Novel use

A sequential treatment of daplusiran/tomligisiran followed by bepirovirsen, combined with nucleoside/nucleotide analogue therapy, addresses the complexity of the HBV infection pathway, significantly improving functional cure rates by targeting multiple aspects and feedback loops, achieving up to 35-38% cure in patients with low HBsAg levels.

WO2025242321A1PCT designated stage Publication Date: 2025-11-27GLAXOSMITHKLINE INTELLECTUAL PROPERTY (NO 3) LIMITED
View PDF 14 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2024/080642
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-17
Filing Date
2024-10-30
Publication Date
2025-11-27

AI Technical Summary

Technical Problem

Current therapeutic approaches for chronic hepatitis B infection, including nucleoside analogues and pegylated interferons, achieve very low rates of functional cure due to their inability to address the complex interactions and feedback loops in the infection pathway, leading to viral relapse and the persistence of HBV reservoirs.

Method used

A sequential treatment regimen involving daplusiran/tomligisiran followed by bepirovirsen, combined with background nucleoside/nucleotide analogue therapy, targets multiple aspects of the HBV infection pathway, leveraging computer models to predict increased functional cure rates.

Benefits of technology

The sequential treatment regimen significantly enhances the rate of functional cure, particularly in patients with baseline HBsAg levels below 3000 IU/mL, achieving up to 35-38% functional cure compared to less than 1% with bepirovirsen alone, by effectively suppressing HBsAg and HBV DNA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000020_0001
    Figure IMGF000020_0001
  • Figure IMGF000020_0002
    Figure IMGF000020_0002
  • Figure IMGF000026_0001
    Figure IMGF000026_0001
Patent Text Reader

Abstract

The present invention relates to a treatment regimen for chronic hepatitis B capable of eliciting high levels of functional cure comprising sequential treatment with one or more RNAi agents and an antisense oligonucleotide.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] NOVEL USE

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to a treatment regimen for chronic hepatitis B capable of eliciting high levels of functional cure comprising sequential treatment with one or more RNAi agents and an antisense oligonucleotide.

[0004] BACKGROUND TO THE INVENTION

[0005] Hepatitis B is a global health concern , affecting ~300 million individuals world-wide, and is a leading cause of liver related mortality. The vast majority of deaths occurs in chronically infected individuals, who progressively develop liver cirrhosis and cancer.

[0006] The infection pathway for Hepatitis B virus has been extensively studied. Uninfected hepatocytes, the target for hepatitis B virus, get infected by free virions to yield productively infected hepatocytes, which in turn produce more free infectious virions as well as non-infectious viral antigen (HBsAg and HBcrAg) in the form of lipid-protein aggregates (termed as sub-viral particles). Free virions and other viral proteins can stimulate liver-resident non-parenchymal immune cells in the liver such as dendritic cells and Kupffer cells to mount an innate immune response, consisting of proinflammatory cytokines. These innate immune effectors can engage in paracrine signaling (for example, via the interferon-JAK / STAT pathway) in uninfected hepatocytes to induce phenotypic switching to a transient antiviral state. However, the virus and viral proteins can downregulate the mounting of a proinflammatory innate immune response suggesting that there is a negative feedback loop between systemic antigen levels and innate immunity.

[0007] In addition, HBV infection and subsequent proinflammatory innate immune responses can also triggers antiviral cellular immune responses. Components of this response include neutrophils and natural killer (NK) cells, which are non-specific effectors, and HBV epitope-specific cytotoxic CD8+ T cells (CTLs). These effector arms are stimulated by infected cells, and activated effector cells kill infected hepatocytes and therefore help in either controlling or clearing infection. However, as observed in chronic infections and cancer, sustained antigenic stimulation from both infected cells and viral antigen such as HBsAg can induce exhaustion of cellular immunity and immune dysfunction thus creating a feedback loop.

[0008] A number of therapeutic approaches for the treatment of chronic hepatitis B infection are approved or are in development. Each of these therapeutic strategies acts at a point in the infection pathway described above and has good rationale for treatment. Despite this, a complete (or sterilizing) cure has proven elusive. This is likely because, in chronically infected individuals, almost all hepatocytes in the liver are infected and further, the virus produces two distinct forms of genome templates. cccDNA, or covalently closed circular DNA, is a stable form of the HBV viral genome that resides in the nucleus of infected cells. It serves as a template for viral replication and is highly resistant to antiviral treatments. This allows HBV to maintain a reservoir of cccDNA, which can persist in infected cells even after seemingly successful antiviral therapy, leading to viral rebound once the treatment is stopped. In addition, HBV can also integrate its DNA into the host's genome. This integration makes it difficult to completely eliminate HBsAg production. Both these mechanisms - the formation of cccDNA and the integration of HBV DNA into the host genome - contribute to the persistence of HBV and the challenges in curing the infection.

[0009] HBV thus forms a long-lived viral reservoir which is resistant to targeting via therapies and thus requires life-long suppressive antiviral treatment. Thus, the current holy grail with hepatitis B therapy is to induce a state known as functional cure, where the virus reservoir is not eradicated from the host, but viral biomarkers are maintained below detection in the absence of any treatment, thus resulting in an asymptomatic host with minimal risk of progressive liver disease. In the context of clinical trials, functional cure is defined as sustained suppression of viremia (with HBsAg loss - with or without anti-HBsAg seroconversion) for 6-months after the discontinuation of all treatments.

[0010] Standard-of-care therapies for CHB are nucleoside or nucleotide analogues (NA and pegylated interferons (PEG-interferon). Because of their frequent and sometimes severe side effects and high cost versus a small gain in treatment response, PEG-interferons are less frequently used than NAs. Functional cure is rarely achieved with NAs and PEG-interferons. Despite prolonged therapy, fewer than 5% of patients have HBsAg loss after 12 months of treatment. Therefore, many people living with chronic HBV require life long therapy to control viral replication.

[0011] Bepirovirsen is an experimental antisense oligonucleotide (ASO) in development for the treatment of chronic hepatitis B (CHB) infection. Bepirovirsen directly targets all HBV messenger ribonucleic acids (mRNAs) via ribonuclease H (RNase H) mediated degradation, resulting in the reduction of viral proteins including HBsAg.

[0012] A Phase 2b clinical study (B-Clear) was conducted to evaluate the efficacy and safety of treatment with bepirovirsen in participants with chronic hepatitis B. See Yuen et al. "Efficacy and safety of bepirovirsen in chronic hepatitis B infection," N. Engl. J. Med. 2022; 387: 1957-68. Bepirovirsen at a dose of 300 mg per week for 24 weeks resulted in sustained HBsAg and HBV DNA loss in 9 to 10% of participants with chronic HBV infection.

[0013] Several small interfering RNA (RNAi) products are in development for the treatment of chronic hepatits B (CHB) infection. RNAi agents mediate their effects via the RNA induced silencing complex (RISC) that can degrade viral mRNA molecules. The initial incision takes place between positions 10 and 11 counting from the end of the 5'-end of the guide strand, and this is followed by further degradation of the mRNA by exonucleases. Clinical trials demonstrate that administering RNAi agents alone results in significant reductions in HBsAg, but functional cure is achieved in less than 1% of patients.

[0014] Aligos Therapeutics, Inc. investigated the combination effect of an anti-HBV RNAi and an anti-HBV ASO on HBsAg reduction preclinically (Tan, 2021, Combination drug interactions of hepatitis B virus (HBV) small interfering RNA (siRNA) and antisense oligonucleotides (ASO) in vitro and in vivo. European Association for the Study of the Liver, Poster abstract #1257). An additive effect was observed on HBsAg levels in vivo using AAV-HBV mice co-treated with the GalNAc conjugated forms of both the RNAi agent and the antisense oligonucleotide, as compared to mice treated with the individual drugs alone although it should be noted, based on clinical trials with RNAi agents, that reductions in HBsAg do not necessarily lead to clinically meaningful functional cure. Therapies capable of inducing functional cure in an expanded group of patients are eagerly awaited.

[0015] SUMMARY OF THE INVENTION

[0016] In a first aspect, the invention provides a method for treating chronic hepatitis B in a subject receiving treatment with nucleotide / nucleoside analogue therapy, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

[0017] In a second aspect, the invention provides a method for achieving functional cure in a subject having chronic hepatitis B and receiving treatment with a nucleotide / nucleoside analogue therapy, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

[0018] The term "treating" as used herein in relation to chronic hepatitis B infection refers to the administration of suitable compositions with the intention of reducing the symptoms of CHB, preventing the progression of CHB or reducing the level of one or more detectable markers of CHB.

[0019] "Functional cure" refers to sustained suppression (at least 24 weeks) of HBV DNA (< lower limit of quantification - LLOQ) off all HBV treatment with HBsAg loss (<0.05 Ill / mL) or HBsAg negative with or without HBsAg after a finite duration of therapy. In one embodiment, "Functional cure" refers to sustained suppression (at least 24 weeks) of HBV DNA (<LLOQ) off all HBV treatment with HBsAg not detected (in a particular embodiment, this is based on an assay with a LLOQ of 0.05 Ill / mL) with or without HBsAb after a finite duration of therapy.

[0020] In testing human samples, when serum HBsAg level is measured by a sandwich immunoassay with Elecsys HBsAg II quant II or Elecsys HBsAg quant II, the LLOQ is 0.05 lU / mL. When a qualitative assay, such as Elecsys HBsAg II, is used to measure the serum HBsAg level, a binary terminology (positive / detected, negative / undetected) is used and the LLOQ is 0.033 lU / mL. In testing human samples, when the serum HBV DNA level is measured with COBAS Ampliprep / COBAS Taqman HBV test v.2.0 (Roche), the LLOQ is 20 lU / mL and when the serum HBV DNA level is measured with cobas HBV (Roche), the LLOQ is 10 lU / mL.

[0021] DESCRIPTION OF DRAWINGS / FIGURES

[0022] FIG. 1 Schematic of a quantitative systems pharmacology (QSP) model of key biological processes that occur during HBV infection and the effects of various therapies - nucleoside / nucleotide analogs (NA), pegylated-interferon-a (IFN), bepirovirsen, and RNAi.

[0023] FIG. 2 Sample fits to available virus and host biomarkers from selected individuals for the following indications: (FIG. 2A) untreated infection cleared after the acute phase, or that persists and turns chronic, (FIG. 2B) chronically infected individuals treated with either NA (nucleotide / nucleoside analogue) or IFN monotherapies, or NA+IFN combination therapy (gray shaded region); start of treatment is designated as time=0, (FIG. 2C) Pharmacokinetics and pharmacodynamics of DAP / TOM (daplusiran / tomligisiran) treated chronically infected individuals, (FIG. 2D) Bepirovirsen treated patients and (FIG. 2E) Bepirovirsen + IFN treated patients that show either progressive disease characterized by sustained viremia after end-of-treatment, relapse, partial response or functional cure characterized by viral suppression even in the off-treatment phase.

[0024] FIG. 3A summarises the treatment regimens simulated using the QSP model. The percentage of simulated patients exhibiting HBsAg and viral load below the limit of quantification (LOQ; i.e. functional cure) for particular treatment regimens are summarised in (FIG. 3B) For subjects with baseline HBsAg > 1000 lU / mL or < 1000 lU / ml, and (FIG. 3C) For subjects with baseline HBsAg >3000 lU / mL or <3000 lU / mL.

[0025] FIG. 4 shows a clinical trial simulation for assessing the impact of shortening the NA consolidation phase (FIG. 4A) schematic of virtual trials, and results according to HBsAg at baseline for > and < 1000 lU / mL (FIG. 4B), and > and < 3000 lU / mL (FIG. 4C). FIG. 5 shows clinical trial simulations where the duration of DAP / TOM therapy or bepirovirsen therapy were altered, or where therapies were assessed with NA-naTve populations (FIG. 5A, FIG. 5B) Shortening or lengthening of the DAP / TOM treatment duration between 12-48 weeks (dosing at 200 mg Q4W), or, (FIG. 5C, FIG. 5D) shortening of bepirovirsen treatment duration to 12 weeks (FIG. 5E, FIG. 5F) NA-naTve populations without NA background therapy. Results are stratified by HBsAg at baseline for > and < 1000 lU / mL (FIG. 5A, FIG. 5C, FIG. 5E), and > and < 3000 lU / mL (FIG. 5B, FIG. 5D, FIG. 5F).

[0026] FIG. 6 shows a schematic of a sequential daplusiran / tomligisiran and bepirovirsen PK-HBsAg model, which is used to describe the effect of treatment on the inhibition of HBsAg synthesis. Abbreviations: ka = absorption rate constant; ALAG = absorption lag time; Q3 = intercompartmental (central to shallow) clearance; Q4 = intercompartmental (central to deep) clearance; SC = subcutaneous; CL = systemic clearance; CLS / CLX= S / X trigger plasma clearance; INsc,s / INsc,x = absorption of S / X trigger after SC administration; ke,uv = elimination rate of S / X trigger from liver; ksyn = ASGPR synthesis rate; Qs / Qx = S / X trigger distributional clearance; RCs / RCx = concentration of ASGPR-bound complex with S / X trigger; Vuv = liver volume; ICso = bepirovirsen or daplusiran / tomligisiran respective concentration resulting in 50% inhibition of HBsAg; Imax = maximum inhibition of HBsAg by a direct effect of bepirovirsen or daplusiran / tomligisiran respectively; kdeg, HBsAg = elimination rate of HBsAg; ktr, HbsAg = transit rate of HBsAg between compartments; ksyn, HbsAg = synthesis rate of HBsAg.

[0027] FIG. 7 shows the results of visual predictive check comparing model simulations with bepirovirsen treatment against observed clinical data from the B-Clear study. Black dashed lines represent 5thand 95thpercentile of observation; black solid lines represent the median of observation and LLOQ (lower limit of quanitification); dark grey shadow intervals represent 95% prediction interval for 5thand 95thpercentile of simulation; light grey shadow represents 95% prediction interval around the median of observation; grey hollow circles represent HBsAg observations. FIG. 7A shows a visual predictive check for treatment with 300 mg bepirovirsen weekly for 24 weeks in subjects on NA treatment and FIG 7B shows a visual predictive check for for treatment with 300 mg bepirovirsen weekly for 24 weeks in subjects not on NA treatment.

