Method for preparing t cell with reduced immunogenicity
By using a three-gene knockout method and the CRISPR/Cas9 system to target and knock out TCR, HLA-I, and HLA-II molecules, the problems of low gene knockout efficiency and immune rejection in universal CAR-T cell preparation have been solved. This has enabled efficient and low-cost allogeneic CAR-T cell preparation, improving therapeutic efficacy and safety.
Patent Information
- Application Number
- PCT/CN2025/082054
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-20
- Filing Date
- 2025-03-12
- Publication Date
- 2025-11-27
AI Technical Summary
Existing universal CAR-T cells have problems such as low gene knockout efficiency, large host immune response, and high cost during preparation. In particular, the low knockout efficiency of HLA-II molecules leads to severe immune rejection during allogeneic transplantation.
The three-gene knockout method is used to target and knock out TCR, HLA-I class I gene (such as B2M), and HLA-II class II gene (such as HLA-DRA) of T cells through the CRISPR/Cas9 system to reduce the immunogenicity of cells. Specific sgRNA is used to edit the target sites to ensure high efficiency and low off-target efficiency.
It significantly reduced the immunogenicity of T cells, decreased host cell loss, improved the accessibility and quality control of CAR-T therapy, reduced production and administration costs, and enhanced the applicability of allogeneic CAR-T cells.
Smart Images

Figure PCTCN2025082054-FTAPPB-I100001 
Figure PCTCN2025082054-FTAPPB-I100002 
Figure PCTCN2025082054-FTAPPB-I100003
Abstract
Description
A method of making T cells with reduced immunogenicity
[0001] Related applications
[0002] This application claims priority to Chinese patent application 202410624572.0, filed May 20, 2024, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD
[0003] The present application relates to the fields of genetic engineering and cell biology, in particular, modified T cells (e.g., CAR-T cells), methods of making the same, and related applications. BACKGROUND
[0004] Chimeric antigen receptor T cell (CAR-T) therapy has achieved great success in anti-tumor treatment, especially for hematological malignancies. However, the commercialization of CAR-T is still a long and difficult road. The 9 CAR-T products on the market (3 of which are approved by NMPA) are all autologous CAR-T, and autologous CAR-T therapy has many shortcomings, such as poor patient condition, long interval between collection and reinfusion, difficulty in ensuring production process and quality control, high production and patient drug costs, etc. These factors determine that autologous CAR-T will eventually be replaced by allogeneic CAR-T.
[0005] However, rejection often occurs in biological organisms to xeno- or allografts, mainly because the donor's genes encode antigens that the recipient does not have, which are recognized by the recipient's immune cells and cause rejection, i.e., host versus graft reaction (HVGR). Therefore, universal CAR-T cells were born. Universal CAR-T can reduce the immunogenicity of cells by editing human leucocyte antigen (HLA) molecules, providing support for more patients to effectively treat through CAR-T therapy.
[0006] Nowadays, there are also many companies at home and abroad actively laying out universal CAR-T, but their universal CAR-T products mostly have more or less problems. For example, the UCAR-T product of Allogene company knocks out the CD52 gene, which needs to be combined with alemtuzumab, which will greatly increase the patient's drug costs, and alemtuzumab will cause great damage to the host's hematopoietic and immune system, with unpredictable side effects; the gene knockout method used by China Beiheng Biotechnology is to knock out TRAC and CIITA, reducing the expression of HLA-II molecules, which can avoid the attack of host CD4 T cells, but cannot avoid the attack of host CD8 T cells, and the knockout efficiency of HLA-II is low.
[0007] Accordingly, there is a need in the art for a solution that enables sufficient knockout editing of T cells of allogeneic origin to obtain improved T cells, such as improved universal CAR-T cells. SUMMARY
[0008] The present disclosure provides methods of making T cells with reduced immunogenicity, such as universal CAR-T cells, by a triple-knockout approach. In contrast to previous approaches of knocking out HLA class II molecules by knocking out CIITA, directly knocking out HLA-DRA results in less modification of the cell, while the efficiency of knocking out HLA-DR is significantly higher than that of knocking out CIITA. The sgRNAs used in the triple-knockout of the present disclosure are validated by NGS sequencing to be very low off-target efficiency and very high on-target rate at the targeted sites. By simultaneously knocking out HLA-I and HLA-I class molecules, the immunogenicity of the T cells is greatly reduced, and the loss of the T cells in the host is reduced. Accordingly, the novel universal T cell preparation and its use provided by the present disclosure can maximize the resolution of the cost, accessibility, quality control, and other problems of CAR-T therapy.
[0009] In one aspect, the present disclosure provides a T cell modified to knock out or inactivate three genes, wherein the first gene is a T cell receptor (TCR) encoding gene, the second gene is an HLA class I molecule encoding gene, and the third gene is an HLA class II molecule encoding gene.
[0010] In some embodiments, the TCR encoding gene is a gene encoding TCRa and / or TCRp, the HLA class I molecule encoding gene is a gene encoding beta-2 microglobulin (B2M), and the HLA class II molecule encoding gene is a gene encoding HLA-DRA.
[0011] In some embodiments, the T cell has knocked out or inactivated genes encoding TCRa, B2M, and HLA-DRA.
[0012] In some embodiments, the T cell is a CAR-T cell, optionally a CAR-T cell obtained by engineering a donor-derived T cell with a CAR construct.
[0013] In one aspect, the present disclosure provides a combination of sgRNAs comprising a first sgRNA targeting a TCR encoding gene, a second sgRNA targeting an HLA class I molecule encoding gene, and a third sgRNA targeting an HLA class II molecule encoding gene.
[0014] In some embodiments, the combination comprises a first sgRNA targeting a TCRa constant region encoding gene, a second sgRNA targeting a B2M gene, and a third sgRNA targeting an HLA-DRA gene.
[0015] In some embodiments, the first sgRNA has a recognition sequence selected from any one of SEQ ID Nos: 1-27; the second sgRNA has a recognition sequence selected from any one of SEQ ID Nos: 28-67; and the third sgRNA has a recognition sequence selected from any one of SEQ ID Nos: 68-78.
[0016] In some specific embodiments, the first, second and third sgRNAs have the recognition sequences as shown in SEQ ID NOs: 13, 28 and 73, respectively.
[0017] In some embodiments, the first, second and third sgRNAs further comprise a constant sequence as a frame, for example, the sequence shown in SEQ ID NO: 79.
[0018] In one aspect, the present application provides a system for gene editing of T cells, comprising:
[0019] a combination of the first, second and third sgRNAs disclosed herein or a combination of one or more vectors expressing the sgRNAs; and
[0020] optionally, a nuclease or a nucleic acid encoding the nuclease.
[0021] In some embodiments, the nuclease is capable of inactivating the corresponding targeted gene under the guidance of each sgRNA. The nuclease can be various Cas nucleases commonly used in the art, for example, Cas9, Cas12 nucleases. Specifically, the nuclease can be a Streptococcus pyogenes Cas9 (SpCas9) nuclease.
[0022] In some embodiments, when the system is applied, the nuclease forms a complex with each sgRNA, respectively, so as to exist in the form of RNP.
[0023] In some embodiments, the gene editing system comprises one or more vectors expressing the sgRNAs. The first, second and third sgRNAs can be expressed by the same vector or by separate vectors.
[0024] In some embodiments, the one or more vectors further comprise a nucleic acid encoding the nuclease. In some other embodiments, the one or more vectors expressing sgRNAs do not comprise the nucleic acid encoding the nuclease, i.e., the nucleic acid encoding the nuclease is separate from the vectors expressing sgRNAs.
[0025] The vector can be selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a transposon vector, and a viral vector; optionally, the vector is a viral vector, such as a lentiviral vector, an adenoviral vector, or a retroviral vector.
