Fn vitro methods for rapid and precise diagnosis of plasmodium infection

Abstract

The present invention relates to an in vitro method for simultaneously detecting and / or quantifying DNA from Plasmodium genus species and / or DNA from Plasmodium falciparum species by using specifically designed primers and to the use of this method for malaria diagnosis and anti-malaria treatment follow-up.

Description

[0001] IN VITRO METHODS FOR RAPID AND PRECISE DIAGNOSIS OF PLASMODIUM INFECTIONTECHNICAL FIELD OF THE INVENTIONThe present invention is in the field of pathogen detection and / or quantification fordiagnostic and therapeutic purposes. It relates to an in vitro method for simultaneouslydetecting and / or quantifying DNA from Plasmodium genus and DNA from Plasmodiumfalciparum species, as well as to an in vitro method for detecting and / or quantifying DNAfrom Plasmodium falciparum species or DNA from other Plasmodium species. The presentinvention also relates to a method for monitoring the efficacy of a treatment againstmalaria and a method for detecting a Plasmodium infection relapse or a new Plasmodiuminfection. In addition, the present invention concerns a kit comprising specific primers for the implementation of the methods of the invention. BACKGROUND ART Malaria is a vector-borne disease transmitted by a protozoan parasite of the genusPlasmodium. Most human cases are caused by Plasmodium falciparum and Plasmodiumvivax. Other species involved are Plasmodium ovale curtisi, Plasmodium ovale wallikeri,Plasmodium malariae and Plasmodium knowlesi. Approximatively half of the world'spopulation, spread across 97 countries and territories, is at risk of infection. Between 2000 and 2015, malaria incidence declined by 37%. Mortality rate decreased by 60% among all age groups and by 65% among children under 5 years. Despite this, 216 million cases and 450,000 deaths were counted in 2017, mostly in Africa and among children under 5 years. P. falciparum is involved in most severe malaria cases. Due to the increasing number of travels to malaria-endemic areas, the number of imported malaria cases in Europe is increasing. According to the European Center for Disease Prevention and Control(ECDC), metropolitan France has the highest burden of imported malaria cases in Europe,with an estimated 5,540 cases in 2019. This represented a 6.3% increase as compared to 2017 (Annual Activity Report 2020, National Reference Center of malaria). Thepredominant species diagnosed was P. falciparum (87.8%).Different techniques are recommended for the routine diagnosis of malaria in the laboratory. The reference method is still the visualization of trophozoites or schizonts bydirect examination of blood smears (BS) by light microscopy. Microscopy allows both thespecies diagnosis and estimation of the parasitemia (determination of specificPlasmodium species) in order to evaluate the severity of the access. However, thin smearspresent a limited sensitivity of 200 parasites / µL of blood and require a skilled operator.Indeed, it is sometimes difficult to detect low parasitemia and to differentiate someplasmodial species, based on their morphological characteristics, such as P. ovale and P.vivax. Correct identification of the species is essential to treat the patient withappropriate drug and to avoid relapses. The use of thick smear overcomes the lack ofsensitivity of the thin smear, with an estimated sensitivity of 10 parasites / µL of blood.However, this technique cannot be used for species diagnosis. Immunochromatographicrapid diagnostic tests (POC) are used in addition to microscopy, and are fast and easy to use, but they are associated with lower sensitivity and specificity especially in non-P.falciparum malaria cases or in mixed infections.In many French laboratories, the molecular diagnosis of malaria is performed using a loop- induced isothermal amplification (LAMP) method based on Illumigene®malaria assay (Meridian Bioscience Inc., Cincinnati, OH, USA). LAMP allows for rapid results and has optimal (~100%) sensitivity. However, this LAMP assay is not able to identify the speciesinvolved, assess parasitemia and identify biparasitism. In recent years, many polymeraseschain reaction (PCR) tests have been developed to detect, identify and quantify thedifferent species of Plasmodium in blood. To date however, no real-time quantitative PCR(qPCR) has been developed to detect and discriminate the five plasmodial speciesinvolved in human pathology.There is thus still a need for a method for detecting an infection by a parasite of thePlasmodium genus that would be rapid and sensitive and that would also be able toefficiently discriminate between the different species of Plasmodium involved in humaninfection. In addition, the method should preferably be optimized to reduce the cost of the detection. SUMMARY OF THE INVENTIONThe present invention solves this problem. The inventors of the present invention indeeddesigned specific primers and probes to be used in a qPCR assay, which allow in a firstmultiplex assay the very rapid and simultaneous identification and quantification of thepresence of any Plasmodium species involved in human infection (using primers and probeable of pan-species amplification) and also specifically of P. falciparum (using primersand probe able of specific P. falciparum amplification). In a second assay, and only whenthe first step permits to conclude to the presence of a Plasmodium species other than P. falciparum, the set of primers and probes designed by the inventors also allows the rapid detection and quantification of the other five plasmodial species mainly involved inhuman infection. The developed primers and probes are used in an in vitro methodallowing to perform species diagnosis, parasitemia quantification, low parasitemiadetection and biparasitism cases detection in a biological sample of a patient suspectedto be infected by a Plasmodium species.Particularly, the inventors developed primers and probes to be used in an in vitrodetection and / or quantification method allowing to detect rapidly, with high sensitivityand in a reliable manner in a sample of a subject simultaneously the presence of aPlasmodium genus species and to determine if said Plasmodium species includes or isPlasmodium falciparum, which is the most dangerous Plasmodium species that needsrapid and appropriate therapeutic intervention.In a first aspect, the present invention thus relates to an in vitro method forsimultaneously detecting and / or quantifying DNA from Plasmodium genus and DNA fromPlasmodium falciparum species in a biological sample comprising nucleic acid molecules,the method comprising the steps of: (a1) contacting DNA of the biological sample with:o a first set of primers for the pan-amplification of DNA fromPlasmodium genus, comprising:^ a forward primer PanF1 of sequence SEQ ID NO:1 or itscomplementary sequence; and ^a reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; oa second set of primers for the specific amplification of DNA fromPlasmodium falciparum species, comprising:^ a forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and ^two reverse primers Pf1R2 and Pf2R2 of sequences SEQ IDNO:4 and 5 or their complementary sequences, respectively; and oreagents suitable for polymerase chain reaction (PCR)amplification; (b1) amplifying DNA from Plasmodium genus with the first set of primersto generate a first amplicon and DNA from Plasmodium falciparum specieswith the second set of primers to generate a second amplicon; (c1) detecting the presence or the absence of the first amplicon and thesecond amplicon, wherein the presence of the first amplicon is indicativeof the presence of DNA from Plasmodium genus in the sample and thepresence of the second amplicon is indicative of the presence of DNA fromPlasmodium falciparum species; and(d1) optionally, measuring the quantity of the first amplicon todetermine the amount of DNA from Plasmodium genus in the biologicalsample and / or measuring the quantity of the second amplicon to determine the amount of DNA from Plasmodium falciparum species in thebiological sample. In addition, the inventors were able to design primers capable to rapidly and accuratelydetect / quantify all species of Plasmodium genus different from Plasmodium falciparummainly involved in human infection, i.e. Plasmodium vivax, Plasmodium ovale curtisi,Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi. This isparticularly advantageous since to the inventors’ knowledge, none of the currently knowndetection / quantification methods allows to also rapidly and reliably detect / quantify thefive Plasmodium species other than P. falciparum, including notably Plasmodiumknowlesi, considered as being difficult to detect.In a second aspect, the present invention thus relates to an in vitro method for detectingand / or quantifying DNA from Plasmodium falciparum species or DNA from a Plasmodiumspecies selected from Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovalewallikeri, Plasmodium malariae and Plasmodium knowlesi in a biological samplecomprising nucleic acid molecules, the method comprising the steps of: ^taking a first sub-sample from the biological sample;^ simultaneously detecting and / or quantifying DNA from Plasmodium genusand DNA from Plasmodium falciparum species in the first sub-sample usingthe method according to the first aspect of the invention; ^when DNA from Plasmodium genus is detected or quantified and / or DNAfrom Plasmodium falciparum species is detected or quantified in the firstsub-sample: i) taking a second, a third, a fourth and a fifth sub-sample from thebiological sample; ii) contacting:^ DNA of the second sub-sample with a set of primers for thespecific amplification of DNA from Plasmodium vivax species,comprising: oa forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and oa reverse primer PvR2 of sequence SEQ ID NO:8 or itscomplementary sequence; ^DNA of the third sub-sample with a set of primers for the specificamplification of DNA from Plasmodium ovale curtisi andPlasmodium ovale wallikeri species, comprising:o a forward primer PoF1 of sequence SEQ ID NO:9 or itscomplementary sequence; and oa reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; ^DNA of the fourth sub-sample with a set of primers for thespecific amplification of DNA from Plasmodium malariae species,comprising: oa forward primer PmF1 of sequence SEQ ID NO:10 or itscomplementary sequence; and oa reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; ^DNA of the fifth sub-sample with a set of primers for the specificamplification of DNA from Plasmodium knowlesi species,comprising: oa forward primer PkF1 of sequence SEQ ID NO:11 or itscomplementary sequence; and oa reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; iii) amplifying DNA from Plasmodium vivax species in the second sub-sample, DNA from Plasmodium ovale curtisi and / or Plasmodium ovalewallikeri species in the third sub-sample, DNA from Plasmodiummalariae species in the fourth sub-sample, and DNA from Plasmodiumknowlesi species in the fifth sub-sample;iv) detecting the presence or the absence of an amplicon in the second,third, fourth and fifth sub-samples, wherein: ^the presence of an amplicon in the second sub-sample isindicative of the presence of DNA from the Plasmodium vivax species; ^the presence of an amplicon in the third sub-sample is indicativeof the presence of DNA from the Plasmodium ovale species; ^the presence of an amplicon in the fourth sub-sample isindicative of the presence of DNA from the Plasmodium malariae species; ^the presence of an amplicon in the fifth sub-sample is indicativeof the presence of DNA from the Plasmodium knowlesi species;v) optionally, measuring the quantity of:^ the amplicon in the second sub-sample to determine the amountof DNA from Plasmodium vivax species in the sample;^ the amplicon in the third sub-sample to determine the amountof DNA from Plasmodium ovale species in the sample;^ the amplicon in the fourth sub-sample to determine the amountof DNA from Plasmodium malariae species in the sample;^ the amplicon in the fifth sub-sample to determine the amount ofDNA from Plasmodium knowlesi species in the sample.Since the methods disclosed above are rapid, reliable and have excellent sensitivity todetect all Plasmodial species, they may be efficiently used in the context of thetherapeutic management of patients. Particularly, since these methods allow todetermine genomic copy number of parasite, they may be used to monitor post-therapeutic response of a subject treated with anti-malaria drugs.In this regard, in a third aspect, the present invention also relates to a method formonitoring the efficacy of a treatment against malaria in a subject from a first biological sample obtained from the subject before starting the treatment and a second biological sample obtained from the subject after starting the treatment, the method comprisingdetecting and / or quantifying DNA from Plasmodium falciparum species or DNA from aPlasmodium species selected from Plasmodium vivax, Plasmodium ovale curtisi,Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi in the firstand second biological samples by the detection / quantification methods of the inventiondisclosed above, wherein the absence in the second biological sample of DNA from thePlasmodium species detected in the first biological sample or decrease in the secondbiological sample compared to the first biological sample of the amount of DNA from thePlasmodium species quantified is indicative that the treatment is efficient.Due to the excellent specificity and sensitivity of the methods of the invention allowingto detect and / or quantify Plasmodium falciparum and the other Plasmodium species, they may also be used as monitoring methods several time after the end of an anti-malariatreatment protocol in order to detect an infection relapse or a new Plasmodium infectionin the previously anti-malaria treated subject.In a fourth aspect, the present invention thus relates to a method for detecting aPlasmodium infection relapse or a new Plasmodium infection in a subject from a firstbiological sample obtained from the subject at the end of an antimalarial treatment and a second biological sample obtained from the subject at a later stage, the methodcomprising detecting and / or quantifying DNA from Plasmodium falciparum species or DNAfrom a Plasmodium species selected from Plasmodium vivax, Plasmodium ovale curtisi,Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi in the firstand second samples using the detection / quantification methods of the inventiondescribed above, wherein the presence in the second biological sample of DNA from aPlasmodium species not detected in the first biological sample or the increase in thesecond biological sample compared to the first biological sample of the amount of DNAfrom a Plasmodium species is indicative of a Plasmodium infection relapse or a newPlasmodium infection in a subject.As indicated above, the advantageous effect of the present invention is particularly dueto the specific design of the primers and probes sequences used in the methods of theinvention. These primers may be used to manufacturing a kit to be used preferably in themethods of the invention disclosed above.Therefore, the present invention also relates to a kit comprising: i) a first set of primers for the pan-amplification of DNA from Plasmodium genus, comprising: ^a forward primer PanF1 of sequence SEQ ID NO:1 or itscomplementary sequence; and ^a reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; ii) a second set of primers for the specific amplification of DNA from Plasmodium falciparum species, comprising:^ a forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and ^two reverse primers Pf1R2 and Pf2R2 of sequences SEQ ID NO:4and 5 or their complementary sequences, respectively.The kit of the invention can further comprise the primers necessary to amplify DNAs fromPlasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodiummalariae and Plasmodium knowlesi. DESCRIPTION OF THE FIGURES Figure 1. Phylogenetic tree of the partial 18S rRNA sequences of the six species of malaria parasites infecting humans (P. falciparum, P. vivax, P. ovale curtisi, P. ovale wallikeri,P. malariae and P. knowlesi) and 3 phylogenetically related blood parasites (B. divergens,B. microti and T. gondii) were represented. The phylogenetic tree was built following theNeighbor Joining method correcting with Tamura-Nei method. Figure 2: Schematical presentation of the methods for simultaneously detecting and / orquantifying DNA from Plasmodium genus and DNA from Plasmodium falciparum species aswell as the other five species (P. vivax, P. ovale curtisi, P. ovale wallikeri, P. malariaeand P. knowlesi) in a biological sample of a patient.Figure 3. Flowchart of development and validation of qPCR. 38 clinical samples positivefor P. falciparum, P. vivax, P. ovale, P. malariae and one culture of P. knowlesi wereused for qPCRs development. To validate our qPCRs, 190 samples from patients diagnosed with malaria (87 samples on the day of diagnosis and 103 samples during post-treatment follow-up) and 333 samples from patients negative by conventional diagnostic methods were used.Figure 4. Comparison of plasmodial load for P. falciparum, P. vivax, P. ovale and P.malariae with pan-Plasmodium or specific-species qPCRs at the diagnosis of a singlespecies malaria. (a) plasmodial load with pan-Plasmodium qPCR, (b) plasmodial load withspecific-species qPCRs. Boxplot represent the interquartile range (IQR) with minimum (Q1– 1.5*IQR) and maximum (Q3 + 1.5*IQR). Black points represent each value of Cq, and largegrey point represent the Cq average. Cq, quantification cycle.Figure 5. Correlation between qPCR Plasmodium spp. and specific-species qPCRs at thesingle species malaria diagnosis. (a) P. falciparum (n = 59), (b) P. vivax (n = 7), (c) P.ovale (n = 10) and (d) P. malariae (n = 3). Scatterplot associated with linear trend allowsto study the relation between Cq values obtained by pan-Plasmodium and specific-speciesqPCR for each plasmodial species. Cq, quantification cycle. Figure 6. Correlation between parasite density estimated by BS and number of copieswith Plasmodium spp. qPCR at the single species malaria diagnosis for all species. (a) allparasitaemia, (b) focus on parasitaemia between more than 0.01 and less than 3%.Scatterplot allows to study the relation between number of copies obtained by pan-Plasmodium qPCR and the parasite density obtained by BS. Parasite density was expressedas parasites / µL. Parasitaemia below 0.01% or the presence of gametocytes alone were represented with a value of 0.005% or 222.5 parasites / µL. Figure 7. Representation of parasite density versus number of copies with Plasmodium spp. qPCR on all species at diagnosis and follow-up for single species malaria. Scatterplotallows to study the relation between number of copies obtained by pan-Plasmodium qPCRand the parasite density obtained by BS. A positive amplification > 45 cycles was considered positive at 45 cycles or 23.1 copies. Parasitaemia below 0.01% or the presenceof gametocytes alone were considered with a value of 0.005% or 222.5 parasites / µL. Greypoints represents the presence of gametocytes alone on BS.Figure 8. Persistence of circulant P. falciparum DNA during post-treatment follow-upwith pan-Plasmodium qPCR. (a) Boxplot represent the interquartile range (IQR) withminimum (Q1 – 1.5*IQR) and maximum (Q3 + 1.5*IQR) of the P. falciparum copy numberdecrease as a function of post-therapy follow-up. Black points represent each value of P.falciparum copy number, and large grey point represent the P. falciparum copy numberaverage. (b) Connected scatterplot represent the P. falciparum copy number decreasefor each patient.Figure 9. Persistence of circulant P. vivax, P. ovale and P. malariae DNA during post-treatment follow-up with pan-Plasmodium qPCR. (a) Boxplot represent the interquartilerange (IQR) with minimum (Q1 – 1.5*IQR) and maximum (Q3 + 1.5*IQR) of the plasmodialcopy number decrease as a function of post-therapy follow-up. Black points represent each value of plasmodial copy number, and large grey point represent the plasmodialcopy number average. (b) Connected scatterplot represent the plasmodial copy numberdecrease for each patient.Figure 10. Integration of Plasmodium qPCR assay in the biological diagnosis of malariaDETAILED DESCRIPTION OF THE INVENTIONIn the context