A method and kit for detecting full-length mRNA of human cell telomerase subunit TERT transcript

Abstract

The application provides a method and a kit for detecting full-length mRNA of human cell telomerase subunit TERT transcript, and belongs to the technical field of biology.The application provides a method for detecting full-length mRNA of human cell telomerase subunit TERT transcript, wherein specific reverse transcription primer TERT rt1 is used for reverse transcription to obtain cDNA; if the 6th exon and the 7th exon of the telomerase subunit TERT can be detected in the cDNA, it is determined that the sample to be detected contains full-length mRNA of human cell telomerase subunit TERT transcript. The method can distinguish the full-length mRNA of TERT mRNA and other splicing isomer mRNA, and provides a new technical means for more convenient and accurate indirect evaluation of telomerase activity in cells.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method and kit for detecting full-length mRNA of human cell telomerase subunit TERT transcript. BACKGROUND

[0002] Telomerase is a ribonucleoprotein complex composed of an RNA template (TERC) and a catalytic subunit (TERT), and its activity is closely related to cell immortalization and cancer occurrence. The expression of TERT is the main rate-limiting factor of telomerase activity, so detecting the expression level of TERT mRNA is an important means to evaluate the activity of telomerase.

[0003] There are mainly two methods for detecting telomerase activity at present. One is TRAP method, which extracts telomerase from cells, extends telomere sequences in vitro, and then determines the extension efficiency of telomere sequences by electrophoresis or qPCR method to judge the activity of cell telomerase. This is the most direct and accurate method to detect the strength of telomerase activity, but its disadvantage is also obvious, that is, the extraction process is very tedious, telomerase is easily inactivated by various factors, the operation time is long, the technical requirement is high, and it is difficult for inexperienced people to extract active telomerase. The second method is to detect the mRNA expression level of telomerase catalytic subunit TERT to indirectly determine the activity of telomerase. High expression of TERT mRNA often means that the telomerase in the cell has high activity, which has been confirmed in many research reports. There are also many telomerase detection kits developed based on this method on the market and patent applications approved. Because in eukaryotic cells, from the production of precursor RNA to the mature mRNA, a series of alternative splicing processes need to be experienced, most introns will be spliced and deleted, and a small amount of exons may also be spliced and deleted. Only the mRNA expressing full-length TERT protein has the activity of telomerase. However, the current detection technology designs primers and probes on the conserved sequence, which means that the TERT mRNA detected by these methods is the detection result of all TERT mRNA splice isomers, and the full-length TERT mRNA cannot be directly detected. SUMMARY

[0004] In view of this, the present application provides a method for detecting full-length mRNA of human cell telomerase subunit TERT transcript.

[0005] In order to achieve the above purpose, the present application provides the following technical scheme:

[0006] The present application provides a method for detecting full-length mRNA of human cell telomerase subunit TERT transcript, comprising the following steps:

[0007] a reverse transcription primer TERT rt1 is designed according to the 11th exon of the telomerase subunit TERT;

[0008] The cDNA is obtained by reverse transcription using the reverse transcription primer TERT rt1, taking the human cell RNA in the sample to be tested as a template,

[0009] If the 6th exon and the 7th exon of the telomerase subunit TERT can be detected in the cDNA, it is determined that the sample to be tested contains the full-length mRNA of the human cell telomerase subunit TERT transcript.

[0010] The present application provides a method for detecting the expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript, comprising the following steps:

[0011] a reverse transcription primer TERT rt1 is designed according to the 11th exon of the telomerase subunit TERT;

[0012] The cDNA is obtained by reverse transcription using the reverse transcription primer TERT rt1, taking the human cell RNA in the sample to be tested as a template, and the expression level of the 6th exon and the 7th exon of the telomerase subunit TERT is detected by taking the cDNA as a template:

[0013] The absolute expression level of the 6th exon and the 7th exon is calculated according to the equation obtained from the standard curve, and the absolute expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript is obtained.

[0014] Or a reference gene is selected, and the relative expression level of the 6th exon and the 7th exon is calculated by using 2 -ΔΔCt The relative expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript is obtained.

[0015] The present application provides a detection kit for implementing the method, comprising a reverse transcription primer TERT rt1 and a primer probe for detecting the 6th exon and the 7th exon.

[0016] The nucleotide sequence of the reverse transcription primer TERT rt1 is shown in SEQ ID NO: 1;

[0017] The primer probe for detecting the 6th exon and the 7th exon comprises an upstream primer TERT6-7 F with a nucleotide sequence shown in SEQ ID NO: 2, a downstream primer TERT6-7 R with a nucleotide sequence shown in SEQ ID NO: 3, and a probe TERT6-7 P with a nucleotide sequence shown in SEQ ID NO: 4.

[0018] The application provides application of the method and the kit to evaluation of telomerase activity for non-diagnostic purposes.

