DNA construct that codes for a fusion protein with at least two enterohemorrhagic escherichia coli antigens, vectors, fusion protein, immunisation methods and vaccines

Abstract

The present invention relates to a DNA construct that codes for a fusion protein comprising at least two enterohemorrhagic Escherichia coli antigens, for example, the antigens Int280, EspB, EspA, Stx2B, EspD, combinations or fragments thereof, vectors, fusion protein, immunisation methods and vaccines. The coded antigens can be fused Int280 and EspB of enterohemorrhagic Escherichia coli, forming a fusion protein with or without a connecting sequence between the two. The fused antigens can show the amino acid sequence SEQ ID No. 3 or SEQ ID No. 4 and are coded by the nucleotide sequence in SEQ ID No. 1 and SEQ ID No. 2. The construct can also comprise a signal sequence and a binding sequence for binding to the membrane of bacteria.

Description

[0001] DNA CONSTRUCTION ENCODING A FUSION PROTEIN WITH AT LEAST TWO ENTEROHEMORRHAGIC ESCHERICHIA COLI ANTIGENS, VECTORS, FUSION PROTEIN, IMMUNIZATION METHODS, AND VACCINES. BACKGROUND Enterohemorrhagic Escherichia coli (EHEC) is a zoonotic pathogen of global importance, capable of causing diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome (HUS) in humans. Within the EHEC pathotype, the main causative agent of disease in humans is serotype O157:H7. HUS is widespread globally and is described as an epidemic disease with a low incidence rate in industrialized countries such as the USA, Canada, and Japan (1-3 cases / 100,000 children under 5 years of age) (Nataro, JP, Clin Microbiol Rev. 11:142-201, 1998). However, in Argentina, the country with the highest annual incidence among those with a registry system (Palermo, MS Expert Rev Anti Infect Ther 7: 697-707, 2009), there are 12-14 cases / 100,000.000 children under 5 years of age, with approximately 500 cases per year. In our country, HUS is considered endemic and has been subject to mandatory reporting since 2000 (Resolution No. 346 / 00 of the Ministry of Health of the Nation). This disease is the leading cause of acute kidney failure in children and the second leading cause of chronic kidney failure. It is also responsible for 20% of kidney transplants in children and adolescents (Rivas, M, Integrated Surveillance Bulletin N560 SE30, 2006). In the period 2004-2010, out of a total of 1245 Shiga toxin-producing E. coli (STEC) strains isolated from cases of HUS (597), bloody diarrhea (353), non-bloody diarrhea (167), healthy carriers (74), and unspecified infections (72), the most frequently found serotype was O157:H7 (74.6% of cases) (Rivas, M, Zoonoses Public Health.2012 Jl:59 Suppl 1:1-90).Ruminants are the most important reservoir of EHEC, particularly cattle, which are considered the main reservoir, with the terminal portion of the rectum being the predominant site of colonization (Naylor S., Infect. Immun., 1505–1512, 2003). Excretion of the bacteria into the environment occurs intermittently through feces (Midgley, S Letters in Applied Microbiology, 32, 307–311, 2001) and occurs for longer periods and with a greater number of bacteria shed in young calves and at weaning than in adult animals. EHEC O157:H7 has been found in dairy and beef cattle, both grazing and feedlot (Fairbrother IM, Rev. Sci. Tech. Off. Int. Epiz, 25, 555–569, 2006; Hussein, S, Journal of Animal Science, 85(13 Suppl), E63-72, 2007; Midgley, S Letters in Applied Microbiology, 32, 307–311, 2001). A high percentage of the national cattle population, as in many other countries, is colonized by E.Shiga toxin-producing coli (STEC) and EHEC. Rates are variable, probably due to differences in detection methods, type of feed, time of year, age of animals, breed, and intermittent excretion (Fernández, D, Letters in Applied Microbiology, 51, 377–382.2010; Fernández D, Journal of Applied Microbiology, 106, 1260–1267.2009; Gioffré A, Veterinary Microbiology, 87, 301–313, 2002; Meichtri L International Journal of Food Microbiology, 96, 189–198, 2004; Mercado E Journal of Veterinary Medicine Series B: Infectious Diseases and Veterinary Public Health, 51, 82–88, 2004; Padola;NL Veterinary Microbiology, 100, 3–9, 2004; Tanaro, JD., Foodborne Pathogens and Disease, 7, 475–477.. 2010). However, this prevalence does not explain the high rate of HUS in Argentina since it can also be found in countries with a much lower incidence of this disease.In humans, infection generally occurs through the consumption of food contaminated with fecal matter containing EHEC. Sources of infection include undercooked beef, unpasteurized milk, dairy products made with unpasteurized milk, horticultural products contaminated through irrigation or fertilizers, and contaminated water. Zoonosis due to EHEC O157:H7 constitutes a serious public health problem. Argentina has the highest incidence of HUS cases worldwide, and cattle are recognized as the main reservoir of the bacteria.Various experimental vaccines have been developed, many of them based on components of EHEC secreted proteins (Esps), Tir and Intimin; O157 lipopolysaccharide and siderophore and porin receptors have also been tested (Van Diemen P, Veterinary Immunology and Immunopathology, 116(1–2), 47–58, 2007). In these trials, antibody responses against the chosen antigens were obtained, but with highly variable results in terms of protection against EHEC. Vaccination with a supernatant containing secreted proteins (EspA, EspB, EspD and intimin) succeeded in reducing the magnitude and duration of EHEC O157:H7 excretion in an experimental inoculation of cattle, although when the experience was expanded and done in the field, a significant reduction of colonization could not be obtained (Potter Vaccine, 22(3–4), 362–369., 2004; Van Donkersgoed, J, Canadian Veterinary Journal, 46(8), 724–728 2005).A vaccine containing siderophore and porin receptors has also been tested in cattle in trials with experimental infection and under natural feedlot conditions (Thomson DU Foodborne Pathogens and Disease, 6(7), 871–877, 2009; Thornton Journal of Food Protection, 72(4), 866–869, 2009). This vaccine, (Escherichia coli Bacterial Extract Vaccine with SRP®, Zoetis, LLC, Florham Park, New Jersey), is composed of siderophore and porin receptors, has conditional approval in the US, and is now manufactured by Vaxxinova (https: / / vaxxinova.us.com / cattle / e-coli-o157 / ). The Econiche® vaccine combined proteins produced by the type III secretion system (SSTT) Esps and Tir with the VSA3 adjuvant; its production was discontinued in 2015. Patent document WO9740177A1 discloses the production of the intimin antigen or others from EHEC in plants or microorganisms.US patent 8858930B2 discloses live, attenuated enterohemorrhagic Escherichia coli (EHEC) bacteria that have a deletion in the sequence encoding Shiga toxin. Patent WO / 2013 / 164334 discloses a secreted type III bacterial protein, nucleic acid, or composition against E. coli for application in a ruminant or monogastric mammal, particularly cattle, sheep, goats, pigs, and horses. Patent WO / 2010 / 115278 describes compositions and methods for stimulating an immune response against Shiga toxin-producing Escherichia coli antigens. BRIEF DESCRIPTION OF THE INVENTION A DNA construct is provided that encodes a fusion protein comprising at least two antigens of enterohemorrhagic Escherichia coli, for example, the antigens Int280, EspB, EspA, Stx2B, EspD, combinations or fragments thereof.In a preferred embodiment, the antigens encoded are the fused antigens Int280 and EspB of enterohemorrhagic Escherichia coli. In another, more preferred embodiment, the fused antigens display the amino acid sequence SEQ ID No. 3 or SEQ ID No. 4 and are encoded by the nucleotide sequence shown in SEQ ID No. 1 and SEQ ID No. 2. The construct may further comprise a signal sequence, for example, wza, Lpp, InaK-NC, AIDAI, or any other; and membrane anchoring sequences for microorganisms (bacteria), for example, Omp, OmpA, InaK-NC, AIDA-I, or others. The most preferred construction comprises the wza signal sequence linked to