[0026] In one aspect, the application provides a method of making a T cell (e.g., a CAR-T cell) with reduced immunogenicity, the method comprising knocking out or inactivating three genes in the T cell, wherein:
[0027] the first gene is a T cell receptor (TCR) encoding gene, the second gene is an HLA class I molecule encoding gene, and the third gene is an HLA class II molecule encoding gene;
[0028] More specifically, the first gene is a gene encoding TCRa and / or TCRP, the second gene is a gene encoding beta-2 microglobulin (B2M), and the third gene is a gene encoding HLA-DRA.
[0029] In some embodiments, the method comprises contacting the T cell with a combination of the first, second, and third sgRNAs disclosed herein or components of a system for gene editing, and introducing the combination of sgRNAs or the system into the T cell. The combination of sgRNAs or the system components can be introduced into the T cell by means well known in the art, such as electroporation. Where the system comprises a nucleic acid molecule or vector encoding a nuclease, the method can comprise co-transfecting the cell with a nucleic acid molecule encoding a nuclease (e.g., in the form of mRNA, DNA, or a vector) together with the first, second, and third sgRNAs.
[0030] In some embodiments, the first, second, and third sgRNAs are mixed together (e.g., in equimolar ratios) and incubated with a nuclease prior to the contacting.
[0031] In some embodiments, the method further comprises engineering the T cell to express a chimeric antigen receptor (CAR), thereby making a CAR-T cell. Optionally, this step is performed prior to performing the gene knockout or inactivation.
[0032] In one aspect, the application provides a CAR-T cell made by any one of the methods disclosed herein.
[0033] In one aspect, the application provides a kit comprising in a container a combination of sgRNAs disclosed herein or components of a system for gene editing, such as a combination of sgRNAs, a vector expressing sgRNAs, and a nuclease or a nucleic acid encoding a nuclease.
[0034] In some embodiments, the kit comprises:
[0035] a first sgRNA, a second sgRNA, and a third sgRNA, optionally in separate containers or in the same container; or
[0036] a vector expressing a first sgRNA, a vector expressing a second sgRNA, and a vector expressing a third sgRNA, optionally in separate containers or in the same container; or
[0037] a vector expressing a first sgRNA, a second sgRNA, and a third sgRNA.
[0038] In one aspect, the application provides a pharmaceutical composition comprising a T cell with reduced immunogenicity disclosed herein and a pharmaceutically acceptable carrier.
[0039] In one aspect, the application provides use of a system or combination of sgRNAs as disclosed herein for producing a T cell with reduced immunogenicity.
[0040] In one aspect, the application provides a T cell (e.g., CAR-T cell) made by the methods of the application for use as a medicament. In one aspect, the application provides use of a T cell (e.g., CAR-T cell) made by the methods of the application in the manufacture of a medicament for treating cancer, an autoimmune disease, or an inflammatory disease in a subject, optionally wherein the T cell is allogeneic or autologous to the subject. In one aspect, the application provides a method of treating cancer, an autoimmune disease, or an inflammatory disease in a subject, wherein a T cell (e.g., CAR-T cell) made by the methods of the application is administered. In one aspect, the application provides a T cell (e.g., CAR-T cell) made by the methods of the application for use in treating cancer, an autoimmune disease, or an inflammatory disease in a subject. The cancer can be any cancer suitable for cell therapy such as CAR-T therapy, for example, leukemia including acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL), lymphoma, multiple myeloma (MM), glioma, breast cancer, kidney cancer, liver cancer, esophageal cancer, stomach cancer, pancreatic cancer, prostate cancer, lung cancer, ovarian cancer, colorectal cancer, head and neck cancer, gallbladder cancer, etc. The autoimmune disease or inflammatory disease includes, but is not limited to, graft versus host disease, inflammatory bowel disease, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, aplastic anemia, celiac disease, type 1 diabetes, Graves’ disease, psoriasis, scleroderma, etc.
[0041] In one aspect, the application provides use of a T cell made by the methods of the application in the manufacture of a medicament for organ transplantation. The cell can be a CAR-T cell.
[0042] BRIEF DESCRIPTION OF DRAWINGS
[0043] Figure 1 shows the detection of T cell TCR and HLA-DLA expression using flow cytometry.
[0044] Figure 2 shows the detection of CAR-T positivity rate in T cells.
[0045] Figure 3 shows the exhaustion and activation of triple-knockout CAR-T cells and non-knockout CAR-T cells after incubation with PBMCs in an in vitro simulated HVGR experiment.
[0046] Figure 4A shows the allogeneic CD4 + T cells have reduced reactivity and stronger resistance to triple-knockout CAR-T cells compared to the control group.
[0047] Figure 4B shows the allogeneic CD8 + T cells have reduced reactivity and stronger resistance to triple-knockout CAR-T cells compared to the control group.
[0048] Figure 5 shows the comparison of the killing ability of CAR-T cells on tumor cells in vitro before and after knockout.
[0049] DETAILED DESCRIPTION
[0050] DEFINITIONS
[0051] As used herein, the term "TRAC" refers to the TCR alpha subunit constant region. The main function of the TCR constant region is to mediate immune recognition of T cells by binding to antigen peptide-MHC complexes and activate the immune response of T cells. Studies have shown that mutations in TRAC can lead to the loss of αβ TCR on the surface of T cells.
[0052] As used herein, the "B2M gene" or "beta 2 microglobulin-encoding gene" in humans is a gene located on human chromosome 15 (15q21.1) containing 4 exons. The beta 2M protein exists in the form of membrane protein and free beta 2M, and the membrane protein beta 2M is non-covalently associated with the heavy chain of MHC class I molecules (i.e., human leukocyte antigen class I molecules, HLA-I) on the cell surface as a constant light chain. B2M is involved in the recognition of lymphocytes and target cell surface antigens, so B2M is closely related to histocompatibility. Almost all nucleated cells in the body can synthesize beta 2 microglobulin and attach to the cell surface. The absence of beta 2 microglobulin will cause abnormal polymerization of HLA class I molecules, so that complete functional molecules cannot be formed.
[0053] As used herein, "HLA-DRA" also known as "MHC class II DR alpha" refers to the alpha chain of the HLA class II histocompatibility antigen DR. HLA-DR is a subtype of MHC class II molecules, which are heterodimers composed of an alpha chain and a beta chain anchored in the cell membrane. HLA DRA is a polymorphic cell surface glycoprotein that plays an important role in the intercellular interactions of the immune response. The alpha chain protein is about 33-35 kDa, and its encoding gene contains 5 exons, with exon 1 encoding a leader peptide, exons 2 and 3 encoding two extracellular domains, and exon 4 encoding a transmembrane domain and cytoplasmic tail. The host immune system recognizes HLA mismatches on incoming or transplanted allogeneic cells, thus generating graft rejection. For example, a mismatch in the HLA-II molecules, which are highly expressed on activated T cells, can activate the recipient's allogeneic reactivity CD4 + T cells. Thus, by reducing or knocking out the HLA-DRA expression of donor cells, HLA-II class mismatch can be reduced, making it an attractive target in the field of cell therapy.
[0054] As used herein, the term "Cas9 nuclease" or "Cas9" is an RNA-guided nuclease belonging to the CRISPR / Cas9 gene editing system, including wild-type Cas9 protein or variants or fragments thereof, such as a protein comprising the active DNA cleavage domain of Cas9 and / or the gRNA binding domain of Cas9. As known in the art, Cas9 is a component of the CRISPR / Cas gene editing system, and wild-type Cas9 can target and cleave DNA target sequences under the guidance of gRNA to form a DNA double-strand break (DSB). The DNA cleavage activity of Cas9 depends on two domains: RuvC and HNH, which are responsible for cleaving two strands of DNA, respectively, in which the complementary strand of the guide RNA is cleaved by RuvC domain activity, and the non-complementary strand is cleaved by HNH domain activity. Artificial mutation inactivation of these two domains can be performed as needed to achieve single- or double-strand cleavage, respectively.