[0028] FIG. 8 shows the results of visual predictive check comparing model simulations with daplusiran / tomligisiran treatment against observed clinical data from AROHBV1001 and REEF-1 studies. Black dashed lines represent 5thand 95thpercentile of observation; black solid line represents median of observation; dark grey shadow intervals represent 95% prediction interval for 5thand 95thpercentile of simulation; light grey shadow represents 95% prediction interval around the median of observation; grey hollow circles represent HBsAg observations. FIG. 8A shows a visual predictive check for treatment with 40 mg daplusiran / tomligisiran Q4W (Q4W refers to dosing every four weeks). FIG. 8B shows a visual predictive check for treatment with 100 mg daplusiran / tomligisiran Q4W. FIG. 8C shows a visual predictive check for treatment with 200 mg daplusiran / tomligisiran Q4W. FIG. 9 shows the HBsAg simulated for sequential daplusiran / tomligisiran and bepirovirsen treatment, and treatment with bepirovirsen plus standard of care for two populations: 1) Subjects with baseline HBsAg > 3000 Ill / mL and 2) Subjects with baseline HBsAg < 3000 Ill / mL. FIG. 9A shows HBsAg simulations for bepirovirsen plus standard of care. FIG. 9B shows HBsAg simulations for 50 mg daplusiran / tomligisiran Q4W followed by bepirovirsen 300 mg QW (QW refers to weekly dosing). FIG. 9C shows HBsAg simulations for 200 mg daplusiran / tomligisiran Q4W followed by bepirovirsen 300 mg QW.

[0029] FIG. 10 is a schematic of the proposed phase lib B-UNITED clinical study, detailing the patient cohorts and dosage regimens of daplusiran / tomligisiran.

[0030] DETAILED DESCRIPTION OF THE INVENTION

[0031] As explained in the introduction, despite the fact that all current therapeutic approaches for the treatment of chronic hepatitis B are based on solid rationale, very low rates of functional cure are achieved. It is believed that this is because the therapeutic approaches target a single aspect of the infection pathway and do not take account of complex interactions that can lead to viral relapse. More recently, in an attempt to combat this, clinical trials have investigated the use of combination therapies, but rates of functional cure observed in these trials have been disappointing. This reflects the complexity of the infection pathway and the multiplicity of feedback loops involved. This is evidence of the fact that it is difficult to predict with any degree of certainty the effect of combination therapies.

[0032] Whilst various aspects of the infection pathway have been studied in isolation, there has been little focus on a more holistic understanding of the impact of targeting different aspect of the infection process. However, this is critical given the complexity of the process and the number of feedback loops. The failure to consider the totality of interactions in a holistic manner likely explains the observation that combination approaches tested in clinical trials have frequently not resulted in increased functional cure rates compared to monotherapy. For example, several clinical trials combining daplusiran / tomligisiran with other HBV therapies such as PEG-interferon, a capsid assembly modulator, a HBV therapeutic vaccine and an anti-PD-1 inhibitor, have been conducted but have not shown clinically meaningful functional cure rates.

[0033] Computer models of HBV infection can be used to provide insights into combination therapies. Two models have been developed to identify combination therapies that can lead to increases in functional cure compared to monotherapy. Both models have been validated against previously obtained clinical data, demonstrating that the models are likely to have predictive power. The models were independently derived but both predict that a sequential regimen with daplusiran / tomligisiran followed by bepirovirsen (plus background nucleoside / nucleotide analogue therapy) will result in increased functional cure compared to bepirovirsen with background nucleoside / nucleotide analogue therapy. This is evidence that the combination regimen is expected to have more than just an additive effect with respect to functional cure because clinical trials have shown that functional cure is observed at less than 1% of patients treated with daplusiran / tomligisiran (plus background nucleoside / nucleotide analogue therapy). Simulations can also be run to show the effects of changing the duration of treatment with daplusiran / tomligisiran or bepirovirsen, and the effects of changing the dose / dosing interval of daplusiran / tomligisiran. The simulations demonstrate that combined doses of daplusiran / tomligisiran as low as 50 mg Q4W or 100 mg Q8W, and a treatment period for both daplusiran / tomligisiran and bepirovirsen as short as 12 weeks can be efficacious and result in levels of functional cure broadly similar to those of higher doses / longer / more frequent dosing durations. Simulations also predict that background nucleoside / nucleotide analogue therapy can be discontinued following the end of bepirovirsen treatment with little effect on overall levels of functional cure achieved, and that the sequential treatment regimen will be effective without background nucleoside / nucleotide analogue therapy. One factor that did have a significant effect on functional cure levels in these simulations was baseline HBsAg levels, with the patient population with baseline HBsAg <3000 Ill / mL, and to a greater extent the patient population with baseline HBsAg <1000 lU / ml exhibiting higher levels of functional cure. Increased levels of functional cure are predicted in this population for both the sequential regimen and for bepirovirsen with background nucleoside / nucleotide analogue therapy, but in each case the functional cure rate was much higher for the sequential treatment regimen (plus background nucleoside / nucleotide analogue therapy) compared to treatment with bepirovirsen (plus background nucleoside / nucleotide analogue therapy).

[0034] The models are discussed below:

[0035] QSP model

[0036] FIG. 1 describes a quantitative systems pharmacology (QSP) model of key biological processes that occur during HBV infection and the effects of various therapies: - nucleoside / nucleotide analogues (NA), pegylated-interferon-a (IFN), bepirovirsen, and RNAi. Example 1 describes this model in more detail, wherein the change of each compartment described in FIG. 1 is expressed in terms of a "dynamic equation", which is a mathematical ordinary differential equation describing the changes over time that that will depend upon the interactions received. This model is parameterised based on information from the literature as well as clinical datasets. The model is capable of capturing the dynamics of virological and host-immune biomarkers upon the onset of acute and chronic infection in untreated patients, as well as upon the administration of therapies in chronically infected patients, thereby permitting estimations of functional cure upon end-of-treatment. Multiple interactive feedback loops that exist between host-virus pathways contributing to disease progression and the effects of various treatments are mechanistically included.

[0037] The model was validated by simulating the course of untreated HBV infection, and also by simulating the course of treating chronically infected individuals treated with either NA or IFN monotherapies, NA + IFN combination therapy, bepirovirsen monotherapy, bepirovirsen + IFN combination therapy, and RNAi monotherapy. The course of infection and these treatment regimens have been previously studied in clinical trials. The course of disease simulated by the model via "QSP digital twins" (virtual representations of individual patients studied in the clinical trials) exhibit biomarker trajectories that closely matched observations within real patients. This validates the model's ability to reproduce HBV infection and effects of therapies in si / ico, and enables it to be used with confidence to predict the result of clinical trials not yet conducted.

[0038] Example 3 describes virtual clinical trials for a sequential treatment regimen with daplusiran and tomligisiran and bepirovirsen (with background nucleoside / nucleotide analogue therapy) using "plausible virtual patients" which satisfy the population characteristics of real patients enrolled into an arm of the B-Clear clinical study. Functional cure was considered met when the mathematical models predicted sustained undetectable HBV DNA and HBsAg at 24 weeks after end of all treatments. This virtual clinical trial predicts a functional cure rate of between 30-34% in the population with HBsAg < 3000 Ill / mL at baseline, which is higher than that achieved by bepirovirsen with background nucleoside / nucleotide analogue therapy in the same patient population (23.9%).

[0039] PK-HBsAg model

[0040] FIG. 6 provides a schematic of a sequential daplusiran / tomligisiran and bepirovirsen PK-HBsAg model, which is used to describe the effect of treatment on the inhibition of HBsAg synthesis. The PK-HBsAg model was developed using PK data from 2 bepirovirsen Phase 2b clinical studies (Study 209668 and Study 209348) conducted in patients with CHB and pooled PK data for daplusiran and tomligisiran from a total of 439 total participants in Phase 1 and 2b clinical studies. The plasma PK of daplusiran and tomligisiran in humans was described simultaneously using a transporter-mediated drug disposition (TMDD) PPK model which included competitive binding of both triggers to the asialogylocprotein (ASGPR) receptor, resulting in saturable hepatic uptake. The ASGPR-mediated liver uptake was described by leveraging DAP / TOM concentrations from the plasma and liver of HBV- infected mice and allowed for the use of allometric scaling to predict human liver concentrations. The model further captures HBsAg pharmacodynamic response via an "indirect response model", utilizing potency parameters derived from clinical trials being the observed bepirovirsen, and daplusiran and tomligisiran concentration resulting in 50% inhibition of HBsAg. The model includesa series of transit compartments to capture the delay between the start of treatment and HBsAg reduction. As with the mechanistic model, changes in each compartment in the PK-HBsAg model are described by dynamic equations. Example 4 describes the dynamic equations and parameters for the PKPD model.

[0041] In Example 5, the model was validated. Simulations were conducted to produce visual predictive checks (VPCs) capturing the time-course of HBsAg following treatment with daplusiran and tomligisiran. The simulated data was validated against observed clinical data from B-Clear (FIG. 7) and the AROHBVIOOl and REEF-1 studies (FIG. 8). VPCs demonstrated good agreement between predicted and observed HBsAg concentrations following individual treatment with bepirovirsen or daplusiran / tomligisiran.

[0042] Example 6 describes a simulation of a sequential treatment regimen with various regimens of daplusiran and tomligisiran followed by bepirovirsen (with background nucleoside / nucleotide analogue therapy). Three distinct patient populations were tested, with all patients receiving background nucleoside / nucleotide analogue therapy. Each simulation was repeated 100 times, and the proportion of participants with HBsAg <LLOQ at various time points were calculated. Results of the simulation suggest an increased proportion of participants achieving HBsAg < LLOQ with sequential therapy than with bepirovirsen alone. The functional cure rates observed with sequential therapy in the HBsAg < 3000 Ill / mL patient population are broadly aligned with the results of the minimal QSP model (35- 38%).

[0043] In summary, two independently validated models predict increased functional cure for a sequential treatment regimen of daplusiran and tomligisiran followed by bepirovirsen (with background nucleoside / nucleotide analogue therapy) as compared to bepirovirsen with background nucleoside / nucleotide analogue therapy alone. Whilst the two models independently predict fairly similar functional cure rates for the sequential regimen, the functional cure rates predicted for the bepirovirsen with background nucleoside / nucleotide therapy alone are higher in the QSP model, and this depends on the characteristics of the plausible virtual patient cohort that was selected for virtual trials. In all simulations however, there was a clinically relevant improvement in functional cure rates with sequential treatment over bepirovirsen with background nucleoside / nucleotide analogue therapy alone.

[0044] The two models have differing strengths and limitations and provide slightly different but complementary information. The PK-HBsAg model is capable of interrogating the effect of modifying dosing and changes to key patient demongraphics, such as age and ethnicity, but does not account for immune-mediated effects of virological biomarkers. The QSP model currently developed cannot interrogate the effect of changing individual patient demographics, but does include more host-virus- drug interaction pathways, including accounting for immune-mediated responses to treatment. Importantly, the QSP model does not assume that the immune status in subjects in whom the levels of S antigen have been lowered by means of RNAi agents will be similar to subjects whose HBsAg levels are originally low at baseline.

[0045] In summary, even though previous attempts to provide a combination therapy for chronic hepatitis B have been largely unsuccessful, two independent, validated models described in the Examples each predict that the sequential treatment regimen described herein will improve rates of functional cure for patients compared to levels of functional cure achievable by treatment with bepirovirsen and background nucleoside / nucleotide analogue therapy. High levels of functional cure are predicted for patients having with HBsAg baseline <3000 Ill / mL, and to an even greater extent for patients with HBsAg baseline <1000 Ill / mL.

[0046] Because all RNAi agents in development, including daplusiran / tomligisiran, AB-729 (Imdusiran), RG- 6346 (Xalnesiran), VIR-2218, ALG-125755, SR-016 and STSG-0002 share a common mechanism and have demonstrated similar clinical effects upon HBV antigens in clinical trials, it is reasonable to extrapolate the results of the model based on daplusiran and tomligisiran to other RNAi agents exhibiting a similar clinical profile (i.e. an ability to reduces S antigen levels in the blood to < 3000 Ill / mL). Similarly, because antisense oligonucleotides sharing the same unmodified sequence as bepirovirsen are expected to have similar clinical profiles, it is reasonable to extrapolate the results of this virtual clinical trial to these antisense oligonucleotides.

[0047] The RNAi and antisense oligonucleotide components, and the treatment regimen is described in further detail below.

[0048] RNAi

[0049] In the context of this invention, an RNAi agent targeting HBV is a double stranded nucleic acid comprising sense and antisense strands of 16 to 30 nucleotides in length, wherein the antisense strand is at least partially complementary (i.e. exhibiting at least 85% complementarity) to a sequence in the HBV genome and which, upon delivery to a cell expressing HBV is capable of inhibiting the expression of one or more HBV genes in vivo and / or in vitro.

[0050] The terms "sense strand" and "antisense strand" refer to the individual nucleotide sequences that make up an RNAi agent have their conventional meaning in the relevant art. As used herein, the term "complementary" has its conventional meaning in the art. Specifically, when used to describe a first nucleotide sequence (e.g. a sense strand or targetted mRNA) in relation to a second nucleotide sequence (e.g. an antisense strand or a single stranded antisense oligonucleotide), the term complementary means the ability of the first nucleotide sequence to hybridise (form base pair hydrogen bonds under mammalian physiological conditions, or similar conditions in vitrei) and form a duplex or double helical structure with the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs and / or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridisation requirements are fulfilled. Complementarity is independent of modification. For example, a and Af are complementary to U (or T) and identical to A for the purposes of complementarity.