the Vibrio anguillarum anchoring sequence (Omp) linked to the sequence encoding the EspB antigen linked to a spacer sequence, linked to the nucleotide sequence encoding the Int280 antigen and is shown in nucleotide sequence SEQ ID No. 1.Also a preferred construct is one lacking the connector and comprising the signal sequence wza linked to the Vibrio anguillarum anchoring sequence (Omp) linked to the sequence encoding the EspB antigen linked to the nucleotide sequence encoding the Int280 antigen, shown in nucleotide sequence SEQ ID No. 2. A fusion protein comprising at least two enterohemorrhagic Escherichia coli antigens, e.g., the Int280 and EspB antigens, fused with or without a spacer sequence between the two antigens, is provided. In a preferred embodiment, the fusion protein comprises the amino acid sequence SEQ ID No. 3 or the amino acid sequence SEQ ID No. 4. An expression vector expressing a fusion protein comprising at least two enterohemorrhagic Escherichia coli antigens, e.g., the Int280 and EspB antigens, fused with or without a spacer sequence between the two antigens, is provided.In a preferred embodiment, the fusion protein comprises the amino acid sequence SEQ ID No. 3 or the amino acid sequence SEQ ID No. 4. Transformed cells are provided with an expression vector that expresses a fusion protein comprising at least two enterohemorrhagic Escherichia coli antigens, for example, the Int280 and EspB antigens fused with or without a spacer sequence between the two antigens. The cell may be an animal cell, a plant cell, a microorganism, for example, a bacterium, bacterial strains, or yeast. In a preferred embodiment, the cell is enterotoxigenic Escherichia coli and / or Salmonella enterica that expresses on its membrane the fusion protein comprising the amino acid sequence SEQ ID No. 3 or the amino acid sequence SEQ ID No. 4. A vaccine against enterohemorrhagic E. coli is provided, comprising inactivated enterotoxigenic Escherichia coli that expresses on its membrane the Int280 and EspB antigens of E. coli.The vaccine consists of inactivated Salmonella enterica expressing the fused enterohemorrhagic E. coli Int280 and EspB antigens on its membrane, and an adjuvant, which may be ISA206, ISA50, or a dual emulsion adjuvant (CVD). In one embodiment, the fused enterohemorrhagic E. coli Int280 and EspB antigens are shown in the amino acid sequences SEQ ID No. 3 or SEQ ID No. 4. The vaccine may consist of the inactivated bacteria, but it may also consist of membrane vesicles obtained from the bacteria by any known method. Immunization methods are provided whereby an effective quantity of the vaccine, for example, 10, can be administered to an animal. 8 and 10 9CFU. Where the animal is a ruminant, for example, a bovine. DESCRIPTION OF THE FIGURES Figure 1 shows the schematic representation of the DNA construct encoding the fusion protein, comprising from the N-terminal end (left) to the C-terminal end: a signal sequence linked to an anchor sequence (wza-omp) that inserts into the outer membrane (EM) of enterobacteria and orients the rest of the chimeric protein toward the extracellular environment, the EspB antigen, the spacer, and the 280-amino-acid C-terminal end of the intimin antigen (Int280). Figure 2 shows the immune response against the EspB and Int280 antigens separately. The presence of specific IgG was measured in the serum of pregnant cows immunized with EspB-E-Int280 and EspB-Int280 using an indirect ELISA assay. Figure 3 shows: the percentage of calves positive for the detection of EHEC in feces in 3 different samplings (days 0, 45 and 60).The bars indicate the percentage of positive animals relative to the total number in each group. Control, immunized with EspB-Int280, immunized with EspB-E-Int28. Figure 4 shows the results of a Western blot revealed with anti-His as the first antibody and anti-mouse conjugated with alkaline phosphatase as the second antibody. Lane 1: Escherichia coli ETEC41 transformed with EspB-E-Int280 and induced, Lane 2: E. coli ETEC41 transformed with EspB-E-Int280 without induction, Lanes 3 and 4: E. coli ETEC41, Lane 5: molecular weight marker, Lane 6: polyHis-tagged control protein, Lane 7: Salmonella enterica Dublin. Lane 8: S. enterica dublin transformed with EspB-E-Int280 induced, Lane 9: S. enterica dublin transformed with non-induced EspB-E-Int280. Figure 5 shows: Lane 1: Molecular weight marker; Lane 2: Outer membrane pellet (20000g pellet) of E. coli ETEC41 transformed with EspB-E-Int280; Lane 3: Washing of 20000g pellet of E.E. coli ETEC41 transformed with EspB-E-Int280; Lane 4: supernatant of 20000g of E. coli ETEC41 transformed with EspB-E-Int280; Lane 5: Sonicated pellet (bacterial extract); Lane 6: supernatant of E. coli ETEC41 culture; Figure 6 shows: Lane 1: Outer membrane pellet (20000g pellet) of S. enterica dublin transformed with EspB-E-Int280; Lane 2: washing of 20000g pellet of S. enterica dublin transformed with EspB-E-Int280; Lane 3: supernatant of 20000g of S. enterica dublin transformed with EspB-E-Int280; lane4: Sonicated pellet (bacterial extract) of S. enterica dublin transformed with EspB- E-Int280; lane 5: culture supernatant of S.E. coli ETEC41 transformed with EspB-E-Int280; Lane 6: Molecular weight marker; Figure 7 shows a topological representation of the EspB-E-Int280 fusion protein in the membrane of bacteria transformed with the DNA construct of the invention. Figure 8 shows: Lane 1: Molecular weight marker; Lane 2: E. coli ETEC41 transformed with uninduced EspB-E-Int280; Lane 3: E. coli ETEC41 transformed with induced EspB-E-Int280; Lane 4: E. coli ETEC41 transformed with induced EspB-E-Int280, inactivated with 0.2% formalin for 72 hours at 4°C; Lane 5: Blank; Lane 6: S. enterica Dublin transformed with uninduced EspB-E-Int280; Lane 7: S. enterica dublin transformed with induced EspB-E-Int280; Lane 8: S. enterica dublin transformed with induced EspB-E-Int280, inactivated with 0.2% formalin for 72 hours at 4°C. Figure 9 shows the murine IgG titers against EspB-E-Int280 15 days after the second inoculation.Groups of animals immunized with: adjuvant only (control), 1 µg of each of the separate EspB and Int280 antigens, 2 µg of fusion protein (EspB-E-Int280), 10 µg of fusion protein (EspB-E-Int280), recombinant ETEC for fusion protein; recombinant Salmonella S. enterica Dublin for fusion protein; and recombinant ETEC fusion protein + recombinant Salmonella for fusion protein. The adjuvant used in all immunizations was ISA50. DETAILED DESCRIPTION OF THE INVENTION The present invention solves an existing problem regarding the vaccination of cattle or other ruminants to reduce infections that cause hemolytic uremic syndrome in humans. To date, all vaccines intended for cattle to reduce the incidence of hemolytic uremic syndrome were not applied by the agricultural producer because they increased costs and, fundamentally, offered no benefit to the livestock.In this respect, the vaccine of the invention is broadly immunogenic against enterohemorrhagic Escherichia coli, and more importantly, it is highly immunogenic against bovine pathogens, such as enterotoxigenic Escherichia coli (ETEC) and Salmonella enterica. In this way, the producer immunizes their animals against common livestock infections and also provides a benefit to humans by significantly reducing the bacteria responsible for hemolytic uremic syndrome. In a preferred embodiment, vaccine compositions are presented comprising inactivated bacterial suspensions of enterotoxigenic Escherichia coli (ETEC) and Salmonella enterica Dublin serotype, both carrying antigenic virulence factors specific to enterohemorrhagic Escherichia coli.Inactivated ETEC and Salmonella bacteria express a fusion protein on their surface comprising at least one outer membrane anchoring sequence, the EspB protein, and the C-terminal third of Intimin gamma (Int280), the latter two connected or not by a spacer sequence. Definitions: The fusion protein is defined as the EspB protein covalently linked by peptide bonds to the C-terminal third of Intimin gamma (Int280). The EspB and Int280 proteins, which exist