[0055] As used herein, the term "guide RNA" or "gRNA" refers to a RNA sequence comprising a guide sequence (also referred to herein as a recognition sequence) and optionally a tracrRNA. A common guide RNA is composed of a crRNA (CRISPR RNA) and a tracrRNA (trans-activating crRNA) sequence that form a complex through partial complementarity, wherein the recognition sequence comprised by the crRNA is sufficiently complementary to a target sequence to hybridize and target the CRISPR complex to the specifically bound target sequence. The term also includes a single guide RNA (sgRNA) that contains features of both the crRNA and the tracrRNA. Typically, the guide sequence of the sgRNA is complementary to a target nucleic acid sequence, responsible for the initial guide RNA / target base pairing. Preferably, the guide sequence of the sgRNA does not tolerate mismatches.
[0056] As used herein, a guide sequence or recognition sequence "specifically recognizes" a target site means that the base complementarity of the guide sequence or recognition sequence in the sgRNA to the sequence of the target site is to at least 85%, preferably at least 90%, more preferably at least 95%, most preferably 100%.
[0057] As used herein, the term "CAR-T cell" refers to a T cell expressing any one of the CAR constructs, or into which a nucleic acid or vector encoding a CAR construct has been introduced. The polynucleotide encoding the CAR construct polypeptide can be introduced into the cell using a variety of methods, or the CAR construct polypeptide can be synthesized in situ in the cell. Methods of introducing polynucleotide constructs into cells are known in the art. In some embodiments, a stable transformation method can be used to integrate the polynucleotide construct into the genome of the cell. In other embodiments, a transient transformation method can be used to transiently express the polynucleotide construct, and the polynucleotide construct is not integrated into the genome of the cell. In other embodiments, a viral-mediated method can be used. The polynucleotide can be introduced into the cell by any suitable method, such as a recombinant viral vector (e.g., retrovirus, adenovirus), liposome, etc. Transient transformation methods include, for example, but are not limited to, microinjection, electroporation, or microparticle bombardment. The polynucleotide can be included in a vector, such as a plasmid vector or a viral vector.
[0058] As used herein, the term "universal CAR-T cell" or "universal allogeneic CAR-T cell" refers to a CAR-T cell that is edited for an antigenic molecule on the surface of the T cell obtained from a donor that is allogeneic to reduce the immunogenicity of the cell in a subject that is different from the donor. The antigenic molecule on the surface of the T cell can be any antigen that is recognized by the immune cells of the subject, such as a human leukocyte antigen, etc.
[0059] CAR-T cell
[0060] The basic principle of chimeric antigen receptor T cell technology (CAR-T) is to obtain T cells from donors and genetically engineer the T cells to express specific tumor antigen receptors in vitro, so that after recognizing tumor-associated antigens or tumor-specific antigens, the T cells can be efficiently activated and proliferate in large numbers, release anti-tumor active molecules, and thus exert a strong tumor-killing effect. After the modified T cells proliferate in vitro, the CAR-T cells are injected into the patient's body, and then attack cancer cells expressing specific antigens.
[0061] The key to CAR-T therapy is to engineer T cells using a chimeric antigen receptor (CAR) construct, which generally contains an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. The antigen-binding domain is often derived from an antigen-binding fragment that can recognize and bind to a specific antigen, such as a single-chain antibody variable region (scFv), VHH, or Fab. By selecting the appropriate antigen-binding domain, the cell surface marker of the target cell associated with a specific disease state, such as a tumor, can be recognized. The intracellular signaling domain is used to transmit effector signals and guide cells to perform specialized functions (such as cytolytic activity or helper activity, including secretion of cytokines), which generally contains a primary signaling domain and a costimulatory signaling domain. The primary signaling domain refers to a protein portion that can regulate the primary activation of the TCR complex in a stimulatory manner or in an inhibitory manner. The primary signaling domain that acts in a stimulatory manner usually contains a signaling motif known as an immunoreceptor tyrosine-based activation motif (ITAM). The costimulatory signaling domain refers to the intracellular signaling domain derived from a costimulatory molecule. The costimulatory molecule is a cell surface molecule other than an antigen receptor or Fc receptor that provides a second signal required for efficient activation and function of T lymphocytes after binding to an antigen.
[0062] The present application is not particularly limited as to the CAR construct for engineering T cells and the antigen to which it is designed to bind. The antigen to which the CAR construct binds can be selected from a variety of tumor-associated antigens or tumor-specific antigens or other immune disease-associated antigens. By way of example and not limitation, the CAR construct can be designed to recognize any one of the antigens selected from the group consisting of CD3, CD19, CD20, 4.1BB (CD137), OX40 (CD134), CD16, CD47, CD22, CD33, CD38, CD123, CD133, CEA, cdH3, EpCAM, epidermal growth factor receptor (EGFR), EGFRvIII, HER2, HER3, dLL3, BCMA, Sialyl-Lea, 5T4, ROR1, mesothelin, folate receptor 1, VEGF receptor, HER2 / neu, HER3 / neu, G250, CEA, MAGE, VEGF, FGFR, alphaVbeta3-integrin, HLA, HLA-DR, ASC, CD1, CD2, CD4, CD5, CD6, CD7, CD8, CD11, CD13, CD14, CD21, CD23, CD24, CD28, CD30, CD37, CD40, CD41, CD44, CD52, CD64, c-erb-2, CALLA, MHCII, CD44v3, CD44v6, p97, gangliosides GM1, GM2, GM3, GD1a, GD1b, GD2, GD3, GT1b, GT3, GQ1, NY-ESO-1, NFX2, SSX2, SSX4 Trp2, gp100, tyrosinase, Muc-1, telomerase, survivin, G250, p53, CA125 MUC, Lewis Y antigen, HSP-27, HSP-70, HSP-72, HSP-90, Pgp, MCSP, EpHA2, GC182, GT468 or GT512, IL-17, IL-20, IL-13, and IL-4.
[0063] In some embodiments, the CAR construct comprises an antigen binding domain in the form of a scFv. In some other embodiments, the CAR construct comprises an antigen binding domain in the form of a VHH.
[0064] In some embodiments, the primary signaling domain of the CAR construct contains an ITAM derived from a member selected from the group consisting of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD3 zeta, CD22, CD79a, CD79b, and CD66d.
[0065] In some embodiments, the co-stimulatory signaling domain of the CAR construct is derived from a co-stimulatory molecule selected from CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD270 (HVEM), CD278 (ICOS), DAP10.
[0066] In some embodiments, the CAR construct further comprises a linker sequence or a connecting domain between the antigen binding domain and the transmembrane domain and / or between the transmembrane domain and the intracellular signaling domain.
[0067] Engineered CAR-T cells can be obtained by transfecting T cells with a virus comprising a CAR coding sequence. In some embodiments, the viral bodies used for transfection are produced by transfecting cells with a plasmid encoding the CAR construct and a viral packaging plasmid. In some other embodiments, engineered CAR-T cells are obtained by transfecting immune cells with an expression vector of the CAR construct. CAR-T cells that can be used for CAR construct engineering are T lymphocytes, including thymocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, or activated T lymphocytes. The T cells can be T helper (Th) cells, such as T helper 1 (Thl) or T helper 2 (Th2) cells. The T cells can be helper T cells (HTL; CD4 T cells), cytotoxic T cells (CTL; CD8 T cells), CD4 CD8 T cells, or any other T cell subpopulation. In some embodiments, the T cells can include naive T cells and memory T cells.
[0068] In some embodiments, the T cells used for engineering are isolated from peripheral blood mononuclear cells (PBMCs). Isolation of various cell fractions from PBMCs is well known to those skilled in the art. In some embodiments, the peripheral blood mononuclear cells are isolated from a subject in need of administration of a CAR-T cell therapy or a healthy donor different from the subject. The T cells include any type of T cells, such as cytotoxic T lymphocytes and regulatory T cells.