of the present invention, the inventors designed specific primer sequencesto be used in real-time PCR method in order to detect and / or quantify rapidly (less than2 hours) and reliably Plasmodium genus species causing malaria. The major advantage ofthe methods of detection / quantification of the invention is the possibility todetect / quantify the presence of any species of the Plasmodium genus and to determinesimultaneously if the detected Plasmodium species includes or is Plasmodium falciparumor if one of the five other Plasmodium species that mainly infect human beings(Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodiummalariae and Plasmodium knowlesi) is present. Because the detection / quantification andthe identification of the Plasmodium genus species is very rapid and accurate with themethods of the invention, these methods may be used successfully as a diagnostic tool ofmalaria and also in the therapeutic management and follow-up of patients treated againstmalaria. Definitions Unless otherwise defined herein, all terms should be construed using their generalmeaning in the technical field of malaria diagnosis and therapy. The definitions below areapplicable to the whole application and each time the defined terms are used.As used herein, “Plasmodium genus” relates to a genus of unicellular eukaryotes thatare holoparasites of vertebrates and insects. The life cycles of Plasmodium species involvedevelopment in a blood-feeding insect host, which then injects parasites into a vertebratehost during a blood meal. Parasites grow within a vertebrate body tissue (often the liver)before entering the bloodstream to infect red blood cells (also referred to aserythrocytes). The ensuing destruction of host red blood cells can result in malaria.The Plasmodium genus consists of over 200 species, generally described on the basis oftheir appearance in blood smears of infected vertebrates. Humans are primarily infectedby five species of Plasmodium, as follows:^ Plasmodium falciparum (causing malignant tertian malaria);^ Plasmodium vivax (the most frequent cause of benign tertian malaria),^ Plasmodium ovale curtisi and Plasmodium ovale wallikeri (another, lessfrequent, cause of benign tertian malaria); ^Plasmodium malariae (causing benign quartan malaria)^ Plasmodium knowlesi (causing severe quotidian malaria in Southeast Asia)The overwhelming majority of severe malaria disease and death is caused by Plasmodiumfalciparum.As used herewith, the term “malaria” designs a mosquito-borne infectious disease thataffects humans and other vertebrates. Human malaria causes symptoms such as fever,fatigue, vomiting, and headaches. In severe cases, it can cause jaundice, seizures, coma,or death. Symptoms usually begin 10 to 15 days after being bitten by an infectedAnopheles mosquito. If not properly treated, people may have recurrences of the diseasemonths later. Human malaria is caused by the above-cited Plasmodium species. The maybe malaria of different type considering the species of Plasmodium causing the infection,the severity of symptoms and their frequency onset. Malignant tertian malaria is themost severe form of malaria, caused by Plasmodium falciparum, with severeconstitutional symptoms and sometimes causing death. Benign tertian malaria ischaracterized by fever that occurs every second day. It is considered benign as it is causedby P. vivax and P. ovale. Infection with these organisms has a very low mortality. Benignquartan malaria is characterized by fever that occurs every third day and is caused by P.malariae. Quotidian malaria is caused by P. knowlesi which is known to replicate every24 h in the human host causing a wide spectrum of clinical manifestations and sometimescan cause fatal illness.As used herewith, the term “biological sample” relates to any sample obtained from alive organism. The biological sample may be obtained from biological fluids or biologicalsolids. Biological fluids include extracellular fluids, intravascular fluids, interstitial fluids,lymphatic fluids and transcellular fluids. Particularly, a biological fluid sample may beselected from the group consisting of blood, urine, saliva, etc. In the context of thepresent invention, a preferred biological fluid sample is a blood sample. A biological solidsample is a sample obtained from cells, from tissues or from organs. A solid biologicalsample may notably be a cell or tissue sample obtained from a biopsy. In the context of the present invention, a preferred solid biological sample is obtained from spleen or from liver. In the present description, the term "subject" refers to mammals, preferably to a humanbeing. Particularly, the human subject is a subject likely to be infected by a Plasmodiumgenus species, particularly by Plasmodium falciparum, Plasmodium vivax, Plasmodiumovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae and / or Plasmodiumknowlesi (for diagnosis and therapeutic management purposes, a suspicion of Plasmodiuminfection can be deduced from the presence of malaria symptoms and the geographical area of residence of the subject in the preceding weeks or months) or a subject which has been diagnosed as suffering from a Plasmodium infection (for follow-up purposes, the diagnosis may have been done using a method of the invention or another method). As used herein, “amplify”, “amplifying” or “amplification reaction” and their derivatives, refer generally to any action or process whereby at least a portion of a nucleic acid molecule (referred to as a template nucleic acid molecule) is replicated or copied through a template-dependent in vitro enzyme-catalysed reaction into at least one additional nucleic acid molecule. The template nucleic acid molecule can be single- stranded or double-stranded and the additional nucleic acid molecule can independently be single-stranded or double-stranded. Amplification optionally includes linear or exponential replication of a nucleic acid molecule. One method which is commonly used for amplifying genetic material is the polymerase chain reaction (PCR). The PCR process is well known in the art (U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159). In PCR, nucleic acid primers that are complementary to opposite strands of a nucleic acid amplification target sequence are permitted to anneal to the denatured sample. Next, DNA polymerase (typically heat stable) extends the DNA duplex from the hybridised primer. The process is then repeated to amplify the nucleic acid target. If the nucleic acid primers do not hybridise to the sample, then there is no corresponding amplified PCR product. In this case, the PCR primer acts as a hybridisation probe. Preferably, the PCR technique used quantitatively measures starting amounts of DNA, cDNA, or RNA. Examples of PCR-based techniques include techniques such as, but not limited to, quantitative PCR (Q-PCR), reverse-transcriptase polymerase chain reaction (RT-PCR), quantitative reverse-transcriptase PCR (QRT-PCR), or digital PCR (dPCR). These techniques are well known and easily available technologies for those skilled in the art and do not need a precise description. The terms “quantitative PCR”, “qPCR”, “real-time quantitative polymerase chain reaction” or “kinetic polymerase chain reaction” refer to a PCR-based analysis thatdetermines a concentration and / or copy number of a target in a sample (i.e. quantifiesthe target). This technique simultaneously amplifies and quantifies target nucleic acids using PCR wherein the quantification is by virtue of an intercalating fluorescent dye that are only detectable once hybridized to a target nucleic acid or sequence-specific probes containing fluorescent reporter molecules that are only detectable upon sequence amplification. The term “real time PCR” refers to a PCR-based analysis in which amplicon formation is measured during the reaction, such as after completion of one or more thermal cycles prior to the final thermal cycle of the reaction. Real-time PCR generally provides quantification of a target based on the kinetics of target amplification.The term “multiplex PCR” refers to a PCR assay performed to amplify at least twodifferent nucleic acid sequences simultaneously in particular two, three, four, five, six, seven, eight or more different nucleic acid sequences simultaneously (as if performing many separate PCR reactions all together in one single pot). This process amplifies nucleic acids in samples using multiple primers. In particular, “multiplex PCR” includes “duplex PCR” (amplification of two distinct targets in only one reaction) and “triplex PCR” (amplification of three distinct targets in only one reaction). By opposition, a PCR assay performed to amplify one nucleic acid sequence is “simplex PCR”, often shortened in “PCR”.As used herein, the term “primer” refers to a short single-stranded polynucleotide,generally with a free 3'-OH group, that binds to a target nucleic acid by hybridizing with a target sequence, and thereafter promotes polymerization of a polynucleotide complementary to the target nucleic acid. Primers can be of a variety of lengths and are often less than 50 nucleotides in length, for example 12-30 nucleotides in length. Primerscan be DNA, RNA, or a chimera of DNA and RNA portions. A primer can be paired withanother compatible primer within an amplification or synthesis reaction to form a primerpair consisting of a forward primer and a reverse primer. “Primer pair” thus refers to aset of two distinct primers comprising a forward primer that hybridises to a single strand at one end of the DNA sequence to be amplified, and a reverse primer that hybridises with the other end on the complementary strand of the DNA sequence to be amplified. Generally, the forward primer primes synthesis of a first nucleic acid strand, and the reverse primer primes synthesis of a second nucleic acid strand, wherein the first andsecond strands are substantially complementary to each other or can hybridise to form adouble-stranded nucleic acid molecule.In addition, as used herein, the term “amplicon” refers to a nucleic acid product of anamplification reaction. An amplicon may be single-stranded or double-stranded, or a combination thereof.As used herein, the term “probe” refers to a molecule (e.g., a protein, nucleic acid,aptamer, etc.) that specifically interacts with or specifically binds to, and thus detects, a target polynucleotide. Generally, a probe is labeled with a detectable label. The probe can indicate the presence or amount of the target polynucleotide by either an increase or decrease in signal from the detectable label. In the context of the invention, a probe is preferably a labeled nucleic acid molecule complementary to a target sequence located between a forward and a reverse primer. Preferably, the probe may detect the target polynucleotide in an amplification reaction by being digested by the 5' to 3' exonuclease activity of a DNA dependent DNA polymerase, the digestion resulting in an increase ordecrease in signal from the detectable label. This may notably be the case when thenucleic acid probe comprises a fluorophore and a quencher. Before digestion by the 5' to 3' exonuclease activity of a DNA dependent DNA polymerase, the quencher is close to the fluorophore and quenches its fluorescence. However, after digestion by 5' to 3' exonuclease activity of a DNA dependent DNA polymerase, the quencher and thefluorophore are no more close to each other and the fluorescence emitted by thefluorophore may be detected. An in vitro method for simultaneously detecting and / or quantifying DNA from Plasmodium genus and DNA from Plasmodium falciparum species in a biological sampleThe present invention first relates to an in vitro method for simultaneously detectingand / or quantifying DNA from Plasmodium genus and DNA from Plasmodium falciparum species in a biological sample comprising nucleic acid molecules, the method comprising the steps of: (a1) contacting DNA of the biological sample with: oa first set of primers for the pan-amplification of DNA fromPlasmodium genus, comprising:^ a forward primer PanF1 of sequence SEQ ID NO:1 or itscomplementary sequence; and ^a reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; oa second set of primers for the specific amplification of DNA fromPlasmodium falciparum species, comprising:^ a forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and ^two reverse primers Pf1R2 and Pf2R2 of sequences SEQ IDNO:4 and 5 or their complementary sequences, respectively; and oreagents suitable for polymerase chain reaction (PCR)amplification; (b1) amplifying DNA from Plasmodium genus with the first set of primersto generate a first amplicon and DNA from Plasmodium falciparum specieswith the second set of primers to generate a second amplicon; (c1) detecting the presence or the absence of the first amplicon and the second amplicon, wherein the presence of the first amplicon is indicativeof the presence of DNA from Plasmodium genus in the sample and thepresence of the second amplicon is indicative of the presence of DNA fromPlasmodium falciparum species; and(d1) optionally, measuring the quantity of the first amplicon to determine the amount of DNA from Plasmodium genus in the biological sample and / ormeasuring the quantity of the second amplicon to determine the amount of DNA from Plasmodium falciparum species in the biological sample. Step (a1) of contacting DNA of the biological sample of the tested subject with specific primers.The method according to the first aspect of the invention aims to detect and / or quantifythe presence of Plasmodium genus species and to determine simultaneously if thedetected Plasmodium species includes or is Plasmodium falciparum. In fact, as alreadyindicated above, Plasmodium falciparum is the Plasmodium species causing the mostserious Plasmodium infection (malignant tertian malaria) and it is thus necessary, whenan infection by Plasmodium is detected, to determine immediately if the detectedPlasmodium species is Plasmodium falciparum.To achieve this purpose, the DNA of the biological sample is contacted with:o a first set of primers for the pan-amplification of DNA fromPlasmodium genus, comprising:^ a forward primer PanF1 of sequence SEQ ID NO:1 or itscomplementary sequence; and ^a reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; oa second set of primers for the specific amplification of DNA fromPlasmodium falciparum species, comprising:^ a forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and ^two reverse primers Pf1R2 and Pf2R2 of sequences SEQ IDNO:4 and 5 or their complementary sequences, respectively. Sets of primersThe first set of primers used in step (a1) comprises primers PanF1 and PanR1. PrimersPanF1 and PanR1 are located in region 1 and hybridize to DNA from any one and all ofPlasmodium falciparum, Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovalewallikeri, Plasmodium malariae and Plasmodium knowlesi species. As a result, the firstset of primers is able to amplify DNA from any one and all of Plasmodium falciparum,Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodiummalariae and Plasmodium knowlesi species. Therefore, the use of the first set of primersallows the amplification and the detection / quantification of DNA from all species ofPlasmodium genus of interest.The second set of primers used in step (a1) comprises primers PanF2, Pf1R2 and Pf2R2.Primer PanF2 is located in region 2 and hybridizes to DNA from any one and all ofPlasmodium falciparum, Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovalewallikeri, Plasmodium malariae and Plasmodium knowlesi species. Primers Pf1R2 andPf2R2 are also located in region 2 and hybridize specifically to DNA from Plasmodiumfalciparum species. Therefore, the use of the first set of primers allows the specificamplification and detection / quantification of DNA from Plasmodium falciparum species.The primers have been designed based on the genomic sequence of the ribosomal small subunit RNA (18S rRNA), as the alignment of 18S rRNA of the five species of malaria parasites infecting humans (P. falciparum, P. vivax, P. ovale curtisi, P. ovale wallikeri,P. malariae and P. knowlesi) with other Apicomplexa species allowed to identify tworegions of 18S rRNA subunit, in which the inventors were able to design both primers ableto hybridize to all 5 Plasmodium species of interest but not to DNA of other Apicomplexaspecies and also primers that specifically hybridize with only one of the 5 Plasmodiumspecies of interest. The particularities of primers present in the first and second sets of primers used in step(a1) are presented in Table 1 below:Table1: Primers added in step (a1)SEQ Binds to DNA IDName Region TypeSequence of NO Forward Plasmodium 1PanF1 1TTCAGTACCTTATGAGAAATCAAA primer spp* Reverse Plasmodium 2PanR1 1TTAACTTTCTCGCTTGCG primer spp Forward Plasmodium 3PanF2 2GCTCCAATAGCRTATATTAAAATT primer spp Reverse Plasmodium 4Pf1R2 2TATTTGGTTTTCCCAAACC primer falciparum Reverse Plasmodium 5Pf2R2 2AGCTAAAATAGTTCCCCTAGAATAG primer falciparum Other reagents added in step (a1)In addition, reagents suitable for polymerase chain reaction (PCR) amplification areadded in step (a1). Reagents necessary for the amplification, including a DNA polymeraseand deoxyribonucleotide triphosphates (dNTPs) to promote extension of the primer oncehybridised to the nucleic acid, are used.Numerous DNA polymerases are known in the art (e.g., T4 DNA polymerase, DNApolymerase I, Klenow Fragment, Phi29 DNA polymerase, T7 DNA polymerase, etc.). The DNA polymerase can comprise strand displacement activity. Examples of polymeraseswhich can be used in the present method include a Bst DNA Polymerase, a Full Length, aBst DNA Polymerase, a Large Fragment, a Bsu DNA Polymerase, a Crimson Taq DNAPolymerase, a Large Fragment, Deep VentRTM, a DNA Polymerase, a Deep VentRTM (exo-),a DNA Polymerase, a E. coli DNA Polymerase I, a Klenow Fragment (3'→5' exo-), a DNA Polymerase I, a Large (Klenow) Fragment, a LongAmp® Taq DNA Polymerase or Hot Start, a M-MuLV Reverse Transcriptase, a OneTaq® DNA Polymerase or Hot Start, a phi29 DNA Polymerase, a Phusion® Hot Start Flex DNA Polymerase, a Phusion® High-Fidelity DNA Polymerase, a Q5® + Q5® Hot Start DNA Polymerase, a Sulfolobus DNA Polymerase IV, a T4 DNA Polymerase, a T7 DNA Polymerase, a Taq DNA Polymerase, a TherminatorTMDNA Polymerase, a VentR® DNA Polymerase, a VentR® (exo-) DNA Polymerase, and anycombination thereof. Particularly, the polymerase is a Taq DNA Polymerase.In the method of the invention an amplification buffer is also preferably added in step(a1). Any conventional amplification buffer used in PCR amplification may be used. Theperson skilled in the art would be able to select an appropriate amplification buffer depending on the selected DNA polymerase.A suitable amplification buffer may notably be the LightCycler® 480 Probes Master (RocheDiagnostics GmbH, Mannheim, Germany). In 1x concentration, it comprises FastStart TaqDNA polymerase, a buffer, a dNTP mix (with dUTP instead of dTTP) and 3.2 mM MgCl2.Preferably, the amplification buffer further comprises Dimethyl Sulfoxide (DMSO). DMSOis a free radical scavenger and a cryopreservant. It elicits protective effect in doublestranded breaks (DSBs) in PCR. Dimethyl sulfoxide has been shown to accelerate strandrenaturation and is believed to give the nucleic acid thermal stability againstdepurination. As a PCR cosolvent, DMSO may help improve yields, especially in long PCR.Particularly, in the method of the invention, DMSO is preferably used in concentrations comprised between 0.1% and 4%, more particularly, between 0.5% and 3%, between 1 and3% and even more particularly, between 1.5% and 2.5%.In addition, the amplification buffer may be supplemented with magnesium ions (Mg2+).Particularly, the inventors surprisingly found that a higher than usual concentration ofmagnesium ions allows to improve the specificity of the detection. The range ofconcentration of magnesium ions added in step (a1) is thus preferably comprised between3 and 15 mM, preferably, between 6 and 12 mM and more preferably between 8 and 10mM.The magnesium ions may be added to the amplification buffer as magnesium salts suchas MgSO4, MgCl2 etc and mixtures thereof.When using LightCycler®480 Probes Master (Roche Diagnostics GmbH, Mannheim,Germany) as amplification buffer, it is preferably supplemented with an additionalconcentration of magnesium ions comprised between 0 and 12 mM, preferably, between3 