as separate protein molecules in wild-type strains, are contiguous in the fusion protein.When directly connected, the resulting structure is called EspB-Int280, and when connected via a spacer (E), it is called EspB-E-Int280. Cloning, purification, and antigenicity assays were performed on different EHEC antigens to evaluate their immunogenicity: EspA, EspB, and EspD, which correspond to secretory proteins of the EHEC type III secretion system; the 280aa C-terminal fragment of Intimin gamma (Int280); and the B subunit of Shiga toxin type 2 (Stx2B). Table 1 shows the antigenicity results in immunized cows. *Experiments performed according to Example 8 ** Experiments performed according to Example 9. *** Experiments performed according to Example 10. For example, antigens can be found in: Int280 ACCESSION AIG71088 https: / / www.ncbi.nlm.nih.gov / protein / AIG71088.1 EspB ACCESSION AAG58818 https: / / www.ncbi.nlm.nih.gov / protein / AAG58818.1 EspA ACCESSION AAG58820 https: / / www.ncbi.nlm.nih.gov / protein / AAG58820.1 EspD ACCESSION AAG58819 https: / / www.ncbi.nlm.nih.gov / protein / AAG58819.1 Stx2B ACCESSION NP_859391 Based on these results, the EspB and Int280 antigens were selected. However, any of the immunogenic proteins or antigens of EHEC, for example, and without limitation, EspA, EspD, or Stx2B, fall within the scope of the present invention. Note that in Table 1, all of them are immunogenic. Preferably, the proteins or antigens are: Int280, EspB, EspA, Stx2B, or EspD, or parts thereof.More preferably, the proteins are EspB, Int280, or parts thereof. In a preferred embodiment, the chimeric or fusion protein comprises the EspB and Int280 antigens, with or without a spacer between them. A construct (SEQ ID No. 1) was obtained and cloned into an expression vector under the control of an inducible promoter. In a preferred embodiment, the expressed fusion protein comprises a signal amino acid sequence, an amino acid sequence from an outer membrane (EM) anchoring protein of enterobacteria that orients the rest of the chimeric protein toward the extracellular environment, the amino acid sequence of the EspB antigen, and the amino acid sequence of the Int280 antigen, with or without a spacer sequence between the two antigens (Figure 1). The DNA construct without the linker sequence is shown in SEQ ID No. 2.The signal sequence can be any bacterial signal sequence, for example, and without limitation, wza, Lpp, InaK-NC, -AIDA-I. The anchoring sequence for the outer membrane of enterobacteria can be any of the known sequences, for example, and without limitation, Omp, OmpA, -InaK-NC, AIDA-I. The EspB-Int280 fusion protein comprises the EspB antigen sequence or parts thereof, the Int280 antigen or parts thereof, and may include a spacer nucleotide sequence of approximately 20 amino acids; in this example, the fusion protein is called EspB-E-Int280. In a preferred embodiment, the construct (SEQ ID No. 1) comprises the wza signal sequence, the Vibrio anguillarum anchoring sequence (Omp), the EspB antigen sequence, the spacer, and the nucleotide sequence encoding the C-terminus of the Int280 antigen.Where Wza corresponds to nucleotide sequences 11 to 82 of SEQ ID No. 1, Omp corresponds to nucleotide sequences 83 to 217 of SEQ ID No. 1, espB corresponds to nucleotide sequences 218 to 1195 of SEQ ID No. 1, the spacer corresponds to nucleotide sequences 1196 to 1258 of SEQ ID No. 1, and Int280 corresponds to nucleotide sequences 1259 to 2095 of SEQ ID No. 1. The fusion proteins were named EspB-E-Int280 and EspB-Int280 with and without spacer, respectively. Pregnant cows were immunized with both fusion proteins (EspB-Int280 and EspB-E-Int280), and the serum immune response was analyzed. IgG antibodies were able to recognize the original separated proteins EspB and Int280, as shown in Figure 2. The presence of both fusion proteins generated an immune response in the immunized animals.The presence of EHEC bacteria in the feces of calves from immunized cows was also evaluated, as shown in Figure 3, where a significant reduction in the amount of EHEC excreted in the feces can be observed. The results shown in Figure 3 suggest that the reduction in EHEC excretion is due to the presence of serum and mucosal IgG directed against the fusion protein antigens (EspB and Intimin). The calves showed a reduction in the amount of EHEC excreted in their feces (Figure 3). EspB-E-Int280 fusion protein expression experiments were carried out in E. coli ETEC41 and S. enterica dublin strains. For this purpose, E. coli ETEC41 and S. enterica dublin strains were transformed by electroporation with an expression vector containing the nucleotide sequence SEQ ID No. 1.The expression of the EspB-E-Int280 fusion protein in the transformed strains can be seen in Figure 4 by Western blot, where both strains express the fusion protein. The expression of both fusion proteins and their presence in the outer membrane of the transformed bacterial strains were studied. To this end, the outer membrane of the transformed ETEC and S. dublin strains was isolated by differential centrifugation and ultracentrifugation, and the fusion protein was detected. Cytoplasmic, membrane, and outer membrane fractions were isolated. An SDS-PAGE followed by Western blot was performed using bovine serum specific against EHEC antigens as the first antibody (Ab) and anti-bovine Ab conjugated with HRP, as shown in Example 7.The results are shown in Figures 5 and 6, where a band corresponding to the molecular weight (MW) of the EspB-Int280 fusion protein (66 kDa) can be observed in the final pellet obtained after performing the outer membrane isolation protocol. Bovine serum recognized the protein in the fraction corresponding to the pellet obtained after centrifuging the sonication product. Finally, bovine serum did not recognize any protein in the supernatants, indicating that the fusion protein is expressed exclusively in the outer membrane. Based on these results, Figure 7 shows the possible topology of the fusion protein in the membrane of the transformed bacteria. The transformed E. coli ETEC41 and S. enterica Dublin strains were inactivated with formalin.The results are shown in Figure 8, where it can be observed that inactivation did not affect the expression level or integrity of the EspB-E-Int280 fusion protein. Although the bacterial strains could be inactivated under different conditions (see Table 3), the one with the lowest percentage of formaldehyde and the longest inactivation time was chosen because it was found to degrade the bacterial proteins less. Mice were vaccinated with the EspB-E-Int280 fusion protein; with the individual EspB and Int280 proteins combined; with the transformed E. coli ETEC41 strain expressing EspB-E-Int280; with the transformed S. enterica Dublin strain expressing EspB-E-Int280; and with both transformed bacterial strains combined. The humoral response was determined using an indirect ELISA assay by plating the EspB-E-Int280 fusion protein.It was observed that the humoral response of mice immunized with the EspB-E-Int280 fusion protein was greater than that of those immunized with the individual EspB and Int280 proteins in a mixture. The same was observed with the inactivated strains E. coli ETEC41 expressing EspB-E-Int280 and S. enterica Dublin expressing EspB-E-Int280, as shown in Figure 9. The transformed ETEC strain expressing the fusion protein can be any strain of E. coli that causes diarrhea in cattle or other mammals, for example, E. coli ETEC41, -H10407 (CFA / I) and E24377A, and others, all of which are within the scope of the present invention. In fact, membrane expression of the fusion protein was tested in different strains, and all of them showed an excellent level of expression. The transformed S. enterica dublin strain expressing the fusion protein can be any strain of S.Enterica Dublin, which causes diarrhea in cattle or other mammals, for example, S. enterica Dublin 98 / 67, - SL1438, HWS 51, Lane -, and all of which are within the scope of the present invention. In fact, the membrane expression of the fusion