OMe-U residues. In some embodiments, the synthetic TERC includes multiple 2’- OMe-nucleotide residues at the 3 ’end. In some embodiments, the synthetic TERC includes other nuclease-resistant nucleotide residues at the 3’ end. In some embodiments, the synthetic TERC includes both a 5’ tmg cap and multiple 3’ modifications (e.g., at least two 2’-OMe-A residues, at least two 2’-OMe-U residues, at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, and / or any combination thereof). In some embodiments, the synthetic TERC includes both a 5’ m7g cap and multiple 3’ modifications (e.g., at least two 2’ -OMe-A residues, at least two 2’-OMe-U residues, at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, and / or any combination thereof). In some embodiments, the synthetic TERC includes both a 5’ cap structure analog and multiple 3’ modifications (e.g., 2’-OMe-A residues. 2 -OMe-A residues, at least two 2’ -OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, and / or any combination thereof). In some embodiments, the multiple 2‘-O-methyl- adenosine residues, 2’-O-methyl-uridine residues, 2’-O-methyl-nucleotide residues, other nuclease-resistant nucleotide residues, and / or any combination thereof at the 3’ end of the TERC molecule are added using any one or more of: PAP Associated Domain Containing 5 / Terminal Nucleotidyltransferase 4B (PAPD5 / TENT4B / TUT3 / TRF4-2), poly(A) polymerases or poly(U) polymerases (PUPs), terminal uridyl transferases (TUTases), PAP Associated Domain Containing polymerases (PAPDs). TENTs (Terminal Nucleotidyltransferases). 2'-O- Methyladenosine-5'-Triphosphate (2'-OMe-ATP), a 2’-OMe-nucleotide-5'- Triphosphate (2’-OMe-NTP), a nuclease-resistant nucleotide triphosphate, and / or any combination thereof.

[0079] Telomere Diseases (also called Telomere Biology Disorders (TBDs))

[0080] The term “telomere disease,” “telomere syndrome”, “telomeropathies”, “telomere biology disorders” (TBDs), or “disorder associated with telomerase dysfunction” refers to a disorder associated with abnormal telomeres. They include, but not are limited to, dyskeratosis congenita (DC), Revesz syndrome, Hoyeraal- Hreidarrson syndrome, Coats plus syndrome, and some forms of inherited aplastic anemia / myelodysplastic syndrome, aplastic anemia, pulmonary' fibrosis, idiopathic pulmonary fibrosis, bone marrow failure, hematological disorder, hepatic disease (e.g.. chronic liver disease, and hepatic cirrhosis) etc. Telomere diseases also include those affecting the blood and immune systems, lungs, liver, skin, mucosal surfaces, bones, cardiovascular system, endocrine system, and / or gastrointestinal system, as cells with the impaired self-renewal capacity' can affect the normal function of organs or systems. Some of these disorders include aplastic anemia, pulmonary fibrosis. hepatic cirrhosis, osteoporosis and osteonecrosis, vascular malformations, diabetes, primary immunodeficiency, and inflammatory bowel disease. This group of diseases is often associated with a cellular state marked with decreased sei P-renewal capacity that can be attributed to an alteration in telomere length. Thus, the term “telomere deficiency'’ as used herein refers to a cellular state in the body, including stem cells, hematopoietic stem and progenitor cells (HSPCs). induced pluripotent cells and fibroblasts, and is often marked by a perturbation in expression or activity of an enzyme that is involved in regulating telomere size. As used herein, the term “telomerase dysfunction"’ refers to abnormal levels or function of telomerase in a cell or patient. For example, telomerase dysfunction can include telomerase deficiency, such as where telomerase levels or telomerase activity is lower than normal due to excess or unwanted telomerase degradation or insufficient levels of components require to form telomerase-holoenzyme, and telomerase over-activity, such as where telomerase levels are higher than normal due to deficient telomerase degradation or enhanced telomerase activity due to increased transcription.

[0081] Provided herein are methods of treating a disorder associated with telomerase dysfunction in a subject. Telomerase dysfunction can cause telomere shortening, telomere uncapping, telomere fusion, telomere fragility, and any combination thereof. In some embodiments, telomere diseases or disorders associated with telomerase dysfunction are typically associated with changes in the size of telomere. Many proteins and RNA components are involved in the telomere regulatory pathway, including TERC, TERT, PARN, DKC1, TERF-1 -interacting nuclear factor 2 (TINF2), and regulator of telomere elongation helicase 1 (RTEL1). This disclosure provides how7these proteins or RNA components work in the regulatory pathway and how they are related to telomere diseases. Additional components and genes related to telomere diseases or disorders associated with telomerase dysfunction are known in the art; e.g., described in Revy P, et al., (2023) Nat Rev Genet. 24(2):86-108.

[0082] Among these telomere diseases, dyskeratosis congenita (DC) is a rare, progressive bone marrow failure syndrome characterized by the triad of reticulated skin hyperpigmentation, nail dystrophy, and oral leukoplakia. Early mortality is often associated with bone marrow- failure, infections, fatal pulmonary complications, or malignancy. Short-term treatment options for bone marrow failure in patients include anabolic steroids (e.g., oxy methoIone, danazol). granulocyte macrophage colony- stimulating factor, granulocyte colony -stimulating factor, and erythropoietin. Other treatments include hematopoietic stem cell transplantation (SCT).

[0083] Idiopathic pulmonary’ fibrosis is a chronic and ultimately fatal disease characterized by a progressive decline in lung function. In some appropriate cases, the following agents are used to treat idiopathic pulmonary fibrosis: nintedanib, a tyrosine kinase inhibitor that targets multiple ty rosine kinases, including vascular endothelial growth factor, fibroblast growth factor, and PDGF receptors; and pirfenidone. Other treatments include lung transplantation. In some cases, lung transplantation for idiopathic pulmonary’ fibrosis (IPF) has been shown to confer a survival benefit over medical therapy.

[0084] Increasing telomerase activity can be beneficial in several degenerative and age-related disorders. The strategies of introducing synthetic TERC can provide important advances in treatment strategies for a broad array of telomere diseases or disorders associated with telomerase dysfunction, e.g., dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, idiopathic pulmonary fibrosis, hematological disorder, hepatic disease (e.g., chronic liver disease), and cancer, e.g., hematological cancer and hepatocarcinoma, etc.

[0085] As described herein, loss-of-function mutations in genes (e.g., TERC. TERT. PARN, DK.C1, TINF2, and RTEL1) involved in the regulatory pathw ay of telomerase function can be linked to telomere diseases.

[0086] Poly(A) specific ribonuclease (PARN)

[0087] PARN is known as a 3:-5’ exoribonuclease responsible for degradation of the poly(A) tails of eukaryotic mRNAs, which is a rate-limiting step in mRNA turnover (Komer, C.G. & Wahle, E. Poly(A) tail shortening by a mammalian poly(A)-specific 3'-exoribonuclease. The Journal of biological chemistry 272, 10448-56 (1997)). PARN is stimulated by presence of a m7g-cap, and requires a minimal substrate of adenosine di- or tri-nucleotides - in other words, oligo(A) rather than strictly poly(A). PARN is a widely-expressed cap-dependent, poly(A) deadenylase with a canonical role in regulating global mRNA levels during development, and additional, more specialized functions including end-trimming of the Dicer-independent microRNA (miR)-451 and deadenylation of small nucleolar (sno)RNAs including TERC. PARN loss-of-function mutations are implicated in idiopathic pulmonary' fibrosis and dyskeratosis congenita.

[0088] Dyskerin pseudouridine synthase 1 (DKC1)

[0089] DK.C1, also known as dyskerin or NAP57. is a protein encoded by the DKC1 gene in humans. It plays a critical role in several cellular processes, including telomere maintenance and ribosome biogenesis. DKC1 is primarily known for its involvement in dyskeratosis congenita (DC), a rare genetic disorder characterized by various abnormalities, including bone marrow failure, skin pigmentation changes, and an increased risk of cancer. Mutations in the DKC 1 gene disrupt the proper functioning of telomerase, leading to telomere shortening and cellular senescence, which are hallmarks of DC. Additionally, DKC1 is involved in ribosome biogenesis, where it participates in the modification and processing of ribosomal RNA (rRNA) to ensure the proper assembly and functioning of ribosomes, the cellular machinery responsible for protein synthesis. DKC1 and telomerase have emerged as potential therapeutic targets for the treatment of cancer and age-related disorders, highlighting the significance of studying their function and regulation.

[0090] DK.CI is a nucleolar protein that is primarily involved in the biogenesis and maintenance of telomeres, the protective caps at the ends of chromosomes. It is a component of the telomerase complex, which adds repetitive nucleotide sequences (TTAGGG (SEQ ID NO: 10) in vertebrates) to the ends of chromosomes to prevent them from shortening during DNA replication. DKC1 contributes to the stability and activity of telomerase by facilitating its assembly and maturation.