[0019] Compared with the prior art, the application has the following advantages:

[0020] The application provides a method for detecting full-length mRNA of a human cell telomerase subunit TERT transcript, and reverse transcription is performed by using a specific reverse transcription primer TERT rt1 to obtain cDNA; if the 6th exon and the 7th exon of the telomerase subunit TERT can be detected in the cDNA, it is determined that the sample to be detected contains full-length mRNA of the human cell telomerase subunit TERT transcript. The application mainly improves the TERT mRNA RT-qPCR method, detects the 7th exon and the complete 6th exon in the TERT rt1 reverse transcription sample by designing the reverse transcription primer TERT rt1 according to the 11th exon, can accurately distinguish the full-length mRNA of TERT mRNA and other splicing isomer mRNA, and provides a new technical means for more convenient and accurate indirect evaluation of telomerase activity in cells. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 A schematic diagram of five splicing isomers of TERT mRNA is shown in the figure;

[0022] Figure 2 A schematic diagram of the design positions of various specific primers and probes of TERT mRNA is shown in the figure;

[0023] Figure 3 A pCDNA3.1(+)-hTERT three-primer and probe combination amplification result diagram is shown in the figure;

[0024] Figure 4 A HEK293T RNA TERT rt1 primer reverse transcription sample detection result diagram is shown in the figure;

[0025] Figure 5 A SH-SY5Y RNA TERT rt1 primer reverse transcription sample detection result diagram is shown in the figure;

[0026] Figure 6 A HUVEC RNA TERT rt1 primer reverse transcription sample detection result diagram is shown in the figure.

[0027] Figure 7 A HEK293T RNA random primer reverse transcription sample detection result diagram is shown in the figure;

[0028] Figure 8 A SH-SY5Y RNA random primer reverse transcription sample detection result diagram is shown in the figure;

[0029] Figure 9 Figure for HUVEC RNA random primer reverse transcription sample detection result;

[0030] Figure 10 Figure for HEK293T RNA Oligo(dT) 18 Figure for HUVEC RNA random primer reverse transcription sample detection result;

[0031] Figure 11 Figure for SH-SY5Y RNA Oligo(dT) 18 Figure for HUVEC RNA random primer reverse transcription sample detection result;

[0032] Figure 12 Figure for HUVEC RNA Oligo(dT) 18 Figure for HUVEC RNA random primer reverse transcription sample detection result;

[0033] Figure 13 Figure for hTERT primer probe amplification efficiency detection and 293T reverse transcription sample absolute quantification;

[0034] Figure 14 Figure for TERT 6-7 primer probe amplification efficiency detection and 293T reverse transcription sample absolute quantification. DETAILED DESCRIPTION

[0035] The present application provides a method for detecting human cell telomerase subunit TERT transcript full-length mRNA, comprising the following steps: designing reverse transcription primer TERT rt1 according to the 11th exon of the telomerase subunit TERT; taking human cell RNA in a sample to be tested as a template, and using the reverse transcription primer TERT rt1 to perform reverse transcription to obtain cDNA, and if the 6th exon and the 7th exon of the telomerase subunit TERT can be detected in the cDNA, it is determined that the sample to be tested contains human cell telomerase subunit TERT transcript full-length mRNA.

[0036] In the present application, the telomerase subunit TERT has at least five variable splicing isomer forms (referred to as variants) in human cells, which are variant 1, variant 2, variant 3, variant 4 and variant 5 (see Figure 1), wherein variant 1 is the mRNA expressing the full-length TERT protein; variant 2 lacks exon 11 compared to variant 1, and thus the TERT polypeptide chain produced by its transcription also becomes shorter, resulting in an inactive telomerase; variant 3 is shorter than variant 1 in exon 6, while lacking exon 7, exon 8 and exon 11; variant 4 lacks exon 7, exon 8 and exon 11 compared to variant 1, and variants 3 and 4 do not produce proteins in cells, thus they belong to non-coding RNA (ncRNA). The four variants of TERT mRNA have different proportions in different cells, and even by changing the culture conditions, the expression proportions in cells can also be changed, and only variant 1 can produce a TERT subunit with reverse transcriptase activity, thus only the expression level of variant 1 mRNA of TERT can truly represent the activity of telomerase in cells. The present application provides a method for effectively distinguishing variant 1 from the other four variants of mRNA, as follows: since the alternative splicing of TERT mRNA mainly occurs at exon 6, exon 7, exon 8 and exon 11, and when the alternative splicing event occurs at exon 7, exon 8 also occurs at the same time. Therefore, exon 7 and exon 8 are regarded as a whole, and by detecting exon 7, it is determined whether exon 8 is spliced, and by detecting exon 6 and exon 7, it is determined whether exon 6 and exons 7 and 8 in the TERT mRNA transcript are spliced. By detecting exon 11, it is determined whether exon 11 is spliced. In order to effectively detect the expression level of the full-length mRNA of the TERT transcript of the human cell telomerase subunit, one embodiment of the present application designs a reverse transcription primer TERT rt1 for exon 11 to obtain a TERT rt1 reverse transcription sample by reverse transcription, and the expression level of exon 7 and complete exon 6 in the TERT rt1 reverse transcription sample is detected, so as to obtain the expression level of the full-length mRNA of the TERT transcript of the human cell telomerase subunit. If the detection of TERT mRNA is directly performed by detecting exon 6, exon 7 and exon 11, it will cause serious deviation, because the detection primer and probe of exon 6 can detect variant 1 and variant 2 at the same time, and the detection primer and probe of exon 11 can detect variant 1 and variant 5 at the same time, and they cannot distinguish incomplete variant 2 and variant 5. In one embodiment of the present application, a reverse transcription sample is obtained by reverse transcription using a random primer (Random Primer 6) and an Oligo(dT) 18 reverse transcription primer, and the detection of exon 6, exon 7 and exon 11 in the reverse transcription sample shows that this method cannot effectively detect the expression level of the full-length mRNA of the TERT transcript of the human cell telomerase subunit.