protein was tested in different strains, and all of them showed an excellent level of expression. The expression of the fusion protein in the membrane of both transformed strains was very high, doubling in the case where the vaccine comprises both strains. Achieving high expression is relevant for generating a strong immune response in vaccinated mammals, which was equivalent to immunization with 100 µg of the purified chimeric protein. An amount such as 100 µg is not applicable by injection and increases the cost and complexity of production, making purification of the product in a bioreactor more difficult. Furthermore, the vaccine of the invention is trivalent; it not only immunizes animals against E.Enterohemorrhagic Escherichia coli (EHEC) not only immunizes animals against EHEC but also against two microorganisms that cause bovine diarrhea: enterotoxigenic Escherichia coli (ETEC) and Salmonella enterica. Mammals, particularly cattle, are a source of enterohemorrhagic E. coli and largely responsible for infecting humans. Enterohemorrhagic Escherichia coli (EHEC) is a zoonotic pathogen of global importance, capable of causing diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome (HUS) in humans, and with a high mortality rate in children under 7 years of age. Immunization of cows during the pre-calving period has been shown to decrease the prevalence of neonatal diarrhea in vaccinated calves. This has resulted in a significant 39.4% reduction in the costs associated with neonatal diarrhea and simplified animal management.Therefore, there is a favorable cost-benefit ratio with the implementation of a vaccine for the prophylaxis of neonatal diarrhea. The vaccine formulated with E. coli ETEC41 and S. enterica Dublin strains expressing the EspB-E-Int280 fusion protein showed high titers against the reference strains enterotoxigenic Escherichia coli (ETEC) and Salmonella enterica Dublin. For ETEC, the assay was performed using an ELISA that detected both fimbriae 5 and the complete bacterium. For Salmonella, an ELISA assay was also performed to determine the immune response against bacterial LPS. An inhibition assay was also performed against the reference Salmonella strain. There is a significant challenge in getting cattle producers to immunize their animals against a bacterium that does not directly affect them. For producers, it is an expense and a problem that offers no advantage.The vaccine of the invention can replace vaccines commonly used in cattle (against bovine neonatal diarrhea) without significant additional cost, but with an added benefit for humans. This invention is best illustrated by the following examples, which should not be interpreted as imposing a limitation on its scope. On the contrary, it should be clearly understood that other embodiments, modifications, and equivalents of the invention may be suggested to those skilled in the art after reading this description, without departing from the spirit of the present invention and / or the scope of the appended claims. Examples Example 1: Gene transformation of bacterial strains Gene synthesis and cloning of the chimeric nucleotide sequence wza-omp-EspB-E-Int280 (Seq ID No. 1) were carried out.The chimeric nucleotide sequence was inserted into the pUC57 vector using its BamHI and HindIII restriction ends. Subsequently, the chimeric nucleotide sequence was cleaved from the pUC57 vector using the BamHI and HindIII restriction enzymes and inserted into the pTrcHis2B vector digested by the same enzymes. The resulting ligation transformed the E. coli DH5 strain. A chimeric variant was also constructed in which the portion corresponding to the EspB-E-Int280 fusion protein lacked a spacer and was named EspB-Int280. Table 2 Plasmids and bacterial strains. Transformation of Salmonella enterica and enterotoxigenic Escherichia coli strains: The strains were cultured separately in LB medium and transformed by electroporation with the vector pTrcHis2B-EspB-E-Int280 or pTrcHis2B-EspB-Int280. The bacteria were selected for ampicillin resistance conferred by the plasmid. All strains in Table 2 were successfully transformed. Example 2: Expression of the EspB-Int280 and EspB-E-Int280 fusion proteins in bacteria. Colonies of E. coli DH5α, E. coli ETEC, and S. enterica dublin transformed with the pTrcHis2B-EspB-Int280 or pTrcHis2B-EspB-E-Int280 plasmid were plated into 5 ml of MINCA broth containing Vitox (E. coli ETEC) and LB (E. coli DH5α and S. dublin) supplemented with ampicillin (100 µg / ml). The cultures were incubated overnight with shaking at 37°C. Then, 250 µl of each culture were inoculated into 25 ml of MINCA broth containing Vitox and LB with ampicillin and cultured with shaking until an OD50 of 25 ml was reached. 6000.6–0.8. They were induced with 1 mM IPTG and left for 4 h under vigorous shaking at 37°C. They were centrifuged (3000 x g, 10 min, 4°C) and the supernatants were discarded. Example 3: Purification of the EspB-E-Int280 fusion proteins: E. coli DH5^ transformed with pTrcHis2B-EspB-Int280 or pTrcHis2B-EspB-E-Int280 was plated in LB broth with ampicillin (100 µg / ml). It was left overnight under shaking at 37°C. 500 µl of the culture were inoculated into 50 ml of LB broth with ampicillin and the cells were allowed to grow under shaking until an OD 6000.6–0.8. The culture was induced with IPTG, then centrifuged, and the supernatant discarded. Lysis buffer (6 M guanidine chloride; 20 mM sodium phosphate; 500 mM NaCl; pH 7.8) was equilibrated at 37°C. The cells were lysed with gentle shaking. The cell lysate was sonicated on ice, then centrifuged, and the pellet discarded. ProBond® resin (an agarose-nickel chelating resin, Invitrogen) was used to purify the EspB-Int280 and EspB-E-Int280 fusion proteins. The bacterial lysate was mixed with 2 ml of resin with gentle shaking for 15–30 min at room temperature on a chromatography column. The column was washed with 4 ml of wash buffer (8 M urea, 20 mM sodium phosphate, 500 mM NaCl, pH 6). Elution buffer (8 M urea, 20 mM sodium phosphate, 500 mM NaCl) pH 4 was added. To evaluate the purification process, an aliquot was taken at each step and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed.The bands were visualized by staining with Coomassie Blue. Example 4: Immunization of cattle with the fusion proteins EspB-Int280 and / or EspB-E-Int280. Cattle were immunized intramuscularly with the fusion proteins EspB-Int280 and / or EspB-E-Int280, using a one-dose and one-booster regimen. Each vaccine dose contains 100 µg of the fusion protein with the adjuvant ISA206. The animals were divided into 3 groups. Control vaccine: 9 pregnant cows were vaccinated with PBS + ISA206 (50% vol / vol). Vaccine with 100 µg of the EspB-Int280 fusion protein: 10 pregnant cows were vaccinated with EspB-Int280 in PBS + ISA206 (50% vol / vol). Vaccine with 100 µg of the EspB-Int280 fusion protein: 4 pregnant cows were vaccinated with EspB-E-Int280 in PBS + ISA206 (50% vol / vol). Pregnant cows were vaccinated with two doses (day 0 and day 21) approximately 2 months before scheduled calving. Blood samples were taken from the cows on days 0 and 21 after immunization.The presence and quantity of IgG against EspB and C-terminal Int280 were determined by indirect ELISA. Three fecal samples were taken from cows on days 0, 45, and 60 to analyze for the presence of EHEC O157:H7. Bovine serology: ELISA: Serum samples were analyzed to detect the presence and titer of IgG antibodies generated against the proteins (Int280 and EspB). The wells of a 96-well MaxiSorp (Nunc, Denmark) optically clear, flat-bottomed, polystyrene microtiter plate were covered with 100 μl of the purified recombinant protein (0.5 μg) in PBS. The plates were incubated overnight at 4°C. Nonspecific sites in the wells were blocked with a blocking solution (PBS-5% skim milk). Serial dilutions of the serum samples were prepared in PBST. Positive and negative controls were also prepared. 