[0091] TERFl-interacting nuclear factor 2 (TINF2)

[0092] TINF2 is a protein that in humans is encoded by the TINF2 gene. TINF2 is a component of the shelterin (also called telosome, a protein complex known to protect telomeres in many eukaryotes from DNA repair mechanisms, as well as to regulate telomerase activity ) protein complex found at the end of telomeres. Regulator of telomere elongation helicase 1 (RTEL1)

[0093] RTEL1 is the animal functional analogue of yeast Srs2, which is a DNA helicase and DNA-dependent ATPase involved in DNA repair and checkpoint recovery. RTEL1 is an essential DNA helicase that disassembles a variety7of DNA secondary structures to facilitate DNA replication, repair, and recombination processes, and to maintain both telomeric and genomic stability. Human RTEL1 is implicated in the etiology of Dyskeratosis congenita (DC, is an inherited bone marrow failure and cancer predisposition syndrome). Point mutations in its helicase domains, and truncations which result in loss of its C terminus have been discovered in DC families. RTEL1 is also a candidate gene influencing glioma susceptibility.

[0094] Subjects

[0095] The terms “subject ’ and “patient” are used interchangeably throughout the specification and describe an animal, human or non-human. Veterinary and non-veterinary applications are contemplated by the present invention. Human patients can be adult humans or juvenile humans (eg., humans below the age of 18 years old). In addition to humans, patients include but are not limited to mice, rats, hamsters, guinea-pigs, rabbits, ferrets, cats, dogs, and primates. Included are, for example, non-human primates (e.g., monkey-, chimpanzee, gorilla, and the like), rodents (e.g., rats. mice, gerbils, hamsters, ferrets, rabbits), lagomorphs, swine (e.g., pig, miniature pig), equine, canine, feline, bovine, and other domestic, farm, and zoo animals.

[0096] In some embodiments, the methods described in this disclosure involves identifying a subject as having, being at risk of developing, or suspected of having a disorder associated with telomerase dysfunction. In some embodiments, the subject has gene mutations including 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations in TERC; 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations in telomerase reverse transcriptase (TERT); 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations in Poly(A) specific ribonuclease (PARN); 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations in dyskerin pseudouridine synthase 1 (DKC1); 1, 2, 3, 4. 5, 6, 7, 8, 9, or 10 mutations in TERF-1 -interacting nuclear factor 2 (TINF2); 1. 2, 3, 4. 5, 6, 7. 8, 9, or 10 mutations in regulator of telomere elongation helicase 1 (RTEL1); and / or any combination thereof. In some embodiments, the gene mutations are partial or complete loss-of- function mutations. In some embodiments, the subject may have a PARN mutation; e.g., a deletion comprising part of PARN gene or the entire PARN gene. In some embodiments, the subject may have a TERC mutation; e.g.. a deletion comprising part of TERC gene or the entire TERC gene. In some embodiments, the subject may have a DKC 1 mutation; e.g., a deletion comprising part of DKC1 gene or the entire DKC 1 gene. In some embodiments, the subject may have a TINF2 mutation; e.g., a deletion comprising part of TINF2 gene or the entire TINF2 gene. In some embodiments, the subject may have aRTELl mutation; e.g., a deletion comprising part of RTEL 1 gene or the entire RTEL 1 gene. In some embodiments, the subject may have mutations in any combination of genes described herein. In some embodiments, the mutations (e.g., deletions) in any combination of genes described herein may result in decreased or complete loss of function.

[0097] In some embodiments, the methods include determining the level or activity of TERC, TERT, PARN, DKC 1, TINF2 or RTEL 1 in a cell from the subject; comparing the level or activity of TERC, TERT, PARN, or DKC 1 to a reference level or reference activity of TERC, TERT, PARN, DKC1, TINF2 or RTEL 1 ; and identifying the subject as having, being at risk of developing, or suspected of having a disorder associated with telomerase dysfunction if the level or activity of TERC, TERT. PARN. DKC1, TINF2 or RTEL 1 is significantly different from the reference level or activity of TERC, TERT, PARN, DKC1, TINF2 or RTEL 1. In some embodiments, the reference level or activity of TERC, TERT, PARN, DKC 1, TINF2 or RTEL 1 is determined by cells obtained from subjects without disorders associated with telomerase dysfunction. In some embodiments, the level or activity of TERC, TERT. PARN, DKC1, TINF2 or RTEL1 is decreased as compared to the reference level or activity of TERC, TERT, PARN, DKC1, TINF2 or RTEL1. In some embodiments, the level or activity ofTERC, TERT, PARN, DKC1, TINF2 or RTELl is not detectable or is absent.

[0098] The level or activity ofTERC. TERT, PARN, DKC1, TINF2 or RTEL 1 can be determined in various types of cells from a subject. The methods can include obtaining cells from a subject, and transforming these cells to iPSCs, and these iPSCs can be used to determine the level or activity ofTERC, TERT, PARN, DKC1, TINF2 or RTEL1. These cells can be, e.g., primaiy human cells.

[0099] Induced pluripotent stem cells

[0100] Induced pluripotent stem cells (iPSCs), are somatic cells (e.g., derived from patient skin or other cell) that have been genetically reprogrammed to an embryonic stem cell-like state by being forced to express genes and factors important for maintaining the defining properties of embryonic stem cells. These cells are generated by methods known in the art.

[0101] It is known that mouse iPSCs demonstrate important characteristics of pluripotent stem cells, including expressing stem cell markers, forming tumors containing cells from all three germ layers, and being able to contribute to many different tissues, when injected into mouse embryos at a very early stage in development.

[0102] Human iPSCs also express stem cell markers and are capable of generating cells characteristic of all three germ layers. iPSCs can be generated from human fibroblasts and are already useful tools for drug development and modeling of diseases. Viruses are currently used to introduce the reprogramming factors into adult cells (e.g., lentiviral vectors disclosed herein), and this process can be carefully controlled and tested in cultured, isolated cells first to then treat cells (e.g., bycontacting with a test compound) to express altered markers, e.g., iPSCs from tumor cells can be manipulated to differentiate or iPSCs from cardiomyocytes can be manipulated to de-differentiate.

[0103] As described herein, the iPSC can be any cells obtained from a subject that has gene mutations, including 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations in TERC; 1, 2, 3, 4. 5, 6, 7, 8. 9, or 10 mutations in TERT; 1, 2, 3, 4, 5, 6, 7. 8, 9, or 10 mutations in PARN; 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations in DKC1; 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations in TINF2; 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations in RTEL1 ; and / or any combination thereof. In some embodiments, the gene mutations are partial or complete loss-of-function mutations. In some embodiments, the gene mutation is amutation at PARN, e.g., a deletion containing part of PARN gene or the entire PARN gene. In some embodiments, the gene mutation is a mutation at TERC, e.g. , a deletion containing part of TERC gene or the entire TERC gene. In some embodiments, the gene mutation is amutation at DKC 1 e.g.. a deletion containing part of DKC 1 gene or the entire DKC 1 gene. In some embodiments, the gene mutation is a mutation at TINF2 e.g., a deletion containing part of TINF2 gene or the entire TINF2 gene. In some embodiments, the gene mutation is a mutation at RTEL 1 e.g., a deletion containing part of RTEL 1 gene or the entire RTEL 1 gene. In some embodiments, the gene mutation is any combination of genes described herein.

[0104] In some embodiments, iPSCs from a subject having the gene mutations as described above can be treated with a pharmaceutical composition to test whether the pharmaceutical composition can alter the level or activity of telomerase or the length of telomere. In some embodiments, the cells are contacted with test pharmaceutical composition (e.g., a composition comprising synthetic TERC). In some embodiments, these iPSC cells can be used for screening pharmaceutical composition that modulate (e.g., increase) telomerase function. In some embodiments, the iPSC cells are converted from patient skin, bone marrow or blood cells. Additional information, including methods of making iPSCs from patient cells, are known in the art (e.g., Nagpal, N. et al. (2020) Cell Stem Cell 26, 896-909; Moon, D. H. et al. (2015) Nat Genet 41, 1482- 1488; Agarwal, S. et al. (2010) Nature 464, 292-296; Mannherz, W. & Agarwal, S. (2023) Nat Genet 55. 568-580; Park, I-H., et al. (2008) Nat Protoc. 3(7): 1180-6).

[0105] Methods of Treatment

[0106] Provided herein are methods of treating a disorder associated with telomerase dysfunction in a subject. In some embodiments, the method comprising identifying the subject as having a disorder associated with telomerase dysfunction; and administering to the subject an effective amount of a pharmaceutical composition including the synthetic TERC described herein, or a pharmaceutical composition including the synthetic TERC, a mRNA or cDNA of TERT (e.g., synthetic TERT mRNA), and / or other agents of increasing TERT level (e.g., expression or amount), and / or thymidine, thereby treating the disorder associated with telomerase dysfunction in the subject.