[0051] As used herein, "fully complementary" has its conventional meaning in the art. Specifically, the term "fully complementary" means that all (100%) of the bases in a contiguous sequence of a first nucleotide sequence will form base pair hydrogen bonds to with the same number of bases in a contiguous sequence of the second nucleotide sequence. The term "partially complementary" has its conventional meaning in the art. Specifically, the term "partially complementary" refers to the situation where not all bases form base pair hydrogen bonds, but where the number of hydrogen bonds are nonetheless sufficient to permit hybridisation and formation of a duplex or double helical structure under under mammalian physiological conditions, or similar conditions in vitro. In one embodiment, the term "partially complementary" refers to a situation where at least 70% (e.g. at least 80% or at least 90%) of the bases in a contiguous sequence of a first nucleotide sequence will form base pair hydrogen bonds to with the same number of bases in a contiguous sequence of the second nucleotide sequence.

[0052] In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 19 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. The sense and antisense strands can either be the same length or different lengths.

[0053] HBV mRNA is polycistronic, resulting in the translation of multiple polypeptides, and separate mRNAs overlap in RNA sequence. As a result, it is possible for a single RNAi agent to inhibit most or all HBV transcripts. Typically, an RNAi agent will target a site that is conserved across the majority of known genotypes of HBV. In some embodiments, an RNAi component includes two or more HBV RNAi agents targeting different locations or regions of HBV transcripts. Careful choice of target sequence can ensure that all HBV viral transcripts are targetted (i.e. 3.5kb pre-genomic RNA, 3.5 kb pre-core mRNA, 2.4 kb pre-Sl RNA, 2.1 kb pre-S2 / S mRNA, 0.7 kb X mRNA). In addition, the use of multiple RNAi agents may potentially expand the population of patients that can be treated, by expanding genotype coverage as well as by decreasing viral resistance resulting from mutations in the siRNA binding site.

[0054] In one embodiment, the RNAi component comprises a single HBV RNAi that targets the S ORF of an HBV genome (S trigger).

[0055] In an alternative embodiment, the RNAi component comprises two or more HBV RNAi agents, wherein one HBV RNAi agent targets the S ORF (i.e. having an antisense strand that targets the S transcripts (S, pre-Sl, and pre-S2),:the pregenomic RNA (core and polymerase), and the pre-core transcripts (HBeAg) of an HBV genome), and a second HBV RNAi agent targets the X ORF (X trigger; having an antisense strand that targets the X transcript of an HBV genome, the S transcripts (S, pre-Sl, and pre-S2), the pregenomic RNA (core and polymerase) and the pre-core transcriptions (HBeAg) of an HBV genome).

[0056] In some embodiments, administration of the one or more RNAi agents to a patient having chronic hepatitis B over a dosing period (e.g. > 20 weeks) reduces S antigen levels in the blood to < 3000 Ill / mL. In a more particular embodiment, administration of one or more RNAi agents to a patient having chronic hepatitis B over a dosing period (e.g. > 20 weeks) reduces S antigen levels in the blood to < 1000 Ill / mL.

[0057] In one embodiment, one of the one or more RNAi agents includes an antisense strand that is at least partially complementary (i.e. capable of hybridising) to a target sequence in the S ORF between nucleotides 2850-3182 and 1-837 of the HBV genome (Hepatitis B virus subtype ayw genotype D from U95551.1).

[0058] In one embodiment, one of the one or more RNAi agents includes an antisense strand that is at least partially complementary (i.e. capable of hybridising) to a target sequence in the S ORF between nucleotides 1-1307 of the Hepatitis B virus subtype (ADW2) genotype A (AM282986.1) genome. In one embodiment, one of the one or more RNAi agents comprises an antisense strand that is fully complementary to a target sequence in the S ORF between nucleotides 1-1307 of the Hepatitis B virus subtype (ADW2) genotype A (AM282986.1) genome. In one embodiment, one of the one or more RNAi agents includes an antisense strand that is at least partially complementary (i.e. capable of hybridising) to a target sequence in the S ORF between nucleotides 261 to 281 of HBV genotype D having GenBank accession number U95551.1. In a more particular embodiment, one of the one or more RNAi agents includes an antisense strand that is fully complementary to a target sequence in the S ORF between nucleotides 261 to 281 of HBV genotype D having GenBank accession number U95551.1. In another embodiment, one of the one or more RNAi agents includes an antisense strand that includes a portion that is at least partially complementary (i.e. capable of hybridising) to a target sequence in the S ORF between nucleotides 274 to 280 of HBV genotype D having GenBank accession number U95551.1. In another embodiment, one of the one or more RNAi agents includes an antisense strand that includes a portion that is fully complementary to a target sequence in the S ORF between nucleotides 274 to 280 of HBV genotype D having GenBank accession number U95551.1.

[0059] In another embodiment, one of the one or more RNAi agents includes an antisense strand that is at least partially complementary (i.e. capable of hybridising) to a nucleotide sequence in the X ORF between positions 1376-1840 of the HBV genome (Hepatitis B virus subtype ayw genotype D from U95551.1). In a more particular embodiment, one of the one or more RNAi agents includes an antisense strand that is fully complementary to a nucleotide sequence in the X ORF between positions 1376-1840 of the HBV genome (Hepatitis B virus subtype ayw genotype D from U95551.1). In one embodiment, one of the one or more RNAi agents includes an antisense strand that is at least partially complementary (i.e. capable of hybridising) to a target sequence in the X ORF between nucleotides 1782 to 1800 of HBV genotype D having GenBank accession number U95551.1. In a more particular embodiment, one of the one or more RNAi agents includes an antisense strand that is fully complementary to a target sequence in the X ORF between nucleotides 1782 to 1800 of HBV genotype D having GenBank accession number U95551.1. In another embodiment, one of the one or more RNAi agents includes an antisense strand that includes a portion that is at least partially complementary (i.e. capable of hybridising) to a target sequence in the X ORF between nucleotides 1794 to 1800 of HBV genotype D having GenBank accession number U95551.1. In a more particular embodiment, one of the one or more RNAi agents includes an antisense strand that includes a portion that is fully complementary to a target sequence in the X ORF between nucleotides 1794 to 1800 of HBV genotype D having GenBank accession number U95551.1.

[0060] In a more particular embodiment, the one or more RNAi agents includes an antisense strand that is at least partially complementary to a sequence in Table 1. The sequences are given for reference genome U95551.1. The skilled person would appreciate that equivalent sequences for different genotypes may have one or more mismatches present.

[0061] Table 1

[0062] In a more particular embodiment, the one or more RNAi agents include an antisense strand that is fully complementary to a sequence in Table 1.

[0063] Accordingly, in one embodiment, one of the one or more RNAi agents comprises an antisense strand that is at least partially complementary to a target sequence having a sequence that is any one of SEQ ID NO: 1-3 or SEQ ID NO: 7. In a more particular embodiment, one of the one or more RNAi agents comprises an antisense strand that is fully complementary to a target sequence having a sequence that is any one of SEQ ID NO: 1-3 or SEQ ID NO: 7.

[0064] In one embodiment, the one or more RNAi agents do not include an antisense strand that is at least partially complementary to a target sequence having SEQ ID NO: 10 (GCACTTCGCTTCACCTCTGC). In one embodiment, the one or more RNAi agents do not include an antisense strand whose target sequence overlaps with a target sequence having SEQ ID NO: 10 (GCACTTCGCTTCACCTCTGC).

[0065] In some embodiments, the one or more RNAi agents disclosed herein comprise the sense and antisense nucleobase sequences in Table 2. Table 2 describes the underlying nucleobase sequence. The skilled reader would appreciate that the invention encompasses modifications of the nucleobases or intern ucleotidic linkages of these sequences. Table 2 - unmodified nucleobase sequences of exemplary RNAi agents

[0066] In some embodiments, an RNAi agent contains one or more modified nucleotides. As used herein, a modified nucleotide is a nucleotide other than a ribonucleotide (i.e. a 2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g. at least 60%, at least 70%, at least 80% , at least 90%) of the nucleotides are modified nucleotides. In one embodiment, four or fewer nucleotides in both the sense or antisense strands are ribonucleotides. In one embodiment, the sense strand has two or fewer (i e, 0, 1, or 2) ribonucleotides. In one embodiment, the antisense strand has two or fewer (i e. 0, 1, or 2) ribonucleotides. Different modifications may be included in different positions such that modification of one nucleotide is independent of modification at another nucleotide.

[0067] As used herein, modified nucleotides include, but are not limited to, 2'-modified nucleotides, nucleotide mimics, abasic nucleotides, inverted (3' to 3') nucleotides, non-natural base-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2', 3'-seconucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 2'-F-Arabino nucleotides, 3'-O-methoxy (2' internucleoside linked) nucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate containing nucleotides and cyclopropyl phosphonate containing nucleotides.

[0068] 2' modified nucleotides are nucleotides with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring. They include, but are not limited to, 2'-O-methyl nucleotides,. 2'-deoxy- 2'-fluoro nucleotides, 2'-deoxy nucleotides (i.e. deoxyribonyucleotides), 2'-methoxyethyl nucleotides, 2'-amino nucleotides and 2'- alkyl nucleotides.

[0069] Non-natural nucleobases are bases capable of base pairing other than adenine, guanine, thymine, cytosine and uracil. They include 5-substituted pyrimidines (e.g. 5-halo, 5-methyl, 5-hydroxymethyl, 5-trifluoromethyl and 5-propynyl derivatives), 2-modified pyrimidines (e.g. 2-thio derivatives), 6- azapyrimidines, N-2, N-6 and 0-6 substituted purines, (e.g., 6-alkyl or 2-alkyl or 2-amino derivatives), 8-modified purines (e.g. 8-halo, 8-amino, 8-sulfhydryl, 8-thio, 8-hydroxyl and 8-aza derivatives), 7- modified purines (e.g. 7-methyl and 7-deaza derivatives) and 3-modified purines (e.g. 3-deaza derivatives), xanthine, hypoxanthine, pseudouracil.

[0070] In one embodiment, the sense strand of an RNAi agent comprises formula (I):

[0071] 5'-(X)a- YYY-(X)b-3' wherein X represents a 2-0-methyl modified nucleotide, Y represents a 2'-fluoro, 2-deoxy modified nucleotide, a and b are the same and are an integer from 7 to 13.

[0072] In one embodiment, the antisense strand of an RNAi agent comprises formula (II): 5'-XYXYXYXYXYXYXYXY-3' wherein X represents a 2'-0-methyl modified nucleotide and Y represents a 2'-fluoro, 2-deoxy modified nucleotide.

[0073] In some embodiments, one or more nucleotides of an RNAi agent are linked by non-standard linkages or backbones (i.e, modified internucleoside linkages or modified backbones). A modified internucleoside linkage is a non-phosphate-containing covalent internucleoside linkage. Modified internucleoside linkages or backbones include, but are not limited to, 5'-phosphorothioates, chiral phosphorothioates, thiophosphates, phosphorod ithioates, phosphotriesters, aminoalkylphosphotriesters, alkyl phosphonates , chiral phosphonates, phosphinates, phosphoramidates, thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, bora nophosphates having normal 3'-5' linkages, 2'- 5' linked analogs of boronophosphates, or bora nophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'- 2'.

[0074] In some embodiments, the sense strand and the antisense strand of an RNAi agent can independently contain 1, 2, 3, 4, 5, or 6 phosphoroth ioate linkages. In some embodiments the sense strand and the antisense strand of an RNAi agent can independently contain 1, 2, 3 or 4 phosphoroth ioate linkages.

[0075] In some embodiments, the sense strand of an RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, at least one phosphorothioate internucleoside linkage exists between the nucleotides at positions 1-3 from the 3' end of the sense strand. In another embodiment, two phosphorothioate internucleoside linkages exist between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, the antisense strand of an RNAi contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 1-3 from the 3' end.

[0076] In some embodiments, an RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with modified internucleoside linkages. In one embodiment, an RNAi agent has the modified nucleotide sequences (antisense and sense strands) set out below in Table 3:

[0077] Table 3 - modified nucleotide sequences of exemplary RNAi agents

[0078] A = adenosine-3'-phosphate;

[0079] C = cytidine-3'-phosphate;

[0080] G = guanosine-3'-phosphate;

[0081] U = uridine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate; as = 2'-O-methyladenosine-3'-phosphorothioate c= 2'-O-methylcytidine-3'-phosphate cs= 2'-O-methylcytidine-3'-phosphorothioate g =2'-O-methylguanosine-3'-phosphate gs=2'-O-methylguanosine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate

[0082] Af = 2'-fluoroadenosine-3'-phosphate

[0083] Afs = 2'-fluoroadenosine-3'-phosporothioate

[0084] Cf= 2'-fluorocytidine-3'-phosphate

[0085] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0086] Gf = 2'-fluoroguanosine-3'-phosphate

[0087] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0088] Uf = 2'-fluorouridine-3'-phosphate

[0089] Ufs = 2'-fluorouridine-3'-phosphorothioate s = phosphoroth ioate

[0090] (Agn) = adenosine-glycol nucleic acid (GNA)

[0091] [ademA-GalNAc] = 2'-modified-GalNAc adenosine

[0092] [ademG-GalNAc] = 2'-modified-GalNAc guanosine

[0093] [MePhosphonate-4O-u]s: 4'-O-monomethylphosphonate-2'-O-methyl uridine-3'-phosphorothioate (Note, there is a terminal 3'-OH at the 3' terminus of the modified nucleotide sequence)

[0094] In some embodiments, the RNAi agents are delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesives nucleospheres, proteinaceous vectors or Dynamic Polyconjugates (DPCs) (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185.)