[0037] The present application designs reverse transcription primer TERT rt1 according to the 11th exon of the telomerase subunit TERT; and the human cell RNA in the sample to be tested is used as a template to obtain cDNA by reverse transcription using the reverse transcription primer TERT rt1. The present application does not make special limitations on the extraction method of human cell RNA, and the conventional extraction method of human cell RNA in the art can be used. In the present application, the human cells preferably include at least one of the following: HEK293T cells, SH-SY5Y cells and HUVEC cells. In the examples of the present application, the TRIzol method is used to extract human cell RNA. After the human cell RNA is extracted, the reverse transcription primer TERT rt1 is used to reverse transcribe the human cell RNA to obtain cDNA. The nucleotide sequence of the reverse transcription primer TERT rt1 is preferably as shown in SEQ ID NO: 1. The present application designs the specific reverse transcription primer TERT rt1 by designing a specific reverse transcription primer on the 11th exon. Only the TERT mRNA containing the 11th exon can be reverse transcribed into cDNA. Since the reverse transcriptase lacks correction function, and the reverse transcription primer has a small probability of binding to other parts of the RNA during annealing, in order to verify the accuracy of reverse transcription, the expression amount of the 11th exon in the TERT rt1 reverse transcription sample is detected after reverse transcription. The reverse transcription primer TERT rt1 is designed between the upstream primer F and the probe for detecting the 11th exon. If the 11th exon cannot be detected in the product or the expression amount of the 11th exon is within 10% of the total TERT mRNA expression amount, it indicates that the error can be ignored, and the accuracy of reverse transcription is high. The primer probe for detecting the 11th exon includes the upstream primer TERT11 F, the nucleotide sequence of which is preferably as shown in SEQ ID NO: 8, the downstream primer TERT11 R, the nucleotide sequence of which is as shown in SEQ ID NO: 9, and the probe TERT11 P, the nucleotide sequence of which is as shown in SEQ ID NO: 10.

[0038] After obtaining the cDNA, dilute 10 times with sterile water or TE to obtain the PCR template, if the 6th and 7th exons of the telomerase subunit TERT can be detected in the cDNA, it is determined that the sample to be tested contains human cell telomerase subunit TERT transcript full-length mRNA. In the present application, the 6th and 7th exon detection primer probe preferably includes the nucleotide sequence of the upstream primer TERT6-7 F as shown in SEQ ID NO: 2, the nucleotide sequence of the downstream primer TERT6-7 R as shown in SEQ ID NO: 3 and the nucleotide sequence of the probe TERT6-7 P as shown in SEQ ID NO: 4. The upstream primer TERT6-7 F is designed at the variable splicing site of the 6th exon, the probe TERT6-7 P is designed at the constant region of the 6th exon, and the downstream primer TERT6-7 R is designed on the 7th exon. The 6th and 7th exon detection primer probe can detect whether the 6th, 7th and 8th exons are contained in the TERT mRNA. The 6th and 7th exon detection system preferably comprises 2x qPCR Mix 10 μL, TERT6-7 F 0.5 μL, TERT6-7 R 0.5 μL, TERT6-7 P 0.3 μL and TERT rt1 reverse transcription sample 2 μL, and sterile water is added to 20 μL. The 6th and 7th exon detection program preferably comprises 95℃ 3 min; 95℃ 15 s, 60℃ 15 s, 72℃, collect fluorescence 20 s, 40 cycles. After the reaction is completed, if the fluorescence signal can be detected, it means that the 6th, 7th and 8th exons are contained in the TERT mRNA, and the stronger the fluorescence signal, the higher the expression level of the human cell telomerase subunit TERT transcript full-length mRNA. Based on the fact that only the human cell telomerase subunit TERT transcript full-length mRNA can produce TERT subunit with reverse transcriptase activity, high expression of TERT mRNA means that the telomerase in the cell has very high activity, and the present application provides a new technical means for more convenient and accurate indirect evaluation of the activity of the telomerase in the cell.

[0039] The present application provides a method for detecting the expression level of human cell telomerase subunit TERT transcript full-length mRNA, comprising the following steps:

[0040] The reverse transcription primer TERT rt1 is designed according to the 11th exon of the telomerase subunit TERT gene; the cDNA is obtained by reverse transcription of the human cell RNA in the sample to be tested using the reverse transcription primer TERT rt1; and the expression levels of the 6th and 7th exons of the telomerase subunit TERT are detected using the cDNA as the template:

[0041] The recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript is used as a standard to draw a standard curve, and the absolute expression levels of the 6th and 7th exons are calculated according to the equation obtained from the standard curve, so as to obtain the absolute expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript.