[0107] In some embodiments, the methods described herein can be used in treating telomerase dysfunction in hematopoietic stem or progenitor cells (HSPCs), immune cells, or engineered immune cells such as chimeric antigen receptor T cells (CAR-T cells). In some embodiments, the methods described herein can be used to increase telomerase function in hematopoietic stem or progenitor cells (HSPCs), somatic cells, bone-marrow mononuclear cells (BMMCs). immune cells, or engineered immune cells such as chimeric antigen receptor T cells (CAR-T cells). In some embodiments, the methods described herein can be used to increase telomere length in hematopoietic stem or progenitor cells (HSPCs), somatic cells, bone-marrow mononuclear cells (BMMCs), immune cells, or engineered immune cells such as

[0108] T1 chimeric antigen receptor T cells (CAR-T cells). In some embodiments, the methods described herein can be used in increasing cellular replicative capacity in hematopoietic stem or progenitor cells (HSPCs), somatic cells, bone-marrow mononuclear cells (BMMCs), immune cells, or engineered immune cells such as chimeric antigen receptor T cells (CAR-T cells). In some embodiments, the methods described herein can be used in treating any other diseases that are associated with or treated by HSPCs, somatic cells, bone-marrow mononuclear cells (BMMCs), immune cells, or engineered immune cells (e.g., CAR-T cells).

[0109] Also provided herein are methods of modulating (e.g.. increasing) the level or activity of telomerase in a cell, the method including contacting the cell with the synthetic TERC, and optionally, contacting the cell with a mRNA or cDNA of telomerase reverse transcriptase (TERT). In some embodiments, the cell is an induced pluripotent stem cell (iPSC), a primary human cell, a genetically-modified primary human cell, or a cell line. In some embodiments, the cell is derived from skin, bone marrow, blood, or tissue including hematopoietic stem or progenitor cells (HSPCs), bone-marrow mononuclear cells (BMMCs), somatic cells or immune cells, or engineered immune cells such as chimeric antigen receptor T cells. In some embodiments, the cell is HSPC. In some embodiments, the cell has low TERT expression or amount. In some embodiments, the cell is human and / or is in a human.

[0110] Generally, HSPCs refer to primitive cells capable of regenerating all blood products throughout the life of an individual, balancing their self-renewal with progeny differentiation. HSPCs have therapeutic potential as a result of their capacity to restore blood and immune cells in transplant recipients. HSPCs have the potential to generate cells for other tissues such as brain, muscle and liver. Human autologous and allogeneic bone marrow transplantation methods are currently used as therapies for diseases such as leukemia, lymphoma, and other life-threatening diseases.

[0111] Generally, engineered immune cells refer to immune cells (such as T cells, NK cells, macrophages) that have been modified or manipulated, for example in a laboratory setting to enhance their ability to recognize and attack specific targets, such as cancer cells or pathogens. This can involve genetic modifications and / or contacting the immune cells with a nucleic acid encoding a desired modification, such as introducing a vector encoding a chimeric antigen receptor (CAR) and / or modifying genes involved in signaling pathways, to enhance their efficacy in fighting disease. Engineered immune cells hold promise for the development of novel immunotherapies for various diseases, including cancer and autoimmune disorders. Exemplary7engineered immune cells include but not limited to Chimeric Antigen Receptor T cells (CAR-T cells), T Cell Receptor (TCR) Engineered T cells, Tumor- Infiltrating Lymphocytes, Natural Killer (NK) Cells, and Tumor-Specific T cells.

[0112] The methods described herein include methods for the treatment of disorders associated with telomerase dysfunction or at least one symptom associated with such disorders. The disorder can be, e.g., dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, idiopathic pulmonary fibrosis, hematological disorder, hepatic disease (e.g., chronic liver disease), or cancer, e.g., hematological cancer or hepatocarcinoma. Generally, the telomerase dysfunction can cause telomere shortening, telomere uncapping, telomere fusion, or telomere fragility . In some embodiments, the telomerase dysfunction causes telomere shortening.

[0113] In some embodiments, the methods comprise administering a therapeutically effective amount of a pharmaceutical composition including the synthetic TERC as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. In some embodiments, the subject has gene mutations as described in the section of “Subjects” above or known in the art.

[0114] As used in this context, to “treat” means to ameliorate at least one symptom of the disorder associated with telomerase dysfunction. In some embodiments, the treatment results in an increase of the telomerase level or activity. In some embodiments, the treatment results in an increase of the telomere length. In some embodiments, the treatment results in thus an increases self-replicative capacity of cells and rescues the senescence. Thus, in some embodiments, a treatment can ameliorate one or more symptoms that are associated with abnormal telomerase function or telomerase deficiency.

[0115] A subject can be administered at least one (e.g., at least 2, 3. 4. or 5) dose of the pharmaceutical composition including the synthetic TERC described herein. The pharmaceutical composition including the synthetic TERC can be administered to the subject at least once a day (e.g., twice a day, three times a day, and four times a day), at least once a week (e.g., twice a week, three times a week, four times a week), and / or at least once a month. A subject can be treated (e.g.. periodically administered the pharmaceutical composition) for a prolonged period of time (e.g., at least one month, two months, six months, one year, two years, three years, four years, or five years). In some embodiments, the dosage of a pharmaceutical composition including the synthetic TERC to be administered to the subject can be determined by a physician by consideration of a number of physiological factors, including, but not limited to, the sex of the subject, the weight of the subject, the age of the subject, and the presence of other medical conditions. The pharmaceutical composition including the synthetic TERC can be administered to the subject orally, intravenously, intraarterially, subcutaneously, intramuscularly, intracranially, or via injection into the cerebrospinal fluid. Likewise, the pharmaceutical composition may be formulated as a solid (e.g., for oral administration) or a physiologically acceptable liquid carrier (e.g., saline) (e.g., for intravenous, intraarterial, subcutaneous, intramuscular, or cerebrospinal administration).

[0116] In some embodiments, the methods of treatment can further include administering to a subject at least one (e.g., at least two, three, four, five, or six) additional agents that can increase the level or activity of telomerase. In some embodiments, the additional agents include added TERT and / or added thymidine. In some embodiments, the additional agents can increase TERT amount and thymidine amount. In some embodiments, the additional TERT mRNA (e.g., synthetic modified TERT mRNA) or cDNA can be added to increase TERT expression. In some embodiments, TERT expression is increased via infecting the cells with TERT containing viruses. In some embodiments, the pharmaceutical composition including the synthetic TERC descnbed herein is administered to a subject in any combination with treatments for telomere diseases that are known in the art.

[0117] In some embodiments, the synthetic TERC can be any modified TERC molecules (also called TERC RNAs) described herein. For example, the synthetic TERC molecule can be a TERC with a 5’ tmg cap, a TERC with a 5’ m7g cap, a TERC with a cap structure analog at the 5’ end, a TERC modified with 3’ 2’-OMe-A residues, a TERC modified with any 2’-OMe-nucleotide residue at the 3’ end, a TERC modified with other nuclease-resistant nucleotide residues at the 3’ end, a TERC modified with a 5’ tmg cap and 3’ modifications (e.g.. 2?-OMe-A residues, 2’-OMe- nucleotide residue, or other nuclease-resistant nucleotide residues, at the 3’ end), or a TERC modified with a 5’ m7g cap and 3’ modifications (e.g., 2’ -OMe-A residues, 2’- OMe-nucleotide residue, or other nuclease-resistant nucleotide residues, at the 3’ end), or a TERC modified with a 5’ cap structure analog and 3’ modifications (e.g., 2’ -OMe-A residues, 2'-OMe-nucleotide residue, or other nuclease-resistant nucleotide residues, at the 3’ end).

[0118] In some embodiments, the synthetic TERC with both a 5’ tmg cap and 3’ 2’- OMe-A residues increases the level or activity of telomerase compared to other types of synthetic TERC molecules, e.g., TERC with singular modifications (e.g., 5’ tmg cap, 3’ 2’-0Me-A residues, or 5’ m7g cap), or TERC with both end modification of 5’ m7g cap and 3’ 2’-0Me-A residues. In some embodiments, the synthetic TERC with both a 5’ tmg cap and 3’ 2’-0Me-A residues increases the length of telomere compared to other types of synthetic TERC molecules, e.g., TERC with singular modifications (e.g., 5’ tmg cap, 3’ 2’-0Me-A residues, or 5’ m7g cap), or TERC with both end modification of 5’ m7g cap and 3’ 2’-0Me-A residues. In some embodiments, the supplementation of TERT (e g., TERT mRNA or cDNA or stably transducing the cells with TERT-expressing viruses) and / or thymidine in addition to the synthetic TERC with both a 5’ tmg cap and 3’ 2 ’-OMe-A residues can further augment telomere length.