[0095] In some embodiments, an HBV RNAi agent comprises a targeting ligand that targets the RNAi agent to particular cells or tissues . In some embodiments, the targeting ligand can include a cell receptor ligand, such as an asialoglycoprotein receptor (ASGPr) ligand. In some embodiments, an ASGPr ligand includes or consists of a galactose derivative cluster. In some embodiments, a galactose derivative cluster includes an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. Targeting ligands can be covalently linked to the 3' or 5' end of a sense strand or an antisense strand. In some embodiments, a targeting ligand is linked to the 3' or 5' end of the sense strand. In some embodiments, a targeting ligand is linked to the 5' end of the sense strand. In some embodiments, a targeting ligand is linked to the sense or antisense strand of an RNAi agent via an inverted abasic residue or a linker. In other embodiments, targeting ligands are attached to the sense or antisense strand without the use of a separate linker.

[0096] Suitable targeting ligands are known in the art and include the following: (NAG13), (NAG13)s,

[0097] (NAG18), (NAG18)S, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27),

[0098] (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s,

[0099] (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36),

[0100] (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s . The chemical structures of these are disclosed in, for example, WO2023 / 281434 and methods of synthesis are disclosed in W02018 / 044350.

[0101] In one embodiment, the targeting ligand is selected from the following:

[0102] (NAG25)s which has the following structure: wherein NAG is N-acetyl-galactosamine. In embodiments in which the RNAi component comprises a combination of a first and a second RNAi agent having different nucleotide sequences, the first and the second RNAi agents may each comprise a targeting ligand which may be the same or different. In some embodiments, the first and the second RNAi agents each comprise a targeting ligand comprised of N-acetyl-galactosamines. In some embodiments, when first and second RNAi agents are included in a composition, each RNAi agent comprises a targeting ligand having the same chemical structure. In some embodiments, when first and second RNAi agents are included in a composition, each RNAi agent comprises a targeting ligand having a different chemical structure.

[0103] In one embodiment, an RNAi agent comprises a targeting ligand and has the structure set out below in Table 4:

[0104] Table 4 - structures of exemplary RNAi agents

[0105] A = adenosine-3'-phosphate;

[0106] C = cytidine-3'-phosphate;

[0107] G = guanosine-3'-phosphate;

[0108] U = uridine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate; as = 2'-O-methyladenosine-3'-phosphorothioate c= 2'-O-methylcytidine-3'-phosphate cs= 2'-O-methylcytidine-3'-phosphorothioate g =2'-O-methylguanosine-3'-phosphate gs=2'-O-methylguanosine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate

[0109] Af = 2'-fluoroadenosine-3'-phosphate

[0110] Afs = 2'-fluoroadenosine-3'-phosporothioate

[0111] Cf= 2'-fluorocytidine-3'-phosphate

[0112] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0113] Gf = 2'-fluoroguanosine-3'-phosphate

[0114] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0115] Uf = 2'-fluorouridine-3'-phosphate

[0116] Ufs = 2'-fluorouridine-3'-phosphorothioate s = phosphoroth ioate

[0117] (Agn) = adenosine-glycol nucleic acid (GNA)

[0118] (invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide (invAb)s = inverted (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate (

[0119] NAG25, NAG25s, NAG37, or NAG37s = targeting ligand with structure disclosed in WO23281434

[0120] L96 is N[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol

[0121] L197 is ligand number 197 in US11427823.

[0122] [ademA-GalNAc] = 2'-modified-GalNAc adenosine

[0123] [ademG-GalNAc] = 2'-modified-GalNAc guanosine

[0124] [MePhosphonate-4O-u]s: 4'-O-monomethylphosphonate-2'-O-methyl uridine phosphoroth ioate

[0125] (Note, there is a terminal 3'-OH at the 3' terminus of the modified nucleotide sequence, unless the 3' end is modified with an inverted abasic residue or targeting ligand).

[0126] In one embodiment, an RNAi agent targeting the S ORF of HBV comprises:

[0127] SEQ ID NO: 11 and SEQ ID NO: 12; or

[0128] SEQ ID NO: 13 and SEQ ID NO: 12; or

[0129] SEQ ID NO: 14 and SEQ ID NO: 15; wherein the RNAi sequences optionally contain one or more modified nucleotides and / or one or more modified internucleoside linkages, and wherein the RNAi agent optionally comprises a targeting ligand.

[0130] In one embodiment, an RNAi agent targeting the S ORF of HBV comprises:

[0131] SEQ ID NO 24: and SEQ ID NO: 32 or 33; or

[0132] SEQ ID NO 25: and SEQ ID NO: 32 or 33; or

[0133] SEQ ID NO 26: and SEQ ID NO: 32 or 33; or

[0134] SEQ ID NO: 27 and SEQ ID NO: 34; wherein the RNAi agent optionally comprises a targeting ligand.

[0135] In one embodiment, an RNAi agent targeting the S ORF of HBV comprises a targeting ligand and has the structure set out in:

[0136] SEQ ID NO 24: and SEQ ID NO: 41, 42 or 43; or

[0137] SEQ ID NO 25: and SEQ ID NO: 41, 42 or 43; or

[0138] SEQ ID NO 26: and SEQ ID NO: 41, 42 or 43; or

[0139] SEQ ID NO: 27 and SEQ ID NO: 44.

[0140] In one embodiment, an RNAi agent targeting the X ORF of HBV comprises SEQ ID NO: 16 and SEQ ID NO: 17, wherein the RNAi sequences optionally contain one or more modified nucleotides and / or one or more modified internucleoside linkages, and wherein the RNAi agent optionally comprises a targeting ligand.

[0141] In one embodiment, an RNAi agent targeting the X ORF of HBV comprises SEQ ID NO: 28 and SEQ ID NO: 35 or 36, wherein the RNAi agent optionally comprises a targeting ligand.

[0142] In one embodiment, an RNAi agent targeting the X ORF of HBV comprises a targeting ligand and has the structure set out in: SEQ ID NO: 28 and SEQ ID NO: 45, 46 or 47.

[0143] In one embodiment, the RNAi component comprises an RNAi agent targeting the S ORF comprising either:

[0144] SEQ ID NO: 11 and SEQ ID NO: 12; or

[0145] SEQ ID NO: 13 and SEQ ID NO: 12; or

[0146] SEQ ID NO: 14 and SEQ ID NO: 15; and an RNAi agent targeting the X ORF comprising:

[0147] SEQ ID NO: 16 and SEQ ID NO: 17; wherein the RNAi sequences optionally contain one or more modified nucleotides and / or one or more modified internucleoside linkages and wherein the RNAi agent optionally comprises a targeting ligand.

[0148] In one embodiment, the RNAi component comprises an RNAi agent targeting the S ORF comprising:

[0149] SEQ ID NO: 24 and SEQ ID NO: 32 or 33; or

[0150] SEQ ID NO: 25 and SEQ ID NO: 32 or 33; or

[0151] SEQ ID NO: 26 and SEQ ID NO: 32 or 33; or

[0152] SEQ ID NO: 27 and SEQ ID NO: 35; and an RNAi agent targeting the X ORF comprising:

[0153] SEQ ID NO: 28 and SEQ ID NO: 35 or 36; wherein the RNAi agent optionally comprises a targeting ligand.

[0154] In one embodiment, the RNAi component comprises an RNAi agent targeting the S ORF comprising a targeting ligand and has the structure set out in:

[0155] SEQ ID NO 24: and SEQ ID NO: 41, 42 or 43; or

[0156] SEQ ID NO 25: and SEQ ID NO: 41, 42 or 43; or

[0157] SEQ ID NO 26: and SEQ ID NO: 41, 42 or 43; or

[0158] SEQ ID NO: 27 and SEQ ID NO: 44. and an RNAi agent targeting the X ORF comprising a targeting ligand and has the structure set out in:

[0159] SEQ ID NO: 28 and SEQ ID NO: 45, 46 or 47. In one embodiment, the RNAi component comprises an RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and an RNAi agent targeting the X ORF comprising an antisense strand consisting of SEQ ID: NO: 28 and a sense strand consisting of SEQ ID NO: 45. The RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42 has the following structure, shown as the free acid:

[0160]

[0161] The RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 25 and

[0162] 5 a sense strand consisting of SEQ ID NO: 42 has the following structure, shown as the sodium salt:

[0163]

[0164] The RNAi agent targeting the X ORF comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45 has the following structure, shown as the free acid:

[0165]

[0166] The RNAi agent targeting the X ORF comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45 has the following structure, shown as the sodium salt: In certain embodiments in which the RNAi component comprises an RNAi agent targeting the S ORF and an RNAi agent targeting the X ORF, they are administered in a molar ratio of about 1:1, 2: 1, 3: 1. 4: 1 or 5: 1. In one embodiment, the RNAi agents targeting the S and X ORFs are administered in a molar ratio of about 2:1.

[0167] In one embodiment, the RNAi component comprises a 2:1 mixture of (1) an RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42 (daplusiran / DAP), and (2) an RNAi agent targeting the X ORF comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45 (tomligisiran / TOM). The DAP / TOM product referred to in the examples is a 2:1 mixture of daplusiran and tomligisiran.

[0168] RNAi agents used in the methods of the invention may be manufactured by methods known in the art. More specifically, RNAi agents having an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, or an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45 may be prepared as described in W02018 / 027106.

[0169] An RNAi agent having an antisense strand consisting of SEQ ID NO: 29 and a sense strand consisting of SEQ ID NO: 48 may be prepared as described in W02020 / 232024. An RNAi agent having an antisense strand consisting of SEQ ID NO: 40 and a sense strand consisting of SEQ ID NO: 38 may be prepared as described in US11427823. An RNAi agent comprising an antisense strand that is at least partially complementary to a target sequence having SEQ ID NO: 6 may be prepared as described in WO2021 / 178885. An RNAi agent having an antisense strand consisting of SEQ ID NO: 31 and a sense strand consisting of SEQ ID NO: 39 may be prepared as described in US patent no 11052104.

[0170] In the methods as disclosed herein, the one or more RNAi agents can be administered as a free acid, a pharmaceutically acceptable salt thereof (e.g., a sodium salt), or a combination thereof. In some embodiments, the one or more RNAi agents are administered as a free acid. In some embodiments, the one or more RNAi agents are administered as a pharmaceutically acceptable salt thereof (e.g., a sodium salt). In some embodiments, the one or more RNAi agents are administered as a combination of a free acid and a sodium salt.

[0171] Antisense oligonucleotide (ASO)

[0172] In the context of this invention, an ASO refers to a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to an HBV mRNA. In some embodiments, the ASO consists of 20 linked nucleosides and has a nucleobase sequence of SEQ ID NO:49 (5'-GCAGAGGTGAAGCGAAGTGC-3')- In some embodiments, the ASO comprises at least one modified sugar. In some embodiments, the at least one modified sugar is a bicyclic sugar or comprises a 2'-O-methoxyethyl (2'-MOE) group. In the context of this invention, the term "bicyclic sugar" means a furanose ring modified by the bridging of two non-geminal carbon atoms. A bicyclic sugar is a modified sugar. In some embodiments, the ASO comprises at least one modified internucleoside linkage as described above in relation to the RNAi agent. In some embodiments, the at least one modified internucleoside linkage is a phosphorothioate linkage. In some embodiments, each internucleoside linkage of the ASO is a phosphorothioate linkage.

[0173] In some embodiments, the ASO comprises at least one modified nucleotide or nucleobase as described above in relation to the RNAi agent. In some embodiments, the modified nucleobase is 5- methylcytosine.

[0174] In some embodiments, the ASO comprises: a gap segment consisting of linked deoxynucleosides, a 5' wing segment consisting of linked nucleosides, and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

[0175] In some embodiments, the ASO comprises a separator segment placed in between gap segments as disclosed in WO2023 / 131098.

[0176] In one embodiment, the ASO is selected from Compounds AUS1233 / AUS1138, AUS1444, AUS1458, AUS1459, AUS1460, AUS1427 / AUS1461, AUS1462, AUS1463, AUS1464, AUS1465, AUS1463, AUS1467, AUS1468, AUS1470, AUS1471, AUS1472, AUS1473, AUS1474, AUS1475, AUS1476 / AUS1493, AUS1478, AUS1479, AUS1489, AUS1490, AUS1443, and AUS1322 disclosed in WO2023 / 131098. In one embodiment, the ASO is selected from Compounds AUS1233 / AUS1138, AUS1463, and AUS1476 / AUS1493. In one embodiment, the ASO is Compound AUS1493. AUS1493 has the modified nucleotide sequence set out in SEQ ID NO: 50.

[0177] SEQ ID NO: 50: 5' moeG-s-moe5MeC-s-moeA-s-moeG-s-dA-s-dG-s-dG-s-dT-s-dG-s-moeA-s-dA-s-dG- s-d5MeC-s-dG-s-dA-s-moeA-s-lnaG-s- moe5Mell-s-lnaG-s-lna5MeC 3' wherein: moeA = 2'-O-(2-methoxyethyl) adenosine moe5MeC = 2'-O-(2-methoxyethyl) 5-methylcytidine moeG = 2'-O-(2-methoxyethyl) guanosine moe5Mell = 2'-O-(2-methoxyethyl) 5-methyl uridine dA = 2'-deoxy adenosine d5MeC = 2'-deoxy 5-methylcytidine dG = 2'-deoxy guanosine dT = 2'-deoxy thymidine lna5MeC = LNA 5-methylcytidine InaG = LNA guanosine -s- = phosphorothioate

[0178] In some embodiments, the ASO comprises: a gap segment consisting of ten linked deoxynucleosides, a 5' wing segment consisting of 5 linked nucleosides, and a 3' wing segment consisting of 5 linked nucleosides, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment includes a 2'-O-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5- methylcytosine.

[0179] In one embodiment, the ASO is bepirovirsen. Bepirovirsen has the modified nucleotide sequence set out in SEQ ID NO: 51.