and 9 mM and more preferably between 5 and 7 mM (as LightCycler® 480 Probes Masteralready contains 3.2 mM MgCl2 in 1x concentration). The supplemental concentration ofmagnesium ions may be provided as magnesium salts such as MgSO4, MgCl2 etc. andmixtures thereof, and in particular as MgSO4.According to a preferred embodiment, reagents suitable for PCR amplification added instep (a1) comprise a Taq DNA polymerase (in particular FastStart Taq DNA polymerase), a buffer, dNTPs (including dNTPs with dUTP instead of dTTP), magnesium ions in finalconcentration between 6 and 12 mM (preferably between 8 and 10 mM, such as about 9to 9.5 mM) and DMSO in a final concentration of 1 to 3% (preferably 1.5 to 2.5%, such as2%). Particularly preferred reagents suitable for PCR amplification added in step (a1)comprise a Taq DNA polymerase (in particular FastStart Taq DNA polymerase), a buffer, dNTPs (including dNTPs with dUTP instead of dTTP), magnesium ions in finalconcentration between 8 and 10 mM and DMSO in a final concentration of 1.5 to 2.5%(such as 2%).Optional addition of probes for quantificationAccording to a preferred embodiment of the detection / quantification method accordingto the invention, the DNA of the biological sample is further contacted in step (a1) with a first probe and a second probe. These probes are used for quantification of the targetDNAs (Plasmodium species and Plasmodium falciparum, respectively).The probes used in the method of the present invention are such that the detectable signal may be produced or the strength of the detectable signal may be increased onlyupon the hybridisation of the probe to the target sequence and the amplification of thetarget sequence, resulting in cleavage of the probe by the 5' nuclease activity of the DNApolymerase. In a specific example, the probes comprise an interactive pair of twodetectable labels and the detectable signal is not generated when both detectable labels are linked together by the probe sequence. However, once at least one detectable labelis cleaved from the probe (due to the 5' nuclease activity of the DNA polymerase), thedetectable signal is generated.Preferably, the interactive pair of detectable labels may consist of a fluorophore and aquencher. Preferably, the fluorophore and the quencher may be located at eachextremity of each probe sequence. Particularly, the fluorophore may be located at the 5'end of the probe, and the quencher may be located at the 3' end of the probe. In anotheraspect, the locations of the fluorophore and quencher on the probe sequence may beinversed (fluorophore may at the 3' end and quencher at the 5' end of the probe).Examples of fluorophores include but are not limited to: ^fluorescein and derivatives thereof, including FAM (carboxyfluorescein), moreparticularly 6-FAM (6-carboxyfluorescein), HEX (Hexachloro-Fluorescein), TET,Cal Gold, Yakima Yellow®, ^rhodamine and derivatives thereof, including ROX, TAMRA™(tetramethylrhodamine), Rhodamine Green, Cal Orange, Rhodamine Red-X, CalRed / Texas Red, ^cyanine and derivatives thereof, including Cy®5 (also known as Quasar-670),Cy®5.5, Cy®3.5, Cy®3 (also known as Quasar-570), and^ bore-dipyrromethene derivatives (BODIPY compounds and azaBODIPYcompounds). Examples of quenchers include but are not limited to: ^TAMRA™ (tetramethylrhodamine),^ BHQ™ (Black Hole Quencher™, in particular BHQ™-0: quenching range of 430-520nm, BHQ™-1: quenching range of 480-580 nm useful for for all fluorophores in thegreen to dark yellow emission spectrum, BHQ™-2: quenching range of 520-650 nmuseful with fluorophores in the dark green to orange emission sector, BHQ™-3: quenching range of 620-730 nm),^ Dabcyl (quenching range: 400-550 nm useful for fluorophores in the blue to greenemission spectra, but is not recommended for fluorophores emitting above 480 nm), ^QSY quenchers (in particular QSY 35 with maximal quenching at 475 nm, QSY 7with maximal quenching at 560 nm, QSY 9 with maximal quenching at 560nm andQSY 21 with maximal quenching at 661 nm),^ Eclipse quencher (quenching range: 390-625 nm useful for a broad group offluorescent dyes between emission ranges of 390–625 nm), ^Tide Quenchers (including TQ2: quenching range of 440-580 nm that fits perfectlyto FAM, JOE, Yakima Yellow and HEX fluorophores, TQ3: quenching range of 510- 620 nm that fits perfectly with HEX, CY3 and TAM fluorophores but shows alsogood quenching activity for ROX and Texas Red fluorophores), ^BlackBerry Quencher 650 (quenching range of 550-750 nm, useful withfluorophores such as Cy5, Cy5.5 and other dyes in the red to near-infrared emission spectrum), ^ElleQuencher, and^ Iowa Black.A skilled person will know how to combine a fluorophore and a quencher in pair based onthe emission wavelength of the fluorophore and the quenching range (and maximal quenching wavelength) of the quencher. A skilled person will also know how to use a first and a second probe with first and second fluorophores with distinct fluorescence emitting wavelengths. This difference offluorescence emitting wavelength of the first and second fluorophores allows to multiplexthe detection, i.e. to perform the detection and / or the quantification of Plasmodiumgenus and Plasmodium falciparum in the same tube.In preferred embodiments, the fluorophore / quencher pair is selected from the pairspresented in Table 2 below:Table 2. Preferred fluorophore / quencher pairs Fluorophore QuencherFAM (carboxyfluorescein), more BHQ1 particularly 6-FAM (6-carboxyfluorescein), Hexachloro-Fluorescein (HEX) BHQ1Cy5 BHQ3According to preferred embodiment of the method of the invention, the probes sequencesSEQ ID NO: 6 (PanP1) and SEQ ID NO: 7 (PanP2) shown in Table 3 below:Table 3. Preferred first and second probes Probe Region Type Binds to DNA of Sequence PanP1 PlasmodiumCTTTGGGTTCTGGGGCGA (SEQ ID NO :6)1 Probespp* PanP2 Plasmodium TTGCAGTTAAAACGYTCGTAGTTGAATATT 2Probespp(SEQ ID NO :7)In one preferred embodiment of the detection / quantification method of the invention, the DNA of the biological sample is thus further contacted in step (a1) with oa first probe PanP1 of sequence SEQ ID NO:6 or its complementarysequence, with a first fluorophore and a first quencher, wherein the first quencher quenches the fluorescence of the first fluorophore, and oa second probe PanP2 of sequence SEQ ID NO:7 or itscomplementary sequence, with a second fluorophore and a second quencher, wherein the second quencher quenches the fluorescence of the second fluorophore, wherein the wavelength of the fluorescence emitted by the first fluorophore is different from the wavelength of the fluorescence emitted by the second fluorophore. Preferably, the first fluorophore is at one extremity, preferably in 5’, and the firstquencher at the other extremity, preferably in 3’, of the first probe. Similarly, the secondfluorophore is preferably at one extremity, preferably in 5’, and the second quencher atthe other extremity, preferably in 3’, of the second probe. In particular, the first andsecond probes are preferably such that the first probe comprises a first fluorophore at its 5’ extremity and a first quencher at its 3’ extremity, the second comprises a second fluorophore at its 5’ extremity and a second quencher at its 3’ extremity, and the wavelength of the fluorescence emitted by the first fluorophore is different from the wavelength of the fluorescence emitted by the second fluorophore. According to a particular embodiment, the primers used in the method of the invention are specifically designed to be used with the probes PanP1 and PanP2.Step (b1) amplifying DNA from Plasmodium genus with the first set of primers togenerate a first amplicon and DNA from Plasmodium falciparum species with thesecond set of primers to generate a second amplicon Amplification step (b1) is a multiplex PCR amplification that includes the simultaneous amplification of two target sequences in a single amplification reaction.The set of primers PanF1 and PanR1 are capable of specifically binding to a targetsequence present in DNA of any one and all Plasmodium species of interest (those thatmainly infect humans, i.e. Plasmodium falciparum, Plasmodium vivax, Plasmodium ovalecurtisi, Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesispecies) and the set of primers PanF2 and Pf1R2 and Pf2R2 are capable of specificallybinding to a target sequence of Plasmodium falciparum. Both of sets of primers do notinterfere with each other and may thus be combined in a multiplex PCR to efficientlyamplify the target sequences.A multiplex qPCR using such a set of primers saves time, efforts and costs for amplifyinga target sequence in comparison with a simplex PCR. Moreover, multiplex qPCR lowersthe threshold of detection of nucleic acid in a sample. In particular, even fragments ofPlasmodium nucleic acid can be detected when several pairs of primers targetingdifferent sequence are used. In other words, multiplex PCR enables the detection of target sequences even when the starting material is degraded, thereby increasing the sensitivity of the detection and reducing its cost.The amplification step is performed in amplification conditions, such as amplificationreagents, temperature and / or incubation time, suitable to obtain adetectable / quantifiable amount of the target Plasmodium sequences.As already mentioned above, a specific amplification buffer, comprising DSMO andsupplemented with MgSO4 in particular concentrations (mentioned above) is preferably used for performing the amplification reaction. Once all necessary reagents have been contacted together, the amplification reactioncomprises several steps involving varying temperatures, including:^ a preliminary activation step performed at a temperature comprised between90°C and 100°C, preferably at 95°C for about 10 minutes; and^ several cycles, preferably about 40 to 50 cycles, more preferably 50 cycles, of:o denaturation of DNA present in the biological sample, performed attemperature comprised between 90°C and 100°C, preferably at about 95°C, for a duration comprised between 10 and 20 seconds, preferably 15seconds; ando annealing of primers with DNA present in the biological sample, performedat temperature comprised between 50°C and 65°C, preferably between54°C and 62°C, between 56°C and 60°C and more preferably at about58°C, for a duration of 15 to 45 seconds, preferably 30 seconds. Preferably, annealing is performed at about 58°C for about 30 seconds.The above-mentioned reagents and amplification conditions may be combined with each other in order to optimize the detection / quantification efficiency. According to particularly preferred embodiments: ^reagents suitable for PCR amplification added in step (a1) comprise a Taq DNApolymerase (in particular FastStart Taq DNA polymerase), a buffer, dNTPs (including dNTPs with dUTP instead of dTTP), magnesium ions in final concentration between 6 and 12 mM (preferably between 8 and 10 mM, such asabout 9 to 9.5 mM) and DMSO in a final concentration of 1 to 3% (preferably 1.5 to 2.5%, such as 2%), and the amplification is performed with an annealing temperature comprised between 56°C and 60°C, or ^reagents suitable for PCR amplification added in step (a1) comprise a Taq DNApolymerase (in particular FastStart Taq DNA polymerase), a buffer, dNTPs (including dNTPs with dUTP instead of dTTP), magnesium ions in final concentration between 8 and 10 mM and DMSO in a final concentration of 1.5 to2.5% (such as 2%) and the amplification is performed with an annealingtemperature of about 58°C.All qPCR runs may be performed on a thermocycler, preferably a Light Cycler 480thermocycler (LC480-II, Roche Diagnostics, Mannheim, Germany), in particular when using the LightCycler®480 Probes Master. After performing the amplification step (b1), a step (c1) of detection of amplicons is performed. Step (c1) detecting the presence or the absence of the first amplicon and the second amplicon The detection of the presence of the first and the second amplicons may be performed by any method known to those skilled in the art, including ethidium bromide detection in an agarose assay and any more precise method.Detection of the presence of the first and the second amplicons is preferably performedby using labelling means appropriate to be used in a PCR assay. Particularly, these meansmay be the first and second probes defined in step (a1) above.In the case where the presence of the first amplicon is detected, this is indicative of thepresence of DNA from Plasmodium genus in the sample.In the case where the presence of the second amplicon is detected, it is indicative of thepresence of DNA from Plasmodium falciparum species.The method of the invention may also be used to quantify the copy number of amplifiedPlasmodium species and Plasmodium falciparum. This method thus comprises an optionalstep (d1) of measuring the quantity of the first and the second amplicons. Step (d1) of measuring the quantity of the first amplicon to determine the amountof DNA from Plasmodium genus in the biological sample and / or measuring thequantity of the second amplicon to determine the amount of DNA from Plasmodiumfalciparum species in the biological sampleThe step of measurement refers to the determination of the concentration and / or copynumber of amplicons. Preferably, the quantification is performed simultaneously with theamplification with the target DNA in the biological sample. Optional step (d1) is preferably present when probes with fluorophore and quencher (see any embodiment disclosed in sub-section “Optional addition of probes for quantification”of step (a1) above) are used for detecting target amplicons, in which case the measuringof their quantities may be performed based on the amount of fluorescence emitted bythe fluorophores during amplification.In step (d1) of the method of the present invention all qPCR runs are preferably performedwith Cq (cycle of quantification) determination using the calculation of the second derivative of the amplification curve. This method of quantification is well known in the art and a skilled person will know how to implement step (d1).For precise quantification, a standard curve is preferably determined for each targetamplicon using cascade dilutions of a sample containing a known quantity of DNA fromPlasmodium falciparum and optionally of a sample containing a known quantity of DNAfrom Plasmodium genus species, in particular Plasmodium vivax, Plasmodium ovalecurtisi, Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi (thesample containing a known quantity of DNA from Plasmodium falciparum may possibilitybe used for both target amplicons).Using such standard curves, the inventors determined a formula that may be used todefine the number of copies from the Cq obtained by qPCR:Q = 1,000 x 1.70 (33.98 – Cq) = X copies / µL , whereinQ = number of copies / µL; 1,000 = number of copies obtained with a control-plasmid at aCq of 33.98; E = 1.70 = efficiency of qPCR Plasmodium spp.; Cq = cycle quantificationobtained with qPCR Plasmodium spp.).This formula should preferably be used when the following conditions are used for amplification: ^adding reagents suitable for PCR amplification in step (a1) comprise a Taq DNApolymerase (in particular FastStart Taq DNA polymerase), a buffer, dNTPs (including dNTPs with dUTP instead of dTTP), magnesium ions in final concentration between 6 and 12 mM (preferably between 8 and 10 mM, such asabout 9 to 9.5 mM) and DMSO in a final concentration of 1 to 3% (preferably 1.5 to 2.5%, such as 2%), ^ adding 0.1 to 0.5 µM, preferably between 0.2 and 0.3 µM of each primer listed in Table 1 above, ^adding 0.1-0.3 µM, preferably 0.1-0.2 µM of each probe listed in Table 3 above,^ preferably adding between 0.5 and 2.5 µM, preferably between 1.5 and 2 µM ofinternal control primer and probe, preferably Cys5 probe,^performing an activation and denaturation steps at temperature comprised between 93°C and 97°C, preferably, 95°C, and ^ performing an amplification with an annealing temperature comprised between 56°C and 60°C, preferably 58°C. Optional use of an internal controlTo obtain more accurate and reliable detection and / or quantification of Plasmodiumgenus and Plasmodium falciparum by the method of the invention, an internal control hasbeen added in this method. Any conventional internal control, such as horde of humanand pathogens can be used provided that there is no interaction between the internal control and the primer and / or the probe. Preferably, the internal control is a viral internal control. For example, it may be a internal control from Diagenode®. According to one embodiment, the method of the invention further comprises: ^adding an internal control to the biological sample before step (a1),wherein the internal control comprises viral DNA; and ^in step (a1), further contacting the DNA of the biological sample with athird set of specific primers for the amplification of viral DNA from the internal control, comprising forward and reverse primers specific for the viral DNA from the internal control and optionally a third probe specificallyhybridizing to the viral DNA from the internal control, wherein when present the third probe comprises a third fluorophore and a third quencher, wherein the third quencher quenches the fluorescence of the third fluorophore, wherein the wavelength of the fluorescence emitted by the third fluorophore is different from the wavelengths of the fluorescence emitted by the first and second fluorophores; ^in step (b1), further amplifying viral DNA from the internal control withthe third set of primers to generate a third amplicon; ^In step (c1) further detecting the presence or the absence of the thirdamplicon, wherein: othe absence of the third amplicon is indicative that the PCR reactionhas not worked; othe presence of the third amplicon only is indicative that there is noDNA from Plasmodium genus in the biological sample;o the presence of the first and third amplicons is indicative that thebiological sample comprises DNA from Plasmodium genus, but does notcontain DNA from Plasmodium falciparum species;o the presence of the second and third amplicons is indicative that thebiological sample comprises DNA from Plasmodium falciparum species;o the presence of the first, second and third amplicons is indicative thatthe biological sample comprises DNA from Plasmodium genus, includingDNA from Plasmodium falciparum species.