[0119] Also provided herein are methods of treating a disorder associated with aging in a subject, the method including a) identifying the subject as having a disorder associated with aging; and b) administering to the subject an effective amount of a pharmaceutical composition comprising the synthetic TERC described herein, thereby treating the disorder associated with aging in the subject.

[0120] Telomeres shorten over the human life span. In large population-based studies, short or shortening telomeres are associated with numerous diseases. Thus, telomeres have an important role in the aging process, and can contribute to various diseases. The role of telomeres as a contributory and interactive factor in aging, disease risks, and protection is described, e g., in Blackbum et al. ’‘Human telomere biology: A contributory and interactive factor in aging, disease risks, and protection,” Science 350.6265 (2015): 1193-1198, which is incorporated by reference in its entirety. Generally, the term ’'aging" refers to degeneration of organs and tissues over time, in part due to inadequate replicative capacity in stem cells that regenerate tissues over time. Aging may be due to natural disease processes that occur over time, or those that are driven by cell intrinsic or extrinsic pressures that accelerate cellular replication and repair. Importantly, numerous factors that localize at telomeres to regulate their length, structure and function, to avert replicative senescence or genome instability and cell death can have Mendelian defects resulting in abnormally short or dysfunctional telomeres, causing a group of rare heterogeneous premature-ageing diseases. Additional pressures include natural chemical, mechanical, and radiation exposure; biological agents such as bacteria, viruses, fungus, and toxins; autoimmunity, medications, chemotherapy, therapeutic radiation, cellular therapy. As the telomere is an important factor in aging and disease development, the methods described herein can be used for treating, mitigating, or minimizing the risk of, a disorder associated with aging (including premature aging; and / or one or more symptoms of a disorder associated with aging / premature aging) in a subject. The methods include the step of identifying a subject as having or being at risk of a disorder associated with aging; and administering a pharmaceutical composition to the subj ect. In some embodiments, the pharmaceutical composition includes an agent that alters the level or activity of TERC. e.g., increase the level or activity of TERC.

[0121] Generally, the term “disorders associated with aging” refers to disorders that are associated with the ageing process, including premature aging, e.g., aging caused by a defect in a factor related to or localized at telomeres. Exemplary disorders include, e.g., macular degeneration, diabetes mellitus (e.g., type 2 diabetes), osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular diseases such as hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, as well as age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, and hearing.

[0122] The disorder associated with aging can be a degenerative disorder, e.g.. a neurodegenerative disorder. Exemplary neurodegenerative disorders include Motor Neuron Disease, Creutzfeldt-Jakob disease, Machado-Joseph disease, Spinocerebellar ataxia, Multiple sclerosis (MS), Parkinson's disease, Alzheimer's disease, Huntington's disease, hearing and balance impairments, ataxias, epilepsy, mood disorders such as schizophrenia, bipolar disorder, and depression, dementia, Pick's Disease, stroke, CNS hypoxia, cerebral senility, and neural injury such as head trauma. Recent studies have shown the association between shorter telomeres and Alzheimer’s disease. The relationship between telomere length shortening and Alzheimer's disease is described., e.g., in Zhan, Yiqiang, el al. "Telomere length shortening and Alzheimer disease — a Mendelian Randomization Study," JAMA neurology 72.10 (2015): 1202-1203, which is incorporated by reference in its entirety. In some embodiments, the neurodegenerative disorder is dementia, e.g., Alzheimer’s disease.

[0123] It has also been determined that there is an inverse association between leucocyte telomere length and risk of coronary heart disease. This relationship is described, e.g., in Haycock, Philip C., et al. "Leucocyte telomere length and risk of cardiovascular disease: systematic review and meta-analy sis." (2014): g4227; and Codd, Veryan, et al. "Identification of seven loci affecting mean telomere length and their association with disease." Nature genetics 45.4 (2013): 422-427; each of which is incorporated by reference in its entirety. Thus, there is strong evidence for a causal role of telomere-length variation in cardiovascular disease (CVD), or coronary artery disease (CAD). In some embodiments, the methods described herein can be used to treat cardiovascular disease (CVD) and / or coronary artery disease (CAD). In some embodiments, the present disclosure provides methods of treating, mitigating, or minimizing the risk of, these disorders. In some cases, the disorder is an atherosclerotic cardiovascular disease.

[0124] Furthermore, a meta-analysis of 5759 cases and 6518 controls indicated that shortened telomere length was significantly associated with type 2 diabetes mellitus risk. The relationship between telomere length and type 2 diabetes mellitus is described, e.g., in Zhao, Jinzhao, et al. "Association between telomere length and type 2 diabetes mellitus: a meta-analysis." PLoS One 8. 11 (2013): e79993, which is incorporated by reference in its entirety. In some embodiments, the disorder is a metabolic disorder, e.g., type 2 diabetes mellitus.

[0125] The methods described herein can be used for treating or diagnosing degenerative disorders in a subject. Degenerative disorders that can be treated or diagnosed using the methods described herein include those of various organ systems, such as affecting brain, heart, lung, liver, muscles, bones, blood, gastrointestinal and genito-urinary tracts. In some cases, degenerative disorders are those that have shortened telomeres, decreased levels of TERC, and / or decreased levels of telomerase, and / or defective function of telomerase relative to normal tissues.

[0126] In some embodiments, aged cells can be used to screen synthetic TERC molecules that alter the length of telomere. In some embodiments, aged cells can be used to screen synthetic TERC molecules that alter the level or activity of telomerase. The aged cells used in the methods can be, e.g., those with genetic lesions in telomere biology genes, those isolated from elderly subjects, or those that undergo numerous rounds of replication in the lab. Such methods can be used to screen a library of test synthetic TERC molecules, e.g., synthetic TERC molecules with various modifications that may or may not alter the length of telomere, or the level or activity of telomerase. Exemplary methods of screening and screening techniques are described herein.

[0127] In some embodiments, synthetic TERC molecule, e.g., synthetic TERC with both a 5’ tmg cap and 3’ 2 -OMe-A residues, increase the level or activity of telomerase, or the length of telomere is used to treat age-related degenerative disorders due to natural causes or environmental causes. In some embodiments, synthetic TERC molecule, e.g., synthetic TERC with both a 5?tmg cap and 3?2’- OMe-A residues, increases self-replicative capacity of cells and rescues the senescence. In some embodiments, these synthetic TERC molecules are used in combination with other treatments.

[0128] Pharmaceutical Compositions and Methods of Administration

[0129] Provided herein are pharmaceutical compositions including the synthetic RNA (e.g., synthetic TERC) comprising one or more modifications that increase RNA (e.g., TERC) stability or resistance to degradation as described herein.

[0130] Pharmaceutical compositions can comprise any synthetic RNA (e.g., synthetic TERC) described herein, including the synthetic RNA (e.g., synthetic TERC) comprising a cap at the 5’ end and / or modifications at the 3’ end. In some embodiments, the 5’ end cap is a 2,2,7-trimethylguanosine cap (5’ tmg cap), a 7- methylguanosine cap (5’ m7g cap), or a cap structure analog. In some embodiments, the 3' end modifications comprise any one or more of: at least one, two, or three 2’- O-methyl-adenosine residues (3’ 2’-0Me-A residues), at least one, two, or three 2’- OMe-nucleotide residue (e.g., 3’ 2’-0Me-U residues), at least one, two or three nuclease-resistant residues, and / or any combination thereof.

[0131] Provided herein are compositions including a synthetic TERC described herein, and / or a mRNA or cDNA of TERT (e.g.. synthetic TERT mRNA) or other agents to increase TERT level (e.g., expression or amount), and / or thymidine. Also provided herein are pharmaceutical compositions comprising any of the compositions described herein.

[0132] Also provided herein are methods of using the pharmaceutical compositions described herein.

[0133] Pharmaceutical compositions typically include a pharmaceutically acceptable carrier. Examples of pharmaceutically acceptable carriers include saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.

[0134] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.

[0135] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration into subjects. Examples of routes of administration include parenteral, e.g.. intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.

[0136] Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY). For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[0137] Also provided herein is a kit including the synthetic RNA (e.g., synthetic TERC) described herein, a pharmaceutically acceptable carrier, and / or an instruction or user manual of using such composition. Also provided herein is a kit including synthetic RNA (e.g., synthetic TERC) described herein, a mRNA or cDNA of TERT (e.g., synthetic TERT mRNA) or a bacterial or mammalian or viral agent to increase TERT expression, and / or thymidine.

[0138] Dosage

[0139] Dosage, toxicity and therapeutic efficacy of the therapeutic compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds which exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and. thereby, reduce side effects.