[0180] SEQ ID NO: 51: 5' moeG-s-moe5MeC-s-moeA-s-moeG-s-moeA-s-dG-s-dG-s-dT-s-dG-s-dA-s-dA-s-dG- s-d5MeC-s-dG-s-dA-s-moeA-s-moeG-s-moe5MeU-s-moeG-s-moe5MeC 3' wherein: moeA = 2’-O-(2-methoxyethyl) adenosine moe5MeC = 2'-O-(2-methoxyethyl) 5-methylcytidine moeG = 2'-O-(2-methoxyethyl) guanosine moe5Mell = 2'-O-(2-methoxyethyl) 5-methyl uridine dA = 2'-deoxy adenosine d5MeC = 2'-deoxy 5-methylcytidine dG = 2'-deoxy guanosine dT = 2'-deoxy thymidine -s- = phosphorothioate

[0181] In another embodiment, the ASO is AHB-137.

[0182] Bepirovirsen is an ASO currently in clinical evaluation for treating Chronic HBV infections. It is compound ISIS No. 505358 as disclosed in WO2012 / 145697. Bepirovirsen has 20 linked nucleosides and has a nucleobase sequence of 5'-GCAGAGGTGAAGCGAAGTGC-3z(SEQ ID NO:49), and it includes: a gap segment consisting of ten linked deoxynucleosides, a 5' wing segment consisting of 5 linked nucleosides, and a 3' wing segment consisting of 5 linked nucleosides, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment includes a 2'-O-methoxyethyl sugar, wherein each internucleoside linkage is a phosphoroth ioate linkage, and wherein each cytosine is a 5- methylcytosine. The CAS Registry Number of bepirovirsen is 1403787-62-1.

[0183] In the methods as disclosed herein, the ASO (e.g. bepirovirsen) can be administered as a free acid, a pharmaceutically acceptable salt thereof (e.g., a sodium salt), or a combination thereof. In some embodiments, the ASO (e.g. bepirovirsen) is administered as a free acid. In some embodiments, the ASO (e.g. bepirovirsen) is administered as a pharmaceutically acceptable salt thereof (e.g., a sodium salt). In some embodiments, the ASO (e.g. bepirovirsen) is administered as a combination of a free acid and a sodium salt.

[0184] TREATMENT REGIMENS

[0185] In one aspect, the invention provides a method for treating chronic hepatitis B in a subject, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the nucleobase sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

[0186] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0187] In a related aspect, the invention provides one or more RNAi agents and an antisense oligonucleonucleotide for use in a method for treating chronic hepatitis B in a subject, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the nucleobase sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage. In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0188] In a further aspect, the invention provides one or more RNAi agents and an antisense oligonucleonucleotide for use in the manufacture of medicaments for use in a method for treating chronic hepatitis B in a subject, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the nucleobase sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

[0189] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0190] In the context of this invention, the phrase "therapeutically effective amount" refers to the administration of the therapeutic agent either alone or as part of a pharmaceutical composition and either in a single dose or as part of a series of doses, in an amount capable of having any detectable, positive effect on any symptom, aspect, or characteristic of a disease or condition when administered to the subject.

[0191] In a more particular embodiment, when used in connection with the one or more RNAi agents, the phrase therapeutically effective amount refers to the administration of the one or more RNAi agents either alone or as part of a pharmaceutical composition and either in a single dose or as part of a series of doses, in an amount capable of reducing mean levels of HBsAg < 3000 Ill / mL in the overall patient population. In a more particular embodiment, HBsAg levels are reduced <1000 Ill / mL. In another embodiment, the HBsAg log reduction at nadir is > 1 log.

[0192] As explained above, this treatment regimen is expected to achieve functional cure of chronic hepatitis B in a significant proportion of treated subjects. Accordingly, the phrase "therapeutically effective amount" can refer to the amounts of the one or more RNAi agents and / or antisense oligonucleotides in an amount capable of achieving functional cure. In one embodiment, the treatment regimen for treating chronic hepatitis B in a subject described above achieves functional cure in a greater proportion of patients than would be achieved by treatment with the antisense oligonucleotide plus standard of care. In another aspect, the invention provides a method for achieving functional cure in a subject having chronic hepatitis B, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the nucleobase sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

[0193] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0194] In a related aspect, the invention provides one or more RNAi agents and an antisense oligonucleonucleotide for use in a method for achieving functional cure in a subject having chronic hepatitis B, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the nucleobase sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

[0195] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0196] In a further aspect, the invention provides one or more RNAi agents and an antisense oligonucleonucleotide for use in the manufacture of medicaments for use in method for achieving functional cure in a subject having chronic hepatitis B, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the nucleobase sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

[0197] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0198] In one embodiment, the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 16 weeks. In one embodiment, the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 20 weeks. In a more particular embodiment, the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 24 weeks. In one embodiment, the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of about 24 weeks. In one embodiment, the subject is treated with a therapeutically effective amount of the antisense oligonucleotide for a period of between 24 and 48 weeks. In one embodiment, the subject is treated with a therapeutically effective amount of the antisense oligonucleotide for a period of about 24 weeks. In one embodiment, the subject is treated with a therapeutically effective amount of the antisense oligonucleotide for a period of about 48 weeks.

[0199] The one or more RNAi agents targeting HBV may be administered by any convenient route. In one embodiment, the one or more RNAi agents targeting HBV may be delivered by a parenteral route, for example, by subcutaneous, intravenous, intraperitoneal or intramuscular administration. In one embodiment, the one or more RNAi agents targeting HBV are administered by subcutaneous administration or by intravenous infusion or injection. In a more particular embodiment, the one or more RNAi agents targeting HBV are administered by subcutaneous administration.

[0200] In one embodiment, the one or more RNAi agents targeting HBV is administered in a combined dose of between 20 and 400 mg per administration with a dosing interval ranging from once per week to once every eight weeks. In one embodiment, the one or more RNAi agents targeting HBV is administered in a combined dose of between 50 and 400 mg per administration with a dosing interval ranging from once per week to once every eight weeks. In one embodiment, the one or more RNAi agents targeting HBV is administered in a combined dose of between 50 and 200 mg per administration with a dosing interval ranging from once per week to once every eight weeks. Dosing intervals are frequently abbreviated as QxW (e.g QW, Q4W or Q8W) and indicate the number of weeks between dosing. QW refers to weekly dosing and Q4W and Q8W refer to dosing every 4 or 8 weeks respectively. Where the one or more RNAi agents targeting HBV is 2: 1 mixture of (1) an RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO 25 and a sense strand consisting of SEQ ID NO: 42, and (2) an RNAi agent targeting the X ORF comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO. 45 respectively, the RNAi agents are administered in a combined dose of from 50-200 mg at each administration (dose based on the free acid) with a dosing interval ranging from once per week to once every eight weeks. In one embodiment, the RNAi agents are administered at a combined dose of 50 mg of the free acids. For a combined dose of 100 mg, the RNAi agent targeting the S ORF is administered at a dose of 35 mg and the RNAi agent targeting the X ORF is administered at a dose of 17 mg. In another embodiment, the RNAi agents are administered at a combined dose of 200 mg of the free acids. For a combined dose of 200 mg, the RNAi agent targeting the S ORF is administered at a dose of 133 mg and the RNAi agent targeting the X ORF is administered at a dose of 67 mg. In one embodiment, the combined doses of the RNAi agents described herein are administered at an interval selected from about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks and about 8 weeks. In one embodiment, the RNAi component is administered at 4-week intervals. In another embodiment, the RNAi component is administered at 8-week intervals.

[0201] In an alternative embodiment where the one or more RNAi agents targeting HBV is an RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 29 and a sense strand consisting of SEQ ID NO: 48, the RNAi agent is administered at a dose of from 50-400 mg at each administration (dose based on the free acid) with a dosing interval ranging from once per week to once every eight weeks. In one embodiment, the RNAi agent is administered at dose of at least 200 mg of the free acid at each administration. In one embodiment, the RNAi agent is administered at dose of about 200 mg of the free acid at each administration. In one embodiment, the RNAi agent is administered at an interval selected from about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks and about 8 weeks. In one embodiment, the RNAi component is administered at 4 weekly intervals. In another embodiment, the RNAi component is administered at 8 weekly intervals.

[0202] In an alternative embodiment where the one or more RNAi agents targeting HBV is a an RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 40 and a sense strand consisting of SEQ ID NO: 38, the RNAi agent is administered at a dose of from 60-90 mg at each administration (dose based on the free acid) with a dosing interval ranging from once per week to once every eight weeks. In one embodiment, the RNAi agent is administered at dose of at least 60 mg of the free acid at each administration. In one embodiment, the RNAi agent is administered at dose of about 60 mg of the free acid at each administration. In one embodiment, the RNAi agent is administered at an interval selected from about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks and about 8 weeks. In one embodiment, the RNAi component is administered at 4 weekly intervals. In another embodiment, the RNAi component is administered at 8 weekly intervals.

[0203] In an alternative embodiment where the one or more RNAi agents targeting HBV is a an RNAi agent targeting the S ORF comprising an antisense strand that is at least partially complementary to a target sequence having SEQ ID NO: 6, the RNAi agent is administered at a dose of from 20-200 mg at each administration (dose based on the free acid) with a dosing interval ranging from once per week to once every eight weeks. In one embodiment, the RNAi agent is administered at dose of 20 mg, 60 mg, 100 mg or 200 mg of the free acid at each administration. In one embodiment, the RNAi agent is administered at an interval selected from about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks and about 8 weeks. In one embodiment, the RNAi component is administered at 4 weekly intervals. In another embodiment, the RNAi component is administered at 8 weekly intervals.

[0204] In an alternative embodiment where the one or more RNAi agents targeting HBV is a an RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 31 and a sense strand consisting of SEQ ID NO: 39, the RNAi agent is administered at a dose of from 100-400 mg at each administration (dose based on the free acid) with a dosing interval ranging from once per week to once every eight weeks. In one embodiment, the RNAi agent is administered at dose of 100 mg, 200 mg, or 400 mg of the free acid at each administration. In one embodiment, the RNAi agent is administered at an interval selected from about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks and about 8 weeks. In one embodiment, the RNAi component is administered at 4 weekly intervals. In another embodiment, the RNAi component is administered at 8 weekly intervals.

[0205] The antisense oligonucleonucleotide comprising the sequence set out in SEQ ID NO: 49, and wherein the sequence optionally contains one or more modified nucleotides and wherein one or more nucleotides are optionally linked by a modified internucleoside linkage may be administered by any convenient route. In one embodiment, the antisense oligonucleotide may be delivered by a parenteral route, for example, by subcutaneous, intravenous, intraperitoneal or intramuscular administration. In one embodiment, the antisense oligonucleotide is administered by subcutaneous administration or by intravenous infusion or injection. In a more particular embodiment, the antisense oligonucleotide is administered by subcutaneous administration. In one embodiment, the antisense oligonucleonucleotide comprising the sequence set out in SEQ ID NO: 49, and wherein the sequence optionally contains one or more modified nucleotides and wherein one or more nucleotides are optionally linked by a modified internucleoside linkage (e.g. bepirovirsen) is administered at a dose of about 150 mg to 450 mg once weekly. In some embodiments, the therapeutically effective amount of the antisense oligonucleotide(e.g. bepirovirsen) is about 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, or 450 mg once weekly. In some embodiments, the therapeutically effective amount of the antisense oligonucleotide (e.g. bepirovirsen) is about 150 mg once weekly. In some embodiments, the therapeutically effective amount of the antisense oligonucleotide (e.g. bepirovirsen) is about 300 mg once weekly. In some embodiments, the antisense oligonucleotide (e.g. bepirovirsen) is administered weekly with additional loading doses in the first two weeks on Day 4 and Day 11 following the first dose (also referred to as "2 loading doses"). In some embodiments, the antisense oligonucleotide (e.g. bepirovirsen) is administered at a dose of about 300 mg once weekly with additional loading doses in the first two weeks on Day 4 and Day 11 following the first dose. In a particular embodiment, the loading dose is 300 mg.

[0206] In some embodiments, the antisense oligonucleotide (e.g. bepirovirsen) is administered for about 24 to 48 weeks. In some embodiments, the antisense oligonucleotide (e.g. bepirovirsen) is administered for 24 weeks, or 48 weeks, or for a range between any two preceding periods. In one embodiment, the antisense oligonucleotide (e.g. bepirovirsen) is administered for 24 weeks. In one embodiment, the antisense oligonucleotide (e.g. bepirovirsen) is administered for 48 weeks. In one embodiment, the ASO (e.g. bepirovirsen) is administered for 24 weeks, with additional loading doses on Day 4 and Day 11 following the first dose.

[0207] In some embodiments, the antisense oligonucleotide (e.g. bepirovirsen) is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

[0208] In one embodiment, there is no gap between the treatment with the therapeutically effective amount of one or more RNAi agents and treatment with the antisense oligonucleotide other than that resulting from the dosing interval of the one or more RNAi agents. For example, if there is a 4 week dosing interval, the final dose of the one or more RNAi agents would be 4 weeks prior to the first dose of the antisense oligonucleotide. In another embodiment, there is an interval between dosing with the therapeutically effective amount of one or more RNAi agents and treatment with the antisense oligonucleotide other than that resulting from the dosing interval of the one or more RNAi agents over and above that which results from the dosing interval of the one or more RNAi agents. In one embodiment, this interval is up to 12 weeks, for example, the interval may be 4 weeks, 8 weeks, or 12 weeks in duration.