[0069] T cells with reduced immunogenicity
[0070] Biological organisms generally reject xenografts or allografts, including allogeneic CAR-T cells, primarily because the donor's genes encode antigens that the recipient does not have, which are recognized by the recipient's immune cells and cause rejection, a host versus graft reaction. Universal CAR-T (UCAR-T) cells have been developed that have reduced cellular immunogenicity, thereby providing support for more patients to be effectively treated by CAR-T therapy.
[0071] The general design principle of universal CAR-T cells is to destroy the TCR genes, HLA class I genes, and / or HLA class II genes of allogeneic T cells by gene editing after the generation of CAR-T cells from allogeneic donors, so that the resulting T cells cannot recognize allogeneic antigens, thereby effectively eliminating graft versus host disease.
[0072] T cells express T cell receptors (TCRs) on their membrane surface, which are responsible for recognizing antigens presented by major histocompatibility complexes (MHCs, also known as human leukocyte antigen, HLA molecules). Unlike B cell receptors, TCRs cannot recognize free antigens, but can recognize antigenic peptide fragments presented by MHC molecules. Typically, TCRs are glycoproteins on the cell membrane surface in the form of heterodimers of α / β chains or γ / δ chains. The specific binding of T cell receptors to polypeptides presented by MHCs triggers a series of biochemical reactions and activates T cells through numerous co-receptors, enzymes, and transcription factors, promoting their division and differentiation. In allogeneic transplantation, lymphocytes in the graft recognize antigens of recipient cells, trigger an immune response, attack recipient cells, and cause graft versus host disease.
[0073] In some embodiments, the endogenous TCR of the universal CAR-T cells is disrupted or knocked out. For example, by targeting the genomic sequence of the constant region of the endogenous α or β subunit of the TCR, the expression of the TCR can be eliminated, so that the resulting T cells cannot recognize allogeneic antigens.
[0074] In some embodiments, the gene expression of the endogenous HLA class I antigen of the universal CAR-T cells is disrupted or knocked out. Cells expressing allogeneic major histocompatibility complex (MHC)-I can be recognized by CD 8 +T cells recognize and destroy, HLA class I genes (HLA-A, HLA-B, HLA-C) encode MHC-I, so knocking out HLA class I molecules helps allogeneic T cells to survive better in the host body. Beta 2 microglobulin (B2M) is a beta light chain of human leukocyte antigen class I molecules (HLA-I), its main function is to participate in the recognition of lymphocytes and target cell surface antigens, so B2M is closely related to histocompatibility. Almost all nucleated cells in the body can synthesize beta 2 microglobulin, which is attached to the cell surface. The absence of beta 2 microglobulin will cause abnormal polymerization of HLA class I molecules, so that complete functional molecules cannot be formed. In some embodiments, the expression of the B2M gene can be knocked out or disrupted. By knocking out the B2M gene, the HLA-I class molecules in the cell can no longer be expressed, reducing the immunogenicity of the cell, effectively reducing the risk of host versus graft reaction and immune rejection.
[0075] In some embodiments, the gene expression of endogenous HLA class II antigens of the universal CAR-T cells is disrupted or knocked out. HLA class II molecules on the surface of T cells are CD4 + The important target of T helper cell recognition, HLA class II molecules include HLA-DR, HLA-DP, HLA-DQ, HLA-DM, HLA-DO, which are also a class of targets for host cells to recognize allogeneic cells. For example, the expression of the gene encoding HLA DRA, one of the HLA class II alpha chain paralogs, can be knocked out or disrupted, and by knocking out HLA-DRA, the immunogenicity of the transplanted cells can be reduced, effectively reducing the risk of host versus graft reaction and immune rejection.
[0076] In some embodiments, the universal CAR-T cells are CAR-T cells that do not express or express low levels of one or more proteins selected from the group consisting of TCR, B2M, HLA class I, and HLA class II molecules.
[0077] In some embodiments, the universal CAR-T cells are CAR-T cells that do not express or express low levels of one or more proteins selected from the group consisting of TCR, B2M, and HLA-DRA.
[0078] In some embodiments, the universal CAR-T cells are CAR-T cells that do not express or express low levels of TCR, B2M, and HLA-DRA.
[0079] Methods of making T cells with reduced immunogenicity
[0080] Various methods known in the art can be used to construct T cells with TCR-deficient, HLA class I, and / or HLA-II gene-deficient genes. The most commonly used gene editing methods include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas9. In some implementations, T cells with knocked-out TCR, HLA class I, and / or HLA-II genes are constructed using CRISPR / Cas gene editing systems, particularly the CRISPR / Cas9 gene editing system.
[0081] In one aspect, the present invention provides a method for preparing modified T cells, wherein the endogenous β-2 microglobulin (B2M) gene in the T cells is knocked out or inactivated. The modified T cells exhibit reduced cellular immunogenicity due to the knockout of HLA-I class molecules. The B2M gene can be rendered biologically inactive by cleaving a target locus in B2M via Cas9 guided by specific sgRNA, followed by the introduction of DNA sequence insertion or base deletion. In some embodiments, the endogenous B2M gene is inactivated by nucleotide deletion, resulting in complete non-expression of B2M. Preferably, each allele of B2M in the genome (e.g., a diploid genome) is inactivated.
[0082] In one aspect, the present invention provides a method for preparing modified T cells, wherein the gene encoding the α or β subunit constant region of an endogenous TCR in the T cells is knocked out or inactivated. The modified T cells exhibit reduced cellular immunogenicity due to the knockout of the TCR molecule. Biological function can be lost by introducing DNA sequence insertion or base deletion after Cas9 cleavage of the target site in the gene encoding the α or β subunit constant region of the TCR guided by specific sgRNA. In some embodiments, the gene encoding the α or β subunit constant region of the endogenous TCR is inactivated by nucleotide deletion, resulting in complete non-expression of the TCR. Preferably, each allele of the TCR in the genome (e.g., a diploid genome) is inactivated.
[0083] In one aspect, the present invention provides a method for preparing modified T cells, wherein an endogenous HLA-DRA gene in the T cells is knocked out or inactivated. The modified T cells exhibit reduced cellular immunogenicity due to the knockout of HLA-II molecules. The HLA-DRA gene can be rendered biologically inactive by cleaving a target locus in HLA-DRA with Cas9 guided by specific sgRNA, followed by the introduction of DNA sequence insertion or base deletion. In some embodiments, the endogenous HLA-DRA gene is inactivated by nucleotide deletion, resulting in complete non-expression of B2M. Preferably, each allele of HLA-DRA in the genome (e.g., a diploid genome) is inactivated.
[0084] In one aspect, the present application provides a method of making a modified T cell, wherein one or more genes selected from the group consisting of: an HLA-DRA-encoding gene, a gene encoding the constant region of the alpha or beta subunit of a TCR, a B2M-encoding gene, is knocked out or inactivated in the T cell. For example, the plurality of target genes can be rendered biologically nonfunctional by introducing a DNA sequence insertion or base deletion following cleavage of a target site in the corresponding target gene by Cas9 guided by a plurality of specific sgRNAs. The plurality of sgRNAs can include: an sgRNA targeting the constant region of the alpha or beta subunit of a TCR, an sgRNA targeting a B2M gene, an sgRNA targeting HLA-DRA, or any combination thereof.