^ In step (d1), when present, further measuring the quantity of the thirdamplicon to determine the amount of viral DNA from the internal control in the biological sample, wherein said measure is performed based on the amount of fluorescence emitted by the third fluorophore.The primers used in step (a1) for the amplification of the viral control DNA as well as theprobes used for the detection may be any one of commercially available viral DNAdetection kit. Preferably, the primers of the third set of primers are selected from thosecommercialized by Diagenode® (ref.: DIDC-CY-L100).According to a particular embodiment, the third fluorophore quenches the fluorescenceof the third quencher. The third fluorophore and the third quencher quencher are on the extremities of the probe sequence. Preferably, the third fluorophore is at 5’ and the third quencher is at 3’ of the probe sequence.The third fluorophore may be selected from any fluorophore defined herein. Preferably,the third fluorophore is a fluorescent dye, more preferably Cyanine5 (Cy5) dye. In step (b1) above, the amplification of the internal control is performed at the sametime as the amplification of the DNA of Plasmodium genus and Plasmodium falciparumspecies with the first and the second set of primers, respectively (triplex PCR, as thewavelength of the fluorescence emitted by the third fluorophore is different from the wavelengths of the fluorescence emitted by the first and second fluorophores).As indicated above, in step (c1) the detection of third amplicon reports different situationdepending on if it is detected alone or with the first and / or the second amplicon.Particularly, when the first, the second and third amplicons are detected, this isindicative for an infection by Plasmodium genus, including Plasmodium falciparum. Thismeans that the tested patient is infected from at least two plasmodium species, one of which being Plasmodium falciparum. In order to determine accurately such an infectionby two species of Plasmodium, the Plasmodium falciparum DNA is quantified. If the copynumber of P. falciparum DNA is weak or the Plasmodium genus DNA is hight, this isindicative that there is another specie of Plasmodium in the tested sample.In the case where it is determined that the tested sample contains Plasmodium genus butnot Plasmodium falciparum or that the concentration of the Plasmodium falciparum DNAis lower compared to the concentration of Plasmodium genus DNA, it is furtherdetermined which of four other Plasmodium species is present in the tested samples.To perform such a determination, the inventors designed set of primers to be used in thedetection and / or quantification method allowing to determine the Plasmodium speciesselected from Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri,Plasmodium malariae and Plasmodium knowlesi.In a second aspect, the present invention thus relates to an in vitro method for detectingand / or quantifying DNA from Plasmodium falciparum species or DNA from on the fourPlasmodium species recited above. An in vitro method for detecting and / or quantifying DNA from Plasmodiumfalciparum species or DNA from a Plasmodium species selected from Plasmodiumvivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariaeand Plasmodium knowlesi in a biological sample.As indicated previously, the inventors of the present invention advantageously developedprimers allowing to detect and / or quantify all five Plasmodium species involved in theplasmodium infection. These primers are used in real-time qPCR method with highefficiency and reduced cost.According to a second aspect, the present invention also relates to an in vitro method fordetecting and / or quantifying DNA from Plasmodium falciparum species or DNA from aPlasmodium species selected from Plasmodium vivax, Plasmodium ovale curtisi,Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi in abiological sample comprising nucleic acid molecules, the method comprising the steps of: ^taking a first sub-sample from the biological sample;^ simultaneously detecting and / or quantifying DNA from Plasmodium genusand DNA from Plasmodium falciparum species in the first sub-sample usingthe method according to the first aspect of the invention; ^when DNA from Plasmodium genus is detected or quantified and / or DNAfrom Plasmodium falciparum species is detected or quantified in the firstsub-sample: i) taking a second, a third, a fourth and a fifth sub-sample from thebiological sample; ii) contacting:^ DNA of the second sub-sample with a set of primers for thespecific amplification of DNA from Plasmodium vivax species,comprising: oa forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and oa reverse primer PvR2 of sequence SEQ ID NO:8 or itscomplementary sequence; ^DNA of the third sub-sample with a set of primers for the specificamplification of DNA from Plasmodium ovale curtisi andPlasmodium ovale wallikeri species, comprising:o a forward primer PoF1 of sequence SEQ ID NO:9 or itscomplementary sequence; and oa reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; ^DNA of the fourth sub-sample with a set of primers for thespecific amplification of DNA from Plasmodium malariae species,comprising: oa forward primer PmF1 of sequence SEQ ID NO:10 or itscomplementary sequence; and oa reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; ^DNA of the fifth sub-sample with a set of primers for the specificamplification of DNA from Plasmodium knowlesi species,comprising: oa forward primer PkF1 of sequence SEQ ID NO:11 or itscomplementary sequence; and oa reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; iii) amplifying DNA from Plasmodium vivax species in the second sub-sample, DNA from Plasmodium ovale curtisi and / or Plasmodium ovalewallikeri species in the third sub-sample, DNA from Plasmodiummalariae species in the fourth sub-sample, and DNA from Plasmodiumknowlesi species in the fifth sub-sample;iv) detecting the presence or the absence of an amplicon in the second,third, fourth and fifth sub-samples, wherein: ^the presence of an amplicon in the second sub-sample isindicative of the presence of DNA from the Plasmodium vivax species; ^the presence of an amplicon in the third sub-sample is indicativeof the presence of DNA from the Plasmodium ovale species; ^the presence of an amplicon in the fourth sub-sample isindicative of the presence of DNA from the Plasmodium malariae species; ^the presence of an amplicon in the fifth sub-sample is indicativeof the presence of DNA from the Plasmodium knowlesi species;v) optionally, measuring the quantity of:^ the amplicon in the second sub-sample to determine the amountof DNA from Plasmodium vivax species in the sample;^ the amplicon in the third sub-sample to determine the amountof DNA from Plasmodium ovale species in the sample;^ the amplicon in the fourth sub-sample to determine the amountof DNA from Plasmodium malariae species in the sample;^ the amplicon in the fifth sub-sample to determine the amount of DNAfrom Plasmodium knowlesi species in the sample.In the step of taking a first sub-sample from the biological sample of the subject testedfor infection by Plasmodium genus, the biological sample is as defined above (see theDefinitions section) and preferably, a blood sample or solid sample obtained from spleenor liver, preferably a spleen or liver sample obtained after a biopsy.In next step of this method, DNA from Plasmodium genus and DNA from Plasmodiumfalciparum species are detected and / or quantified in the first sub-sample using themethod according to the first aspect of the present invention as described above.According to one embodiment, the method of detection and / or quantification ofPlasmodium genus and DNA from Plasmodium falciparum species according to the firstaspect of the invention, used in the present method allowing to detect and / or quantifythe other Plasmodium species, further comprises a step of addition of internal control inthe biological sample, as described above.When DNA from Plasmodium genus species is detected and / or quantified and / or DNA fromPlasmodium falciparum species is detected and / or quantified in the first sub-sample,further steps are performed to determine and / or quantify which of the four otherPlasmodium species is present in the sample. Indeed, as previously indicated, the claimed method is particularly advantageous since it allows to detect a biparasitism, i. e., an infection by more than one Plasmodium species.For example, according to one embodiment, if an infection by Plasmodium falciparum isdetected by the method according to the first aspect of the invention as well as another Plasmodium species, the steps of the above disclosed method are performed to determinewhich is the other Plasmodium species between Plasmodium vivax, Plasmodium ovalecurtisi, Plasmodium ovale wallikeri, Plasmodium malariae or Plasmodium knowlesi.According to another embodiment, if Plasmodium species is detected / quantified by themethod according to the first aspect of the invention but not Plasmodium falciparum, the steps of the method disclosed above are performed to determine which is / are thePlasmodium species between Plasmodium vivax, Plasmodium ovale curtisi, Plasmodiumovale wallikeri, Plasmodium malariae and Plasmodium knowlesi.For this purpose, a second, a third, a fourth and a fifth sub-sample are taken from thebiological sample of the tested subject. Each one of these samples is contacted with specific set of primers designed for specific amplification of DNA of the species other than Plasmodium falciparum.To detect and / or quantify Plasmodium vivax species, the second sub-sample is contactedwith specific set of primers for the DNA amplification of this Plasmodium species,comprising:- a forward primer PanF2 of sequence SEQ ID NO:3 or its complementary sequence; and- a reverse primer PvR2 of sequence SEQ ID NO:8 or its complementary sequence.To detect and / or quantify Plasmodium ovale curtisi and Plasmodium ovale wallikerispecies, the third sub-sample is contacted with specific set of primers for the DNAamplification of this Plasmodium species, comprising:- a forward primer PoF1 of sequence SEQ ID NO:9 or its complementary sequence; and- a reverse primer PanR1 of sequence SEQ ID NO:2 or its complementary sequence.To detect and / or quantify Plasmodium malariae species, the fourth sub-sample iscontacted with specific set of primers for the DNA amplification of this Plasmodium species, comprising:- a forward primer PmF1 of sequence SEQ ID NO:10 or its complementary sequence; and- a reverse primer PanR1 of sequence SEQ ID NO:2 or its complementary sequence.To detect and / or quantify Plasmodium knowlesi species, the fifth sub-sample is contactedwith specific set of primers for the DNA amplification of this Plasmodium species,comprising:- a forward primer PkF1 of sequence SEQ ID NO:11 or its complementary sequence; and- a reverse primer PanR1 of sequence SEQ ID NO:2 or its complementary sequence.The particularities of primers added in the second, third, fourth and fifth sub-samples instep (ii) (not already presented in Table 1 above) are presented in Table 4 below:Table4: Some primers added in step (ii) SEQName Type Binds to DNA of SequenceID NO 8PvR2 ReversePlasmodium TAGGTAGGATGCGCACAG primer vivax 9PoF1 ForwardPlasmodium GAAAGATTTTTAAATAAGAAAATTCC primerovale curtisi +Plasmodium ovale wallikeri 10 PmF1 ForwardPlasmodium GATGATAGAGTAAAAAATAAAAGAGAC primer malariae 11 PkF1 ForwardPlasmodium TTCTCTCCGGAGATTAGAAC primer knowlesiAccording to a preferred embodiment of the detection and / or quantification methodaccording to the second aspect of the invention, the DNA of the second, third, fourth andfifth sub-samples are further contacted in step (ii) with a first probe and a second probe.These probes are used for quantification of the target DNAs (Plasmodium vivax,Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae andPlasmodium knowlesi, respectively).The probes used in the method of the present invention are such that the detectable signal may be produced or the strength of the detectable signal may be increased onlyupon the hybridisation of the probe to the target sequence and the amplification of thetarget sequence, resulting in cleavage of the probe by the 5' nuclease activity of the DNApolymerase. In a specific example, the probes comprise an interactive pair of twodetectable labels and the detectable signal is not generated when both detectable labels are linked together by the probe sequence. However, once at least one detectable labelis cleaved from the probe (due to the 5' nuclease activity of the DNA polymerase), thedetectable signal is generated.Preferably, the interactive pair of detectable labels may consist of a fluorophore and aquencher. Preferably, the fluorophore and the quencher may be located at eachextremity of each probe sequence. Particularly, the fluorophore may be located at the 5'end of the probe, and the quencher may be located at the 3' end of the probe. In anotheraspect, the locations of the fluorophore and quencher on the probe sequence may beinversed (fluorophore may at the 3' end and quencher at the 5' end of the probe). Thefluorophore and quencher are those described above.Preferably, the probes optionally added in step (ii) of the method according to the second aspect of the invention correspond to those described above for the method ofdetection / quantification of DNA of Plasmodium genus species or Plasmodium falciparum(see step (a1)). According to one embodiment, the DNA of the third, fourth and fifth sub-samples is further contacted with a first probe PanP1 of sequence SEQ ID NO:6 or its complementary sequence, with a first fluorophore and a first quencher, wherein the first quencher quenches the fluorescence of the first fluorophore. In addition, the DNA of the second sub-sample is further contacted with a second probe PanP2 of sequence SEQ ID NO:7 or its complementary sequence, with a second fluorophore and a second quencher, wherein the second quencher quenches the fluorescence of the second fluorophore. In any cases, the wavelength of the fluorescence emitted by the first fluorophore is different from the wavelength of the fluorescence emitted by the second fluorophore. Particularly, when the probes PanP1 and PanP2 are used, all sub-samples are distinct, i.ethere is four sub-samples for detecting DNA of any one of Plasmodium vivax, Plasmodiumovale curtisi and / or Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodiumknowlesi. In one embodiment, when the probes PanP1 and PanP2 are used, the second sub-sample may be the same as the third sub-sample or the fourth sub-sample or the five sub-sample.This means that, when primers PanP1 and PanP2 are used, Plasmodium vivax may bedetected and / or quantified simultaneously with Plasmodium ovale curtisi and / orPlasmodium ovale wallikeri or with Plasmodium malariae or with Plasmodium knowlesi in the same sample. After the step of contacting each one of the sub-samples of the biological sample with the corresponding set of primers described above, follows a step of amplification of DNAof the Plasmodium genus species, wherein: DNA from Plasmodium vivax species isamplified in the second sub-sample; DNA from Plasmodium ovale curtisi and / orPlasmodium ovale wallikeri species is amplified in the third sub-sample; DNA fromPlasmodium malariae species is amplified in the fourth sub-sample, and DNA fromPlasmodium knowlesi species is amplified in the fifth sub-sample.Amplification of DNA of the above-recited Plasmodium species is performed in the sameamplification conditions (reagents used in the amplification mixture, temperature andduration of the amplification) described above for the detection / quantification methodaccording to the first aspect of the invention (sees step (b1) described above).After the step of amplification is performed the step of detection of the presence or theabsence of an amplicon in the second, third, fourth and fifth sub-samples. The detectionmay be performed by any means known to those skilled in the art as (see step (c1) above).Particularly, these means may be the first and second probes defined in step (a1) above.The presence of an amplicon in the second sub-sample is indicative of the presence ofDNA from the Plasmodium vivax species. The presence of an amplicon in the third sub-sample is indicative of the presence of DNA from the Plasmodium ovale species. The presence of an amplicon in the fourth sub-sample is indicative of the presence of DNAfrom the Plasmodium malariae species.The presence of an amplicon in the fifth sub-sample is indicative of the presence of DNAfrom the Plasmodium knowlesi species.The method according to the second aspect of the invention can also comprises a step of measurement. The step of measurement refers to the determination of the concentration and / or copynumber of amplicons. Preferably, the quantification is performed simultaneously with theamplification with the target DNA in the biological sample. The measurement is performed as follows:- the concentration and / or copy number of the amplicon in the second sub-sample is (are)measured to quantify the DNA from Plasmodium vivax species in the sample;- the concentration and / or copy number of the amplicons in the third sub-sample is(are)measured to quantify the DNA from Plasmodium ovale species in the sample;- the concentration and / or copy number of the amplicons in the fourth sub-sample is(are)measured to quantify the of DNA from Plasmodium malariae species in the sample, and- the concentration and / or copy number of the amplicons in the fifth sub-sample is(are)measured to quantify the of DNA from Plasmodium knowlesi species in the sample.Preferably, the measurement of Plasmodium vivax, Plasmodium ovale curtisi,Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi isperformed at the same manner as the measurement of the concentration / copy numberdescribed above for the method according to the first aspect of the invention (see step(d1) described above). Preferably, when a step of measurement is present, measuring the concentration and / orcopy number of the amplicons in the second, third, fourth and fifth sub-samples isperformed based on the amount of fluorescence emitted by the first or second fluorophores, depending on the probe added to each sub-sample. According to one embodiment the methods according to the firs and the second aspect of the invention disclosed above can also comprises a preliminary step of isolating DNA fromthe biological sample. The methods to isolate the target DNA are not particularly limitedand may be selected from any conventional method known to the person skilled in theart and being appropriate to amplify the isolated DNA in PCR assay.The interest of the methods of the invention disclosed above is based in the use of a duplex qPCR able to detect a pan-plasmodial target, a P. falciparum-specific target and a viral internal control. In contrast to the LAMP method, the methods of the invention are able to detect all human plasmodial species and to quantify plasmodial number of copies.The methods of the invention are based on the use of a primer and probe common to allplasmodial species, which allows to reduce reagent costs. A method for monitoring the efficacy of a treatment against malaria in a subjectThe methods of detection and / or quantification disclosed above, allow to detect and / orto quantify rapidly and reliably all five Plasmodium species mentioned above in thesubject suffering or suspected to suffer from Plasmodium infection. Because they arerapid and accurate, the methods of the invention may be used successfully in medicalfield not only for diagnosis but also for monitoring purposes.The present invention thus also relates to a method for monitoring the efficacy of atreatment against malaria in a subject from a first biological sample obtained from the subject before starting the treatment and a second biological sample obtained from the subject after starting the treatment, the method comprising detecting and / or quantifyingDNA from Plasmodium falciparum species or DNA from a Plasmodium species selectedfrom Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri,Plasmodium malariae and Plasmodium knowlesi in the first and second biological samplesusing the methods according to the invention as described above, particularly, accordingto the second aspects of the invention, wherein the absence in the second biologicalsample of DNA from the Plasmodium species detected in the first biological sample ordecrease in the second biological sample compared to the first biological sample of theamount of DNA from the Plasmodium species quantified is indicative that the treatmentis efficient. Particularly, the second sample may be obtained at predetermined time, once or moretimes after starting the treatment of subject suffering from malaria or at the end of thetreatment.As used herein, the term “treating” or “treatment” means an improvement of thepatient’s condition suffering from Plasmodium infection, which may be observed at theclinical, histological, and / or biochemical level. The terms “treating” or “treatment” notably include improving a clinical, histological, and / or biochemical symptom orparameter associated with Plasmodium infection or inhibiting, reducing, or delayingprogression or exacerbation of the Plasmodium infection (including secondary damagecaused by the disease, disorder, or condition) to either a statistically significant degree or to a degree detectable to one skilled in the art.The method for monitoring the efficacy of a treatment against malaria can be carried outat the end of the treatment and / or at regular intervals during the treatment in order to possibly adjust the doses administered or completely modify the treatment (nature of the compound administered and its dosage). if the treatment initially administered appears to be ineffective. Beside in a method for monitoring the efficacy of a treatment against malaria, thedetection and / or quantification methods of the present invention may be also used inother therapeutic application, for example for detecting a Plasmodium infection relapseor a new Plasmodium infection in a subject previously infected by Plasmodium genusspecies. A method for monitoring the efficacy of a treatment against malaria in a subject According to the fourth aspect, the present invention relates to a method for detecting aPlasmodium infection relapse or a new Plasmodium infection in a subject from a firstbiological sample obtained from the subject at