[0209] In one aspect, the invention provides a method for treating chronic hepatitis B in a subject, wherein: a) the subject is treated with a first RNAi agent comprising an antisense strand consisting of SEQ ID: NO 25 and a sense strand consisting of SEQ ID NO: 42, and a second RNAi agent comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO. 45 at a combined dose of 50-200 mg Q4W for about 24 weeks, wherein the ratio of the first RNAi agent to the second RNAi agent is about 2:1; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide having the sequence set out in SEQ ID NO: 51, wherein the antisense oligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

[0210] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0211] In a related aspect, the invention provides one or more RNAi agents and an antisense oligonucleotide for use in a method for treating chronic hepatitis B in a subject, wherein: a) the subject is treated with a first RNAi agent comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and a second RNAi agent comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45 at a combined dose of 50-200 mg Q4W for about 24 weeks, wherein the ratio of the first RNAi agent to the second RNAi agent is about 2:1; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide having the sequence set out in SEQ ID NO: 51, wherein the antisense oligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

[0212] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0213] In a further aspect, the invention provides one or more RNAi agents and an antisense oligonucleotide for use in the manufacture of medicaments for use in a method for treating chronic hepatitis B, wherein: a) the subject is treated with a first RNAi agent comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and a second RNAi agent comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45 at a combined dose of 50-200 mg Q4W for about 24 weeks, wherein the ratio of the first RNAi agent to the second RNAi agent is about 2:1; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide having the sequence set out in SEQ ID NO: 51, wherein the antisense oligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

[0214] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0215] In one embodiment, the first and second RNAi agents are administered at a dose of 50 mg Q4W for about 24 weeks. In one embodiment, the first and second RNAi agents are administered at a dose of 100 Q4W for about 24 weeks. In one embodiment, the first and second RNAi agents are administered at a dose of 200 mg Q4W for about 24 weeks.

[0216] In another aspect, the invention provides a method for achieving functional cure in a subject having chronic hepatitis B, wherein: a) the subject is treated with a first RNAi agent comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and a second RNAi agent comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO. 45 at a combined dose of 50-200 mg Q4W for about 24 weeks, wherein the ratio of the first RNAi agent to the second RNAi agent is about 2:1; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide having the sequence set out in SEQ ID NO: 51, wherein the antisense oligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

[0217] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0218] In a related aspect, the invention provides one or more RNAi agents and an antisense oligonucleotide for use in a method for achieving functional cure in a subject having chronic hepatitis B, wherein: a) the subject is treated with a first RNAi agent comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and a second RNAi agent comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO. 45 at a combined dose of 50-200 mg Q4W for about 24 weeks, wherein the ratio of the first RNAi agent to the second RNAi agent is about 2:1; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide having the sequence set out in SEQ ID NO: 51, wherein the antisense oligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose. In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0219] In a further aspect, the invention provides one or more RNAi agents and an antisense oligonucleotide for use in the manufacture of medicaments for use in method for achieving functional cure in a subject having chronic hepatitis B, wherein: a) the subject is treated with a first RNAi agent comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and a second RNAi agent comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO. 45 at a combined dose of 50-200 mg Q4W for about 24 weeks, wherein the ratio of the first RNAi agent to the second RNAi agent is about 2:1; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide having the sequence set out in SEQ ID NO: 51, wherein the antisense oligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

[0220] In one embodiment, the subject is additionally receiving nucleotide / nucleoside analogue therapy.

[0221] In one embodiment, the first and second RNAi agents are administered at a dose of 50 mg Q4W for about 24 weeks. In one embodiment, the first and second RNAi agents are administered at a dose of 100 mg Q4W for about 24 weeks. In one embodiment, the first and second RNAi agents are administered at a dose of 200 mg Q4W for about 24 weeks.

[0222] In one embodiment, the subject has a baseline HBsAg >200 Ill / mL. In a more particular embodiment, the subject has a baseline HBsAg >100 Ill / mL. In one embodiment, the subject will have a baseline HBsAg >3000 Ill / mL. In another embodiment, the subject will have a baseline HBsAg <3000 lU / mL.

[0223] In one embodiment, the subject does not have cirrhosis. The presence of cirrhosis may be determined by techniques known in the art including liver biopsy, hepatic imaging or liver elastography. In one embodiment, the subject has a score of> 10.5 on FibroScan. In another embodiment, the subject has an APRI (Aspartate aminotransferase-platelet index) > 2 and Fibrosure / Fibrotest > 0.7. In a further embodiment, the subject has Metavir score F4 or liver stiffness as measured by transient elastography > 12 kPa.

[0224] In one embodiment, the subject does not have total bilirubin > 1.25x ULN (upper limit of normal) and or ALT > 2 x ULN.

[0225] In one embodiment, the subject does not have GFR <60 mL / min / 1.73m2 as calculated by the CKD-EPI formula or the JSN-CKDI equation. In some embodiments, the subject has chronic hepatitis B caused by infection by any of the human geographical genotypes, including but not limited to: A (Northwest Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean area, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America). Where the RNAi component comprises an RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and an RNAi agent targeting the X ORF comprising an antisense strand consisting of SEQ ID: NO: 28 and a sense strand consisting of SEQ ID NO: 45, the two RNAi triggers plus antisense oligonucleotide has full match coverage with 99.73% HBV genomes (including 99.64% of A genotype sequences, 99.32% of B genotype sequences, 99.83% of C genotype sequences, 99.92% of D genotype sequences, 99.63% of E genotype sequences, 100% of F genotype sequences, 100% of G genotype sequences and 100% of H genotype sequences).

[0226] In one embodiment, the subject with chronic hepatitis B is not co-infected with HDV, HCV and / or HIV.

[0227] In some embodiments, the human is HBeAg negative or HBeAg positive prior to treatment. In some embodiments, the human is HBeAg negative prior to treatment. In some embodiments, the human is HBeAg positive prior to treatment.

[0228] In some embodiments, the subject is not currently treated at the outset of the sequential treatment regimen.

[0229] In some embodiments, the subject is on stable nucleoside or nucleotide analogue (NA) therapy throughout the treatment period. In some embodiments, the NA therapy is lamivudine, adefovir, adefovir dipivoxil, telbivudine, entecavir, tenofovir, tenofovir disoproxil fumarate (TDF), or tenofovir alafenamide (TAF), or a pharmaceutically acceptable salt thereof. In some embodiments, the NA therapy is entecavir, tenofovir, tenofovir disoproxil fumarate, or tenofovir alafenamide. In some embodiments, the NA therapy is entecavir. In some embodiments, the NA therapy is tenofovir. In some embodiments, the NA therapy is tenofovir disoproxil fumarate. In some embodiments, the NA therapy is tenofovir alafenamide. In an embodiment, subjects in which HBV DNA <LLOQ and HBsAg is not detected (as assessed by qualitative HBsAg assay) discontinue NA therapy after the final dose of the antisense oligonucleotide. In one embodiment, subjects discontinue NA therapy 12 weeks after the final dose of the antisense oligonucleotide where the discontinuation criteria outlined above (i.e. HBV DNA <LLOQ and HBsAg is not detected) are met a) following the final dose of the antisense oligonucleotide and b) 12 weeks after the final dose of the antisense oligonucleotide. In another embodiment, subjects discontinue NA therapy 24 weeks after the final dose of the antisense oligonucleotide where the discontinuation criteria outlined above are met a) following the final dose of the antisense oligonucleotide and b) 24 weeks after the final dose of the antisense oligonucleotide. In another embodiment, subjects discontinue NA therapy 36 weeks after the final dose of the antisense oligonucleotide where the discontinuation criteria outlined above are met a) following the final dose of the antisense oligonucleotide and b) 36 weeks after the final dose of the antisense oligonucleotide. Nucleotide / nucleoside analogue therapy should be maintained where there is evidence of cirrhosis or for other reasons based on clinical assessment.

[0230] Following cessation, nucleotide / nucleoside analogue therapy or other rescue medication may be started in any subject with virologic relapse as measured by HBV DNA levels (> 200,000 lU / ml on any one occasion of > 2000 lU / ml in two sequential tests).

[0231] PHARMACEUTICAL COMPOSITIONS

[0232] In one embodiment the one or more RNAi agents and the antisense oligonucleotide are each formulated in separate pharmaceutical compositions. In each case, the pharmaceutical composition may be administered by injection or continuous infusion (examples include, but are not limited to, intravenous, intraperitoneal, intradermal, subcutaneous, intramuscular, intraocular, and intraportal). In one embodiment, pharmaceutical composition is suitable for subcutaneous administration. Such compositions comprise a pharmaceutically acceptable carrier and optionally further excipients as known and called for by acceptable pharmaceutical practice.

[0233] For subcutaneous administration, suitable pharmaceutically acceptable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline. The pharmaceutical composition may contain adjuvants such as isotonic agents, preservatives, antioxidants, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms upon the therapeutically active substance may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. The proper fluidity can be maintained, for example, by the use of by the maintenance of the required particle size in the case of dispersion or by the inclusion of surfactants.

[0234] Sterile injectable solutions can be prepared by incorporating the therapeutically active substance in the required amount in the pharmaceutically acceptable carrier, followed by filter sterilization. In some cases, the active substance is provided in the form of a sterile powder for the extemporaneous preparation of sterile injectable solutions or dispersions. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0235] In an embodiment, the pharmaceutical composition comprising the one or more RNAi agents also comprises water for injection and has been adjusted to pH 8.0 with acid or base. In an embodiment, the one or more RNAi agents is formulated as a sterile solution containing 200 mg / mL of RNAi agents (e.g. Daplusiran / Tomligisiran in the form of their sodium salts) adjusted to pH 8.0 with acid or base. In an embodiment, the one or more RNAi agents is formulated as a sterile solution containing 200 mg / mL of RNAi agents (e.g. Daplusiran / Tomligisiran in the form of their sodium salts) in aqueous sodium phosphate buffer adjusted to pH 8.0 with acid or base. In another embodiment, the pharmaceutical composition comprising the antisense oligonucleotide (e.g. bepirovirsen) also comprises water for injection and has been adjusted to pH 8.0 with acid or base. In one embodiment, the antisense oligonucleotide (e.g. bepirovirsen) is formulated as a sterile solution containing 150 mg / mL of antisense oligonucleotide (as free acid) in water, adjusted to pH 8 with acid or base.

[0236] Example 1 -QSP Model Generation and Validation

[0237] The model is described in FIG. 1. In FIG. 1, uninfected hepatocytes (T), the target for hepatitis B virus (V), get infected by free virions to yield productively infected hepatocytes (I), which in turn produce more free infectious progeny virions as well as non-infectious viral antigen (primarily HBsAg; S). Systemic antigen (infected cells as well as free virions) can stimulate both an innate immune (X) as well as cytolytic cellular immune response (E). Some of these innate immune effectors act via paracrine signalling (for example, via the interferon-JAK / STAT pathway) in uninfected hepatocytes to induce a temporary phenotypic switch to an antiviral state (R). Other innate immune responses such as interleukins are mainly proinflammatory in nature and can enhance cellular immune responses. Activated effector cells (E) kill infected hepatocytes and therefore help in either controlling or clearing infection. The death of hepatocytes results in the release of the intracellular liver enzyme alanine transferase (ALT; A) into the milieu. ALT flares upon therapies were therefore assumed to be a surrogate marker for cytotoxic immune responses as well as liver damage. As observed in chronic infections and cancer, sustained antigenic stimulation from both infected cells and viral antigen such as HBsAg can induce exhaustion of cellular immunity and immune dysfunction. This double negative feedback (shown in FIG. 1) was recognized as a commonly observed dynamical motif across viral infections and can explain a wide range of outcomes from pathogen clearance to persistent infections.

[0238] The effects of therapy - NA (nucleoside / nucleotide analogues), IFN, RNAi (DAP / TOM), and bepirovirsen - are encoded into the model as follows: all four therapies possess antiviral mechanisms which interfere with the virus lifecycle and inhibit the production of progeny virions from infected hepatocytes. In addition, IFN and bepirovirsen also possess secondary immunomodulatory mechanisms, culminating mainly in the activation of cytolytic cellular immune responses. Since the dosage and dosing regimen for NA, IFN, and bepirovirsen are established their pharmacokinetics are not integrated into the model. Their pharmacodynamic effects on various pathways are assumed to be present for the duration of therapy and are described by a constant efficacy term that impacts various model pathways (FIG. 1; Table 6), as is the standard practice with the field of viral dynamics modelling. In contrast, RNAi (DAP / TOM) has a long pharmacodynamic effect lasting weeks-to-months after clearance from the plasma, and this is commonly attributed to a long-lived population of intracellular RNAi-RISC complexes, thus resulting in a complex and persistent dose-response. To capture this pharmacodynamic effect, RNAi pharmacokinetics were modelled via a minimal absorption-clearance PK model, formation and turnover of intracellular RNAi-RISC complexes via a minimal target-mediated drug disposition framework, and the ensuing inhibitory pharmacodynamic effects on virology biomarkers (equations in Table 5, parameters in Table 6). Table 5. Equations in the QSP model.

[0239] Footnote: Initial conditions for simulating the model are as follows:

[0240] The model was parameterised by compiling a comprehensive clinical dataset sourced from published literature as well as data from clinical trials, consisting of longitudinal biomarker data with resolution at the level of individual patients. The biomarkers included standard virology biomarkers in serum / blood such as HBV DNA and HBsAg as well as host-specific biomarkers such as ALT and HBV- specific CD8+ T cells. For RNAi, we also had plasma pharmacokinetics data available for both S and X triggers. In total, data from 1106 patients were collated, and the patient disease characteristics and treatment indications are listed in Table 7. Where possible, we fixed model parameter values from previous studies (Table 6), especially when robust estimates were available. We estimated the remaining parameters using non-linear mixed effects modelling with some parameters varying across individuals and others held constant to estimated population averages (Table 6), to simultaneously fit biomarkers from all patients across disease outcomes and treatment indications. Parameters with inter-individual variability are modelled as = P x enJ , where Pj is the value of the parameter for the jthindividual, P is the population mean with a certain distribution, n ~N(o, w) are normally distributed 'random effects' whose variances (estimated from data) yield a measure of the difference between Pj and P. For parameters without inter-idividual variability, we assume Pj =

[0241] P.

[0242] Table 6

[0243]

[0244]

[0245]

[0246]

[0247]

[0248] Table 7. List of individual-level longitudinal biomarker datasets from published literature and internal data sourced for model parameterization and calibration The model was validated based on its ability to quantitatively capture the dynamics of HBV infection and the influence of therapies of interest - NA, IFN, bepirovirsen, RNAi - across all the individuals in the dataset, as demonstrated in FIG. 2 (one selected individual per indication). The non-linear mixed effects parameterisation approach yields population-distributions of parameters that vary across individuals (Table 6), and thus a quantitative framework for elucidating the effects of treatments on hepatitis B disease progression. This gives confidence in the model's ability to make forward predictions of the results of clinical trials not yet conducted.