[0140] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays, e.g., human cell or cell lines. The cellbased assays can employ patient-derived fibroblasts or iPSCs or hematopoietic stem and progenitor cells (HSPCs) or bone-marrow mononuclear cells (BMMCs) or T- cells. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. A compound that is tested in a cell-based assay can display a low or high potency, defined by the range of concentration at which it is effective. The dosage of such compounds lies preferably within a range of circulating concentrations that include the IC50 with little or no toxicity. The dosage may vary' within this range depending upon the dosage form employed and the route of administration utilized. Such information derived from initial cell-based assays can be used to more accurately determine useful doses in humans. In some embodiments, prior to treatment, patients can be identified with genetic mutations, e.g., alterations in genes associated with telomere disease, and selected to be treated with composition described herein (e.g., a composition comprising TERC; e.g., a synthetic modified nucleic acid comprising SEQ ID NO: 1 ). e.g., to treat a telomere- or telomerase- associated disease.

[0141] EXAMPLES

[0142] The materials and methods described here have been used to generate the examples described herein.

[0143] Materials and Methods

[0144] Cell culture, cell growth, and introduction of TERC RNA iPSCs Derivation, characterization, and culture conditions of iPSCs from fibroblasts from patients were performed as described (Agarwal et al, 2010, Moon et al., 2015, Nagpal et al., 2020, Mannherz et al., 2023). For feeder-free culture, iPSCs were maintained in Essentials™ medium (Life Technologies) on hES-qualified Matrigel™ matrix (BD Biosciences) and subcultured using Accutase™ cell detachment solution (Stem Cell Technologies).

[0145] HSPCs CD34+ HSPCs from anonymous healthy donors, peripheral blood mobilized and cryopreserved, were obtained from Fred Hutchinson Cancer Research Center, Seatle. Washington (NIDDK Cooperative Centers of Excellence in Hematology). Cells were resuspended and maintained in X-VIVO 15 (Lonza, 04-418Q) media supplemented with lOOng / ml of each of Flt3-L (recombinant human FLT-3 ligand, Peprotech; 300-19), TPO (human thrombopoietin, Peprotech; 300-18) and SCF (recombinant human stem cell factor, R & D Systems; 255-SC-200). Resuspended cells were thawed and maintained in the above-described media for 24hrs before electroporation.

[0146] Cell lines HEK293 TERC null cells were generated as described (Mannherz et al., 2023). Overexpression of luciferase or TERT was achieved using lentiviral vectors containing luciferase or human TERT. HEK293 TERC null cells were transduced with lentivirus containing luciferase or human TERT constructs in media supplemented with protamine sulfate (Sigma- Aldrich) at 1 Opg ml'1, followed by selection with 2pg ml'1puromycin (Sigma-Aldrich) for 7 days.

[0147] Introduction of TERC RNA

[0148] Transfection HEK293 TERC null cells were transfected 24 hours after plating 2x 105cells in 6-w ell plates with 4.5pg of synthetic TERC RNA using 7 pl lipofectamine™ 2000 transfection reagent (Thermo fisher Scientific, 11668019) in 200pl of Opti- MEM™ medium (Thermofisher Scientific, 31985062) 72 hours post-transfection cells were harvested, stored at -80°C and processed for telomerase activity via lysis with Chaps buffer as described below.

[0149] For telomere length analysis. 4.5 pg of synthetic TERC RNA was resuspended in transfection mixture of 7pl lipofectamine™ 2000 transfection reagent and 200pl of OptiMEM™ medium and cells were harvested 72 hours post-transfection.

[0150] Ipg of synthetic TERT mRNA w as added to the transfection mixture of 4.5 pg of synthetic TERC RNA. For mRNA overexpression control, Ipg of synthetic enhanced green fluorescent protein (eGFP) mRNA was added to transfection mixture of 7pl lipofectamine 2000 transfection reagent and 200pl of OptiMEM ™ medium.

[0151] 0.5pg of TERT (pCDNA-3x-HA-hTERT, Addgene; 51637) w as added to the transfection mixture. 24 hours after transfection, 500pM thymidine was added. Cells were harvested 72 hours post-transfection and processed for DNA extraction for Southern blot as described below.

[0152] For telomere length analysis in HEK293 cells with lentivirus-mediated overexpression of luciferase or TERT, 4.5 pg of synthetic TERC RNA was resuspended in transfection mixture of 7 l lipofectamine™ 2000 transfection reagent and 200pl of OptiMEM™ medium. Transgene expression was induced with 2pg ml’1doxycycline 4hrs after transfection. Cells were harvested 72hrs and 8-days posttransfection.

[0153] Electroporation For iPSCs, for each electroporation, 9pg of synthetic TERC RNAs with or without 2’-OMe-adenosine blocked 3’ ends were mixed with supplemented nucleofector solution and incubated for 15 min at room temperature. Immediately before electroporation, iPSCs derived from patients with mutations in telomerebiology associated genes were collected using Accutase™ cell detachment solution and washed with PBS. 4x 103cells were resuspended for each RNA-nucleofector mix and electroporation was done using Cell line nucleofector® kit V (Lonza VC Al 003), program B-016. Cells were maintained in Essential-8 medium and harvested using Accutase™ cell detachment solution 72 hours post-electroporation, and processed for DNA extraction for Southern blot as described below.

[0154] For TERC RNA levels, electroporated cells were maintained in Essential 8™ medium and harvested directly in Trizol™ reagent (Thermofisher Scientific, 15596026), 24, 48, and 72 hours post electroporation.

[0155] For HSPCs, 5pg of synthetic TERT mRNA and 20pg of synthetic TERC RNA were mixed with supplemented nucleofector solution (P3 primary cell 4D- Nucleofector™ kit, Lonza V4XP-3024) immediately before electroporation. HSPCs were collected and washed with PBS. 2.5x l06cells were resuspended for each RNA- nucleofector mix and electroporation was performed using program EO-100. Cells were maintained in the above-mentioned media, harvested 72 hours postelectroporation, and processed for DNA extraction for Southern blot as described below. Telomerase activity and telomere length measurements

[0156] Telomerase activity assay Cells were lysed with CHAPS lysis buffer and protein concentration measured using DC™ Protein assay kit II (Bio-Rad, 5000112). 10- fold dilutions of equivalent total protein lysate were subjected to TRAP (telomere repeat amplification protocol) assay per the TRAPeze® Telomerase Detection kit (EMD Millipore. S7700). Products were resolved on 10% TBE polyacrylamide gels and visualized by staining with Sybr™ Gold Nucleic acid gel stain (Thermofisher Scientific, S-11494). Relative telomerase activity was quantified using ImageJ software, by pairwise comparison of the intensity of the first 40 amplicons in corresponding lanes with and without exogenous TERC RNA, and averaging across the three replicates per treatment.

[0157] Telomere length measurement Genomic DNA was isolated from harvested cells using Thermo Scientific™ GenJET genomic DNA purification kit (Thermofisher Scientific, K0721) and terminal restriction fragment (TRF) telomere length analysis was performed using the TeloTAGGG™ telomere length assay kit (Roche Life Science; 12209136001).

[0158] To detect 5’ -TTAGGT-3’ (SEQ ID NO: 11) telomere repeats, a dig-labeled probe was synthesized that was complementary to the altered template-encoded TTAGGT(n) (SEQ ID NO: 11) repeat sequence. TRF was performed per the kit protocol (TeloTAGGG telomere length assay kit, Roche Life Science; 12209136001), except using the altered template dig-labeled probe and hybridization overnight at 50°C, followed by telomere length analysis according to the kit protocol. Membranes probed for the altered repeat sequence were then stripped with confirmation of negligible residual signal and re-hybridized with the kit-provided probe for regular, WT telomere repeat (TTAGGG, SEQ ID NO: 10) detection.

[0159] In vitro transcription and northern blot analysis

[0160] In vitro transcription Full length TERC template with a T7 promoter was PCR amplified from pBS U3-hTR-500 using platinum™ superfi™ DNA polymerase (Thermofisher Scientific, 12351010) and TERC specific primers (5?- TAATACGACTCACTATAGGGGGGTTGCGGAGGGTGGGCCTGG-3 ’ (SEQ ID NO: 2), and 5 - GC ATGTGTGAGCCGAGTCCTGG-3 ’ (SEQ ID NO: 3)). In vitro transcription was carried out using MEGAshortscript™ T7 Transcription kit (Thermofisher Scientific AMI 354). Transcripts were purified using Monarch® RNA cleanup kit (New England Biolabs, T2040S) and eluted in nuclease- free / RNase-free water. To generate tmg-capped TERC, the transcription reactions contained m32.2.7GP3G (trimethylated cap analog, Jena Biosciences NU-853) at a ratio of 4: 1 with GTP. To generate m7g-capped TERC- the transcription reaction was carried out using mMessage mMachine™ T7 Transcription kit (Thermofisher Scientific, AM 1344). with a cap analog to GTP ratio of 4: 1.