[0042] Or the internal reference gene is selected, and the relative expression levels of the 6th and 7th exons are calculated by using the 2 -ΔΔCt method, so as to obtain the relative expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript.

[0043] In the present application, the method for designing the reverse transcription primer TERT rt1 according to the 11th exon of the telomerase subunit TERT gene is preferably the same as the above-mentioned method, which will not be repeated here. The human cell RNA in the sample to be tested is used as a template to perform reverse transcription by using the reverse transcription primer TERT rt1 to obtain cDNA, and the method is preferably the same as the above-mentioned method, which will not be repeated here.

[0044] In the present application, the recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript is used as a standard to draw a standard curve, and the absolute expression levels of the 6th and 7th exons are calculated according to the equation obtained from the standard curve, so as to obtain the absolute expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript. In the present application, the accession number of the full-length cDNA of the human cell telomerase subunit TERT transcript in NCBI is NM_198253.3. The recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript is preferably obtained by inserting the full-length cDNA of the human cell telomerase subunit TERT transcript into the multiple cloning site of a backbone plasmid. The backbone plasmid is preferably pCDNA3.1(+), which is purchased from Wuhan Moli Biological Technology Co., Ltd., and the multiple cloning site of the backbone plasmid is Nhe I and Xba I. The primers for amplifying the full-length cDNA of the human cell telomerase subunit TERT transcript include an upstream primer F with a nucleotide sequence as shown in SEQ ID NO: 11 and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO: 12. The amplification system is: Phanta Flash Super-Fidelity DNA Polymerase 1 μL, 2 × Phanta Flash Buffer 25 μL, 2 μL of the upstream primer F and the downstream primer R, 293T cDNA template 10 μL, and sterile water 10 μL. The amplification program is: 98℃ for 30 s; 98℃ for 10 s, 65℃ for 5 s, 72℃ for 1 min, 35 cycles; 72℃ for 2 min; 4℃ for 10 min.

[0045] or selecting an internal reference gene, using 2 -ΔΔCt The present application does not make special limitation to the internal reference gene, and any internal reference gene commonly used in the art can be selected. For example, ACTB or GAPDH, etc. In the examples of the present application, the 2nd exon of the constant region of TERT mRNA is used as the internal reference gene to design primers and probes to determine the relative expression amount of the telomerase subunit TERT gene. In the examples of the present application, the 2nd exon is used as the internal reference gene to design primers and probes to determine the relative expression amount of the telomerase subunit TERT gene. The primer and probe for detecting the 2nd exon preferably include an upstream primer hTERT F having the nucleotide sequence shown in SEQ ID NO: 5, a downstream primer hTERT R having the nucleotide sequence shown in SEQ ID NO: 6, and a probe hTERT P having the nucleotide sequence shown in SEQ ID NO: 7. The internal reference gene is in the constant region of TERT mRNA, and the relative expression level of the full-length TERT mRNA can be evaluated by detecting the expression amount of the constant region. In addition to the 2nd exon, the 1st exon, the 3rd exon, the 4th exon, the 5th exon, the 9th exon, or the 10th exon can also be selected. Since only the TERT mRNA containing the 11th exon is reverse transcribed into cDNA during reverse transcription, the relative expression amount is the expression amount of the full-length mRNA of the human cell telomerase subunit TERT relative to the TERT mRNA containing the 11th exon. In the present application, in order to eliminate the error caused by the different amplification efficiencies of the primers designed for different regions, a recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript is constructed to correct the error caused by the different amplification efficiencies of the primers. The recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript is preferably the same as the above-mentioned recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript, and will not be described here again.

[0046] The present application provides a detection kit for implementing the method, which comprises a reverse transcription primer TERT rt1 and primer and probe for detecting the 6th exon and the 7th exon;

[0047] The nucleotide sequence of the reverse transcription primer TERT rt1 is shown in SEQ ID NO: 1;

[0048] The primer probe for detecting the 6th and 7th exons comprises an upstream primer TERT6-7 F with a nucleotide sequence as shown in SEQ ID NO: 2, a downstream primer TERT6-7 R with a nucleotide sequence as shown in SEQ ID NO: 3, and a probe TERT6-7 P with a nucleotide sequence as shown in SEQ ID NO: 4.

[0049] In the present application, the primer probe for detecting the internal reference gene and / or the recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript are preferably further included.

[0050] The primer probe for detecting the internal reference gene comprises an upstream primer hTERT F with a nucleotide sequence as shown in SEQ ID NO: 5, a downstream primer hTERT R with a nucleotide sequence as shown in SEQ ID NO: 6, and a probe hTERT P with a nucleotide sequence as shown in SEQ ID NO: 7.

[0051] The full-length cDNA of the human cell telomerase subunit TERT transcript has an accession number NM_198253.3 in NCBI.

[0052] Based on the fact that only the full-length mRNA of the human cell telomerase subunit TERT transcript can produce the TERT subunit with reverse transcriptase activity, a high expression level of TERT mRNA means that the telomerase in the cell has a high activity, and the present application provides an application of the method or the kit in evaluating the telomerase activity for non-diagnostic purposes.

[0053] In the present application, the expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript is positively correlated with the telomerase activity.