[0249] Example 2 - Creation and validation of virtual populations

[0250] With the QSP model, in siiico clinical trials can be simulated with virtual patients that capture intrinsic inter-individual heterogeneity while removing multiple sources of logistical heterogeneity that often obfuscates readouts from clinical trials, such as patient population characteristics (age / gender / race / ...), treatment history, time of diagnosis, duration of treatment, etc. For example, deterministic in siiico trials with two treatment arms (e.g., monotherapy vs. combination therapy) can be conducted in which virtual twins are enrolled into both arms. This ensures that the same virtual patient undergoes both treatment regimens across the two arms, with the state of disease progression and treatment parameters (such as start of infection and treatment, duration of treatment, drug regimen, etc.) being the same for both virtual twins. In this setting, the difference in treatment responses and trial endpoints can only be attributed to the effects of the drugs, thus yielding a direct predictive comparison between treatments. At the same time, enrolling large numbers of virtual twins into in siiico trials enables capturing of inter-patient heterogeneity.

[0251] Virtual patient cohorts with chronic HBV infection were generated for running in siiico trials that can robustly estimate functional cure rates with therapies of interest.

[0252] Population (non-linear mixed effects) fitting of the mechanistic HBV model to individual-level clinical biomarker data yielded physiologically relevant parameter distributions for parameters that varied across individuals (Table 2) and are thus measures of inter-individual heterogeneity. These distributions can then be numerically sampled to yield parameter vectors, with each vector representing a virtual patient exhibiting realistic disease time courses and treatment effects. Importantly, there is no practical limit on the sample sizes of these virtual patient cohorts, and thus, large cohorts similar to those in phase 3 studies can be constructed which robustly captures interpatient variability for both disease progression and treatment responses. However, these virtual patient cohorts must be calibrated to match baseline characteristics of patients enrolled into either past or future clinical trials ("plausible virtual patients") to project realistic estimates of functional cure with therapies of interest. Here, from an initial sampling of 500,000 virtual patients, we select a plausible virtual patient cohort subset via Monte Carlo rejection sampling such that they satisfy the population characteristics of real patients enrolled into an arm of the Phase 2b study 209668 (B-Clear), which tested 24 weeks of bepirovirsen monotherapy with NA background therapy followed by 24 weeks of NA-only therapy in NA-suppressed chronically infected patients. The criteria for plausible virtual patient cohort generation are: (1) the plausible virtual cohort has HBsAg distributions at the baseline (week 0), end-of-bepirovirsen treatment (week 24), and at the end-of-NA-only period (week 48; also the end-of-study) similar to those enrolled into the B-Clear trial, and (2) simulation of the plausible virtual cohort yields similar percentages of virtual patients with sustained virological response (undetectable HBsAg and HBV DNA) at the end-of-study (week 48) as that seen in the B-Clear trial (based on statistical analysis of clinical data in November 2021). Note that virtual patients were stratified into two groups - those with baseline HBsAg lesser than or greater than 1000 - since bepirovirsen was found to be much more efficacious in the former and the latter is a hard-to-treat population. Characteristics of the plausible virtual patient cohorts agreed with clinical populations with respect to both criteria above (Table 8).

[0253] Table 8. Agreement of plausible virtual cohorts with clinical data from the B-Clear trial.

[0254] Distribution of Subjects (%) Example 3 - In si / ico clinical trials assessing the efficacy of RNAi+bepirovirsen sequential regimens compared to bepirovirsen monotherapy

[0255] In si / ico clinical trials were performed to assess the efficacy of a sequential combination of RNAi + bepirovirsen using the plausible virtual cohorts of chronically infected NA-suppressed patients generated in Example 2. The "combination" treatment arm consists of 16-24-weeks of RNAi treatment with NA background therapy, followed by 24-weeks of bepirovirsen treatment with NA background therapy, followed by 24 weeks of NA-only therapy (NA consolidation phase), followed by 24-weeks off-treatment. In silico trials thus last 96-weeks (FIG. 3A) and sustained virological response at week 96 is consistent with the definition of functional cure. The "comparator" arm in these trials is bepirovirsen monotherapy with NA background therapy (FIG. 3A).

[0256] The B-Clear trial and other real-world clinical trials have shown that populations with higher baseline HBsAg are more difficult to treat. To capture this in our in silico trials, the plausible virtual cohort is stratified in two ways: firstly into two subsets with baseline HBsAg lesser than 1000 (N = 6064) or greater than 1000 (N = 9844), and secondly into two subsets with baseline HBsAg lesser than 3000 (N = 9690) or greater than 3000 (N = 6218). Multiple doses and dosing regimens of RNAi were explored in the first treatment phase from weeks 0-24: 50 mg, 100 mg, or 200 mg doses, and either Q4W (6 doses at weeks 0, 4, 8, 12, 16, 20) or Q8W (3 doses at weeks 0, 8, 16).

[0257] Across regimens, the combination arm is more efficacious than the comparator arm. In the first stratification at HBsAg of 1000 (FIG. 3B), in the subset of virtual patients with baseline HBsAg < 1000, the combination yields a functional cure rate of 42.1 % - 45.3 % (depending on the RNAi dosing regimen) in contrast to 36.8 % with the comparator arm. In the population with baseline HBsAg > 1000, the combination yields 7.9 % - 10.9 % functional cure in contrast to 2.1 % with the comparator. Similarly, with the second stratification at a HBsAg of 3000 (FIG. 3C), the combination yields functional cure rates of 30.2 % - 33.5 % in contrast to 23.9 % with the comparator in the baseline HBsAg < 3000 population, and 6.2 % - 9.2 % in contrast to 1.6 % with the comparator in the baseline HBsAg > 3000 population.

[0258] In silico trials are also employed to assess whether the NA consolidation phase (weeks 48-72; schematic in FIG. 3A) could be shortened without impacting functional cure rates at the end of the study. This could not only have implications for shortening clinical trials, but also inform treatment schedules with the combination of RNAi and bepirovirsen. FIG. 4A shows the schematic for similar virtual trials as in FIG. 3, but with progressively shorter NA consolidation phases, including a scenario with no NA consolidation. With either 50 mg or 200 mg RNAi (Q4W dosing) in combination with bepirovirsen, shortening or eliminating the NA consolidation phase had no impact in populations with either low or high baseline HBsAg (FIG. 4B, C). (The marginal increase in functional cure rates observed with shorter NA consolidation phases is likely to be a transient effect due to shorter duration of these trials.). Similarly, changing the duration of RNAi therapy between 12-48 weeks (illustrated using a DAP / TOM dosing regimen at 200 mg Q4W) in FIG 5A, B, and / or shortening the duration of bepirovirsen from 24 to 12 weeks in FIG. 5C, D, have marginal impacts on functional cure rates. Finally, we show that a NA-treatment-naTve population subjected to the sequential combination of DAP / TOM followed by bepirovirsen without NA-background therapy also shows improved functional cure compared to bepirovirsen monotherapy (FIG. 5 E, F). Example 4 - Sequential daplusiran / tomligisiran and bepirovirsen PK-HBsAg model generation

[0259] A semi-mechanistic exposure response model was previously developed to describe the full timecourse of bepirovirsen exposures and HBsAg changes following subcutaenous administration, including the identification of covariates that may impact exposure and / or response. This model was updated to incorporate pharmacokinetic (PK) and response (HBsAg) data from daplusiran / tomligisiran (DAP / TOM), hereby referred to as the "PK-HBsAg" model. Altogether, the updated PK-HBsAg model (illustrated in FIG. 6) was used to describe the full time-course of sequential DAP / TOM followed by bepirovirsen exposures and HBsAg changes following drug administration.

[0260] The population pharmacokinetic analysis (PPK) for bepirovirsen was first developed to adequately describe the plasma concentration time profiles in healthy participants and patients with CHB. The objective of the analysis was to estimate the PK parameters for bepirovirsen that describe the timecourse of drug in the body and identify potential covariates that could potentially impact bepirovirsen exposure. Based on exploratory analysis of clinical trial data, structural PK model model development for bepirovirsen was initiated using a 3-compartment structural model with first-order absorption. After administration into a subcutaneous depot compartment, bepirovirsen is absorbed into a central compartment, with an absorption delay (ALAG1), which is characterized by a central volume of distribution (V2). The distribution of bepirovirsen to and from the central compartment to two separate peripheral compartments (V3 and V4) are characterized by intercompartmental clearance parameters (Q3 and Q4). From the central compartment, bepirovirsen can also undergo linear elimination, described by a clearance parameter (CL). Interindividual variability (IIV) was estimated for each parameter to describe differences in parameters between subjects, and enters the model as a component of the expression defining a model parameter as such:

[0261] Xj = Xj x enJ , where Xj is the true value of the X parameter in the jthindividual; X is the population mean value of parameter X in the jthindividual, and n* is the IIV between the true and population mean value of parameter X in the jthindividual. In addition, residual variability (o2) for bepirovirsen concentrationtime data represents a composite of unexplained variability, and is calculated as follows: Cpij — Cpij X 1 + £cw,ij') as a proportional error model, where Cp,7is the measured value of the ithplasma concentration value in the jthindividual; Cp^ is the ithplasma bepirovirsen concentration in the jthindividual predicted using the specified model, and £CVv,ij is the random variable representing the proportional component of residual variability. Covariate analysis revealed baseline weight to be a significant covariate on CL and V2, as well as patient population (CHB) on V3. Final model parameters and covariates can be found in Table 10 under "Bepirovirsen PK Parameters". Sunsequently, the PPK model was incorporated into the PKPD model, which describes the time-course of bepirovirsen exposure and inhibition of HBsAg. The individual post-hoc parameters from the final PPK model were used for the PK-HBsAg model. The population PK-HBsAg model was composed of an indirect-response model with a series of transit compartments to capture the delay between the start of bepirovirsen treatment and reduction of HBsAg in the serum. Drug effect was modelled as a Hilllike equation, with bepirovirsen inhibiting the synthesis of HBsAg. The following parameters were estimated: baseline HBsAg (SAGO), elimination rate constant of HBsAg from serum (kdeg, HBsAg), transit rate of HBsAg between compartments (ktr, HBsAg), bepirovirsen resulting in a 50% reduction in HBsAg synthesis (IC50), and a Hill coefficient. The Imax parameter was initially estimated using a logit transform, although the estimated value was very close to 1, and hence the Imax was fixed to a value of 1 (indicating full inhibition). To link reduction of HBsAg to clinical outcome, an HBsAg nadir threshold associated with sustained response (HBsAg < LLOQ from end of bepirovirsen treatment through end of study) was incorporated as a model parameter (SRrhreshoid). Baseline HBsAg level and nucleot(s)ide treatment status were found to be significant covariates on IC50. IIV was estimated for all model parameters using exponential error models assuming the parameters were log-normally distributed. Equations used to describe inhibition of HBsAg synthesis are listed in Table 9. Final model parameters can be found in Table 10 under "HBsAg Turnover Parameters" and "Bepirovirsen Efficacy Parameters." Finally, the PPK model for DAP / TOM was incorporated into the PK-HBsAg model to describe the timecourse of DAP / TOM following subcutaneous administration. The plasma PKof DAP / TOM was described using a two-compartment disposition model with linear elimination and a sequential zero-order and first-order absorption process for each trigger. After absorption, both triggers distribute into the central compartment, which is characterized by a central volume of distribution (Vc). The distribution from the central compartment to the peripheral compartment is characterized by intercompartmental clearance (QDAP, QTOM) and peripheral volume of distribution (Vp) for each trigger, which define the transfer rate constant from central to peripheral compartments and vice versa. From the central compartment, daplusiran and tomligisiran could each be eliminated via a non-saturable elimination pathway, quantified by the trigger-specific plasma elimination clearances (CLDAP, CLTOM) (T'Jollyn et al., Understanding the Dynamics of HBsAg Decline Through Model-Informed Drug Development (MIDD) of siRNA and CAM-N for the Treatment of Chronic Hepatitis B Infection. Poster presented at: European Association for the Study of the Liver, 2022. Poster abstract #370)

[0262] The PK-HBsAg turnover model used to describe inhibition of HBsAg synthesis in response to bepirovirsen was repurposed to describe inhibition of HBsAg synthesis by DAP / TOM. The existing turnover model was used without parameter re-estimation, utilizing the same equations listed in Table 9, and the same HBsAg turnover parameters. To incorporate DAP / TOM efficacy, the DAP / TOM drug- related efficacy parameters were used, as listed in Table 10. Together, the PK-HBsAg model combined the PPK models of bepirovirsen and DAP / TOM, and the HBsAg turnover model for both compounds. The final model was then used to simulate dosing scenarios that would inform the optimal regimen for sequential DAP / TOM and bepirovirsen treatment.

[0263] Table 9 Table 10

[0264]

[0265]

[0266] Example 5 - Daplusiran / tomligisiran and bepirovirsen PK-HBsAg model validation

[0267] To validate the use of the daplusiran / tomligisiran and bepirovirsen PK-HBsAg model to characterize daplusiran / tomligisiran PK / PD, simulations were conducted to produce visual predictive checks (VPCs) capturing the time-course of HBsAg following daplusiran / tomligisiran and bepirovirsen treatment individually.

[0268] For bepirovirsen, the model was used to simulate each participant included in the model 1000 times, and validated against observed data. The VPCs demonstrated good agreement was seen between model-based simulations and observed data from the B-Clear Study (FIG. 7). For DAP / TOM, the simulated data was sampled from the distribution of demographics from participants in REEF-1 and AROHBVIOOl and was validated against observed clinical data from those studies (FIG. 8). VPCs demonstrated good agreement between predicted and observed HBsAg concentrations following treatment with daplusiran / tomligisiran. The fact that good agreement is observed with model based simulations dosing with bepirovirsen and daplusiran / tomligisiran separately is evidence of the predictive power of the model.