[0085] The sgRNAs of the application are particularly suitable for CRISPR / Cas mediated oligonucleotide binding and / or editing, wherein the oligonucleotide binding and / or editing is mediated by a complex comprising the sgRNA of the application and a Cas enzyme, which can comprise any suitable Cas enzyme. In certain embodiments, the Cas enzyme is selected from the group consisting of Cas9, Casl2a, Casl2e, Casl2b, Casl2i, Casl2h, Casl2c, Casl2d, Casl2f, Casl2g, Casl2k, Casl2j, Casl3a, Casl3b, Casl3c, Casl3d and Casl4, including any recombinant variant thereof, in particular selected from the group consisting of Cas9, including any recombinant variant thereof. The Cas9 enzyme can be a Streptococcus, e.g. S. pyogenes or Lactobacillus Cas9 enzyme, as described in Briner et al. (2014), the contents of which are incorporated herein by reference, including any recombinant variant thereof. In some embodiments, the Cas nuclease is selected from the group consisting of a Cas9 nuclease and a Casl2 nuclease. The skilled person will understand that the sgRNAs of the application can be used in conjunction with a variety of Cas proteins, and thus for a variety of CRISPR / Cas systems, such as a CRISPR / Cas9 system, a CRISPR / Casl2 system, a CRISPR / nCas9 system, a CRISPR / dCas9 system. The Cas9 protein is a multifunctional protein, with a protein structure comprising a recognition region (REC) consisting of alpha-helices, a nuclease region consisting of a HNH domain and a RuvC domain, and a PAM binding region at the C-terminus. The two important nuclease domains RuvC and HNH can cleave the DNA-complementary and non-complementary strand of the gRNA, respectively, resulting in a blunt-ended DNA double-strand break. The Cas9 protein can be mutated as desired to result in a single-stranded DNA break. Recognition of Cas9 to the target DNA depends on the tracrRNA:crRNA complex and the PAM sequence located downstream of the target site. In some embodiments, the Cas9 protein is a wild-type Cas9. In some embodiments, the Cas9 protein is derived from a S. pyogenes Cas9 protein or a S. aureus Cas9 protein. Preferably, the Cas9 protein can induce a double-strand break at the target site in the target gene.
[0086] Disabling an endogenous target gene can be performed by introducing a Cas nuclease and one or more sgRNAs into a T cell. In some embodiments, a complex of a Cas nuclease and an sgRNA is introduced into a T cell. For example, a Cas nuclease and one or more sgRNAs can be incubated prior to introduction into a T cell. The introduction can be performed by electroporation. In some other embodiments, a coding vector for one or more sgRNAs and a coding vector for a Cas nuclease are introduced into a T cell. In some other embodiments, a coding vector for one or more sgRNAs further comprises a nucleic acid sequence encoding a nuclease.
[0087] The sgRNA comprises a recognition sequence for a target site in a target gene. The recognition sequence is typically designed to be 20 nt. In addition to the recognition sequence, the sgRNA further comprises a constant part as a framework, which can comprise part of crRNA and tracrRNA sequences. The sgRNA has the function of accurately recognizing the sequence of a target gene in the CRISPR / Cas9 gene editing system, the effect of which can affect the efficiency of editing, whether off-target occurs, etc., and even plays a decisive role in the final effect of gene editing. Therefore, designing a reasonable and effective sgRNA is an important basis for realizing gene editing, and selecting a suitable recognition sequence is the core work of sgRNA design. For the designed sgRNA, the best sgRNA can be selected based on specificity score, cleavage efficiency score, potential off-target situation and off-target site information, etc.
[0088] The sgRNAs targeting TCR, HLA class I, and / or HLA class II genes are not limited to those specifically used herein, but any sgRNA known in the art that can be used to knock out or disrupt expression of TCR, HLA class I, and / or HLA class II-encoding genes can be used for gene editing to make universal CAR-T cells. In addition, the sgRNAs described herein can be modified, for example, by thio and / or methoxy modification or other modifications known in the art, to improve the stability of the sgRNA. The sgRNAs described herein can be synthesized by in vitro transcription or by chemical methods.
[0089] In some embodiments, an sgRNA targeting the constant region of the alpha subunit of TCR (also referred to as a TRAC sgRNA) is used. In some embodiments, the TRAC sgRNA comprises a recognition sequence that is a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-27. In some embodiments, the TRAC sgRNA comprises a recognition sequence set forth in SEQ ID NO: 13.
[0090] In some embodiments, a sgRNA targeting B2M (also referred to as B2M sgRNA) is used. In some embodiments, the B2M sgRNA comprises a recognition sequence that is a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 28-67. In some embodiments, the B2M sgRNA comprises a recognition sequence set forth as SEQ ID NO: 28.
[0091] In some embodiments, a sgRNA targeting HLA-DRA (also referred to as HLA-DRA sgRNA) is used. In some embodiments, the HLA-DRA sgRNA comprises a recognition sequence that is a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 68-78. In some embodiments, the HLA-DRA sgRNA comprises a recognition sequence set forth as SEQ ID NO: 73.
[0092] In some embodiments, one or more of a TRAC sgRNA, a B2M sgRNA, and a HLA-DRA sgRNA is used, e.g., a combination of a TRAC sgRNA and a B2M sgRNA, a combination of a B2M sgRNA and a HLA-DRA sgRNA, a combination of a TRAC sgRNA and a HLA-DRA sgRNA, or a combination of all three of a TRAC sgRNA, a B2M sgRNA, and a HLA-DRA sgRNA is used. In some embodiments, a combination of all three of a TRAC sgRNA, a B2M sgRNA, and a HLA-DRA sgRNA is used to disrupt or knock out the TCR gene, the B2M gene, and the HLA-DRA gene in a CAR-T cell. A dual or multiple knock-out universal CAR-T cell will have lower immunogenicity compared to a universal CAR-T cell with a single knock-out, further reducing the likelihood of developing graft versus host disease.
[0093] Evaluation of gene editing effect
[0094] The present application also provides methods for evaluating the editing effect of modified T cells, particularly CAR-T cells. In some embodiments, the method is performed by contacting the modified CAR-T cells with heterologous immune cells, thereby evaluating the resistance of the modified CAR-T cells to the heterologous immune cells (e.g. the degree of activation of the heterologous immune cells and the killing of the CAR-T cells after the contacting). In some embodiments, the immune cells are allogeneic to the CAR-T cells, e.g. the immune cells comprise MHC-I different from that of the CAR-T cells. In some embodiments, the immune cells are isolated from PBMCs of a subject different from the subject from which the CAR-T cells are obtained. In some embodiments, the immune cells are selected from T cells, e.g. cytotoxic CD8 + T cells, CD4 + T cells or natural killer cells.
[0095] In some embodiments, the method is performed by PCR reaction combined with T7E1 enzyme digestion to identify the editing efficiency of one or more genes selected from the group consisting of TCR a or β constant region encoding genes, B2M genes and HLA-DLA genes. The method comprises extracting the genomic DNA of the modified CAR-T cells, designing primers for PCR amplification to obtain PCR products with knockout sites, adding T7E1 enzyme for enzyme digestion, and then performing agarose gel electrophoresis on the reaction products to determine the editing effect by the presence or absence of bands.
[0096] The present application also provides methods for evaluating the tumor killing effect of the knockout CAR-T cells. The method can be performed by incubating the knockout CAR-T cells with tumor cells at a certain ratio, thereby evaluating the killing effect of the knockout CAR-T cells on the tumor cells. In some embodiments, the tumor cells are liver cancer cells, breast cancer cells, kidney cancer cells, lung cancer cells, etc.
[0097] Systems, reagents and kits for gene editing
[0098] In one aspect, provided herein is a modified CAR-T cell prepared by any one of the methods provided herein. Specifically, provided is a T cell with significantly reduced immunogenicity, wherein one or more genes selected from the group consisting of TCR a or β constant region encoding genes, B2M genes and HLA-DLA genes are not expressed or are expressed at a low level. The T cells provided by the present application, e.g. universal CAR-T cells, can effectively reduce the risk of graft versus host disease and immune rejection, thereby improving the therapeutic effect of the T cells.
[0099] In one aspect, provided herein is a pharmaceutical composition comprising any one of the modified T cells provided herein and a pharmaceutically acceptable carrier.
[0100] In one aspect, provided herein is a gene editing system comprising any combination of one or more of a sgRNA targeting a TCRa constant region-encoding gene, a sgRNA targeting a TCRP constant region-encoding gene, a sgRNA targeting a B2M gene, and a sgRNA targeting a HLA-DRA gene, and a nuclease or a mRNA encoding the nuclease.