[0054] In order to further illustrate the present application, the schemes provided by the present application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0055] Example 1

[0056] Design method of primer probe

[0057] 1. Design method of TERT6-7 primer probe

[0058] Since the variable splicing of TERT mRNA mainly occurs at the 6th, 7th, 8th and 11th exons, and the 8th exon is spliced when the 7th exon is spliced, the two exons are regarded as a whole, the 8th exon is determined by detecting the 7th exon, and the 6th exon and the 7th and 8th exons are determined by detecting the 6th exon and the 7th and 8th exons, i.e. a specific upstream detection primer TERT6-7 F: gctgtactttgtcaaggtggatgtg (SEQ ID NO: 2) is designed at the variable splicing of the 6th exon, a specific probe TERT6-7 P: cggtatgccgtggtccagaaggccgc (SEQ ID NO: 3) is designed at the constant region of the 6th exon, and a specific downstream detection primer TERT6-7 R: ggctggaggtctgtcaaggtag (SEQ ID NO: 4) is designed at the 7th exon, and if the fluorescence signal of the probe can be detected, it means that the 6th, 7th and 8th exons are contained in the TERT mRNA.

[0059] 2. Design method of TERT 11 primer probe

[0060] A specific detection primer TERT11 F: tgcgtggtgaacttgcggaag (SEQ ID NO: 8) and a probe TERT11 P: cctggtgcggcctgctgctggat (SEQ ID NO: 9) are designed at the 11th exon, and a specific downstream detection primer TERT11 R: gaaggtgagactggctctgatgga (SEQ ID NO: 10) is designed at the 12th exon, and if the 11th exon is spliced, the fluorescence signal cannot be detected.

[0061] 3. Design method of reverse transcription primer TERT rt1

[0062] If the exon 6 and exon 11 are directly detected by the above primer and probe combination to determine the TERT mRNA, it will cause serious bias, because the exon 6 detection primer and probe can detect variant 1 and variant 2 at the same time, and the exon 11 detection primer and probe can detect variant 1 and variant 5 at the same time, and they cannot distinguish incomplete variant 2 and variant 5, therefore, a specific reverse transcription primer TERT rt1: gccggcatctgaacaaaagcc (SEQ ID NO: 1) is designed, that is, a specific reverse transcription primer is designed on the exon 11, only the TERT mRNA containing the exon 11 will be reverse transcribed into cDNA, and then the presence of the exon 6 and the exon 7 is detected by the exon 6 specific primer and probe to indirectly determine the relative expression amount of the full-length TERT mRNA.

[0063] Therefore, by the combination of the TERT specific reverse transcription primer and the exon 6 specific primer and probe, the expression amount of the full-length TERT mRNA can be more accurately detected.

[0064] 4. Design method of hTERT (internal reference gene) primer probe

[0065] The specific detection primer hTERT F: aacgaacgccgcttcctcag (SEQ ID NO: 5) and hTERT R: cagtcccgcacgctcatctt (SEQ ID NO: 6) and the specific probe hTERT P: cctgcagcgagagcttggcatgcttccc (SEQ ID NO: 7) are designed at the constant region of the exon 2 of the TERT mRNA to detect all TERT mRNA, which is used as an internal reference gene to evaluate the relative expression level of the full-length TERT mRNA.

[0066] The design positions of the specific primers and probes of different regions are shown in Figure 2 .

[0067] Example 2

[0068] Preparation method of reverse transcription sample

[0069] 1. RNA extraction and preparation of Random Primer 6 reverse transcription sample and Oligo (dT) 18 Preparation of reverse transcription sample and TERT rt1 reverse transcription sample

[0070] (1) In 6 cm culture dish, HEK293T, SH-SY5Y, HUVEC cells were cultured, when the confluence was 80%~90%, the culture medium was removed, 1 mL TRIzol reagent was added to the cells, vortexed and mixed, and the cells were lysed at room temperature for 5 min;

[0071] 200 μL chloroform was added to the cell lysate, vortexed and mixed thoroughly, and incubated at room temperature for 5 min;

[0072] (2) 4°C, 12000xg centrifugation for 10 min, the supernatant was transferred to a new centrifuge tube, 500 μL isopropanol was added, and mixed evenly by inversion, and incubated at room temperature for 10 min;

[0073] (3) 4°C, 12000xg centrifugation for 15 min, the supernatant was discarded, 800 μL 75% ethanol was added to the tube, and mixed gently by inversion;

[0074] (4) 4°C, 7500xg centrifugation for 5 min, the supernatant was discarded, and 800 μL 75% ethanol was added, and mixed gently by inversion;

[0075] (5) 4°C, 7500xg centrifugation for 5 min, the supernatant was discarded, the empty tube was placed in a closed environment to dry, 100 μL DEPC-treated sterile water was added, and the precipitate was dissolved by blowing, then the RNA concentration was measured by ultramicro UV spectrophotometer;

[0076] (6) Electrophoresis detection was performed with 1xTBE, and the integrity of the RNA was checked. Only RNA that had not been degraded could be used for subsequent experiments;

[0077] (7) The DNA digestion system was configured according to Table 1, and incubated at 37°C for 15 min;