100 μl of each dilution was added to each well and incubated with shaking at room temperature.100 μl of the secondary antibody, anti-bovine IgG conjugated to peroxidase (Cayman Chemical Company, USA), diluted in PBST (1:8000), was added. The mixture was incubated for 1 h with shaking at room temperature. Then, 100 μl of ABTS peroxidase substrate solution (Amresco, USA) at a concentration of 20 mg / m³ with 0.03% H₂O₂ was added, and the mixture was incubated until color development at room temperature with shaking. The reaction was stopped with 100 μl of 5% SDS. The optical density was measured at 405 nm (OD405) using a BioTek ELx808 reader (BioTek Instruments, USA). Western blot: Western blot assays were performed to evaluate the presence of IgG antibodies against the EspB and Int280 proteins, the EspB-E-Int280 and EspB-Int280 fusion proteins, and pre- and post-immunization. SDS-PAGE was performed under reducing conditions, loading 2.5 μg of the proteins per well. The proteins were transferred from the gel to a 0.45 μm nitrocellulose membrane (Amersham-Pharmacia).The nitrocellulose membrane was blocked with 5% PBS-skim milk. It was washed with PBST and incubated with the primary antibody, which was serum from cattle immunized with the EspB-Int280 fusion protein, with Int280, or with EspB (1:1000 dilution). It was then washed with PBST and incubated again with the secondary antibody, in this case, peroxidase-conjugated bovine anti-IgG diluted 1:1000 in PBST. Finally, it was developed with DAB / H2O2 (Pierce, USA) according to the manufacturer's instructions. Example 5: Inactivation of the transformed strains ETEC and S. dublin expressing the EspB-E-Int28 fusion protein and vaccine preparation: Both transformed strains (E. coli ETEC41 and S. enterica dublin) were inactivated with 0.2% formalin for 96 h at 4 °C. The bacteria were cultured at 37 °C in MINCA broth with Vitox (E. coli) and LB (Salmonella) to which ampicillin and IPTG (isopropyl-β-D-1-thiogalactopyranoside) were added for the expression of the EspB-E-Int28 chimera.Each culture was then centrifuged at 7000 rpm, and the resulting pellet was resuspended in 0.2% formalin in phosphate-buffered saline, pH 7.4 (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄). This bacterial suspension was incubated at 4 °C for 96 hours (without agitation) to allow for inactivation. Three 100 μL aliquots of the inactivated bacterial suspension were inoculated and cultured at 37 °C on tryptic soy agar plates for one week to confirm loss of viability. Loss of viability was confirmed by the absence of ETEC and Salmonella colonies on the inoculated medium. The E. coli ETEC41 and S. enterica Dublin strains expressing EspB-E-Int280 were subjected to different tests to evaluate their inactivation with the aim of being used as a vaccine.Exploratory inactivation assays were performed using different formalin concentrations (0.2%, 0.8%, 1%, 2%, 3%, and 5%), different incubation times (24, 48, 72, and 120 hours), and different temperatures (4°C, ambient, and 37°C). Bacteria were cultured in media and under conditions necessary for the expression of the EspB-E-Int280 fusion protein. Colonies of E. coli ETEC and S. enterica dublin transformed with the pTrcHis2B-EspB-E-Int280 plasmid were inoculated into 5 ml of MINCA broth containing Vitox (E. coli ETEC) and LB (S. dublin) supplemented with ampicillin (100 µg / ml). The cultures were incubated overnight with shaking at 37°C. Then 250 µl of each culture were inoculated into 25 ml of MINCA broth with Vitox and LB with ampicillin and cultured under shaking until an OD. 6000.6-0.8. They were induced with 1 mM IPTG and left for 4 h under vigorous shaking at 37°C. Subsequently, the cultures were centrifuged at 7000 xg for 10 minutes and the resulting pellet (containing the bacteria) was resuspended in PBS buffer (pH 7.4) with formaldehyde at different concentrations (0.2%, 0.3%, 0.8%, 1%, 2%, 3% and 5%) and different combinations of temperatures and times, after which samples were extracted for confirmation of their non-viability, as shown in the following table: Table 3: Conditions of % of formaldehyde, temperature and times for the inactivation of the transformed strains To assess the viability of the strains after treatment, 100 μl of the inactivated culture were plated in triplicate onto tryptic soy agar plates and incubated at 37 °C for one week. To confirm the loss of viability, the inactivated bacteria were stored at 4 °C in sterile PBS until use. Example 6: Immunization of mice. Seven groups of mice were used, each consisting of five 3-month-old male BALB / c mice. The mice were immunized subcutaneously (sc) and received an initial dose and a booster dose 15 days later. Blood samples were taken submandibularly on days 15 and 30. The groups were immunized as follows: Group 1: control, PBS + Group 2: 1 µg of EspB antigen + 1 µg of Int280 antigen Group 3: 2 µg of EspB-E-Int280 fusion protein Group 4: 10 µg of EspB-E-Int280 fusion protein Group 5: 10 8 CFU of transformed E. Coli ETEC expressing inactivated EspB-E-Int280 Group 6: 108 CFU of transformed S. enterica dublin expressing inactivated EspB-E-Int280 Group 7: Transformed E. Coli ETEC41 expressing EspB-E-Int280 + transformed S. enterica dublin expressing EspB-E- Int280, both inactivated at an amount of 10 8CFU of each strain. In all cases, 50% v / v ISA50 adjuvant was used. Example 7: Subcellular localization: Isolation of outer membrane and detection of the EspB-E-Int280 fusion protein. Starting with 10 ml of bacterial culture, 1 ml was taken and centrifuged at 10,000 x g for 2 min. The supernatant was retained, and the pellet was washed with PBS. The supernatants from the washes were pooled and retained. The pellets were resuspended in 1.5 ml of Tris-HCl-NaCl buffer pH 8.0 (50 mM, 0.3% NaCl / PR). They were sonicated for 5 minutes on ice. They were centrifuged at 10,000 x g for 5 minutes. The pellet containing cell debris was retained. The supernatant was centrifuged at 20,000 x g at 4°C for 1 hour. The supernatant containing the inner membrane was retained. The pellet was resuspended in 0.4 ml of HEPES buffer pH 7.4 (10 mM, with 1% sodium N-laurylsarcosine / PR). It was ultracentrifuged at 20,000 x g at 4°C for 1 hour.The supernatant containing the inner membrane fragments and the pellet containing the outer membrane were preserved. Example 8: Method for evaluating the recognition frequency of the antigens in Table 1 by bovine sera. Cattle were immunized with EspB, Int280, EspA, Stx2B, or EspD proteins using a one-dose and one-booster regimen. Each animal was injected intramuscularly with a formulation containing 100 µg of the recombinant protein with the adjuvant ISA206. The bovine humoral immune response against these antigens was measured by ELISA. Example 9: Evaluation of the recombinant expression level of cloned antigens. The EspB, Int280, EspA, Stx2B, or EspD genes were cloned into the pRSET-A expression vector; E. coli BL21 was transformed with the resulting constructs. Colonies of E. coli BL21pRSET-A (espB), pRSET-A (int280), pRSET-A (espA), pRSET-A (stx2B), or pRSET-A (espD) were plated in LB medium supplemented with Ampicillin (100 µg / ml).Cultures were induced with 1 mM IPTG and left for 4 h under vigorous shaking at 37°C. They were centrifuged (3000 x g, 10 min, 4°C) and the supernatants were discarded. The expression level was monitored by PGE SDS and Coommassie blue staining and Western blot revealing anti-6xHis. Example 10: Presence of the genes in EHEC. By presence analysis using the Artemis software of the five genes in 10 sequenced strains. Stx2b has subtypes that sometimes signify amino acid substitutions. Example 11: Preparation of the vaccine with the strains and the adjuvant. Among 10. 8 and 10 9 CFU (inactivated) of S. enterica dublin (EspB-E-Int280), between 10 8 10 9CFU (inactivated) of E. coli ETEC41 (EspB-E-Int280), in PBS (phosphate buffer saline) and ISA206 adjuvant (50% vol / vol) Example 12: measurement of immune activity of strains producing diarrhea Performed in agreement with Walt-Towner-Towner D., Martin SW, Meek AH, McMillan I., Crouch CF Can J Comp Med.1985;49(1):1–9 y Kohara J., Hirai T., Mori K., Ishizaki H., Tsunemitsu H. J Vet Med Sci 1997;59(11):1025–1025.doi. 10.1292 / jvms.59.1023).