the end of an antimalarial treatment and a second biological sample obtained from the subject at a later stage, the methodcomprising detecting and / or quantifying DNA from Plasmodium falciparum species or DNAfrom a Plasmodium species selected from Plasmodium vivax, Plasmodium ovale curtisi,Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi in the firstand second samples using the methods according to the invention as described above,particularly, according to the second aspect of the invention, wherein the presence inthe second biological sample of DNA from a Plasmodium species not detected in the firstbiological sample or the increase in the second biological sample compared to the firstbiological sample of the amount of DNA from a Plasmodium species is indicative of aPlasmodium infection relapse or a new Plasmodium infection in a subject.In some cases, even if a treatment against malaria is known as being sufficiently effective,it would be preferable to continue the monitoring of patient who was infected byPlasmadium genus species since it is possible that even when the test performed at theend of anti-malaria treatment shows the absence of Plasmodium infection, there remainundetectable quantity of Plasmodium conducing to a Plasmodium infection relapse.In addition, it is possible that a subject is infected by two or more Plasmodium species atdistinct time interval so as, when a first Plasmodium species is detected, the other(s) arenot still detectable. The present method allows to detect a new Plasmodium infection,i.e. an infection of another Plasmodium species that those previously detected.Particularly, for detecting a Plasmodium infection relapse or a new Plasmodium infectionin a subject, the method of the invention is performed one, two, three or four week(s)after the end of the anti-malaria treatment.Since the methods of detecting and / or quantifying Plasmodium species according to thepresent invention are accurate, easily implementable and with a reasonable cost (duesto the primer design), these ones may be used without limit in the medical practice tomonitor treatment efficiency and to follow-up patient sometime after the Plasmodiuminfection and after the end of the treatment.Kits All primers designed in the present invention can be included in a kit. According to fifth embodiment, the present invention thus relates to a kit comprising: vi) a first set of primers for the pan-amplification of DNA from Plasmodiumgenus, comprising: ^a forward primer PanF1 of sequence SEQ ID NO:1 or itscomplementary sequence; and ^a reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; vii) a second set of primers for the specific amplification of DNA fromPlasmodium falciparum species, comprising:^ a forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and ^two reverse primers Pf1R2 and Pf2R2 of sequences SEQ ID NO:4and 5 or their complementary sequences, respectively. The primers in the first and the second set of primers are those described in the Table 1 above.The kit comprising the primers mentioned above may be used in the detection and / orquantification of Plasmodium genus species and particularly, Plasmodium falciparum.Preferably, the kit of the invention is used in the in vitro method of the invention forsimultaneously detecting and / or quantifying DNA from Plasmodium genus and DNA fromPlasmodium falciparum species in a biological sample comprising nucleic acid molecules.According to one embodiment, the kit of the present invention also comprises otherprimers, particularly, primers allowing to amplify DNA of Plasmodium genus speciesselected from Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri,Plasmodium malariae and Plasmodium knowlesi species.According to preferred embodiment, the kit of the invention further comprises: ^a reverse primer PvR2 of sequence SEQ ID NO:8 or its complementarysequence; ^a forward primer PoF1 of sequence SEQ ID NO:9 or its complementarysequence; ^a forward primer PmF1 of sequence SEQ ID NO:10 or its complementarysequence; and ^a forward primer PkF1 of sequence SEQ ID NO:11 or its complementarysequence. The nucleic acid sequences of these primers as well as their function are shown in Table4 above.The kit comprising primers having nucleic acid sequences corresponding to the sequences SEQ ID NO:1 to 5 and SEQ ID NO: 8 to 11 can be used for detecting and / or quantifying DNAfrom Plasmodium falciparum species or DNA from a Plasmodium species selected fromPlasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodiummalariae and Plasmodium knowlesi in a biological sample comprising nucleic acidmolecules in the method according to the second aspect of the invention.According to another embodiment, the kit of the invention further comprises probes,preferably TaqMan type probe with a fluorophore and a quencher wherein the quencherquenches the fluorescence of the fluorophore. Particularly, the fluorophore and the quencher are located at each extremity of the probe sequence. Preferably, the fluorophore is at 5’ and the quencher in 3’. More preferably, the probes used in the kit of the invention have sequences corresponding to SEQ ID NO: 6 and SEQ ID NO: 7. Preferably, the probes comprised in the kit correspond those described above (see step (a1)). According to a preferred embodiment, the kit of the invention further comprises: ^a first probe PanP1 of sequence SEQ ID NO:6 or its complementarysequence, with a first fluorophore and a first quencher, wherein the first quencher quenches the fluorescence of the first fluorophore, and ^a second probe PanP2 of sequence SEQ ID NO:7 or its complementarysequence, with a second fluorophore and a second quencher, wherein the second quencher quenches the fluorescence of the second fluorophore, wherein the wavelength of the fluorescence emitted by the first fluorophore is different from the wavelength of the fluorescence emitted by the second fluorophore.According to a particular embodiment, the kit of the invention further comprises aninternal control comprising viral DNA, forward and reverse primers specific for the viral DNA from the internal control and optionally a third probe specifically hybridizing to theviral DNA from the internal control, wherein when present the third probe comprises athird fluorophore and a third quencher, wherein the quencher quenches the fluorescenceof the fluorophore. More preferably, the third fluorophore and the third quencher arelocated at the extremities of the probe sequence, particularly the third fluorophore islocated in 5’ and the third quencher in 3’, wherein the wavelength of the fluorescenceemitted by the third fluorophore is different from the wavelengths of the fluorescence emitted by the first and second fluorophores.This kit can also comprise regents adapted to an amplification of the nucleic acidsequences by polymerase chain reaction (PCR), particularly by qPCR. These reagents are such as: DNA polymerase, deoxynucleotides triphosphates (dNTP),buffer and preferably magnesium or sulfate of magnesium, DMSO and any combinationthereof.According to a particular embodiment the regents used for the DNA amplification are thesame as those described above in the section relating to the method according to the firstaspect of the invention (see step (a1)).According to another embodiment, the kit of the invention comprises:- an internal control comprising viral DNA, forward and reverse primers specific for theviral DNA from the internal control and optionally a third probe specifically hybridizing to the viral DNA from the internal control, wherein when present the third probe comprisesa third fluorophore and third quencher, wherein the third quencher quenches thefluorescence of the third fluorophore, preferably, the third fluorophore and the third quencher are located at the extremities of the probe, more preferably the thirdfluorophore is in 5’ and a third quencher in 3’, wherein the wavelength of thefluorescence emitted by the third fluorophore is different from the wavelengths of the fluorescence emitted by the first and second fluorophores;- A DNA polymerase;- Deoxynucleotides triphosphates (dNTP);- A buffer- Magnesium- DMSO- Any combination thereof.Particularly, DMSO is in concentrations comprised between 0.1% and 4%, moreparticularly, between 0.5% and 3% and in final concentration comprised between 1% and3%, particularly between 1.5% and 2.5%, such as 2%.The range of concentration of magnesium ions added in step in the kit of the invention ispreferably comprised between 3 and 15 mM, preferably, between 6 and 12 mM and morepreferably between 8 and 10 mM, such as about 9 to 9.5 mM.The magnesium ions may be added to the amplification mixture as magnesium salts such as MgSO4, MgCl2 etc. Preferably, in the kit of the present invention, the magnesium ions are added as MgSO4. particularly, at concentration of 6 mM of MgSO4. According to a preferred embodiment, the kit of the invention comprises 6 mM of MgSO4added to 2% of DMSO. Preferably, the constituents (chemical, probes and primers) of the kits of the present invention are as those used in the methods described above.According to one embodiment, the kit of the invention can further comprise instructionsof enablement. The kit of the invention as disclosed above are essentially used for the detection ofPlasmodium genus species selected from Plasmodium falciparum, Plasmodium vivax,Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae andPlasmodium knowlesi species but may be also used in a method for monitoring theefficacity of treatment against malaria, for example as in the method according to thethird aspect of the invention and in methods for detecting a Plasmodium infection relapseor a new Plasmodium infection as for example the method according to the fourth aspectof the invention. The following examples merely intend to illustrate the present invention. EXAMPLES Example 1 This example relates to the design of specific primers used in the detection and / orquantification method of Plasmodium genus species according to the methods ofinvention as well as the use of these methods to follow-up patients treated against malaria.Materials and MethodsPatients and specimens Left over whole blood specimens from 410 patients suspected of malaria collected from June 2016 to March 2021 were prospectively processed in parallel to a routine diagnostic procedure (thick and thin blood smear [BS] and BinaxNow point of care immunoassay (Abbott) [ICT]). The parasitaemia was calculated for positive thin smear specimens. Malarial episode was defined as the presence of trophozoites and / or schizonts detected upon thick smears, with the species identified based on the morphology of the parasitic forms on the thin smear. The microscopy result was used as the gold standard to study the results obtained with the method of the invention. The ICT can detect the Histidine-Rich Protein II (HRP2) antigen specific of P. falciparum(T1) and aldolase (T2), a common antigen of all Plasmodium species.Species confirmation These blood samples were referred to the French National Reference Center of malaria for species confirmation by qPCR. The Plasmodium Typage (Bio-Evolution, Bussy-Saint- Martin, France) real-time qPCR kit have been used for simultaneous identification ofP. falciparum, P. ovale, P. vivax, P. malariae and P. knowlesi.All diagnostic, clinical and therapeutic data were collected in the French National Reference Center of malaria database. Nucleic Acids Extraction Whole nucleic acids (WNAs) were extracted from 1.3 mL of EDTA whole blood with the addition of 10 µL of 1:5 diluted internal control per sample (DNA Virus Culture, DICD-CY- L100, Diagenode, Seraing, Belgium) using a Qiasymphony (Qiagen, Hilden, Germany) with the Virus Pathogen MIDI extraction kit (Qiagen, Hilden, Germany) following manufacturer’s instructions. WNAs were eluted in 100 µL. All extracts were stored (from 1 week to 5 years) at -80°C until use. Selection of Target Gene The ribosomal small subunit RNA (18S rRNA) gene of Plasmodium falciparum, Plasmodiumvivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae andPlasmodium knowlesi together with that of Babesia divergens, Babesia microti andToxoplasma gondii were downloaded from the GenBank Database (https: / / www.ncbi.nlm.nih.gov, accession number in Table 5) and aligned to design accordingly probesand primers using Geneious Prime version 2020.2.4 software (Biomatters Ltd., NewZealand) (Figure 1 and Figure 2). Probes and primers were listed in Table 5. The absenceof hairpins, self-dimers and hetero-dimers were checked for each primer and probe. Thein silico specificity of the primers and probes were tested using primer-BLAST.Table 5. Sequences of the probes, forward and reverse primers designed on 18S rRNA.Assays Plasmodium species 5’ to 3’ sequenceDuplex qPCR Plasmodium spp. PanF1 :TTCAGTACCTTATGAGAAATCAAA (SEQ ID NO: 1° PanR1 : TTAACTTTCTCGCTTGCG(SEQ ID NO: 2) PanP1 (FAM) :CTTTGGGTTCTGGGGCGA (SEQ ID NO: 6) P. falciparum PanF2 :GCTCCAATAGCRTATATTAAAATT (SEQ ID NO: 3) Pf1R2 : TATTTGGTTTTCCCAAACC (SEQ ID NO: 4) Pf2R2 : AGCTAAAATAGTTCCCCTAGAATAG (SEQ ID NO: 5) PanP2 (HEX) :TTGCAGTTAAAACGYTCGTAGTTGAATA TT (SEQ ID NO: 7) Species-specific qPCRs P. vivax PanF2 :GCTCCAATAGCRTATATTAAAATT (SEQ ID NO: 3) PvR2 : TAGGTAGGATGCGCACAG(SEQ ID NO: 8) PanP2 (HEX) : TTGCAGTTAAAACGYTCGTAGTTGAATA TT (SEQ ID NO: 7) P. ovale PoF1 :GAAAGATTTTTAAATAAGAAAATTCC (SEQ ID NO: 9) PanR1 : TTAACTTTCTCGCTTGCG (SEQ ID NO: 2) PanP1 (FAM) : CTTTGGGTTCTGGGGCGA (SEQ ID NO: 6) P. malariae PmF1 :GATGATAGAGTAAAAAATAAAAGAGAC (SEQ ID NO: 10) PanR1 : TTAACTTTCTCGCTTGCG (SEQ ID NO: 2) PanP1 (FAM) : CTTTGGGTTCTGGGGCGA (SEQ ID NO: 6) P. knowlesi PanF2 :GCTCCAATAGCRTATATTAAAATT (SEQ ID NO: 3) PkF2 :CATAAAGCAGAAAACATATATTGG (SEQ ID NO: 11) PanP2 (HEX) : TTGCAGTTAAAACGYTCGTAGTTGAATA TT (SEQ ID NO: 7) Quantitative PCRs DNAs amplification was performed using the following conditions: 1X of LightCycler®480 Probes Master (Roche Diagnostics GmbH, Mannheim, Germany), 6 mM of Magnesium Sulfate (MgSO4, Invitrogen), 2% of Dimethyl Sulfoxide (DMSO, Sigma®, Life Science), 0.3 µM of each primer, 0.1 µM of each probe and 1.75 µL of internal control primers and Cy5 probe (DICD-CY-L100, Diagenode, Seraing, Belgium) in a total volume of 35 µL and 8 µL of eluted nucleic acids. The amplification consisted of one activation step at 95°C for 10 minutes and 50 cycles of denaturation at 95°C for 15 seconds and annealing at 58°C for 30 seconds. All qPCR runs were performed on a Light Cycler 480 thermocycler (LC480-II, Roche Diagnostics, Mannheim, Germany) with Cq determination using the calculation of the second derivative of the amplification curve.Using a Plasmodium spp. locus in a control-plasmid, the inventors were able to evaluatethe parasite load in copy numbers for pan-Plasmodium qPCR. The formula used to definethe number of copies from the Cq obtained by qPCR is as follows: Q = 1,000 x 1.70(33.98 – Cq)= X copies / µL (Q = number of copies / µL; 1,000 = number of copies obtained with the control-plasmid ata Cq of 33.98; E = 1.70 = efficiency of qPCR Plasmodium spp.; Cq = cycle quantificationobtained with qPCR Plasmodium spp.).Parasite load for species-specific qPCRs was expressed in cycles of quantification (Cq) in the absence of species-specific control-plasmid. Parasitaemia obtained by counting parasitical forms on thin smears was expressed as the number of parasites / µL. The inventors first validated each single assay on species-specific samples together withthe internal control assay and then optimized a duplex assay based on Plasmodium spp.(FAM), P. falciparum (HEX) and internal control (Cy5) primers and probes.qPCR Efficiency and Limit of Detection The standard curve allowing qPCR efficiency calculation was obtained based on the result of two replicates of eight 5-fold serial dilutions of eluted nucleic acids in DNA free water for each plasmodial species. The eluates of four positive clinical specimens withparasitaemia between 8,900 and 12,460 parasites / µL for P. falciparum, P. vivax, P. ovale,P. malariae and DNA extract of P. knowlesi culture (1.1 ng / mL) have been used for studythe efficiency and the limit of detection for each qPCR assay. A 179-base pair DNA plasmid containing only the PCR target locus of the qPCRPlasmodium spp. was synthetized at 40 ng / µL (Eurogentec, Seraing, Belgium), diluted atdifferent concentrations (1,000 to 1 copies / µL per well) and tested in 4 to 10 replicates to obtain the limit of detection and absolute quantification on a LC480 thermocycler (Roche Diagnostics). Analytical specificity of qPCR The development and evaluation of the analytical specificity of different qPCRs were studied on 38 samples positive for a single plasmodial species by conventional methods (BS and ICT), from 38 different patients at the time of diagnosis. Among these samples,18 were positive for P. falciparum, 7 for P. vivax, 10 for P. ovale, 3 for P. malariae. TheP. knowlesi DNA was obtained from ongoing in vitro cultures of Robert Moon team atLSHTM (Mohringh et al.).Validation of qPCR A total of 190 samples from 87 different patients were used to validate the different qPCRs. These samples were positive for one or two plasmodial species. Of these positive samples, 87 and 103 were collected at the time of diagnosis (D0) and at the time of post- malaria treatment follow-up, respectively. These positive samples were analyzed with all qPCRs developed. In addition, 333 samples from 323 patients suspected of malaria but negative by BS and ICT were screened with duplex qPCR assay (Figure 3).Statistical Analysis and GraphsMedians and interquartile ranges (IQRs) are given for specific descriptions in non-normally distributed parameters. Contingency tables and Fischer’s exact test were performed to analyze the statistical links between clinical presentation, direct examination, and qPCR test result. Graphs were obtained using RStudio (version 1.2.5042) with ggplot2 package. Regression lines were constructed automatically by plotting the logarithm of the initial template concentration versus the corresponding Cq value by using the Analysis package included in LightCycler 480 software version 1.5 (Roche Diagnostics). Results Limit of Detection and EfficiencyThe limit of detection of the Plasmodium spp. assay was tested using a control-plasmidamplicon and was detectable until a dilution of 1 copies / µL (Table 6).Table 6. Limit of detection of the pan-Plasmodium qPCR assay using a control-plasmidamplicon. Cq, quantification cycle. DNA Mea Cq Cq Cq Cq SD copies / Cq 1 Cq 2 Cq 4 Cq 5 Cq 9 Cq 10n 3 6 7 8 Cq µL Cq 0.2 0 0.2 5 0.3 6 Using clinical specimens, the limit of detection was 0.02 parasites / µL for P. falciparum and P. vivax, 0.57 for P. ovale and 2.85 for P. malariae for each species-specific qPCRs.Using DNA from a culture, the limit of detection for P. knowlesi assay was 1.41 x 10-5ng / mL of P. knowlesi DNA.The calculated qPCR efficiencies are described in Table 7. Table 7. qPCR efficiency for each qPCR assay. Species EfficiencyPlasmodium spp. 1.70 (85%)P. falciparum 1.87 (93.5%)P. vivax 1.93 (96.5%)P. ovale 1.61 (80.5%)P. malariae 1.68 (84%)P. knowlesi 1.85 (92.5%)Analytical Specificity A limited number of samples were used to determine the analytical specificity of each assay (Figure 6). The pan-Plasmodium assay was able to detect all six species. No cross-reactivity was found for specific assays (Table 8).Table 8. Analytical specificity of each qPCR assay against 39 species-specific specimens (expressed as % of specimens detected). Species-specific specimens tested P. falciparum P. vivax P. ovale P. malariae P. knowlesi qPCR assay (n = 18) (n = 7) (n = 10) (n = 3) (n = 1) Plasmodium spp. 100 100 100 100 100P. falciparum 100 0 0 0 0P. vivax 0 100 0 0 0P. ovale 0 0 100 0 0P. malariae 0 0 0 100 0P. knowlesi 0 0 0 0 100Clinical validation The inventors then screened their collection of whole blood extracts obtained from patient suspected of malaria with the developed duplex assay. Out of 410 patients, 87 had malaria (median age, 40; sex ratio (M / F), 3.35) with positive BS with P. falciparum(n = 59), P. vivax (n = 7), P. ovale (n = 10), P. malariae (n = 3). No cases of P. knowlesimalaria were diagnosed (Table 9). A total of 190 samples were obtained from these 87 different positive patients, with 87 samples collected on the day of diagnosis (D0) and 103 during post-therapeutic follow-up. The median number of samples per patient was 2[ Q1: 1 – Q3: 7].Table 9. Basic characteristics of 410 patients.Characteristic Negative BS Positive BSNo. of patients 323 87Malaria species identification, No. (%) 59 (67.8) P. falciparum 7 (8) P. vivax 10 (11.5) P. ovale 3 (3.5) P. malariae 8 (9.2) Biparasitism No. of specimens333 190Day of diagnosis 87 Follow-up 103 No. of specimens per species, No. (%) 117 (61.6) P. falciparum 19 (10) P. vivax 25 (13.2) P. ovale 9 (4.7) P. malariae 20 (10.5) Biparasitism No. of specimens per patient, 1[1 – 3] 2 [1 – 7]median [range]Sex ratio (M / F) 1.03 3.35Age (median) 41 40Analysis of negative samples on blood smears Eight out of 323 patients with negative BS (2.5%) had positive duplex qPCR for at leastone of the two plasmodial targets (Plasmodium spp. / P. falciparum) with late Cq values(Table 10). These results were confirmed on another qPCR run. Epidemiological or clinical data, available for 7 of them, were consistent with the detection of low plasmodial DNA load in blood (Table 10). Among these patients, two treated with antimalarial drugs in the malaria endemic country were qPCR assay positive while they had negative BS and ICT results. One patient had a positive qPCR and ICT with a negative BS. Table 10. Patients with negative blood smear examination and positive qPCR. Cq, quantification cycle. No. Plasmodium P. Internal Clinical informations patient spp. Cq* falciparum control Cq 167 45 42.22 No inhibitors Fever for one week after returning fromMalaysia. Non-bloody diarrhea, abdominal pain, nausea and dry cough. 