[0078] Table 1 DNA digestion reagent ratio

[0079]

[0080] (8) 1 mL TRIzol reagent was added to the RNA after removing the DNA, and steps (1)~(6) were repeated to extract the RNA again;

[0081] (9) The RNA denaturation system was configured according to Table 2, and incubated at 65°C for 5 min, then quickly placed in ice; TERTrt1 in Table 2 is the reverse transcription primer TERT rt1 in Example 1;

[0082] Table 2 RNA denaturation system ratio

[0083]

[0084] (10) The RNA reverse transcription premix was configured according to Table 3, and then 6 μL was added into the denaturation system configured in Table 2, respectively, mixed uniformly, and then reverse transcribed at 50°C for 60 min, and finally inactivated at 95°C to obtain the Random Primer 6 reverse transcription sample, Oligo(dT) 18 reverse transcription sample and TERT rt1 reverse transcription sample.

[0085] Table 3 RNA reverse transcription system ratio

[0086]

[0087] 2. Construction method of recombinant plasmid pCDNA3.1(+)-hTERT

[0088] The amplification efficiency of primers designed in different regions may be quite different. In order to exclude such errors caused by different amplification efficiencies, a recombinant plasmid pCDNA3.1(+)-hTERT containing the full-length TERT mRNA sequence was designed and constructed, and the errors caused by different amplification efficiencies of primers were corrected by the amplification effect of the recombinant plasmid.

[0089] The construction method of the recombinant plasmid is as follows:

[0090] The SH-SY5Y cell cDNA was used as a template to amplify the full-length TERT upstream primer F: ACCCAAGCTGGCTAGCctctcctcgcggcgcga (SEQ ID NO: 11) and downstream primer R: GGGCCCTCTAGAtttttttcaaaactgaaaaactcatatattcagtattttactcccac (SEQ ID NO: 12). The high-fidelity enzyme of Novozyme was used for amplification (product number P521-D1), and the PCR product was purified using a PCR product purification kit. The pCDNA3.1(+) plasmid (purchased from Wuhan Moliang Biology) was used as a backbone vector, and the Nhe I and Xba I restriction sites were used to cut the PCR product and the pCDNA3.1(+) vector, respectively. After the enzyme cutting was completed, the PCR product was purified and recovered using a PCR product purification kit, and then the target fragment and the cut vector were connected using T4 DNA ligase at a molar molecular ratio of 5:1 overnight, and then transformed, plated and inverted in an LB plate containing ampicillin and cultured overnight. After PCR identification of positive clone colonies, the plasmid was extracted and sent for sequencing, and the pCDNA3.1(+)-hTERT plasmid with accurate sequencing results was used as a recombinant plasmid for standby.

[0091] Example 3

[0092] qPCR detection

[0093] 1. The recombinant plasmid pCDNA3.1(+)-hTERT and TERT rt1 reverse transcription samples were detected by using the hTERT primer probe, TERT6-7 primer probe and TERT11 primer probe in Example 1 respectively. The qPCR reaction system is shown in Table 4 and the reaction procedure is shown in Table 5.

[0094] The concentration of the recombinant plasmid pCDNA3.1(+)-hTERT was 0.3 ng / μL.

[0095] 180 μL of sterile 1x TE solution was added to the TERT rt1 reverse transcription sample and mixed evenly.

[0096] Table 4 qPCR reaction system

[0097]

[0098] Table 5 qPCR reaction procedure

[0099]

[0100] 2. All threshold values (fluorescence intensity) were adjusted to 50 and then the data was exported for relative expression statistical analysis.

[0101] (1) pCDNA3.1(+)-hTERT plasmid detection results

[0102] The amplification results of pCDNA3.1(+)-hTERT are shown in Figure 3 and Table 6. The amplification efficiency of TERT6-7 primer and TERT11 primer was almost the same, but the amplification efficiency of hTERT primer which amplified total TERT mRNA was significantly reduced, because the GC content of the sequence in the 2nd exon was significantly higher than that of the 6th exon and the 11th exon. Therefore, this result was used to eliminate the difference caused by different amplification efficiency in the subsequent sample analysis.

[0103] Table 6 Amplification results of three primers and probe combinations of pCDNA3.1(+)-hTERT

[0104]

[0105] (2) TERT rt1 reverse transcription sample detection results

[0106] The amplification results of the sample after TERT rt1 reverse transcription are shown in Figure 4As shown, the relative expression level of TERT6 in the HEK293T sample accounts for 0.38 times of the total TERT mRNA, and the relative expression level of TERT11 is only 0.046 times of the total TERT mRNA. Our TERT rt1 reverse transcription primer is designed between the upstream primer F and the probe of TERT exon 11, which should theoretically not detect the fluorescence signal of TERT11, but due to the lack of correction function of reverse transcriptase, and the reverse transcription primer has a small chance of binding to other parts of the RNA during annealing, resulting in a small amount of cDNA containing TERT exon 11 in the product, but the amount of these non-specific products is extremely small, which does not affect the accuracy of the detection results;

[0107] The analysis results of SH-SY5Y cell and HUVEC cell samples are shown in Figure 5 and Figure 6 As shown, the relative expression level of TERT6 in the SH-SY5Y cell is about 0.72 times of the total TERT mRNA, and the relative expression level of TERT11 is only 0.022 times of the total TERT mRNA; the relative expression level of TERT6 in the HUVEC cell is about 0.47 times of the total TERT mRNA, and the relative expression level of TERT11 is only 0.071 times of the total TERT mRNA.