[0269] Example 6 - Simulation of sequential daplusiran / tomligisiran and bepirovirsen treatment regimen

[0270] Population PK / PD model-based simulations of HBsAg following dosing with various regimens of daplusiran / tomligisiran (DAP / TOM) followed by bepirovirsen were performed using mrgsolve (vO.11.1). For the simulations, individual parameters were sampled using the omega matrix from the final models. Weight (PK), age (PD), and baseline HBsAg (PD) were included as covariates on bepirovirsen parameters; and creatinine clearance (PK), baseline weight (PK), Asian race (PD), baseline weight (liver PK) were included as covariates on DAP / TOM parameters. For the effect of baseline HBsAg on bepirovirsen ICso, the HBsAg level at the start of bepirovirsen treatment was used (i.e. at the end of DAP / TOM treatment period). Continuous demographics and patient characteristics were sampled from a normal distribution based on observed mean and standard deviation from the Phase 2b study 209668 (B-Clear), including age (45.5 ± 11.32 years) and baseline weight (71.2 ± 14.7 kg). 50% of participants simulated were assumed to be of Asian race to reflect the observed population in B-Clear.

[0271] Using the PK-HBsAg model, clinical trial simulations were completed for three populations: 1) Subjects with baseline HBsAg > 3000 lU / mL, 2) Subjects with baseline HBsAg < 3000 lU / mL, and 3) An overall population with a distribution of baseline HBsAg reflective of the on-NA group in B-Clear (62% <3000 lU / mL, 38% >3000 lU / mL). Each simulation included 150 subjects to reflect a sample size similar to the proposed Phase 2b study design. The simulations were conducted for two doses of daplusiran / tomligisiran (combined dose of 50 mg Q4W and combined dose of 200 mg Q4W for 24 weeks), followed by bepirovirsen (300 mg weekly for 24 weeks plus loading doses). Bepirovirsen plus standard of care alone was also simulated as a control arm.

[0272] Each simulation was repeated 100 times, and the proportion of participants with HBsAg <LLOQ was summarized at the end of DAP / TOM treatment period (Week 24), the end of bepirovirsen treatment period (Week 48), at 36 weeks after the end of bepirovirsen treatment period (Week 84), and at 48 weeks after the end of bepirovirsen treatment period (Week 96). For each endpoint, the mean, median, and 95% CI for proportion of participants with HBsAg <LLOQ were calculated across the 100 repeated simulations. The results of the simulations are shown in Table 11 and FIG. 9. Table 11

[0273] The results simulation suggest an increased proportion of participants achieving HBsAg < LLOQ with sequential therapy than with bepirovirsen plus nucleotide / nucleoside analogue therapy alone in patients with HBSAg baseline >3000 Ill / mL or <3000 Ill / mL, although higher levels of functional cure are observed in the <3000 Ill / mL population (Table 11, FIG. 9). Both doses of DAP / TOM are predicted to demonstrate added benefit with 30.5% of participants in the overall population receiving 200 mg Q4W achieving HBsAg < LLOQ at Week 84 and with 29.1% of participants achieving HBsAg < LLOQ at Week 96. 28.4% of participants in the overall population receiving 50 mg Q4W achieve HBsAg < LLOQ at Week 84 and 27.4% achieve HBsAg < LLOQ at Week 96. This compares with to 15.2% at Week 84 and with 14.5% at Week 96 in patients treated with 24 weeks of bepirovirsen plus nucleotide / nucleoside analogue therapy. Overall, the PK-HBsAg model describing HBsAg in response to sequential DAP / TOM and bepirovirsen therapy was able to provide predictions for HBsAg inhibition at the two doses of interest tested, and provides confidence in the combination.

[0274] Example 7 - B-UNITED clinical study

[0275] A Phase 2b, multi-centre, randomised, partially placebo-controlled, double-blind study is proposed to investigate the safety and efficacy of sequential therapy with daplusiran / tomligisiran followed by bepirovirsen in participants with chronic hepatitis B virus on background nucleos(t)ide analogue therapy (B-United). The study will compare two different sequential regimens of daplusiran / tomligisiranfollowed by bepirovirsen in patients with chronic hepatitis B without cirrhosis on background nucleoside / nucleotide analogue (NA) therapy.

[0276] The study proposed has a two-cohort design which is illustrated in FIG 10 and tests two different dose regimens of daplusiran / tomligisiran (200 mg, Q4W for 20 weeks, and 50 mg Q4W for 20 weeks). NA therapy is stopped at in patients in which HBV DNA <LLOQ and HBsAg is not detected (as assessed by qualitative HBsAg assay) 24 weeks from the final dose of Bepirovirsen (i.e. Week 72).

[0277] The primary endpoint of the study will be functional cure (FC) response 24 weeks after the nucleotide cessation timepoint (Week 96) in the all-comers population (baseline HBsAg >100 lU / mL). in the absence of rescue medication. ( defined as any medication with proven anti-HBV activity newly initiated for the purpose of HBV control (rescue medication includes NA re-treatment after NA cessation). Key secondary endpoints are expected to be FC response in the baseline HBsAg>3000 lU / mL and baseline HBsAg <3000 lU / mL sub-populations.

Claims

CLAIMS1. A method for treating chronic hepatitis B in a subject receiving treatment with nucleotide / nucleoside analogue therapy, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

2. A method according to claim 1, wherein functional cure is achieved.

3. A method for achieving functional cure in a subject having chronic hepatitis B and receiving treatment with a nucleotide / nucleoside analogue therapy, wherein: a) the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 12 weeks; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide for a period of at least 12 weeks, wherein the antisense oligonucleonucleotide comprises the sequence set out in SEQ ID NO: 49, wherein the antisense oligonucleotide optionally contains one or more modified nucleotides and wherein one or more internucleoside linkages of the antisense oligonucleotide are a modified internucleoside linkage.

4. A method according to any preceding claim, wherein one of the one or more RNAi agents comprises an antisense strand that is at least partially complementary to a target sequence in the S ORF between nucleotides 1-1307 of the Hepatitis B virus subtype (ADW2) genotype A (AM282986.1) genome.

5. A method according to claim 4, wherein one of the one or more RNAi agents comprises an antisense strand that is at least partially complementary to a target sequence in the S ORF between nucleotides 261 to 281 of the Hepatitis B virus genotype D having GenBank accession number U95551.1.

6. A method according to claim 5, wherein one of the one or more RNAi agents comprises an antisense strand that includes a portion that is fully complementary to a target sequence in the S ORF between nucleotides 274 to 280 of the Hepatitis B virus genotype D having GenBank accession number U95551.

17. A method according to claim 4, wherein one of the one or more RNAi agents comprises an antisense strand that is at least partially complementary to a target sequence having a sequence that is any one of SEQ ID NO: 1-3 or SEQ ID NO: 7.

8. A method according to claim 7, wherein one of the one or more RNAi agents comprises:SEQ ID NO: 11 and SEQ ID NO: 12; orSEQ ID NO: 13 and SEQ ID NO: 12; orSEQ ID NO: 14 and SEQ ID NO: 15; wherein the RNAi agents optionally contain one or more modified nucleotides and / or one or more modified internucleoside linkages, and wherein the RNAi agents optionally comprises a targeting ligand.

9. A method according to claim 8, wherein the one or more RNAi agents additionally comprise an RNAi targeting the X ORF comprising SEQ ID NO: 16 and SEQ ID NO: 17; wherein the RNAi agents optionally contain one or more modified nucleotides and / or one or more modified internucleoside linkages, and wherein the RNAi agent optionally comprises a targeting ligand.

10. A method according to claim 7, wherein one of the one or more RNAi agents comprises: an RNAi agent targeting the S ORF of HBV comprising:SEQ ID NO: 24 and SEQ ID NO: 32 or 33; orSEQ ID NO: 25 and SEQ ID NO: 32 or 33; orSEQ ID NO: 26 and SEQ ID NO: 32 or 33; orSEQ ID NO: 27 and SEQ ID NO: 34; wherein the RNAi agent optionally comprises a targeting ligand.

11. A method according to claim 10, wherein the one or more RNAi agents additionally comprise an RNAi agent targeting the X ORF comprising SEQ ID NO: 28 and SEQ ID NO: 35 or 36, wherein the RNAi agents optionally comprise a targeting ligand.

12. A method according to claim 10, wherein one of the one or more RNAi agents comprises: an RNAi agent targeting the S ORF of HBV that comprises a targeting ligand and has the structure set out in:SEQ ID NO 24: and SEQ ID NO: 41, 42 or 43; orSEQ ID NO 25: and SEQ ID NO: 41, 42 or 43; orSEQ ID NO 26: and SEQ ID NO: 41, 42 or 43; orSEQ ID NO: 27 and SEQ ID NO: 44.

13. A method according to claim 12, wherein the one or more RNAi agents additionally comprise an RNAi targeting the X ORF which comprises a targeting ligand and has the structure set out in: SEQ ID NO: 28 and SEQ ID NO: 45, 46 or 47.

14. A method according to claim 12, wherein the one or more RNAi agents comprises an RNAi agent targeting the S ORF comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and an RNAi agent targeting the X ORF comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45.

15. A method according to claim 7, wherein the one or more RNAi agents comprises an RNAi agent having an antisense strand consisting of SEQ ID NO: 29 and a sense strand consisting of SEQ ID NO: 48.

16. A method according to claim 7, wherein the one or more RNAi agents comprises an RNAi agent having an antisense strand consisting of SEQ ID NO: 40 and a sense strand consisting of SEQ ID NO:38.

17. A method according to claim 7, wherein the one or more RNAi agents comprises an RNAi agent having an antisense strand consisting of SEQ ID NO: 31 and a sense strand consisting of SEQ ID NO:39.

18. A method according to any preceding claim, wherein the subject exhibits HBsAg levels in the blood <3000 Ill / mL following treatment of the RNAi agent in step (a).

19. A method according to any preceding claim, wherein the antisense oligonucleonucleotide comprises: a gap segment consisting of linked deoxynucleosides, a 5' wing segment consisting of linked nucleosides, and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

20. A method according to claim 19, wherein the antisense oligonucleonucleotide has the sequence set out in SEQ ID NO: 50.

21. A method according to claim 19, wherein the antisense oligonucleonucleotide has the sequence set out in SEQ ID NO: 51.

22. A method according to any preceding claim, wherein the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of at least 20 weeks.

23. A method according to claim 22, wherein the subject is treated with a therapeutically effective amount of one or more RNAi agents targeting HBV for a period of about 24 weeks.

24. A method according to any preceding claim, wherein the subject is treated with a therapeutically effective amount of the antisense oligonucleotide for a period of about 24 weeks.

25. A method according to any preceding claim, wherein the one or more RNAi agents targeting HBV are administered by subcutaneous administration.

26. A method according to claim 23, wherein the one or more RNAi agents targeting HBV are administered in a combined dose of between 20 and 400 mg per administration with a dosing interval ranging from once per week to once every eight weeks.

27. A method according to any preceding claim, wherein the antisense oligonucleotide is administered by subcutaneous administration.

28. A method according to any one of claims 22 to 27, wherein the antisense oligonucleotide is administered at a dose of about 150 mg to 450 mg once weekly.

29. A method according to claim 28, wherein the antisense oligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

30. A method for treating chronic hepatitis B in a subject receiving treatment with nucleotide / nucleoside analogue therapy, wherein: a) the subject is treated with a first RNAi agent comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and a second RNAi agent comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45 at a combined dose of 50-200 mg Q4W for about 24 weeks, wherein the ratio of the first RNAi agent to the second RNAi agent is about 2:1; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide having the sequence set out in SEQ ID NO: 51, wherein the antisense oligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

31. A method for achieving functional cure in a subject having chronic hepatitis B and receiving treatment with a nucleotide / nucleoside analogue therapy, wherein: a) the subject is treated with a first RNAi agent comprising an antisense strand consisting of SEQ ID NO: 25 and a sense strand consisting of SEQ ID NO: 42, and a second RNAi agent comprising an antisense strand consisting of SEQ ID NO: 28 and a sense strand consisting of SEQ ID NO: 45 at a combined dose of 50-200 mg Q4W for about 24 weeks, wherein the ratio of the first RNAi agent to the second RNAi agent is about 2:1; b) the subject is then treated with a therapeutically effective amount of an antisense oligonucleotide having the sequence set out in SEQ ID NO: 51, wherein the antisenseoligonucleotide is administered at a dose of about 300 mg once weekly for 24 weeks, with additional loading doses each of 300 mg, on Day 4 and Day 11 following the first dose.

32. A method according to claim 30 or claim 31 wherein the combined dose of the first and second RNAi agents is 50 mg Q4W for about 24 weeks.

33. A method according to claim 30 or claim 31 wherein the combined dose of the first and secondRNAi agents is 200 mg Q4W for about 24 weeks.

34. A method according to any preceding claim, wherein the subject has a baseline level of HBSAg <3000 Ill / mL.

35. A method according to any preceding claim, wherein the subject does not have cirrhosis.

36. A method according to any preceding claim, wherein the subject with chronic hepatitis B is not co-infected with HDV, HCV and / or HIV.

37. A method according to any preceding claim, wherein the subject is HBeAg negative prior to treatment.

38. A method according to any preceding claim, wherein the nucleotide / nucleoside analogue therapy is discontinued 24 weeks after the final dose of the antisense oligonucleotide.

Citation Information

Patent Citations

  • Methods for treating hepatitis B infection

    US11052104B2

  • Targeted compositions

    US11427823B2

  • Delivery of substances to cells

    WO2000053722A2

  • Polyconjugates for in vivo delivery of polynucleotides

    WO2008022309A2

  • Compositions for targeted delivery of sirna

    WO2011104169A1