182 45 Negative No inhibitors Last trip to the Congo in 2018.184 40.67 37.09 No inhibitors Fever and chest pain on return from a45-day stay in Ivory Coast without prophylaxis. Positive thick drop in Ivory Coast. 186 41.59 37.89 No inhibitors Return from Cameroon.188 Negative 40.04 No inhibitors Fever, diarrhea, abdominal pain andnausea on return from a 3-day stay in Ghana. 191 42.67 39.04 No inhibitors Hospitalized in intensive care unit foraltered general condition, confusional syndrome, vomiting, diarrhea and fever. Anemia, thrombocytopenia and acute renal failure. Two thick drops positive in Ivory Coast with malaria treatment. 243 45 Negative No inhibitors No clinical informations.322 40.52 36.03 No inhibitors Probable treated malaria (positive P.falciparum ICT)Analysis on specimens obtained at diagnosis with a single speciesAll patients who were diagnosed by BS were positive with pan-Plasmodium qPCR andspecies-specific qPCRs (Table 11), leading a sensitivity of 100%. The sensitivity of the ICTwas 89.4%, 100%, 30% and 33.3% for the diagnosis of P. falciparum, P. vivax, P. ovale andP. malariae, respectively (Table 11).Table 8. Positivity rate for single species malaria diagnosis with BS, ICT and qPCR.Positive BS Positive ICT Positive qPCR Species n (%) n (%) n (%) P. falciparum 59 (89.4) 59 (89.4) 66 (100)P. vivax 7 (100) 7 (100) 7 (100)P. ovale 10 (100) 3 (30) 10 (100)P. malariae 3 (100) 1 (33.3) 3 (100)Using the pan-Plasmodium assay, the parasite load was higher for P. falciparum than forthe other species (Cq, 26.7 vs. 28.1 for P. vivax, 29.4 for P. ovale, 29.1 for P. malariae,Figure 4A and Table 12). This was also confirmed when the specific assays were used(Figure 4B). Table 12. Comparison of Cq at the single species malaria diagnosis between pan-Plasmodium and specific-species qPCRs. Cq, quantification cycle.Malaria species Median parasitaemia Cq, median at the identification Target qPCRat diagnosis diagnosis [IQR] (parasites / µL) [IQR] Plasmodium spp. 26.7 [24.6 – 29.6]P. falciparum13,350 [4,005 – 46,725]P. falciparum 24.2 [22.6 – 27.2]Plasmodium spp. 28.1 [26.6 – 28.5]P. vivax8,900 [2,336 – 17,800]P. vivax 27.9 [26.7 – 28.2]Plasmodium spp. 29.4 [28 – 32.1]P. ovale2,670 [445 – 4,450]P. ovale 36 [35.1 – 38.4]Plasmodium spp. 29.1 [28.7 – 30]P. malariae5,785 [5,118 – 7,343]P. malariae 36.9 [36.2 – 37.3]The correlation between the pan-Plasmodium and species-specific assays gave adjusted-R2between 0.71 and 0.99 (Figure 5). When compared quantification as log of number of copies to the parasitaemia obtained by microscopy, we observed a good correlation between 13% (3,692,745 copies / µL) and less than 0.01% (85.7 copies / µL) parasitaemia (adjusted-R2= 0.8). Below 0.01% parasitaemia, qPCR assay has a wide range ofquantification from 85.7 to 15,052 copies / µL (Figure 6).Comparing with the identification obtained at the French National Reference Center ofmalaria, the P. ovale qPCR assay was able to detect either P. ovale wallikeri (n = 1) andP. ovale curtisi infections (n = 4).Analysis of patients with biparasitism Cases of malaria involving two different species were detected by standard methods (BS or ICT), by the qPCR used by the French National Reference Center of malaria, or during the study with our qPCR (n = 8). We found five patients (5.7%) harboring biparasitism with our qPCR assays. Among them, only one biparasitism (20%) was detected by BS. Forbiparasitism involving P. falciparum, the parasite load of P. falciparum was always higherthan other plasmodial species. In addition, for one biparasitism with P. falciparum and P.malariae suspected microscopically (patient 404), P. malariae qPCR assay was negativeand only positive for P. falciparum (result confirmed by French National Reference Centerof malaria). Two coinfections identified by the French National Reference Center ofmalaria were not found with our qPCR (patient 385 and 405, Table 13).Table 13. Suspected malarial coinfections with two plasmodial species by conventional diagnostic methods and / or molecular biology. T1 and T2 were the P. falciparum-specific antigen (HRP2) and the common antigen of all plasmodial species, respectively. qPCR results obtaine d by the P. P. P. No. P. P. French Plasmod falcipar malari knowl patieBS ICTvivax ovale Nationa ium spp.um ae esi nt Cq Cq l Cq Cq* Cq Refere nce Center of malaria Negativ Negati Negati Negati 385 P. vivax T1 34.233.2 P. vivax e ve ve ve + P. falcipar um P. falcipar Negati Negati Negati Negati um 398 P. ovale 31.6 3440 ve ve ve ve + P. ovale curtisi P. Negati Negati Negati Negati 403 malaria33 35.940 NA ve ve ve ve e P. falcipar P. um &T1 + Negati Negati Negati Negati 40431.4 29.5falcipar P. T2 ve ve ve ve um malaria e P. ovale P. Negati Negativ Negati Negati Negati + P. 405 malaria 31.6 39.6 ve e ve ve ve malaria e e P. P. Negati Negati Negati 406 malariaT2 29.5 32.536.2 malaria ve ve ve e e P. falcipar P. Negati Negati Negati um 407 malariaT2 28.4 31.935.5 ve ve ve + P. e malaria e P. P. falcipar falcipar um &T1 + Negati Negati Negati um 40829.3 27.745 P. T2 ve ve ve + P. malaria malaria e e ICT was negative in 3 / 8 (37.5%) cases harboring biparasitism by qPCR (patient 398, 403and 405, Table 13). One sample was positive for P. falciparum antigen but only positivefor P. vivax by our qPCR. This sample was positive for P. vivax and P. falciparum byNational Reference Center qPCR (patient 385). A positive sample for both antigens withICT was confirmed with a positive qPCR for P. falciparum (patient 404). Two samplespositive for P. falciparum and P. malariae by qPCR were only positive for commonplasmodial antigen with ICT (patient 406 and 407). Only one sample was consistent with all techniques (patient 408).Analysis on follow-up specimens from single species malaria casesOf the 170 initial and follow-up malaria samples involving a single species, 145 (85.3%)were positive with pan-Plasmodium qPCR, 110 for P. falciparum, 13 for P. vivax, 17 forP. ovale and 5 for P. malariae. Among these 145 samples, 72 (49.7%) had a parasitaemiagreater than or equal to 0.01% with a copy number between 880 and 3,692,744 copies / µL. In addition, 9 (6.2%) samples had only P. falciparum gametocytes on the BS with copy numbers ranged from 14.9 to 1,054 copies / µL. Finally, 47 (32.4%) follow-up specimens were negative on BS and detectable with pan-Plasmodium qPCR with low copy numbersranging from 2.89 to 175 copies / µL (Figure 7). Two reactivation episodes of P. vivax andP. ovale were identified. For those cases, the duplex qPCR was positive at D28, D65 andD95 for P. vivax, and at D56 and D332 for P. ovale after primary malaria infection. Eachepisode was treated except for the reactivation episode at D28 of the primary P. vivax infection, which was identified with our qPCR but negative by BS.Analysis on follow-up specimens from P. falciparum casesThe inventors then analyzed pan-Plasmodium qPCR results in cases for which follow-upsamples under treatment were obtained (n = 30 patients and 85 samples). The inventors obtained 30, 23, 18, 7 and 7 patients with a follow up at D0, D2-D4, D5-D7, D8-D14, D15- D30, respectively. Most of the patients were treated with artemisinin-based combination therapies for 3days. A 3.1 log decrease of the P. falciparum load was observed between D0 and D2-D4specimens. The median P. falciparum load was 67,234 copies / µL at D0 and 53.4 copies / µLat D2-D4 (Figure 8). Among the samples collected between D2 and D30 after the P.falciparum malaria infection, 95.7% and 57.1% were still positive at D2-D4 and D15-D30follow-up, respectively. This clearance of plasmodial DNA was higher for non-P.falciparum species than for P. falciparum (Figure 9).Discussion The inventors developed a new duplex qPCR detection method allowing detection and / oridentification of both Plasmodium spp. and P. falciparum, as well as specific qPCRsmethod for detection and / or identification of all human plasmodial species. The inventorsobtained a limit of detection of 1 copy / µL for Plasmodium spp. No cross-reactivity wasfound for all the species-specific assays. Clinical validation of these different qPCRs on a cohort of 410 patients demonstrated 100% sensitivity for the detection of all fiveplasmodial species, including P. ovale wallikeri and P. ovale curtisi, at the time of single-species malaria diagnosis. As described in the literature, P. falciparum was the speciesmost frequently found in imported malaria cases in France (Thellier et al., 2020). Analysisof negative samples by conventional microscopy methods identified 8 patients out of 323 (2.5%) with a positive amplification. Two of these samples were a persistent circulating DNA secondary to antimalarial treatment. Due to the high sensitivity of qPCR, the detection of plasmodial DNA in the other 6 samples may be a detection of sub-microscopicmalaria, or a P. ovale / P. vivax relapse (patient 182, Table 11). A study carried out inColombia showed a global malaria prevalence of 0.3% by microscopy, compared with anestimated 9.7% by qPCR (Vallejo et al., 2015).Using direct examination as the gold standard for malaria diagnosis, duplex qPCR and species-specific qPCRs have a diagnostic sensitivity of 100% for cases of monoparasitism. The lack of sensitivity of ICT for the diagnosis of P. ovale and P. malariae infection wasconfirmed by the inventors, with a sensitivity of 30% and 33.3%, respectively. For P. ovaleinfections, the inventors detected both P. ovale wallikeri and P. ovale curtisi infectionsas identified by the French National Reference Center of malaria (Loste et al. 2021).Despite the detection of all cases of P. ovale and P. malariae monoparasitism, it wasobserved later Cq with species-specific qPCRs, compared with those for P. falciparum andP. vivax. Parasite density of asexual forms was observed to be higher for P. falciparuminfections compared with those involving P. ovale and P. malariae. Although there arevery few descriptions of imported P. knowlesi malaria in France (6 cases since 2010, dataof French National Reference Center of malaria), the inventors developed a specific qPCR for this species. The use of a plasmid containing a fragment of the small 18S subunit of ribosomal DNA enabled the inventors to assess the consistency between microscopy and qPCR for parasitaemia determination. Despite a good correlation between microscopic parasitedensity and number of copies, the inventors observed a heterogeneous distribution ofparasite load within low parasitaemia probably due to a combination of sequestration and stochastic effects of low copy number DNA. Among the 87 microscopy-positive patients, the inventors identified 5 cases (5.7%) of biparasitism by qPCR which are important to diagnose especially those involving P. ovaleand P. vivax (prevention therapy of relapses) (Wångdahl et al, 2021).The results of the biparasitism cases involving P. falciparum are consistent with those ofthe French National Reference Center of malaria. In 37.5% of biparasitism cases, the ICTwas negative, confirming the lack of sensitivity of immunochromatographic tests (Malthaet al., 2013). To date, biological assessment of plasmodial clearance is based on the use of microscopy. ICT and qPCR are not recommended because of parasite persistence secondary to antimalarial treatment. In the present invention, 145 samples (85.3%) were positive by qPCR at diagnosis and during post-treatment follow-up, with a sharp decrease in parasiteload between D0 and D3. The French retrospective study by Kamaliddin et al. showed that rapid diagnostic test and qPCR remained positive, respectively in 51% and 10-12% ofcases, 28 days after treatment of imported P. falciparum malaria. Despite the small sizeof performed assay, the inventors detected persistent P. falciparum DNA in 57.1% ofsamples between 15 and 30 days after treatment. The difference in parasite DNA clearance observed by qPCR may be explained by differences in premunition status between patients. The positivity of qPCR after anti-malarial treatment can be explained by the elimination of parasite DNA secondary to parasite death or sub-microscopic persistence of the parasite in the absence of relapse and better sensitivity compared toconventional methods (Vafa Homann et al., 2017 and Tadele et al., 2022). Indeed, theinventors found positive qPCR for 9 samples (6.2%) in which gametocytes were found on direct examination without other parasitical forms, with a plasmodial load of between119.2 and 8,432 DNA copies (Figure 7). The persistence of sub-microscopic gametocytesexplains the persistence of qPCR positivity. The prevalence of gametocytes estimated byMwingira et al. was determined by microscopy and pfs25-specific qRT-PCR in 226 patient samples. The results showed a gametocyte carriage in the study population of 10.6% by RT-qPCR and 1.2% by microscopy. These results demonstrate that the use of qPCR is interesting for the detection of sub-microscopic gametocytemia in patients who may bethe reservoir of malaria. The inventors have shown that P. falciparum load decays lessrapidly than other plasmodial species (Figure 8). The study of post-therapeuticplasmodial load decay by Lo et al. showed faster clearance for P. vivax than for P.falciparum This may be explained by the extended circulation of P. falciparumgametocytes, compared with that of other species. This invention may be used to study the decay of post-therapeutic parasite load in non-endemic areas. Indeed, the methodsof the present invention allow to determine the persistence of circulating DNA in a cohortof patients infected with antimalarial drug-resistant mutants. Two P. vivax and P. ovalerelapses were identified. In these cases, duplex qPCR was positive at D28, D65, D67 andD95 for P. vivax, and at D56, D59 and D332 for P. ovale after initial malaria diagnosis. Incomparison with these qPCR results, direct examination was negative at D28 and D67 forP. vivax and at D59 for P. ovale. No treatment failure occurred in patients whose sampleswere included herein, confirmed by the absence of resistance tested by the French National Reference Center of malaria. In fact, the detection method of the present invention may be an better alternative ofconventional methods, using Plasmodium spp. / P. falciparum / internal control qPCR in asuspected malaria of patient returning from an endemic area. If both plasmodial targets of duplex qPCR are positive, the number of copies can be quantified. In the case of singlePlasmodium spp. target positivity, suggesting malaria caused by a species other than P.falciparum, the method of the invention consists in using specific qPCRs to identify the involved species (Figure 10). Finally, the inventors developed the automation and miniaturization of these detection methods to enable DNA extraction and amplification in less than two hours, allowing thus to establish a reliable and rapid diagnosis. Example 2This example relates to the determination of the condition of amplification, such as thetemperature and the concentration of some reagents used in the qPCR method according to the invention. Materials and MethodsThe Materials and Methods used in this example are as those used in Example 1 above,but specific parameters (as disclosed below) have been assessed in order to determinethe optimal conditions for performing the methods of the invention.Results Optimization of temperature of the amplification reaction The inventors demonstrated that the amplification reaction performed in the context of the detection methods of the invention may take place at temperatures in the range comprised particularly between 51°C and 62°C. More specifically, the following temperatures have been assessed: 51°C, 54°C, 56°C, 58°C and 61°C. Particularly, the inventors performed a cycle quantification (Cq) at 54°C and 58°C duringthe amplification of DNA of P. falciparum and the amplification of DNA of P. vivax, P.ovale and P. malariae. The obtained results are presented on Tables 14: Table 14: Temperature assay with P. falciparum58°C + 6 mM Mix primers Mix primers Average Cq ΔCq MgSO4+ 2%f falci + falci + DMSO probe pan probe pan Well 1 Well 2 P. falciparum36,36 36,55 36,46 2,281 / 25 P. falciparum38,75 38,73 38,74 2,751 / 125 P. falciparum41,50 41,47 41,491 / 625 54°C + 6 mM Mix primers Mix primers MgSO4+ 2% falci + probe falci + probe DMSO pan panAverage Cq ΔCqWel l1 Well 2 P. falciparum 1 / 25 38,84 38,93 38,89 2,31P. falciparum 1 / 125 41,14 41,26 41,20P. falciparum 1 / 625 >45 >45 >45The above results demonstrates that in the same amplification conditions, when the temperature increases from 54°C to 58°C, the Cq was reduced with 2.4 cycles. Optimization of the reagent used in the amplification reaction The inventor further assessed the optimization of some reagents used in the amplificationreaction as the concentration of DMSO and the supplementation or not of the reactionmedium with MgSO4. Particularly, the inventors performed a cycle quantification (Cq) ina medium of 2% DMSO supplemented with 6mM of MgSO4 and in medium without DMSOand MgSO4 during the amplification of DNA of P. falciparum and the amplification of DNAof P. vivax, P. ovale and P. malariae.In addition, the inventors combined these reagent conditions with the temperature of amplification.Thus, the following amplification conditions have been tested for P.falciparum ant thethree of other Plasmodium species:1) a 2%DMSO medium + 6mM MgSO4 at 58°C, and 2) a medium without DMSO and MGSO4 at 54°C .The obtained results are presented on Tables 15 and 16 below:Table 15: Comparison of amplification conditions 1) and 2) of DNA of P. falsiparum .58°C + 6 Mix MixAverage Cq ΔCqmM MgSO4primers primers + 2%f DMSO falci + falci + probe pan probe pan Well 1 Well 2 P. falciparum 1 / 25 36,36 36,55 36,46 2,28 P. falciparum 1 / 125 38,75 38,73 38,74 2,75P. falciparum 1 / 625 41,50 41,47 41,49Mix primers Mix primers falci + probe falci + probe 54°C sans pan panAverage Cq ΔCqMgSO4 et DMSO Well 1 Well 2 P. falciparum 1 / 25 42,79 41,61 42,20P. falciparum 1 / 125 >45 >45 >45P. falciparum 1 / 625 >45 >45 >45Table 16: Comparison of the amplification conditions 1) and 2) of DNA of P. falsiparum,P. vivax, P. ovale and P. malariae58°C + 6 mM Mix primers Mix primers Average ΔCq MgSO4 + 2%f pan + probe pan + probe Cq DMSO pan pan Well 1 Well 2P. falciparum 1 / 25 33,57 33,74 33,66 2,46P. falciparum 1 / 125 36,05 36,19 36,12 2,40P. falciparum 1 / 625 38,73 38,30 38,52 P. vivax 26,44 26,74 26,59P. ovale 27,03 27,02 27,03P. malariae 27,26 27,52 27,3954°C without Mix primers Mix primers Average MgSO4 and pan + probe pan + probe Cq DMSO pan pan Well 1 Well 2P. vivax 33,48 33,69 33,59P. ovale 34,86 35,11 34,99P. malariae 35,58 35,67 35,63The above results demonstrate that in the tested amplification conditions 1), the Cq was reduced with about 7 cycles. This demonstrate the positive effect on the efficacity of thedetection method of the invention when the amplification is performed at 58°C and theamplification medium contains 2% of DMSO and is also supplemented with MgSO4.