[0101] In some embodiments, the sgRNA targeting a TCRa constant region-encoding gene has a recognition sequence complementary to a sequence of interest in a TCRa constant region-encoding gene, suitable for inactivating an endogenous TCRa constant region-encoding gene. Specifically, the sgRNA can comprise a recognition sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-27. In some embodiments, the sgRNA targeting a B2M gene has a recognition sequence complementary to a sequence of interest in a B2M gene, suitable for inactivating an endogenous B2M gene. Specifically, the sgRNA can comprise a recognition sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 28-67. In some embodiments, the sgRNA targeting a HLA-DRA gene has a recognition sequence complementary to a sequence of interest in a HLA-DRA gene, suitable for inactivating an endogenous HLA-DRA gene. Specifically, the sgRNA can comprise a recognition sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 68-78. The sgRNAs disclosed herein can additionally comprise a frame sequence as set forth in SEQ ID NO: 79, for example at the 3’ end.
[0102] In some embodiments, the nuclease comprises a Cas nuclease. In some embodiments, the Cas nuclease comprises a Cas9 nuclease.
[0103] The gene editing system of the present application is particularly suitable for performing gene editing in CAR-T cells, particularly simultaneous knockout of three genes.
[0104] Advantages of the present application
[0105] 1) A method for preparing T cells capable of efficiently knocking out TRAC / B2M / HLA-DRA genes is provided.
[0106] 2) The prepared T cells greatly reduce the attack on normal cells in the body of the patient and greatly reduce immunogenicity, and can maximize the attack on host T cells.
[0107] 3) The prepared T cells can maintain high proliferation ability and high tumor cell killing ability.
[0108] 4) Not only can the production and medication costs of CAR-T be greatly reduced, but also the immunogenicity of universal CAR-T can be greatly reduced, the loss of which in the host is reduced, and many difficult problems such as cost, accessibility, quality control of CAR-T treatment are maximized. EMBODIMENT
[0109] The following embodiments are provided to better understand the present application, which are not intended to be limiting.
[0110] Materials and reagents
[0111] Example 1: Preparation of lentivirus
[0112] Synthesize the CAR construct (take the CAR targeting CD70 as an example), and transform and connect it into the PLV vector through enzyme digestion, with the EF-1a promoter upstream of the gene. Transform the vector into DH5a E. coli strain, screen with ampicillin, obtain positive clones, extract plasmids, and identify clones through enzyme digestion to obtain CD70 CAR lentivirus packaging vector.
[0113] 293T cells for virus packaging are cultured in a cell incubator at 37°C, 5% CO2. The culture medium used is DMEM medium containing 10% Gibco fetal bovine serum. One day before formal virus packaging, the cultured 293T cells are passaged in T75 cell bottles at a cell number of 1×10 7 When the 293T cells reach 70-80% confluence and are evenly distributed in the culture bottle, start lentivirus packaging.
[0114] Prepare the plasmid and transfection reagent diluent, vortex to mix the PEI 40K transfection reagent. Prepare two centrifuge tubes, and prepare the plasmid and transfection reagent diluent in the following order, respectively.
[0115] Mix well. Add the diluted transfection reagent (tube 2) to the plasmid DNA solution (tube 1) and mix well immediately. Note that the order of addition is very important. Incubate the transfection mixture at room temperature for 15-20 minutes. Discard the old medium from the flask containing the 293T cells, add 9 ml of fresh DMEM medium, then add the incubated 1 ml transfection mixture, and mix the medium gently by pipetting. Incubate the cells at 37°C in a 5% CO2 incubator for 6 hours. Discard the medium from the flask and add 15 ml of fresh medium.
[0116] Collect the cell culture supernatant 48 hours after transfection, and add 15 ml of fresh medium. Collect the cell culture supernatant 72 hours after transfection, and a total of 30 ml of cell culture supernatant is obtained. Centrifuge at 1000 g for 8 min, and filter the cell debris using a 0.45 μm filter membrane. Transfer the filtrate to an ultracentrifuge tube. Use an ultracentrifuge to centrifuge at 22000 rpm for 1.5 h at 4°C. Use a pipette to remove the supernatant and discard it. Resuspend the virus pellet with 200 μl of X-VIVO medium, transfer it to an EP tube, and store it in a 4°C refrigerator overnight.
[0117] Example 2: Preparation of general CAR-T cells
[0118] Take one cryogenic tube containing 5 x 10 7 PBMC cells from the liquid nitrogen tank, and thaw it in a 37°C water bath. Take a new sterile cryogenic tube and place it in a magnetic stand in advance. Add 1 ml of X-VIVO medium. Take a 15 ml centrifuge tube, and add 4 ml of X-VIVO medium in advance. Transfer the thawed PBMC cells to the 15 ml centrifuge tube, centrifuge (500 g, 5 min), discard the supernatant, and add 50 μl of separation antibody and 800 μl of X-VIVO medium. Incubate for 5 min, add 50 μl of separation magnetic beads, mix well, and add them to the prepared cryogenic tube. Incubate for 3 min.
[0119] After the incubation is complete, take a 15 ml centrifuge tube, add 7 ml of medium, and transfer the cells in the cryogenic tube to the centrifuge tube. Centrifuge at 500 g for 5 min and count the cells. After counting, centrifuge (500 g, 5 min), discard the supernatant, and add 100 μl of activation magnetic beads and 50 μl of medium per 1 x 10 7 cells.
[0120] After resuspending the cells by pipetting several times, incubate them in the incubator for 7 min. Repeat the resuspension and incubation three times. After the incubation is complete, transfer the cells to a 15 ml centrifuge tube at a concentration of 2.0 x 10 6The cells were cultured in T25 bottles at a ratio of 1 x 106cells / ml of medium. After 24 h, the virus vector produced in Example 1 was added at a ratio of MOI = 5, together with polybrene 4 ug / ml and IL-2 20 ng / ml.
[0121] The virus was replaced after 24 h, and the magnetic beads were removed at the same time, and then the electrotransformation knockout operation was started. The electrotransformation solution was prepared: the entire supplement solution was added to the dissolution solution, and the ratio of the dissolution solution to the supplement solution was 4.5:1. An appropriate amount of medium was prepared and placed in the well plate and pre-warmed in the incubator. TRAC-sgRNA (TRAC-KO13), B2m-sgRNA (B2m-KO1), HLA-DRA-sgRNA (HLA DRA-KO6) were dissolved into a solution of 100 nmol / μl. Cas9 and each sgRNA were mixed in an amount of cas9:TRAC-sgRNA:B2m-sgRNA:HLA-DRA-sgRNA = 60 pmol:75 pmol:75 pmol:75 pmol, respectively, and incubated for 10 min.
[0122] Table A: Recognition sequences of TRAC sgRNA, B2m-sgRNA and HLA-DRA-sgRNA (where T is U in RNA)
[0123] In addition to the recognition sequence, the above sgRNA additionally contains a constant sequence as a scaffold at the 3' end of the recognition sequence. The constant sequence is shown in SEQ ID NO: 79: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU.
[0124] After centrifugation to count the cells, 1 x 106 7 The cells were centrifuged again, and resuspended using 200 μl of electrotransformation solution. 20 μl of the resuspended cell solution was added to the RNP. The cell solution was transferred to the strip. The electrotransformation instrument was turned on and the strip option was selected, and the T cell editing program EN113 was used for electrotransformation knockout. The well into which the cell solution had been added was selected, and the T cell editing option was selected. The start button was pressed, and after the electrotransformation was completed, the mixture was transferred to the previously prepared medium and cultured in the incubator. The resulting cells were TRAC-KO / B2m-KO / HLADRA-KO triple knockout CAR-T cells (also referred to as tKO UCAR-T cells).
[0125] Figure 1 shows the TCR / HLA-I / HLA-II knockout efficiency detection results. Figure 2 shows the CAR-T positive rate detection results, in which the CAR-T positive cells reached more than 76%.