[0002] SEQUENCE LISTING <110> INTA-Conicet <120> DNA construct encoding a fusion protein with at least two Escherichia coli enterohemorrhagic antigens, vectors, fusion protein, immunization methods and vaccines. <130> 32642 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 2110 <212> DNA <213> Artificial Sequence <220> <223> DNA construction <400> 1 ggatccggcc atggcagtgt caaaaaagta tttgcctttg attatcgcct cagtagtttt 60 aacggggtgc accattccgg gttcacacct acctacaggc gaaaaaaatg ccgcaatcgc 120 actattagca tcttttgct ttggtggcct gcagc 180 agcgtcaacc actggcggag ccgctggcgg cacagcagcg acaacggcag cagtaggtac 240 agtaacggca cggactagtc cgaatactat tgataatact caagtaacga tggttaattc 300 cgcttcggag agtacgaccg gcgctcg tgcatcgc tatcaattga 360 ttcatctctg cttactgatg gtaaggttga tatttgtaag ctgatgctgg aaattcaaaa 420 actcctcggc aagatggtga ctctattgca ggattaccaa caaaaacaat tggcgcaaag 480 ctatcagatt cagcattgacg ttccatgaatag gctattgaggaaaaaaaagc 540 cgcggcaacc gctgctttgg ttggcgggat tattcatca gcattgggga tcttaggttc 600 ttttgcagca atgaacaacg cggctaaagg ggctggtgag attgctgaaa aagcaagctc 660 tgcatcttca aaggctgctg gtgcggcttc tgaggttgca aataaagctc tggtcaaggc 720 tacggaagt gttgctgatg tcgcagagga ggcatccagt gcgatgcaga aagcgatggc 780 cacaacaacg aaagcagcca gccgtgcatc tggcgttgca gatgatgttg cgaaagcctc 840 tgactttgct gaagatcttg cagacgccgc cgagagaca agcagaatca ataagttgtt 900 gaatccgta gataaactga ccaataccac agcatttgtt gccgtgacca gtcttgctga 960 aggtacgaaa acgttgccaa caacaatatc tgagtccgtc aaatcgactc atgaggttaa 1020 tgaacaacgt gcgaagtcgc tggaaaactt ccagcagggg aatctggagc tgtataaaca 1080 agacgttcgc agaacgcagg atgatatcac gactcgtctg cgtgatata cgtccgctgt 1140 ccgcgatctc cttgaggtcc agaatcgtat ggggcaatcg ggtcgcttag ctggggaagc 1200 cgccgccaaa gaagccgccg ccaaagaagc cgccgccaaa gaagccgccg ccaaacaaac 1260 caaggccagc attactgaga ttaaggctga taagacaact gcagtagcaa atggtaagga 1320 tgctattaaa tatactgtaa aagttatgaa aaacggtcag ccagttaata atcaatccgt1380 tacattca acaacttg ggatgttcaa cggtaagtct caacgcaag siaccacgg 1440 aaatgatggt cgtgcgacga taacactaac tccagttcc gccggtaag cgactgttag 1500 tgcgacagtc agtgggattgagggg ttgatgaact 1560 gaaaattgac aaaaggttg atattattgg taacaatgtc agaggcgagt tgcctatatat 1620 ttggctgca tatggtcagt ttaaactgaa agcaagcggt ggtgatggta catattcatg 1680 cataccagcagtcatcatcatg gggaaagtca ctttgaatgg 1740 taaaggcagt gtcgtaatta aagccacatc tggtgataag caacagtaa gttacactat 1800 aaagcaccg tcgtatatga taaagtgga taagcaagcc tattatgctg atgctcaa0 cattaccattc 18 gacggtattg tcagatattt atgactcatg 1920 gggggctgca aaaaata gccattatag ttctatgaac tcaatactg cttggattaa 1980 acagacatct agtgagcagc gttctggagt atcagcact tataaccta taacacaaaagg cctactatgt 20cctacct aaatgtctat gcggtttgtg tagagctt 2100 agagagctt 2110 <210> 2 <211> 1930 <212> DNA <213> Artificial Sequence <220> <223> connector-free DNA construction <400> 2 ggatccggccatggcagtgt caaaaaagta tttgccttg attatcgcct cagtagtttt 60 aacggggtgc accattccgg gttcacacct acctacaggc gaaaaaaatg ccgcaatcgc 120 actattagca tcttttgctt ttggtggcgt agcgatttgct gctgc agcgtcaacc actggcggag ccgctggcgg cacagcagcg acaacggcag cagtaggtac 240 agtaacggca cggactagtc cgaatactat tgataatact caagtaacga tggttaattc 300 cgcttcggag agtacgaccg gcgcttccag tgcatctgcg gcattgc 360 ttcatctctg cttactgatg gtaaggttga tatttgtaag ctgatgctgg aaattcaaaa 420 actcctcggc aagatggtga ctctattgca ggattaccaa caaaaacaat tggcgcaaag 480 ctatcagatt cagttcaggccg ttgagatagaagg aaaaaaaagc 540 cgcggcaacc gctgctttgg ttggcgggat tatttcatca gcattgggga tcttaggttc 600 ttttgcagca atgaacaacg cggctaaagg ggctggtgag attgctgaaa aagcaagctc 660 tgcatctgctgcgct gctgctc tgaggttgca aataaagctc tggtcaaggc 720 tgactttgct gaagatcttg cagacgccgc cgagaagaca agcagaatca ataagttgtt 780 gaattccgta gataaactga ccaataccac agcatttgtt gccgtgacca gtcttgctga 8cttgctgagtccgtc aaatcgactc atgaggttaa 900 tgaacaacgt gcgaagtcgc tggaaaactt ccagcagggg aatctggagc tgtataaaca 960 agacgttcgc agaacgcagg atgatatcac gactcgtctg cgtgatataa cgtccgctgt 1020 ccgcgatctc cttgaggtcc agaatcgtat ggggcaatcg ggtcgcttag ctgggcaaac 1080 caaggccagc attactgaga ttaaggctga taagacaact gcagtagcaa atggtaagga 1140 tgctattaaa tatactgtaa aagttatgaa aaacggtcag ccagttaata atcaatccgt 1200 tacattctca acaaactttg ggatgttcaa cggtaagtct caaacgcaag caaccacggg 1260 aaatgatggt cgtgcgacga taacactaac ttccagttcc gccggtaaag cgactgttag 1320 tgcgacagtc agtgatgggg ctgaggttaa agcgactgag gtcacttttt ttgatgaact 1380 gaaaattgac aacaaggttg atattattgg taacaatgtc agaggcgagt tgcctaatat 1440 ttggctgcaa tatggtcagt ttaaactgaa agcaagcggt ggtgatggta catattcatg 1500 gtattcagaa aataccagta tcgcgactgt cgatgcatca gggaaagtca ctttgaatgg 1560 taaaggcagt gtcgtaatta aagccacatc tggtgataag caaacagtaa gttacactat 1620 aaaagcaccg tcgtatatga taaaagtgga taagcaagcc tattatgctg atgctatgtc 1680 catttgcaaa aatttattac catccacacagacggtattg tcagatattt atgactcatg 1740 gggggctgca aataaatata gccattatag ttctatgaac tcaataactg cttggattaa 1800 acagacatct agtgagcagc gttctggagt atcaagcact tataacctaa taacacaaaaa 1860 ccctcttcct ggggttaatg ttaatactcc aaatgtctat gcggtttgtg tagaagctct 1920 agagaagctt 1930 <210> 3 <211> 703 <212> PRT <213> Artificial Sequence <220> <223> Protein fusion with connector <400> 3 Asp Pro Ala Met Ala Val Ser Lys Lys Tyr Leu Pro Leu Ile Ile Ala 1 5 10 15 Ser Val Val Leu Thr Gly Cys Thr Ile Pro Gly Ser His Leu Pro Thr 20 25 30 Gly Glu Lys Asn Ala Ala Ile Ala Leu Leu Ala Ser Phe Ala Phe Gly 35 40 45 Gly Val Ala Met Ala Ala Val Glu Glu Thr Thr Thr Ala Ser Thr Thr 50 55 60 Gly Gly Ala Ala Gly Gly Thr Ala Ala Thr Thr Ala Ala Val Gly Thr 65 70 75 80 Val Thr Ala Arg Thr Ser Pro Asn Thr Ile Asp Asn Thr Gln Val Thr 85 90 95 Met Val Asn Ser Ala Ser Glu Ser Thr Thr Gly Ala Ser Ser Ala Val 100 105 110 Ala Ala Ser Ala Leu Ser Ile Asp Ser Ser Leu Leu Thr Asp Gly Lys 115 120 125 Val Asp Ile Cys Lys Leu Met LeuGlu Ile Gln Lys Leu Leu Gly Lys 130 135 140 Met Val Thr Leu Leu Gln Asp Tyr Gln Gln Lys Gln Leu Ala Gln Ser 145 150 155 160 Tyr Gln Ile Gln Gln Ala Val Phe Glu Ser Gln Lys Ala Ile Glu 