[0161] For altered template TERC RNA, full length TERC template with a T7 promoter was PCR amplified from pBS U3-hTR-500 using Platinum Superfi DNA polymerase (Thermofisher Scientific, 12351010) and altered template TERC specific primers (5‘- TAATACGACTCACTATAGGGGGGTTGCGGAGGGTGGGCCTGGGAGGG GTGGTGGCCATTTTTTGTCTAAACCTAAATGAGAAGGGCGTAGGC Gees’ (SEQ ID NO: 4), and 5’- GCATGTGTGAGCCGAGTCCTGG-3’ (SEQ ID NO: 5)). In vitro transcription reactions were carried out using MEGAshortscript T7 Transcription kit (Thermofisher Scientific AM1354) substituting GTP with m32,2,7G(5')ppp(5')G (trimethylated cap analog, Jena Biosciences NU-853), at a GTP to cap analog ratio of 1 :4.

[0162] To generate synthetic eGFP mRNA- full length eGFP template with a T7 promoter was PCR amplified from pCMV-T7-EGFP (Addgene; BPK1098) using platinum™ superfi™ DNA polymerase and eGFP specific primers (5’- AATACGCGGCCGCTAATACGACTCACTATAGGGAGAGCCGCCACCATG GTGAGC-3’ (SEQ ID NO: 6), and 5’-TTTTTTTTTTTTTTTTTTT NO: 7)). In vitro transcription was carried out using mMessage mMachine™ T7 Transcription kit. with a m7g-cap analog to GTP ratio of 4: 1. To generate synthetic TERT mRNA- full length TERT template with a T7 promoter was PCR amplified from pCDNA-3x-HA-hTERT using platinum™ superfi™ DNA polymerase and TERT specific primers (5’- ATAAGCGGCCGCTAATACGACTCACT

[0163] ATAGGGAGAGCCGCCACCATGGTGCCGCGCGCTCCCCGCTGCCGAGCC

[0164] GTGCGC TCCCTG CTG -3’ (SEQ ID NO: 8), and 5 -

[0165] ATAAGTTTAAACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

[0166] TTTTTTTTTTTTTTTTTTTTTTTTTTTCAGTCCAGGATGGTC TTGAAGTC- 3’ (SEQ ID NO: 9)). In vitro transcription was carried out using mMessage mMachine™ T7 Transcription kit, with a m7g-cap analog to GTP ratio of 4: 1.

[0167] Northern blot RNA was isolated using TRIzol per standard protocol. Total RNA (1-2 pg) was electrophoresed on 2% agarose / formaldehyde gel followed by capillary transfer to Amersham™ Hybond™ N+ membranes (GE Healthcare; RPN303B) in 10X SSC. Blot was hybridized for 12hrs with a-32P-dCTP-labeled full-length TERC probe in ULTRAhyb™ buffer (Life Technologies, AM8669M). 18S rRNA signal obtained from ethidium bromide staining was used for normalization and signal quantifications were performed using ImageJ software.

[0168] Purification of recombinant PAPD5 / TENT4B and modification of TERC RNA 3’end in vitro

[0169] Purification of recombinant PAPD 5 PAPD5 cDNA (Genbank CCB84642.1) was cloned into a modified pMtac-His6 vector and recombinant protein produced and purified as described (Nagpal et al., 2020).

[0170] Modification of TERC 3’end For protecting the 3’end of TERC, 2.5 pg of in vitro transcribed TERC RNA and 20 pmol of purified recombinant PAPD5 were added per lOOpl of the reaction mix in a buffer containing 25mM Tris-HCl (pH7.4), 50mM KC1, 5mM MgCh, and ImM 2’-OMe-ATP (Jena Biosciences, NU-1184), followed by incubation at room temperature for Ihr. Reactions were purified using RNA clean and concentrator-25 kit (Zymo Research, RIO 17) and purified products were eluted in 25pl RNase free water. Integrity and purity of RNA were confirmed by gel electrophoresis.

[0171] Quantification and statistical analysis

[0172] Error bars presented mean with standard error. P values were calculated based on two-way ANOVA and p<0.05 was defined as significant. All the statistical analysis was done using GraphPad Prism 8 software. Each experiment, treatment was replicated n>3 and one representative blot is shown. Statistical details are represented as ns- not significant, *p<0.05, ****p<0.0001

[0173] Example 1: Exogenous TERC (eTERC) RNA boosted telomere repeat synthesis in iPSCs and primary human hematopoietic stem and progenitor cells (HSPCs) from healthy donors

[0174] A potential early translational target for eTERC is human hematopoietic stem and progenitor cells (HSPCs) to rescue bone marrow failure that occurs in over 90% of individuals with DC by the third decade of life. Furthermore, rapid and transient telomere extension via eTERC could be useful to address replicative exhaustion during therapeutic engineering and expansion of normal adult HSPCs ex vivo. Thus, the ability of eTERC to increase telomere repeat synthesis was next tested by introducing eTERC into healthy donor HSPCs. However, because telomerase is preferentially active at the shorter telomeres, normal telomere length in cells is expected to limit the telomere lengthening effect of eTERC, making it difficult to visualize by Southern blot. Accordingly, when eTERC was introduced into normal iPSCs, unlike telomere biology disorders (TBDs) patient iPSCs, bulk telomere lengthening was not observed over the course of 120 hours (FIG. 12). Similar to normal iPSCs, when eTERC was introduced into HSPCs from healthy donors, bulk telomere lengthening was not observed over the course of 72 hours, even with the cointroduction of TERT mRNA and eTERC (FIG. 13).

[0175] To overcome this limitation, a strategy was exploited to specifically and sensitively detect new telomere repeat synthesis by altering the template of eTERC to encode 5 -TTAGGT-3’ (SEQ ID NO: 11) instead of 5 -TTAGGG-3' (SEQ ID NOTO) repeats (FIGs. 14A-14B). Using a probe complementary to the TTAGGT (SEQ ID NO: 11) repeats encoded by the altered TERC template, and stringent hybridization conditions, new telomere repeat synthesis was clearly detected in PARN-mutant patient iPSCs transfected with a 5 ’-TTAGGT-3’ -encoding (SEQ ID NO: 11) eTERC RNA. The new telomere repeat synthesis depended on 2’-0Me-A residues for 3’ end protection of eTERC and correlated with telomere lengthening (FIG. 15). This same strategy enabled detectable telomere repeat synthesis in normal iPSCs, overcoming limitations in observing changes to overall telomere length with the WT probe (FIG. 16)

[0176] In TERC -null 293T cells, telomere elongation with altered eTERC was found to depend on the co-expression of TERT mRNA (FIG. 17). Further, when these optimized conditions were applied to healthy donor human CD34+ selected mobilized peripheral blood HSPCs, new altered 5’-TTAGGT-3’ (SEQ ID NO: 11) telomere repeat addition was detected (FIG. 18). Again these changes could not be resolved based on telomere length changes using the WT probe, but new telomere repeat synthesis is clearly demonstrated using the altered-template probe. Taken together, these data demonstrate new telomere synthesis in primary human HSPCs ex vivo through the administration of eTERC, in a manner that is compatible with existing blood stem cell therapeutic engineering platforms.

[0177] Example 2: Modified synthetic TERC RNA treatment rescues telomere length in patient iPSCs and in primary human hematopoietic stem and progenitor cells engineered at telomere biology disorders (TBDs)-causing genes

[0178] Additional Methods:

[0179] Cell culture iPSCs were derived from fibroblasts of normal subject (WT) or patient with mutations in / N / A' gene. iPSCs were maintained in Essential 8 medium (Invitrogen) on hES-qualified matrix, Matrigel (BD Biosciences) and subcultured using Accutase cell detachment solution (Stem Cell Technologies).

[0180] Cryopreserved peripheral blood GCSF mobilized CD34+ hematopoietic stem and progenitor cells (HSPCs) from anonymous healthy donors were obtained from Fred Hutchinson Cancer Research Center. Seattle. Washington (NIDDK Cooperative Centers of Excellence in Hematology). HSPCs were thawed, resuspended and maintained in X-VIVO 15 (Lonza, 04-418Q) media supplemented with lOOng / ml of each of Flt3-L (recombinant human FLT-3 ligand, Peprotech; 300-19), TPO (human thrombopoietin, Peprotech; 300-18) and SCF (recombinant human stem cell factor, R & D Systems; 255-SC-200).

[0181] CRISPR / Cas9-mediated disruption of PARN in HSPCs

[0182] CRISPR / Cas9 RNP electroporation of HSPCs was performed using Lonza 4D Nucleofector nucleocuvette strips (V4XP-3032) after resuspension in P3 solution using program EO-IOO. Modified synthetic gRNAs (with first and last three nucleotides having 2'-O-methyl-3'-phosphorothrioate modification, Synthego Corporation) and Alt-R™ S.p. Cas9 Nuclease V3 (Integrated DNA Technologies, 1081059) were mixed in equimolar concentrations and incubated for 15 min at RT. PARN gene disruption was achieved using one gRNA (UGAAGUGUUAGGAGAUACAU). TERC gene disruption was achieved using 2 gRNAs (GCCUACGCCCUUCUCAGUUA and UCAGGCCGCAGGAAGAGGAA). Electroporated HSPCs were maintained in X-VIVO media supplemented with cytokines.