[0126] Example 3: In vitro allogeneic experiment
[0127] Graft versus host (GVHD) experiment
[0128] Take one cryopreservation tube containing 5 x 10 7 PBMC cells (from a different donor than the CAR-T cells) from the liquid nitrogen tank, and thaw in a 37°C water bath. Take a clean 15ml centrifuge tube, add 9ml of culture medium, and transfer the thawed cells to the centrifuge tube, centrifuge at 500g for 5min, discard the supernatant, add 10ml of culture medium, and mix thoroughly by blowing. Mix the cell suspension and trypan blue 1:1, measure the cell concentration by a cell counter, and take enough PBMC cells, centrifuge (500g, 5min), discard the supernatant, resuspend the cells with 25ml of culture medium, and transfer them to a T75 cell culture bottle.
[0129] Use the Elekta Infinity linear accelerator to irradiate the PBMC cells with a dose of 20gy, so that the PBMC cells are in a sublethal state. Take 1 x 10 6 PBMC cells that have received radiation as target cells, and take 1 x 10 6 TRAC-KO CAR-T cells as effector cells and incubate with PBMC, and after 12 hours, detect the exhaustion and activation of CAR-T cells by flow cytometry.
[0130] The results are shown in Figure 3. After incubation of the triple-knockout CAR-T cells with PBMC, the exhaustion and activation were lower than those of the unknocked-out CAR-T cells (i.e., mock CART). CD69 is a marker of T cell activation, and is one of the earliest markers to be upregulated after T cell activation. The more CAR-T cells with CD69, the higher the degree of activation. +
[0131] Host versus graft reaction (HVGR) experiment
[0132] Take 5 x 10 7 PBMC from the liquid nitrogen, and thaw in a 37°C water bath. Note that the PBMC taken should be from a different donor than the knocked-out CAR-T cells. Centrifuge the PBMC at 500G for 5min after adding them to preheated 7ml X-VIVO culture medium. Discard the supernatant, and add 50ul of separation antibody and 800ul of X-VIVO culture medium to the cells, and incubate at room temperature for 5min.
[0133] Add 1 ml pre-warmed X-VIVO medium into the cryo tube. Add 50 ul separation magnetic beads into the cells, mix well, and transfer all 900 ul cell solution into the cryo tube, mix again. Put the cryo tube into the magnetic stand, after 3 min, aspirate all cell solution, transfer into pre-warmed 7 ml X-VIVO medium, centrifuge at 500 G for 5 min. Discard the supernatant, resuspend the cells with 10 ml X-VIVO medium, and count the cells. After counting, centrifuge again at 500 G for 5 min.
[0134] Discard the supernatant, resuspend the cells with 100 ul / 1 x 10 7 Add the cells into the pre-warmed X-VIVO medium, resuspend the cells. Mix well, and incubate in the incubator for 7 min. After 7 min, gently blow the cells again, mix the cells and magnetic beads well. Repeat this step twice. Transfer the separated T cells into 2 x 10 7 Add the cells into the pre-warmed X-VIVO medium, resuspend the cells. Mix well, and incubate in the incubator for 7 min. After 7 min, gently blow the cells again, mix the cells and magnetic beads well. Repeat this step twice. Transfer the separated T cells into 2 x 10 6 Incubate in the 37 °C incubator.
[0135] After 48 h of T cell culture, count the cells, centrifuge all cells at 500 G for 5 min, and resuspend with 1 ml pre-warmed X-VIVO, add into the cryo tube. Put the cryo tube into the magnetic stand, after 3 min, aspirate all cell solution, centrifuge at 500 G for 5 min. Discard the supernatant, resuspend the cells with 20 ul / 1 x 10 7 Add the cells into CD8+ positive selection magnetic beads or CD4+ positive selection magnetic beads, and resuspend with 80 ul / 1 x 10 7 Add the cells into X-VIVO medium, mix well. Incubate for 10 min. After incubation, centrifuge at 500 G for 5 min. Discard the supernatant, resuspend with 3 ml X-VIVO medium. Aspirate the cell solution through the Miltenyi LS sorting column, and filter with 10 ml X-VIVO medium. Discard the filtrate, add 3 ml X-VIVO medium, remove the sorting column, and quickly squeeze the piston to obtain CD8+ T cells or CD4+ T cells.
[0136] Use CFSE to stain the sorted CD4+ T cells, centrifuge at 500 G for 5 min after 37 °C staining for 10 min. Discard the supernatant, resuspend with 1 x 10 7 Add the cells into PBS, centrifuge again at 500 G for 5 min. Discard the supernatant, resuspend with 1 x 10 6 Add the cells into X-VIVO medium.
[0137] Take out 5 x 10 5 CD4+ T cells, adjust the volume to 500 ul with X-VIVO medium. Take out 5 x 10 5The knockout CAR-T cells were also adjusted to 500ul with X-VIVO medium. Co-cultured in a 24-well plate with a total volume of 1ml as experimental well 1, and three parallel experimental wells were set up.
[0138] Take out 5x10 5 CD4+T cells were adjusted to 500ul with X-VIVO medium. Take out 5x10 5 The non-knockout CAR-T cells were also adjusted to 500ul with X-VIVO medium. Co-cultured in a 24-well plate with a total volume of 1ml as experimental well 2, and three parallel experimental wells were set up.
[0139] Take out 1x10 6 CD4+T cells were adjusted to 1ml with X-VIVO medium. Cultured in a 24-well plate as a control well, and three parallel experimental wells were set up.
[0140] After 3 days of co-culture, the CD4+T cell+knockout CAR-T cell group (single knockout, double knockout or triple knockout), the CD4+T cell+non-knockout CAR-T cell group, and the CD4+T cell group were respectively stained with CD69+and CD25+antibodies and subjected to flow cytometry analysis. Single knockout (sKO) refers to CAR-T cells knocked out only with TRAC sgRNA, and double knockout (dKO) refers to CAR-T cells knocked out with TRAC sgRNA and B2M sgRNA. As shown in FIG. 4A, by flow cytometry analysis, the prepared triple-knockout CAR-T cells had the highest resistance to allogeneic CD4 + T cells had the highest resistance.
[0141] The sorted CD8+T cells were stained with CFSE, and after staining at 37°C for 10min, centrifuged at 500G for 5min. After discarding the supernatant, 1x10 7 cells / ml of PBS was added, and centrifuged again at 500G for 5min. After discarding the supernatant, 1x10 6 cells / ml of X-VIVO medium was added.
[0142] Take out 5x10 5 CD8+T cells were adjusted to 500ul with X-VIVO medium. Take out 5x10 5 The knockout CAR-T cells were also adjusted to 500ul with X-VIVO medium. Co-cultured in a 24-well plate with a total volume of 1ml as experimental well 1, and three parallel experimental wells were set up.
[0143] Take out 5x10 5CD8+ T cells, adjusted volume to 500ul with X-VIVO medium. Take out 5x10 5 Non-knockout CAR-T cells, also adjusted volume to 500ul with X-VIVO medium. Co-cultured in 24-well plate with total volume 1ml as experimental well 2, three parallel wells for the same experimental well.
[0144] Take out 1x10 6 CD8+ T cells, adjusted volume to 1ml with X-VIVO medium. Cultured in 24-well plate as control well, three parallel wells for the same experimental well.
[0145] After 3 days of co-culture, CD8+ T cells + knockout CAR-T cells group (single knockout, double knockout or triple knockout), CD8+ T cells + non-knockout CAR-T cells group, and CD8+ T cells group were respectively stained with CD69+ and CD25+ antibodies, and flow cytometry analysis was performed.
[0146] The results are shown in Figure 4B. Through flow cytometry analysis, the prepared triple-knockout CAR-T cells had higher resistance than CD8 + T cells + allogeneic CART (alloCART) cells group, CD8 + T cells + single-knockout CART cells group, CD8 + T cells + double-knockout CART cells group had higher resistance to allogeneic CD8 + T cells.