165 170 175 Glu Lys Lys Ala Ala Ala Thr Ala Ala Leu Val Gly Gly Ile Ile Ser 180 185 190 Ser Ala Leu Gly Ile Leu Gly Ser Phe Ala Ala Met Asn Ala Ala 195 200 205 Lys Gly Ala Gly Glu Ile Ala Glu Lys Ala Ser Ser Ala Ser Ser Lys 210 215 220 Ala Ala Gly Ala Ala Ser Glu Val Ala Asn Lys Ala Leu Val Lys Ala 225 230 235 240 Thr Glu Ser Val Ala Asp Val Ala Glu Ala Ser Ser Ala Met Gln 245 250 255 Lys Ala Met Ala Thr Thr Thr Lys Ala Ala Ser Arg Ala Ser Gly Val 260 265 270 Ala Asp Val Ala Lys Ala Ser Asp Phe Ala Glu Asp Leu Ala Asp 275 280 285 Ala Ala Glu Lys Thr Ser Arg Ile Asn Lys Leu Leu Asn Ser Val Asp 290 295 300 Lys Leu Thr Asn Thr Thr Ala Phe Val Ala Val Thr Ser Leu Ala Glu 305 310 315 320 Gly Thr Lys Thr Leu Pro Thr Thr Ile Ser Glu Ser Val Lys Ser Thr 325 330 335 His Glu Val Asn Glu Gln ArgAla Lys Ser Leu Glu Asn Phe Gln Gln 340 345 350 Gly Asn Leu Glu Leu Tyr Lys Gln Asp Val Arg Arg Thr Gln Asp Asp 355 360 365 Ile Thr Thr Arg Leu Arg Asp Ile Thr Ser Ala Val Arg Asp Leu Leu 370 375 380 Glu Val Gln Asn Arg Met Gly Gln Ser Gly Arg Leu Ala Gly Glu Ala 385 390 395 400 Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala 405 410 415 Ala Lys Gln Thr Lys Ala Ser Ile Thr Glu Ile Lys Ala Asp Lys Thr 420 425 430 Thr Ala Val Ala Asn Gly Lys Asp Ala Ile Lys Tyr Thr Val Lys Val 435 440 445 Met Lys Asn Gly Gln Pro Val Asn Asn Gln Ser Val Thr Phe Ser Thr 450 455 460 Asn Phe Gly Met Phe Asn Gly Lys Ser Gln Thr Gln Ala Thr Thr Gly 465 470 475 480 Asn Asp Gly Arg Ala Thr Ile Thr Leu Thr Ser Ser Ser Ala Gly Lys 485 490 495 Ala Thr Val Ser Ala Thr Val Ser Asp Gly Ala Glu Val Lys Ala Thr 500 505 510 Glu Val Thr Phe Phe Asp Glu Leu Lys Ile Asp Asn Lys Val Asp Ile 515 520 525 Ile Gly Asn Asn Val Arg Gly Glu Leu Pro Asn Ile Trp Leu Gln Tyr 530 535 540 Gly Gln Phe Lys Leu Lys AlaSer Gly Gly Asp Gly Thr Tyr Ser Trp 545 550 555 560 Tyr Ser Glu Asn Thr Ser Ile Ala Thr Val Asp Ala Ser Gly Lys Val 565 570 575 Thr Leu Asn Gly Lys Gly Ser Val Val Ile Lys Ala Thr Ser Gly Asp 580 585 590 Lys Gln Thr Val Ser Tyr Thr Ile Lys Ala Pro Ser Tyr Met Ile Lys 595 600 605 Val Asp Lys Gln Ala Tyr Tyr Ala Asp Ala Met Ser Ile Cys Lys Asn 610 615 620 Leu Leu Pro Ser Thr Gln Thr Val Leu Ser Asp Ile Tyr Asp Ser Trp 625 630 635 640 Gly Ala Ala Asn Lys Tyr Ser His Tyr Ser Ser Met Asn Ser Ile Thr 645 650 655 Ala Trp Ile Lys Gln Thr Ser Ser Glu Gln Arg Ser Gly Val Ser Ser 660 665 670 Thr Tyr Asn Leu Ile Thr Gln Asn Pro Leu Pro Gly Val Asn Val Asn 675 680 685 Thr Pro Asn Val Tyr Ala Val Cys Val Glu Ala Leu Glu Lys Leu 690 695 700 <210> 4 <211> 683 <212> PRT <213> Artificial Sequence <220> <223> proteina de fusion sin conector <400> 4 Asp Pro Ala Met Ala Val Ser Lys Lys Tyr Leu Pro Leu Ile Ile Ala 1 5 10 15 Ser Val Val Leu Thr Gly Cys Thr Ile Pro Gly Ser His Leu Pro Thr 20 25 30 Gly GluLys Asn Ala Ala Ile Ala Leu Ala Ser Phe Ala Phe Gly 35 40 45 Gly Val Ala Met Ala Ala Val Glu Glu Thr Thr Thr Ala Ser Thr Thr 50 55 60 Gly Gly Ala Ala Gly Gly Thr Ala Ala Thr Thr Ala Ala Val Gly Thr 65 70 75 80 Val Thr Ala Arg Thr Ser Pro Asn Thr Ile Asp Asn Thr Gln Val Thr 85 90 95 Met Val Asn Ser Ala Ser Glu Ser Thr Thr Gly Ala Ser Ser Ala Val 100 105 110 Ala Ala Ser Ala Leu Ser Ile Asp Ser Ser Leu Leu Thr Asp Gly Lys 115 120 125 Val Asp Ile Cys Lys Leu Met Leu Glu Ile Gln Lys Leu Leu Gly Lys 130 135 140 Met Val Thr Leu Leu Gln Asp Tyr Gln Gln Lys Gln Leu Ala Gln Ser 145 150 155 160 Tyr Gln Ile Gln Gln Ala Val Phe Glu Ser Gln Asn Lys Ala Ile Glu 165 170 175 Glu Lys Lys Ala Ala Ala Thr Ala Ala Leu Val Gly Gly Ile Ile Ser 180 185 190 Ser Ala Leu Gly Ile Leu Gly Ser Phe Ala Ala Met Asn Asn Ala Ala 195 200 205 Lys Gly Ala Gly Glu Ile Ala Glu Lys Ala Ser Ser Ala Ser Lys 210 215 220 Ala Ala Gly Ala Ala Ser Glu Val Ala Asn Lys Ala Leu Val Lys Ala 225 230 235 240 Thr Glu Ser Val AlaAsp Val Ala Glu Glu Ala Ser Ser Ala Met Gln 245 250 255 Lys Ala Met Ala Thr Thr Thr Lys Ala Ala Ser Arg Ala Ser Gly Val 260 265 270 Ala Asp Asp Val Ala Lys Ala Ser Asp Phe Ala Glu Asp Leu Ala Asp 275 280 285 Ala Ala Glu Lys Thr Ser Arg Ile Asn Lys Leu Leu Asn Ser Val Asp 290 295 300 Lys Leu Thr Asn Thr Thr Ala Phe Val Ala Val Thr Ser Leu Ala Glu 305 310 315 320 Gly Thr Lys Thr Leu Pro Thr Thr Ile Ser Glu Ser Val Lys Ser Thr 325 330 335 His Glu Val Asn Glu Gln Arg Ala Lys Ser Leu Glu Asn Phe Gln Gln 340 345 350 Gly Asn Leu Glu Leu Tyr Lys Gln Asp Val Arg Arg Thr Gln Asp Asp 355 360 365 Ile Thr Thr Arg Leu Arg Asp Ile Thr Ser Ala Val Arg Asp Leu Leu 370 375 380 Glu Val Gln Asn Arg Met Gly Gln Ser Gly Arg Leu Ala Gly Gln Thr 385 390 395 400 Lys Ala Ser Ile Thr Glu Ile Lys Ala Asp Lys Thr Thr Ala Val Ala 405 410 415 Asn Gly Lys Asp Ala Ile Lys Tyr Thr Val Lys Val Met Lys Asn Gly 420 425 430 Gln Pro Val Asn Asn Gln Ser Val Thr Phe Ser Thr Asn Phe Gly Met 435 440 445 Phe Asn Gly Lys SerGln Thr Gln Ala Thr Thr Gly Asn Asp Gly Arg 450 455 460 Ala Thr Ile Thr Leu Thr Ser Ser Ser Ala Gly Lys Ala Thr Val Ser 465 470 475 480 Ala Thr Val Ser Asp Gly Ala Glu Val Lys Ala Thr Glu Val Thr Phe 485 490 495 Phe Asp Glu Leu Lys Ile Asp Asn Lys Val Asp Ile Ile Gly Asn Asn 500 505 510 Val Arg Gly Glu Leu Pro Asn Ile Trp Leu Gln Tyr Gly Gln Phe Lys 515 520 525 Leu Lys Ala Ser Gly Gly Asp Gly Thr Tyr Ser Trp Tyr Ser Glu Asn 530 535 540 Thr Ser Ile Ala Thr Val Asp Ala Ser Gly Lys Val Thr Leu Asn Gly 545 550 555 560 Lys Gly Ser Val Val Ile Lys Ala Thr Ser Gly Asp Lys Gln Thr Val 565 570 575 Ser Tyr Thr Ile Lys Ala Pro Ser Tyr Met Ile Lys Val Asp Lys Gln 580 585 590 Ala Tyr Tyr Ala Asp Ala Met Ser Ile Cys Lys Asn Leu Leu Pro Ser 595 600 605 Thr Gln Thr Val Leu Ser Asp Ile Tyr Asp Ser Trp Gly Ala Ala Asn 610 615 620 Lys Tyr Ser His Tyr Ser Ser Met Asn Ser Ile Thr Ala Trp Ile Lys 625 630 635 640 Gln Thr Ser Ser Glu Gln Arg Ser Gly Val Ser Ser Thr Tyr Asn Leu 645 650 655 Ile Thr Gln AsnPro Leu Pro Gly Val Asn Val Asn Thr Pro Asn Val 660 665 670 Tyr Ala Val Cys Val Glu Ala Leu Glu Lys Leu 675 680