[0183] Methylcellulose hematopoietic colony forming assay

[0184] CRISPR / Cas9-targeted HSPCs described above were maintained in vitro in X- VIVO 15 media for 24 hours followed by electroporation of synthetic eTERC RNA or eGFP mRNA. Cells were maintained in vitro for recovery for 24 h, followed by plating of 1000 cells in methylcellulose medium containing human cytokines (Stem Cell Technologies, H4434). After 12-14 days of culture at 37 °C, 5% CO2, the progenitor colonies were manually counted via light microscopy and classified based on colony morphology.

[0185] In vitro transcription

[0186] For TERC RNAs, full length TERC template with T7 promoter was PCR amplified from pBS U3-hTR-500 using Platinum Superfi DNA polymerase (Thermofisher Scientific, 12351010) and TERC specific primers (5’- TAATACGACTCACTATAGGGGGGTTGCGGAGGGTGGGCCTGG-3’; SEQ ID NO:2; and 5’- GCATGTGTGAGCCGAGTCCTGG-3’; SEQ ID NO:3). In vitro transcription reactions were carried out using MEGAshortscript T7 Transcription kit (Thermofisher Scientific AM1354) substituting GTP with m32’2,7G(5')ppp(5')G (trimethylated cap analog, Jena Biosciences NU-853). at a GTP to cap analog ratio of 1 :4. Transcripts were purified using the Monarch RNA cleanup kit (New England Biolabs, T2040S).

[0187] Modification of synthetic RNAs

[0188] For TERC 3’ modification, 2.5pg of in vitro transcribed RNA and 20 pmol of purified rTENT4B were added per lOOpl reaction in a buffer containing 25mM Tris- HC1 (pH7.4), 50mM KC1, 5mM MgCh, and ImM modified NTP (2’-O- Methyluridine-5 '-triphosphate, Jena Biosciences, NU-1212 or Uridine-5'-(alpha- thio)-triphosphate. Jena Biosciences, NU-411 or 2'-O-Methyladenosine-5'- triphosphate, Jena Biosciences, NU-1184), followed by incubation at room temperature for 1 h. Reactions were purified using RNA clean and concentrator-25 kit (Zymo Research. R1017) and purified products were eluted in 25LII RNase free w ater. Integrity and purity of RNA were confirmed by agarose gel electrophoresis.

[0189] Introduction of TERC RNA into cells

[0190] Electroporation. For iPSCs, 9pg of synthetic TERC RNA was mixed with supplemented nucleofector solution (Cell line nucleofector® kit V, Lonza VCA1003) and incubated for 15 min at RT. Immediately before electroporation, iPSCs were collected using Accutase cell detachment solution and washed with PBS. 4x 10’ cells were resuspended for each RNA-nucleofector mix and electroporation was performed using program B-016. Cells were maintained in Essential-8 medium and harvested using Accutase cell detachment solution 72 h post-electroporation and processed for DNA extraction for Southern blot as described below.

[0191] For HSPCs, 2.5pg of synthetic TERC RNA w ere mixed w ith supplemented nucleofector solution (P4 primary cell 4D-nucleofector kit, Lonza V4XP-3024) immediately before electroporation. HSPCs were collected and washed with PBS. 2.5xl05PARN or TERC disrupted cells were resuspended for each RNA-nucleofector mix and electroporation was performed using program EO-IOO. Cells were maintained in the above-mentioned media, plated for methylcellulose colony formation assay 24 h post-electroporation, and / or harvested 48 h post-electroporation followed by cry opreservation via flash-freeze for telomerase activity assay as described below.

[0192] RG7834 treatment

[0193] PARN-disrupted HSPCs that were not electroporated with RNA were cultured in EI4434 in RG7834 (1 pM). Cells were harvested 48 h post-treatment followed by cry opreservation via flash-freeze for telomerase activity assay as described below.

[0194] Telomerase activity' (TRAP) assay

[0195] Cryopreserved cell pellets were resuspended and lysed with CHAPS buffer, and protein concentration measured using DC Protein assay kit II (Bio-Rad, 5000112). 10-fold dilutions of equivalent total protein lysate were subjected to TRAP (telomere repeat amplification protocol) assay per the TRAPeze Telomerase Detection kit (EMD Millipore, S7700). Products were resolved on 10% TBE polyacrylamide gels and visualized by staining with Sybr Gold Nucleic acid gel stain (Thermofisher Scientific, S-11494). Relative telomerase activity was quantified using ImageJ software, by pairwise comparison of the intensity of the first 40 amplicons in corresponding lanes with and without exogenous TERC RNA, averaged across the three replicates.

[0196] Telomere length measurement

[0197] Genomic DNA was isolated from harvested cells using GenJET genomic DNA purification kit (Thermofisher Scientific, K0721). To analyze telomere length, terminal restriction fragment (TRF) length analysis was performed using the kit protocol (Tel oTAGGG telomere length assay kit, Roche Life Science; 12209136001). Briefly, 2 pg of genomic DNA (pretreated with RNase A and Proteinase K) was digested with Hinfl / Rsal restriction enzy mes and followed by electrophoresis using 0.7% agarose gels. The gel was blotted and probed using kit reagents. Images were taken using Chemidoc Touch Imaging System (Bio-Rad) and quantifications to determine mean telomere lengths were performed as described herein.

[0198] TENT4B plus 2’OMe-Uridine-modified synthetic TERC RNA rescues telomere length in patient iPSCs

[0199] Mutations in PARN negatively impact TERC biogenesis and result in reduced TERC levels and telomerase deficiency in telomere biology disorders (TBDs) patients. We next sought to test the effect of 2’-0Me-Uridine (2’0Me-U) modified TERC RNA in iPSCs from a TBDs patient carrying biallelic mutations in the PARN gene, which resulted in TERC deficiency and the severe early-onset form of TBDs called dyskeratosis congenita (DC). Consistent with the results obtained with eTERC (2’0Me-A modified TERC RNA), we observed a robust increase in telomere length 72 h post-electroporation of 2’0Me-U modified TERC RNA (Figure 19). These results show that TENT4B-mediated enzymatic modification of the 3’ end of synthetic TERC RNA using either 2‘OMe-adenosine triphosphate or 2’OMe-uridine triphosphate results in its functional incorporation into telomerase and telomere elongation in disease-relevant human stem cells. eTERC RNA rescues telomerase activity in primary human hematopoietic stem and progenitor cells engineered to carry loss-of-function mutations in TBDs- causing genes

[0200] A potential early translational target for eTERC would be human hematopoietic stem and progenitor cells (HSPCs) to rescue bone marrow failure that occurs in over 90% of individuals with DC by the third decade of life. Moreover, rapid and transient telomere extension via eTERC could be useful to address concerns of replicative exhaustion during therapeutic engineering and expansion of normal adult HSPCs ex vivo. Thus, we next sought to test the effects of eTERC in CD34+ HSPCs engineered to carry loss-of-function of gene by high-efficiency CRISPR / Cas9 genome editing. After 72 h of in vitro culture, we found reduced telomerase activity in 7 7?N-deficient CD34+ cells that was significantly increased by the introduction of eTERC compared to eGFP RNA electroporation or RG7834 treatment (Figure 20). In methylcellulose assays, we found that eTERC electroporation showed a significant increase in overall hematopoietic colony formation compared to eGFP RNA in / <4 / A;-deficient CD34+ cells (Figure 21). Similarly, robust, significant increase in hematopoietic colony output was observed in response to eTERC electroporation in TERC-deficient CD34+ cells compared to eGFP mRNA as control (Figure 21). Taken together, these data demonstrate telomerase enhancement in primary human HSPCs by administering eTERC ex vivo, in a manner that does not adversely affect hematopoietic differentiation and compatible with existing blood stem cell therapeutic engineering platforms.

[0201] OTHER EMBODIMENTS

[0202] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the follow ing claims.

Claims

WHAT IS CLAIMED IS:

1. A synthetic telomerase RNA component (TERC) comprising one or more modifications that increase TERC stability or resistance to degradation.

2. The synthetic TERC of claim 1, wherein the one or more modifications comprise a cap at the 5’ end, wherein the 5’ end cap is a 2,2,7-trimethylguanosine cap (5’ tmg cap), a 7-methylguanosine cap (5’ m7g cap), or a 5’ cap structure analog.