[0147] Example 5. CAR-T cells with triple-knockout (TRAC KO / B2m KO / HLADRA KO ) mediated tumor cell killing
[0148] X-VIVO serum-free cell culture medium was preheated in a 37°C water bath. Prepare well-conditioned 7860-luc, U251-luc and Huh7-luc cells. Before plating, transfer the culture medium in the cultured 7860-luc, U251-luc and Huh7-luc cells into a 15ml centrifuge tube, and rinse the bottom of the culture bottle with PBS, add an appropriate amount of 0.25% trypsin for digestion, see cell suspension, use a pipette to suck the original cell culture supernatant into the culture bottle to stop digestion, blow the cells to disperse them into a 15ml centrifuge tube, centrifuge (400g, 5min) to remove the supernatant. In a 96-well cell culture plate, add 60ul of 3.33x10 5The target cells were 20000 cells, and the effector-to-target ratio E:T was 8:1. Because the amount of medium added was also 60 μl, the cells needed to be adjusted to (160000 / 0.06 / positive rate) cells / ml. Meanwhile, 1:1, 1:2, and 1:4 effector-to-target ratios were sequentially diluted by half (150 μl of cell suspension + 150 μl of X-VIVO serum-free cell culture medium containing 10% FBS). The cell culture plate with the cells was placed in a 37°C, 5% carbon dioxide incubator for 8 h.
[0149] Before the end of the incubation, the reagents in the ONE-Glo Luciferase Assay System kit were taken out of the -20°C refrigerator and placed at room temperature until the reagents were thawed. According to the instructions, the E605A reagent was used to dissolve the E606A powder, and after complete dissolution, the EP tube was used for sub-packaging, and the storage was performed in the -20°C refrigerator.
[0150] The multifunctional enzyme marker was opened and the software was selected. The Luminescence mode was selected, and the plate layout was performed. 100 μl of the prepared reagent was added to each well of the cells, and the cells were mixed several times by blowing. The cells were placed at room temperature for 10 min in the dark, 180 μl of the solution in the cell culture plate was transferred into a 96-well white flat-bottom plate using a pipette gun to avoid air bubbles, and the 96-well white flat-bottom plate was placed in the enzyme marker to read the data and export the data for saving, which was used to calculate the cell killing rate. Cell killing rate = (background luminescence value - sample luminescence value) / background luminescence value * 100%.
[0151] The results are shown in FIG. 5. The triple knock-out (TRAC KO / B2m KO / HLADRA KO ) does not affect the killing ability of CAR-T cells on tumors.
[0152] Those skilled in the art should understand, according to the present disclosure, that many changes can be made in the specific embodiments disclosed and still obtain similar or similar results without departing from the spirit and scope of the disclosed subject matter.
Claims
1. A T cell modified to knock out or inactivate three genes, wherein the first gene is a T cell receptor (TCR) encoding gene, the second gene is a HLA class I molecule encoding gene and the third gene is a HLA class II molecule encoding gene.
2. The T cell of claim 1, wherein the TCR encoding gene is a gene encoding TCRa and / or TCRP, the HLA class I molecule encoding gene is a gene encoding beta-2 microglobulin (B2M) and the HLA class II molecule encoding gene is a gene encoding HLA-DRA.
3. The T cell of claim 2, wherein the T cell has knocked out or inactivated genes encoding TCRa, B2M and HLA-DRA.
4. The T cell of any one of claims 1-3, which is a CAR-T cell, optionally a CAR-T cell obtained by engineering a donor-derived T cell with a CAR construct.
5. A combination of sgRNAs comprising a first sgRNA targeting a TCR encoding gene, a second sgRNA targeting a HLA class I molecule encoding gene and a third sgRNA targeting a HLA class II molecule encoding gene.
6. The combination of claim 5, comprising a first sgRNA targeting a TCRa constant region encoding gene, a second sgRNA targeting a B2M gene and a third sgRNA targeting a HLA-DRA gene.
7. The combination of claim 6, wherein: the first sgRNA has a recognition sequence selected from any one of SEQ ID Nos: 1-27; the second sgRNA has a recognition sequence selected from any one of SEQ ID Nos: 28-67; and the third sgRNA has a recognition sequence selected from any one of SEQ ID Nos: 68-78.
8. The combination of claim 7, the first, second and third sgRNAs having the recognition sequences as set forth in SEQ ID NOs: 13, 28 and 73, respectively.
9. The combination of any one of claims 5-8, wherein the first, second and third sgRNAs further comprise a constant sequence as a frame, such as the sequence set forth in SEQ ID NO:
79.
10. A system for genetically editing a T cell, comprising: a combination of sgRNAs of any one of claims 5-9 or a combination of one or more vectors expressing the sgRNAs; and optionally, a nuclease or a nucleic acid encoding the nuclease.
11. The system of claim 10, wherein the nuclease is capable of inactivating the respective targeted gene under the guidance of each sgRNA, optionally the nuclease is a Cas nuclease, such as a Cas9 nuclease or a Casl2 nuclease, more specifically a spCas9 nuclease.
12. The system of claim 10 or 11, wherein the nuclease forms a complex with each sgRNA, respectively.
13. The system of claim 10 or 11, comprising one or more vectors expressing the sgRNAs.
14. The system of claim 13, wherein the one or more vectors comprise a nucleic acid encoding the nuclease or the nucleic acid encoding the nuclease is separate from a vector expressing the sgRNA.
15. The system of any one of claims 10-14, wherein the vector is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a transposon vector, and a viral vector; optionally, the vector is a viral vector, such as a lentiviral vector, an adenoviral vector, or a retroviral vector.
16. A method of making a T cell with reduced immunogenicity, the method comprising knocking out or inactivating three genes in the T cell, wherein: the first gene is a T cell receptor (TCR) encoding gene, the second gene is an HLA class I molecule encoding gene, and the third gene is an HLA class II molecule encoding gene, optionally, the first gene is a gene encoding TCRa and / or TCRP, the second gene is a gene encoding beta-2 microglobulin (B2M), and the third gene is a gene encoding HLA-DRA.
17. The method of claim 16, comprising contacting the T cell with the combination of sgRNAs of any one of claims 5-9 or the system of any one of claims 10-15, and introducing the combination of sgRNAs or the system into the T cell.
18. The method of claim 17, wherein the T cell is introduced by electroporation.
19. The method of claim 17 or 18, wherein the first sgRNA, the second sgRNA, and the third sgRNA are mixed together with a nuclease and incubated prior to contacting.
20. The method of any one of claims 16-19, further comprising engineering the T cell to express a chimeric antigen receptor (CAR), thereby making a CAR-T cell.
21. A T cell made by the method of any one of claims 16-20.
22. A kit comprising in a container the combination of sgRNAs of any one of claims 5-9 or the system of any one of claims 10-15.
23. The kit of claim 22, comprising: the first sgRNA, the second sgRNA, and the third sgRNA, optionally in separate containers or in the same container; or a vector expressing the first sgRNA, a vector expressing the second sgRNA, and a vector expressing the third sgRNA, optionally in separate containers or in the same container; or a vector expressing the first sgRNA, the second sgRNA, and the third sgRNA.
24. A pharmaceutical composition comprising the T cell of any one of claims 1-4 and 21 and a pharmaceutically acceptable carrier.
25. Use of the T cell of any one of claims 1-4 and 21 in the manufacture of a medicament for treating a cancer, an autoimmune disease, or an inflammatory disease in an allogeneic subject.
26. Use of the T cell of any one of claims 1-4 and 21 in the manufacture of a medicament for allogeneic organ transplantation.
Citation Information
Patent Citations
Universal CAR-T cell and preparation method and application thereof
CN107723275A
Method for efficiently knocking out primary T cell genes from clusters of regularly interspaced short palindromic repeats (CRISPR)-Cas9 and application
CN110616233A
Induced pluripotent stem cell line for reducing cell immunogenicity and construction method thereof
CN111424016A
Engineered immune cells and uses thereof
CN114075550A
Reagent and method for knocking out TRAC and B2M in T cells
CN116622712A