[0002] BIBLIOGRAPHIC REFERENCES Beshir KB, Hallett RL, Eziefula AC, Bailey R, Watson J, Wright SG et al. Measuringthe efficacy of anti-malarial drugs in vivo: quantitative PCR measurement of parasiteclearance. Malar J 2010; 9: 312.Bouzayene A, Zaffaroullah R, Bailly J, Ciceron L, Sarrasin V, Cojean S et al. Evaluation of two commercial kits and two laboratory-developed qPCR assays comparedto LAMP for molecular diagnosis of malaria. Malar J 2022; 21: 204.Joste V, Bailly J, Hubert V, Pauc C, Gendrot M, Guillochon E et al. Plasmodiumovale wallikeri and P. ovale curtisi Infections and Diagnostic Approaches to ImportedMalaria, France, 2013–2018. Emerg Infect Dis 2021; 27: 372–384.Kamaliddin C, Joste V, Hubert V, Kendjo E, Argy N, Houze S. Evaluation of PCR To Monitor Plasmodium falciparum Treatment Efficacy in a Nonendemicity Setting. J ClinMicrobiol 2019; 58: e01080-19.Khairnar K, Martin D, Lau R, Ralevski F, Pillai DR. Multiplex real-time quantitative PCR, microscopy and rapid diagnostic immuno-chromatographic tests for the detection of Plasmodium spp: performance, limit of detection analysis and quality assurance. Malar J 2009; 8: 284. Lo E, Nguyen J, Oo W, Hemming-Schroeder E, Zhou G, Yang Z et al. ExaminingPlasmodium falciparum and P. vivax clearance subsequent to antimalarial drug treatment in the Myanmar-China border area based on quantitative real-time polymerase chainreaction. BMC Infectious Diseases 2016; 16. doi:10.1186 / s12879-016-1482-6.Maltha J, Gillet P, Jacobs J. Malaria rapid diagnostic tests in travel medicine.Clinical Microbiology and Infection 2013; 19: 408–415.Mohring F, Hart MN, Rawlinson TA, Henrici R, Charleston JA, Diez Benavente E etal. Rapid and iterative genome editing in the malaria parasite Plasmodium knowlesiprovides new tools for P. vivax research. eLife; 8: e45829. Mwingira F, Genton B, Kabanywanyi A-NM, Felger I. Comparison of detection methods to estimate asexual Plasmodium falciparum parasite prevalence and gametocytecarriage in a community survey in Tanzania. Malar J 2014; 13: 433.Tadele G, Jaiteh FK, Oboh M, Oriero E, Dugassa S, Amambua-Ngwa A et al. Persistence of Residual Submicroscopic P. falciparum Parasitemia following Treatment of Artemether-Lumefantrine in Ethio-Sudan Border, Western Ethiopia. Antimicrob AgentsChemother 2022; 66: e0000222.Thellier M, Simard F, Musset L, Cot M, Velut G, Kendjo E et al. Changes in malariaepidemiology in France and worldwide, 2000–2015. Médecine et Maladies Infectieuses 2020; 50: 99–112. Vallejo AF, Chaparro PE, Benavides Y, Álvarez Á, Quintero JP, Padilla J et al. Highprevalence of sub-microscopic infections in Colombia. Malar J 2015; 14: 201.Wang Y, Yang Z, Yuan L, Zhou G, Parker D, Lee M-C et al. Clinical Efficacy ofDihydroartemisinin–Piperaquine for the Treatment of Uncomplicated Plasmodiumfalciparum Malaria at the China–Myanmar Border. Am J Trop Med Hyg 2015; 93: 577–583Vafa Homann M, Emami SN, Yman V, Stenström C, Sondén K, Ramström H et al. Detection of Malaria Parasites After Treatment in Travelers: A 12-months LongitudinalStudy and Statistical Modelling Analysis. EBioMedicine 2017; 25: 66–72.Wångdahl A, Sondén K, Wyss K, Stenström C, Björklund D, Zhang J et al. Relapseof Plasmodium vivax and Plasmodium ovale Malaria With and Without PrimaquineTreatment in a Nonendemic Area. Clin Infect Dis 2021; 74: 1199–1207.