3. The synthetic TERC of claim 1 or 2. wherein the one or more modifications comprise modifications at the 3' end, wherein the 3’ end modifications are selected from one or more 2’-O-methyl-adenosine residues (3’ 2’-0Me-A residues), one or more 2’-O-methyl-uridine residues (2’-0Me-U residues), one or more 2'-OMe-nucleotide residues, one or more nuclease-resistant nucleotide residues, and any combination thereof.

4. The synthetic TERC of any one of claims 1-3, wherein the one or more modifications comprise(a) a 5?tmg cap; and(b) one or more modifications at the 3’ end comprising at least two 2’-0Me-A residues, at least two 2’-0Me-U residues, at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, or any combination thereof.

5. The synthetic TERC of any one of claims 1-4, wherein the one or more modifications comprise(a) a 5’ m7g cap; and(b) one or more modifications at the 3’ end comprising at least two 2’-0Me-A residues, at least two 2’-0Me-U residues, at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, or any combination thereof.

6. The synthetic TERC of any one of claims 1-5, wherein the one or more modifications comprise(a) a 5' cap structure analog; and(b) one or more modifications at the 3’ end comprising at least two 2’-0Me-A residues, at least two 2’-0Me-U residues, at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant nucleotide residues, or any combination thereof.

7. A method of treating a disorder associated with telomerase dysfunction in a subject, the method comprising: a) identifying the subject as having a disorder associated with telomerase dysfunction; and b) administering to the subject an effective amount of a pharmaceutical composition comprising the synthetic TERC of any one of claims 1-6. thereby treating the disorder associated with telomerase dysfunction in the subject.

8. The method of claim 7, wherein the disorder associated with telomerase dysfunction is dyskeratosis congenita, Hoyeraal Hreidarsson syndrome, aplastic anemia, pulmonary fibrosis, idiopathic pulmonary fibrosis, hematological disorder, or hepatic disease.

9. The method of claim 7 or 8, wherein the subject has short telomeres and / or compromised telomerase and / or one or more mutations in one or more genes necessary for telomerase-holoenzyme assembly, telomerase function, telomerase structure, or telomerase-holoenzyme trafficking and localization.

10. The method of claim 9, wherein the mutations in the one or more genes comprise one or more mutations in TERC, one or more mutations in telomerase reverse transcriptase (TERT), one or mutations in Poly(A) specific ribonuclease (PARN), one or mutations in dyskerin pseudouridine synthase 1 (DKC1), one or more mutations in TERF-1 -interacting nuclear factor 2 (TINF2), one or mutations in regulator of telomere elongation helicase 1 (RTEL1). or any combination thereof.

11. The method of any one of claims 7-10, wherein the telomerase dysfunction causes telomere shortening, telomere uncapping, telomere fusion, or telomere fragility.

12. The method of any one of claims 7-11, wherein the synthetic TERC increases the level or activity of telomerase.

13. The method of any one of claims 7-12, wherein the synthetic TERC increases the length of telomere.

14. The method of any of claims 7-13, wherein the synthetic TERC increases self- replicative capacity of cells and rescues the senescence.

15. A method of treating a disorder associated with aging in a subject, the method comprising: a) identifying the subject as having a disorder associated with aging; and b) administering to the subject an effective amount of a pharmaceutical composition comprising a pharmaceutical composition comprising the synthetic TERC of any one of claims 1 -6, thereby treating the disorder associated with aging in the subject.

16. The method of claim 15, wherein the disorder associated with aging is macular degeneration, diabetes mellitus, osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular disease, hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, or age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, or hearing.

17. The method of claim 15 or 16, wherein the disorder associated with aging is a neurodegenerative disorder.

18. A method of increasing the level or activity of telomerase in a cell, the method comprising contacting the cell with the synthetic TERC of any one of claims 1-6.

19. The method of claim 18, wherein the cell is an induced pluripotent stem cell (iPSC), a primary human cell, a genetically -modified primary human cell, or a cell line.

20. The method of claim 18 or 19, wherein the cell is derived from skin, bone marrow, or blood; optionally wherein the cell is or is derived from hematopoietic stem and progenitor cells (HSPCs), bone-marrow mononuclear cells (BMMCs), immune cells (e.g., T cells, NK cell, macrophages), or engineered immune cells (e.g., chimeric antigen receptor T cells).

21. The method of any one of claims 18-20, wherein the cell is from a subject having or suspected of having a disorder associated with telomere or telomerase dysfunction.

22. A synthetic RNA comprising a cap at the 5’ end and / or modifications at the 3’ end, wherein the 5’ end cap is a 2,2,7-trimethylguanosine cap (5?tmg cap), a 7- methylguanosine cap (5’ m7g cap), or a 5’ cap structure analog, wherein the 3’ end modifications are selected from at least two 2’-O-methyl-adenosine residues (3‘ 2’-OMe-A residues), at least two 2’-OMe-nucleotide residues, at least two nuclease-resistant residues, and any combination thereof.

23. The synthetic RNA of claim 22 is more than 150 nucleotides (nt) in length.

24. The synthetic RNA of claim 22 or 23 comprises telomerase RNA component (TERC). messenger RNA (mRNA). small interfering RNA (siRNA). microRNA (miRNA), long non-coding RNA (IncRNA), circular RNA (circRNA), antisense RNA (asRNA), ribosomal RNA (rRNA), prime editing guide RNA (pegRNA), guide RNA (gRNA), antisense oligonucleotide (ASO), aptamer, ribozyme, smallnuclear RNA(snRNA), small nucleolar RNA (snoRNAs), small cajal bodyspecific RNA (scaRNA), viral RNA, or coding RNA or noncoding RNA.

25. The synthetic RNA of any one of claims 22-24 is TERC.

26. The synthetic RNA of any one of claims 22-25 is a precursor TERC, a full-length TERC sequence, a fragment of TERC, a template variant of TERC, a sequence variant of TERC, or an extension of TERC or a combination of different domains of TERC.

27. A pharmaceutical composition comprising the synthetic TERC of any one of claims 1-6 or the synthetic RNA of any one of claims 22-26.

28. A method of making the synthetic TERC of any one of claims 1-6 comprising(a) obtaining a TERC molecule;(b) adding a 2,2,7-trimethylguanosine cap (tmg) or a 7-methylguanosine cap (m7g) to the 5’ end of the TERC molecule obtained in step (a); and(c) adding at least two 2’-O-methyl-adenosine residues, at least two 2'-O-methyl- uridine residues, at least two 2’-OMe-nucleotide residues, at least two nuclease- resistant nucleotide residues, or any combination thereof, to the 3’ end of the TERC molecule obtained in step (a) or step (b); optionally by using PAP Associated Domain Containing 5 (PAPD5) or TENT4B (Terminal Nucleotidyltransferase 4B), poly(A) polymerases or poly(U) polymerases (PUPs), terminal undyl transferases (TUTases), PAP Associated Domain Containing polymerases (PAPDs), TENTs (Terminal Nucleotidyltransferases), 2'-O-Methyladenosine-5'-Triphosphate (2'-0Me-ATP), a 2’ -OMe-nucleotide-5 '-Triphosphate (2’-0Me-NTP), a nuclease-resistant nucleotide triphosphate, or any combination thereof.

29. The method of claim 28 further comprising synthesizing a TERC molecule based on a nucleotide sequence of TERC or a fragment thereof using chemical or enzymatic reactions.

30. The method of claim 28 or 29 further comprising purifying the synthesized TERC molecule.

31. A composition comprising a synthetic TERC of any one of claims 1-6, a mRNA or cDNA of telomerase reverse transcriptase (TERT) or other agents of increasing TERT level, and / or thymidine.

32. A pharmaceutical composition comprising the composition of claim 31.

33. A method of treating a disorder associated with telomerase dysfunction in a subject, the method comprising: a) identifying the subject as having a disorder associated with telomerase dysfunction; and b) administering to the subject an effective amount of the composition of claim 31 or the pharmaceutical composition of claim 32, thereby treating the disorder associated with telomerase dysfunction in the subject.

34. A method of increasing the level or activity of telomerase in a cell, the method comprising contacting the cell with the synthetic TERC of any one of claims 1-6, and optionally, contacting the cell with a mRNA or cDNA of telomerase reverse transcriptase (TERT).

35. The method of claim 18 or 34, wherein the cell is an induced pluripotent stem cell (iPSC), a primary human cell, a genetically -modified primary human cell, or a cell line (e.g., cell lines derived from a human tissue).

36. The method of claims 18 or 34, wherein the cell is derived from skin, bone marrow, or blood or tissue; optionally wherein the cell is a population of or is derived from hematopoietic stem and progenitor cells (HSPCs), bone-marrow mononuclear cells (BMMCs), immune cells (e.g.. T cells, NK cell, macrophages), or engineered immune cells (e.g., chimeric antigen receptor T cells).

37. The method of any one of claims 18 and 34-36, wherein the cell is a HSPC.

38. The method of any one of claims 18 and 34-26, wherein the cell is in a human.