[0108] Therefore, it can be judged that using the specific reverse transcription primer of TERT exon 11 for reverse transcription and combining the TERT6-7 primer and probe combination and the hTERT primer and probe combination can effectively distinguish the TERT full-length mRNA and other variants, and can more accurately quantify the expression amount of the telomerase subunit TERT with reverse transcriptase activity.

[0109] In addition, according to the principle of the method, it can also be extended to detect the content and changes of other RNA variants, and provide help for the research of RNA alternative splicing.

[0110] Comparative Example 1

[0111] Random Primer6 reverse transcription sample and Oligo(dT) 18 Reverse transcription sample detection results

[0112] The Random Primer6 reverse transcription sample, Oligo(dT) 18 Reverse transcription sample, reaction system and reaction procedure are the same as in Example 3.

[0113] Random Primer (Random Primer 6) and Oligo(dT) 18The reverse transcription mechanism of reverse transcription primers is different. Random primers can randomly and arbitrarily bind to any part of RNA, whether mRNA, miRNA or LncRNA. Under the action of reverse transcriptase, various cDNAs of different lengths can be produced, including complete cDNA. Oligo(dT) 18 Only binds to mRNA containing Poly(A) sequence. The transcribed cDNA is the complete complementary chain cDNA of all mRNA. These two different products may lead to inconsistent quantitative results. Therefore, the results of the two methods are compared to verify whether the results are reliable.

[0114] The amplification results of HEK293T cell RNA reverse transcribed by random primers (Random Primer 6) are shown in Figure 7 According to the error elimination results of pCDNA3.1(+)-hTERT plasmid in Example 3, after the error caused by the amplification efficiency is deducted by the internal reference, the detection results of total TERT cDNA are used as internal control genes for normalization processing. The results show that the expression amount of TERT exon 11 is much higher than that of exon 6, and the detection results of SH-SY5Y cells and HUVEC cells also show the same results, i.e. the expression amount of TERT exon 11 is much higher than that of exon 6, as shown in Figure 8 and Figure 9 .

[0115] Oligo(dT) 18 The reverse transcription of HEK293T cell RNA, SH-SY5Y cell RNA and HUVEC cell RNA also shows that the expression amount of TERT exon 11 is much higher than that of exon 6, as shown in Figure 10 , Figure 11 and Figure 12 .

[0116] The above results show that whether the sample is reverse transcribed by random primers or oligo(dT) 18 primers, the expression amount of TERT exon 11 is much higher than that of exon 6, which fully shows that different TERT mRNA variants exist in cells, and the total amount of variants containing exon 11 is much higher than that of variants containing exon 6. The position of random primer binding is uncertain, so some easily reverse transcribed regions are more likely to obtain cDNA, while those with more complex secondary structure are more difficult to transcribe into cDNA, resulting in significant differences in detection results of different regions. Oligo(dT) 18Only total mRNA can be detected, and no variant can be distinguished. There is a great error in the method of designing detection primers in the constant sequence region of TERT to indirectly evaluate the activity of telomerase subunit TERT.

[0117] Example 4

[0118] Absolute expression of TERT mRNA detected by qPCR

[0119] 1. Detecting Oligo(dT) of HEK293T with hTERT primer probe in Example 1 18 The reaction system and reaction procedure of reverse transcription sample, TERTrt1 reverse transcription sample and gradient dilution of recombinant plasmid pCDNA3.1(+)-hTERT are the same as those in Example 3. The standard curve is prepared according to the detection results of gradient dilution of recombinant plasmid pCDNA3.1(+)-hTERT, and the absolute quantification of Oligo(dT) 18 The total TERT mRNA expression in reverse transcription sample and TERT rt1 reverse transcription sample. The absolute quantification standard curve formula of hTERT is y = -0.3025x + 12.127, y is Ct value, and x = lg(copy number).

[0120] The detection results are shown in Figure 13 and Table 7, where Std represents the standard of recombinant plasmid pCDNA3.1(+)-hTERT. The results show that the amplification efficiency of hTERT primer probe reaches 100.7%, and the reverse transcription efficiency of TERT mRNA using Oligo(dT) is slightly lower than that of specific reverse transcription primer TERT rt1. The average expression of total TERT mRNA in TERT rt1 and Oligo(dT) 18 After reverse transcription of 293T RNA, TERT rt1 reverse transcription sample and Oligo(dT) 18 The average expression of total TERT mRNA in reverse transcription sample is 272 copies / well and 197 copies / well, respectively.