Claims

1. CLAIMS1. An in vitro method for simultaneously detecting and / or quantifying DNA fromPlasmodium genus and DNA from Plasmodium falciparum species in a biologicalsample comprising nucleic acid molecules, the method comprising the steps of: (a1) contacting DNA of the biological sample with: oa first set of primers for the pan-amplification of DNA fromPlasmodium genus, comprising:^ a forward primer PanF1 of sequence SEQ ID NO:1 or itscomplementary sequence; and ^a reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; oa second set of primers for the specific amplification of DNA fromPlasmodium falciparum species, comprising:^ a forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and ^two reverse primers Pf1R2 and Pf2R2 of sequences SEQ IDNO:4 and 5 or their complementary sequences, respectively; and oreagents suitable for polymerase chain reaction (PCR)amplification; (b1) amplifying DNA from Plasmodium genus with the first set of primersto generate a first amplicon and DNA from Plasmodium falciparum specieswith the second set of primers to generate a second amplicon; (c1) detecting the presence or the absence of the first amplicon and the second amplicon, wherein the presence of the first amplicon is indicativeof the presence of DNA from Plasmodium genus in the sample and thepresence of the second amplicon is indicative of the presence of DNA fromPlasmodium falciparum species; and(d1) optionally, measuring the quantity of the first amplicon to determine the amount of DNA from Plasmodium genus in the biological sample and / ormeasuring the quantity of the second amplicon to determine the amount of DNA from Plasmodium falciparum species in the biological sample.

2. The method according to claim 1, wherein:^ the DNA of the biological sample is further contacted in step (a1) with:o a first probe PanP1 of sequence SEQ ID NO:6 or its complementarysequence, with a first fluorophore and a first quencher, wherein the first quencher quenches the fluorescence of the first fluorophore, and oa second probe PanP2 of sequence SEQ ID NO:7 or itscomplementary sequence, with a second fluorophore and a second quencher, wherein the second quencher quenches the fluorescence of the second fluorophore,wherein the wavelength of the fluorescence emitted by the first fluorophore is different from the wavelength of the fluorescence emitted by the second fluorophore; and ^step (d1) is present and measuring the quantities of the first and secondamplicons is performed based on the amount of fluorescence emitted by the first and second fluorophores, respectively.

3. The method according to claim 1 or claim 2, wherein:^ the first set of primers amplifies DNA from Plasmodium falciparum,Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi species; and^ when present, the first and second probes PanP1 and PanP2 hybridize toDNA from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovalecurtisi, Plasmodium ovale wallikeri, Plasmodium malariae andPlasmodium knowlesi.

4. The method according to any one of claims 1 to 3, further comprising:^ adding an internal control to the biological sample before step (a1),wherein the internal control comprises viral DNA; and ^in step (a1), further contacting the DNA of the biological sample with athird set of specific primers for the amplification of viral DNA from the internal control, comprising forward and reverse primers specific for the viral DNA from the internal control and optionally a third probe specifically hybridizing to the viral DNA from the internal control, wherein when present the third probe comprises a third fluorophore and a third quencher, wherein the third quencher quenches the fluorescence of the third fluorophore, wherein the wavelength of the fluorescence emitted by the third fluorophore is different from the wavelengths of the fluorescence emitted by the first and second fluorophores; ^in step (b1), further amplifying viral DNA from the internal control withthe third set of primers to generate a third amplicon; ^In step (c1) further detecting the presence or the absence of the thirdamplicon, wherein: othe absence of the third amplicon is indicative that the PCR reactionhas not worked; othe presence of the third amplicon only is indicative that there is noDNA from Plasmodium genus in the biological sample;o the presence of the first and third amplicons is indicative that thebiological sample comprises DNA from Plasmodium genus, but does notcontain DNA from Plasmodium falciparum species;o the presence of the second and third amplicons is indicative that thebiological sample comprises DNA from Plasmodium falciparum species;o the presence of the first, second and third amplicons is indicative thatthe biological sample comprises DNA from Plasmodium genus, includingDNA from Plasmodium falciparum species;^ In step (d1), when present, further measuring the quantity of the thirdamplicon to determine the amount of viral DNA from the internal control in the biological sample, wherein said measure is performed based on the amount of fluorescence emitted by the third fluorophore.

5. An in vitro method for detecting and / or quantifying DNA from Plasmodiumfalciparum species or DNA from a Plasmodium species selected from Plasmodiumvivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi in a biological sample comprising nucleic acidmolecules, the method comprising the steps of: ^taking a first sub-sample from the biological sample;^ simultaneously detecting and / or quantifying DNA from Plasmodium genusand DNA from Plasmodium falciparum species in the first sub-sample usingthe method according to any one of claims 1 to 4; ^when DNA from Plasmodium genus is detected or quantified and / or DNAfrom Plasmodium falciparum species is detected or quantified in the firstsub-sample: i) taking a second, a third, a fourth and a fifth sub-sample from thebiological sample; ii) contacting:^ DNA of the second sub-sample with a set of primers for thespecific amplification of DNA from Plasmodium vivax species,comprising: oa forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and oa reverse primer PvR2 of sequence SEQ ID NO:8 or itscomplementary sequence; ^DNA of the third sub-sample with a set of primers for the specificamplification of DNA from Plasmodium ovale curtisi andPlasmodium ovale wallikeri species, comprising:o a forward primer PoF1 of sequence SEQ ID NO:9 or itscomplementary sequence; and oa reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; ^DNA of the fourth sub-sample with a set of primers for thespecific amplification of DNA from Plasmodium malariae species,comprising: oa forward primer PmF1 of sequence SEQ ID NO:10 or itscomplementary sequence; and oa reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; ^DNA of the fifth sub-sample with a set of primers for the specificamplification of DNA from Plasmodium knowlesi species,comprising: oa forward primer PkF1 of sequence SEQ ID NO:11 or itscomplementary sequence; ando a reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; iii) amplifying DNA from Plasmodium vivax species in the second sub-sample, DNA from Plasmodium ovale curtisi and / or Plasmodium ovalewallikeri species in the third sub-sample, DNA from Plasmodiummalariae species in the fourth sub-sample, and DNA from Plasmodiumknowlesi species in the fifth sub-sample;iv) detecting the presence or the absence of an amplicon in the second,third, fourth and fifth sub-samples, wherein: ^the presence of an amplicon in the second sub-sample isindicative of the presence of DNA from the Plasmodium vivax species; ^the presence of an amplicon in the third sub-sample is indicativeof the presence of DNA from the Plasmodium ovale species; ^the presence of an amplicon in the fourth sub-sample isindicative of the presence of DNA from the Plasmodium malariae species; ^the presence of an amplicon in the fifth sub-sample is indicativeof the presence of DNA from the Plasmodium knowlesi species;v) optionally, measuring the quantity of:^ the amplicon in the second sub-sample to determine the amountof DNA from Plasmodium vivax species in the sample;^ the amplicon in the third sub-sample to determine the amountof DNA from Plasmodium ovale species in the sample;^ the amplicon in the fourth sub-sample to determine the amountof DNA from Plasmodium malariae species in the sample;^ the amplicon in the fifth sub-sample to determine the amount of DNAfrom Plasmodium knowlesi species in the sample.

6. The method of claim 5, wherein:^ In the step of simultaneously detecting and / or quantifying DNA fromPlasmodium genus and DNA from Plasmodium falciparum species in thefirst sub-sample, the method of claim 2 or claim 3 depending on claim 2 or claim 4 depending on claim 2 is used; ^In step (ii):o further contacting DNA of the third, fourth and fifth sub-sampleswith a first probe PanP1 of sequence SEQ ID NO:6 or its complementary sequence, with a first fluorophore and a first quencher, wherein the first quencher quenches the fluorescence of the first fluorophore; ofurther contacting DNA of the second sub-sample with a secondprobe PanP2 of sequence SEQ ID NO:7 or its complementary sequence, with a second fluorophore and a second quencher, wherein the second quencher quenches the fluorescence of the second fluorophore;wherein the wavelength of the fluorescence emitted by the first fluorophore is different from the wavelength of the fluorescence emitted by the second fluorophore; and ^step (v) is present and measuring the quantities of the amplicons in thesecond, third, fourth and fifth sub-samples is performed based on the amount of fluorescence emitted by the first or second fluorophores, depending on the probe added to each sub-sample.

7. A method for monitoring the efficacy of a treatment against malaria in a subjectfrom a first biological sample obtained from the subject before starting the treatment and a second biological sample obtained from the subject after starting the treatment, the method comprising detecting and / or quantifying DNA from Plasmodium falciparum species or DNA from a Plasmodium species selected fromPlasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi in the first and second biologicalsamples using the method according to claim 5 or claim 6, wherein the absence in the second biological sample of DNA from the Plasmodium species detected in thefirst biological sample or decrease in the second biological sample compared to the first biological sample of the amount of DNA from the Plasmodium speciesquantified is indicative that the treatment is efficient.

8. A method for detecting a Plasmodium infection relapse or a new Plasmodiuminfection in a subject from a first biological sample obtained from the subject at the end of an antimalarial treatment and a second biological sample obtained from the subject at a later stage, the method comprising detecting and / or quantifying DNA from Plasmodium falciparum species or DNA from a Plasmodium speciesselected from Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae and Plasmodium knowlesi in the first and secondsamples using the method according to claim 5 or claim 6, wherein the presence in the second biological sample of DNA from a Plasmodium species not detectedin the first biological sample or the increase in the second biological sample compared to the first biological sample of the amount of DNA from a Plasmodium species is indicative of a Plasmodium infection relapse or a new Plasmodiuminfection in a subject.

9. The method according to any one of claims 1 to 8, wherein the biological sampleis whole blood, a spleen biopsy, or a liver biopsy.

10. The method according to any one of claims 1 to 9, the method comprising apreliminary step of isolating DNA from the biological sample.

11. A kit comprising:i) a first set of primers for the pan-amplification of DNA from Plasmodiumgenus, comprising: ^a forward primer PanF1 of sequence SEQ ID NO:1 or itscomplementary sequence; and^ a reverse primer PanR1 of sequence SEQ ID NO:2 or itscomplementary sequence; ii) a second set of primers for the specific amplification of DNA fromPlasmodium falciparum species, comprising:^ a forward primer PanF2 of sequence SEQ ID NO:3 or itscomplementary sequence; and ^two reverse primers Pf1R2 and Pf2R2 of sequences SEQ ID NO:4and 5 or their complementary sequences, respectively.

12. The kit according to claim 11, further comprise:^ a first probe PanP1 of sequence SEQ ID NO:6 or its complementarysequence, with a first fluorophore and a first quencher, wherein the first quencher quenches the fluorescence of the first fluorophore, and ^a second probe PanP2 of sequence SEQ ID NO:7 or its complementarysequence, with a second fluorophore and a second quencher, wherein the second quencher quenches the fluorescence of the second fluorophore, wherein the wavelength of the fluorescence emitted by the first fluorophore is different from the wavelength of the fluorescence emitted by the second fluorophore.

13. The kit according to claim 11 or claim 12, further comprising:^ a reverse primer PvR2 of sequence SEQ ID NO:8 or its complementarysequence; ^a forward primer PoF1 of sequence SEQ ID NO:9 or its complementarysequence; ^a forward primer PmF1 of sequence SEQ ID NO:10 or its complementarysequence; and ^a forward primer PkF1 of sequence SEQ ID NO:11 or its complementarysequence.

14. The kit according to claim 13, further comprising:^ An internal control comprising viral DNA, forward and reverse primersspecific for the viral DNA from the internal control and optionally a third probe specifically hybridizing to the viral DNA from the internal control, wherein when present the third probe comprises a third fluorophore and a third quencher, wherein the third quencher quenches the fluorescence ofthe third fluorophore, wherein the wavelength of the fluorescence emitted by the third fluorophore is different from the wavelengths of the fluorescence emitted by the first and second fluorophores; ^A DNA polymerase;^ Deoxynucleotides triphosphates (dNTP);^ A buffer^ Magnesium^ DMSO^ Any combination thereof.

Images