Claims

CLAIMS Having thus specifically described and determined the nature of the present invention and the manner in which it is to be carried out, the following are claimed as the exclusive property of the owner:

1. A DNA construct, characterized in that the DNA construct encodes a fusion protein comprising at least two enterohemorrhagic Escherichia coli antigens selected from the group consisting of Int280, EspB, EspA, Stx2B, EspD, combinations and fragments thereof.

2. The construct according to claim 1, characterized in that it encodes the fusion protein comprising the enterohemorrhagic Escherichia coli antigens Int280 and EspB.

3. The construct according to claim 1, characterized in that the enterohemorrhagic Escherichia coli antigens are enterohemorrhagic Escherichia coli O157:H7 antigens. 4.The construct according to claim 1, characterized in that it comprises a signal nucleotide sequence selected from the group consisting of wza, Lpp, InaK-NC, and AIDAI.

5. The construct according to claim 1, characterized in that it comprises a bacterial membrane anchoring nucleotide sequence selected from the group consisting of Omp, OmpA, InaK-NC, and AIDAI.

6. The construct according to claim 2, characterized in that the fusion protein comprises a spacer sequence between the encoded Int280 and EspB antigens.

7. The construct according to claim 1, characterized in that it comprises the signal nucleotide sequence wza linked to the Vibrio anguillarum anchoring sequence (Omp) linked to the sequence encoding the EspB antigen linked to a spacer sequence linked to the nucleotide sequence encoding the Int280 antigen. 8.The construction according to claim 7, characterized in that it comprises the nucleotide sequence shown in SEQ ID No.

1.

9. The construction according to claim 1, characterized in that it comprises the signal nucleotide sequence wza linked to the anchoring sequence of. Vibrio anguillarum (Omp) linked to the sequence encoding the EspB antigen linked to the nucleotide sequence encoding the Int280 antigen.

10. The construct according to claim 9, characterized in that it comprises the nucleotide sequence shown in SEQ ID No.

2.

11. A fusion protein, characterized in that it comprises at least two enterohemorrhagic Escherichia coli antigens.

12. The fusion protein according to claim 11, characterized in that it comprises the Int280 and EspB antigens.

13. The fusion protein according to claim 12, characterized in that it comprises a spacer amino acid sequence between the two antigens.

14. The fusion protein according to claims 12 and 13, characterized in that it comprises the amino acid sequence SEQ ID No.

3.

15. The fusion protein according to claim 12, characterized in that it comprises the amino acid sequence SEQ ID No.

4. 16.An expression vector, characterized in that it comprises the construct of claim 1.

17. A cell transformed with the vector of claim 16.

18. The cell according to claim 17, characterized in that it is selected from the group consisting of enterotoxigenic Escherichia coli and Salmonella enterica.

19. The cell according to claim 18, characterized in that it expresses, anchored to its membrane, a fusion protein comprising the Int280 and EspB antigens of enterohemorrhagic E. coli.

20. The cell according to claim 19, characterized in that it expresses the fusion protein shown in amino acid sequence SEQ ID No.

4.

21. The cell according to claim 19, characterized in that it expresses the fusion protein shown in amino acid sequence SEQ ID No.

3.

22. A vaccine against E.enterohemorrhagic E. coli, characterized in that it comprises inactivated enterotoxigenic Escherichia coli expressing on its membrane the fused Int280 and EspB antigens of enterohemorrhagic E. coli, inactivated Salmonella enterica expressing on its membrane the fused Int280 and EspB antigens of enterohemorrhagic E. coli, and an adjuvant.

23. The vaccine according to claim 22, characterized in that the adjuvant is selected from ISA206, ISA 50 and dual emulsion adjuvant (CVD).

24. The vaccine according to claim 22, characterized in that the fused enterohemorrhagic E. coli Int280 and EspB antigens have the amino acid sequence shown in SEQ ID No.

3.

25. The vaccine according to claim 22, characterized in that the fused enterohemorrhagic E. coli Int280 and EspB antigens have the amino acid sequence shown in SEQ ID No.

4.

26. An immunization method, characterized in that it comprises immunizing an animal with an effective quantity of the vaccine of claim 22.

27. The immunization method according to claim 26, characterized in that it is carried out intravenously, intramuscularly, or subcutaneously.

28. The immunization method according to claim 26, characterized in that it comprises administering to an animal a dose between 10 8 and 10 9CFU.

29. The immunization method according to claim 26, characterized in that the animal is a ruminant.

30. A process for preparing the vaccine of claim 22, characterized in that it comprises the step of: a. mixing in a liquid medium between 10 8 and 10 9 CFU of inactivated Salmonella enterica that expresses the fused Int280 and EspB antigens on its membrane and between 10 8 10 9CFU of inactivated enterohemorrhagic E. coli expressing the fused Int280 and EspB antigens on its membrane; and b. adding a quantity of an adjuvant.

31. A vaccine against enterohemorrhagic E. coli, characterized in that it comprises membranous vesicles of inactivated enterotoxigenic Escherichia coli expressing the fused Int280 and EspB antigens of enterohemorrhagic E. coli on its membrane and membranous vesicles of inactivated Salmonella enterica expressing the fused Int280 and EspB antigens of enterohemorrhagic E. coli on its membrane; and b. adding a quantity of an adjuvant.

Images