[0121] Table 7 Amplification efficiency of hTERT primer probe and absolute quantification data of 293T reverse transcription sample

[0122]

[0123] 2. Detecting TERT rt1 reverse transcription sample and Oligo(dT) of HEK293T with TERT6-7 primer probe in Example 1 18The reverse transcription samples and serially diluted recombinant plasmid pCDNA3.1(+)-hTERT were processed using the same reaction system and procedure as in Example 3. A standard curve was constructed based on the results of the serially diluted recombinant plasmid pCDNA3.1(+)-hTERT, and the TERTrt1 reverse transcription sample and Oligo(dT) were calculated. 18 The expression level of TERT mRNA containing TERT exon 6 in the reverse transcription sample. The absolute quantification formula for TERT 6 is y = -0.2829x + 11.472, where y is the Ct value and x = lg (copy number).

[0124] Test results are shown Figure 14 As shown in Table 8, the amplification efficiency of TERT 6-7 primers and probes reached 92.1%, and the reverse transcription efficiency of TERT rt1 was higher than that of Oligo(dT). Using TERT rt1 and Oligo(dT)... 18 After reverse transcription of 293T RNA, the TERT rt1 reverse transcription sample and Oligo(dT) were analyzed. 18 The average expression levels of TERT mRNA containing exon 6 in the reverse transcription samples were 123 copies / well and 100 copies / well, respectively.

[0125] Table 8. TERT 6-7 primer-probe amplification efficiency detection and absolute quantitative data of 293T reverse transcription samples.

[0126]

[0127] 3. Calculate the average expression level of TERT mRNA containing exon 6 to the total TERT mRNA expression level. The ratio of TERT 6 mRNA / hTERT in the TERT rt1 reverse transcription sample is approximately 0.45, which is consistent with that in Example 3. Figure 4 The small differences in the test results indicate that the data obtained using the TERT rt1 reverse transcription primers are more stable.

[0128] The ratio of TERT 6 mRNA / hTERT in the Oligo(dT) reverse transcription sample was approximately 0.51, which is different from that in Comparative Example 1. Figure 10 The large discrepancies in the test results indicate that the test results are unstable.

[0129] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for detecting the expression level of the full-length mRNA of the transcript of the human cell telomerase subunit TERT for non-disease diagnostic purposes, characterized in that, The method comprises the following steps: a reverse transcription primer TERT rt1 is designed according to the 11th exon of the telomerase subunit TERT gene; cDNA is obtained by reverse transcription of the human cell RNA in the sample to be tested using the reverse transcription primer TERT rt1, and the expression levels of the 6th and 7th exons of the telomerase subunit TERT are detected using the cDNA as a template; a standard curve is drawn using a recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript as a standard, and the absolute expression levels of the 6th and 7th exons are calculated according to the equation obtained from the standard curve to obtain the absolute expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript; Or select internal reference gene, using 2 -ΔΔCt Method to calculate the relative expression level of exon 6 and exon 7, get the relative expression level of human cell telomerase subunit TERT transcript full-length mRNA; the nucleotide sequence of the reverse transcription primer TERT rt1 is shown in SEQ ID NO: 1; the primer probe for detecting the 6th and 7th exons comprises an upstream primer TERT6-7 F with a nucleotide sequence shown in SEQ ID NO: 2, a downstream primer TERT6-7 R with a nucleotide sequence shown in SEQ ID NO: 3, and a probe TERT6-7 P with a nucleotide sequence shown in SEQ ID NO:

4.

2. The method of claim 1, wherein, The accession number of the full-length cDNA of the human cell telomerase subunit TERT transcript in NCBI is NM_198253.

3.

3. The method of claim 1, wherein, The internal reference gene comprises the 2nd exon; the primer probe for detecting the 2nd exon comprises an upstream primer hTERT F with a nucleotide sequence shown in SEQ ID NO: 5, a downstream primer hTERT R with a nucleotide sequence shown in SEQ ID NO: 6, and a probe hTERT P with a nucleotide sequence shown in SEQ ID NO:

7.

4. The method of any one of claims 1 to 3, wherein, The human cells comprise at least one of the following: HEK293T cells, SH-SY5Y cells, and HUVEC cells.

5. A test kit for carrying out the method according to any one of claims 1 to 4, characterized in that The reverse transcription primer TERT rt1 and the primer probe for detecting the 6th and 7th exons are included; the nucleotide sequence of the reverse transcription primer TERT rt1 is shown in SEQ ID NO: 1; the primer probe for detecting the 6th and 7th exons comprises an upstream primer TERT6-7 F with a nucleotide sequence shown in SEQ ID NO: 2, a downstream primer TERT6-7 R with a nucleotide sequence shown in SEQ ID NO: 3, and a probe TERT6-7 P with a nucleotide sequence shown in SEQ ID NO:

4.

6. The test kit according to claim 5, characterized in that The primer probe for detecting the internal reference gene and / or the recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript are also included; the primer probe for detecting the internal reference gene comprises an upstream primer hTERT F with a nucleotide sequence shown in SEQ ID NO: 5, a downstream primer hTERT R with a nucleotide sequence shown in SEQ ID NO: 6, and a probe hTERT P with a nucleotide sequence shown in SEQ ID NO:

7. The full-length cDNA of the human cell telomerase subunit TERT transcript has the accession number NM_198253.3 in NCBI.

7. Use of the method according to any one of claims 1 to 4, or of the kit according to claim 5 or 6, for the evaluation of telomerase activity for non-diagnostic purposes.

Images