Forebrain assembloid that uniformly expresses chr2 and method for producing same
A method for creating a forebrain assembler with uniform ChR2 expression addresses the limitations of viral delivery systems by forming a neural model with stable gene expression, enabling optogenetic analysis of neural circuits and diseases.
Patent Information
- Application Number
- PCT/KR2025/007105
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-24
- Filing Date
- 2025-05-26
- Publication Date
- 2025-11-27
AI Technical Summary
Existing viral delivery systems for optogenetic experiments in neural networks suffer from non-uniform gene expression, random insertion leading to silencing, and transient gene expression, making them unsuitable for long-term studies.
A method is developed to introduce the ChR2 gene into pluripotent stem cells, forming a forebrain organoid, activating Hedgehog and Wnt signaling pathways, and encapsulating it with reelin-expressing neurons, followed by injection of glial cells to create a forebrain assembler with uniform and stable ChR2 expression.
The forebrain assembler exhibits neural activity in response to light stimulation, providing a reliable model for studying neural circuits and neurological diseases with maturity similar to the human brain.
Smart Images

Figure KR2025007105_27112025_PF_FP_ABST
Abstract
Description
Whole brain assembler uniformly expressing CHR2 and method for producing the same
[0001] The present invention relates to a forebrain assembler that exhibits a maturity similar to that of the human brain and expresses ChR2 to enable optogenetic analysis, and more particularly, to a method for manufacturing a forebrain assembler that enables optogenetic analysis; a forebrain assembler manufactured by the method; and a forebrain assembler comprising a single rosette structure including six cortical layers and a cavity, wherein the forebrain assembler includes glial cells in the cortical layer and uniformly expresses ChR2.
[0002] Understanding human brain development and neurological diseases presents numerous challenges due to the scarcity and limited accessibility of human brain tissue. However, thanks to advances in stem cell technology and three-dimensional (3D) culture, human pluripotent stem cells (hPSCs), such as human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), can self-organize in vitro and develop into 3D tissues that mimic the human brain.
[0003] Optogenetics is a technology that uses light to temporally and spatially control the activity of specific cell populations by genetically introducing light-responsive proteins, such as ion channels, pumps, and enzymes. This technology has revolutionized neuroscience research over the past decade, and has been successfully applied to study neural networks and synaptic function within specific neural populations in vitro, and to understand the role of specific brain regions in neural circuits, memory, and behavior in vivo.
[0004] To introduce genes encoding light-responsive proteins into cells, optogenetic experiments commonly employ viral delivery techniques. However, this viral infection method can lead to non-uniform gene expression and easy silencing. Furthermore, according to non-patent literatures 1 and 2, lentiviral-based delivery can disrupt endogenous gene expression due to random insertion of genes, potentially affecting normal or disease phenotypes. While adeno-associated virus (AAV) delivery can partially overcome these issues, AAV-based delivery only induces transient gene expression, making it unsuitable for experiments requiring long-term culture. Therefore, existing viral delivery systems have limitations in precisely and reliably controlling neural activity.
[0005] [Prior Art Literature]
[0006] [Non-patent literature]
[0007] (Non-patent Document 0001) Vannucci L. et al. “Viral vector: a look back and ahead on gene transfer technology”, New Microbiologica.2013;36(1):1-22.
[0008] (Non-patent document 0002) Ellis J. “Silencing and variegation of gammaretrovirus and lentivirus vectors”, Human gene therapy.2005;16(11):1241-1246.
[0009] Against this backdrop, the inventors of the present invention targeted ChR2 to the AAVS1 region to produce a forebrain assembler with uniform and stable ChR2 expression. This ChR2-based forebrain assembler exhibited strong neural activity in response to light stimulation, confirming that the ChR2 forebrain assembler could serve as a highly useful model as an optogenetic platform for studying human brain neural circuits and dynamics, as well as various neurological diseases. This completed the present invention.
[0010] Accordingly, an object of the present invention is to provide a method for manufacturing a whole brain assembler capable of optogenetic analysis, comprising the following steps:
[0011] (a) A step of introducing a ChR2 gene into pluripotent stem cells (PSCs) to produce pluripotent stem cells into which ChR2 has been introduced;
[0012] (b) a step of forming a forebrain organoid by culturing the pluripotent stem cells into which the ChR2 has been introduced;
[0013] (c) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;
[0014] (d) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;
[0015] (e) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin (RELN) expressing neurons; and
[0016] (f) A step of producing a forebrain assembler by injecting glial cells into the single rosette forebrain organoid.
[0017] Another object of the present invention is to provide a whole brain assembly manufactured by the above method.
[0018] Another object of the present invention is to provide a forebrain assembler comprising a single rosette structure including six cortical layers and a cavity, characterized in that the cortical layer includes glial cells and uniformly expresses ChR2.
[0019] To solve the above-described problem, a method for manufacturing a whole brain assembler capable of optogenetic analysis is provided, comprising the following steps:
[0020] (a) A step of introducing a ChR2 gene into pluripotent stem cells (PSCs) to produce pluripotent stem cells into which ChR2 has been introduced;
[0021] (b) a step of forming a forebrain organoid by culturing the pluripotent stem cells into which the ChR2 has been introduced;
[0022] (c) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;
[0023] (d) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;
[0024] (e) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin (RELN) expressing neurons; and
[0025] (f) A step of producing a forebrain assembler by injecting glial cells into the single rosette forebrain organoid.
[0026] At this time, the above-mentioned forebrain assembler may be a human forebrain assembler.
[0027] At this time, in the step (a), the ChR2 gene may be introduced into the AAVS1 gene locus of the pluripotent stem cell.
[0028] At this time, in the step (a), the ChR2 gene may be introduced homozygously or heterozygously.
[0029] At this time, in the step (a), the introduction may be performed using an sgRNA including the base sequence of sequence number 3.
[0030] At this time, the AAVS1 gene locus may include the base sequence of sequence number 1, and the ChR2 gene may be introduced after the 17th base of sequence number 1.
[0031] At this time, the substances that activate the Hedgehog and Wnt signal pathways in the above step (c) may be CHIR99021 and SAG.
[0032] At this time, the CHIR99021 may be at a concentration of 0.1 to 5 μM, and the SAG may be at a concentration of 100 to 1000 nM.
[0033] At this time, in the step (e), the relin-expressing neurons are 1×10 3 1×10 5 It could be personal.
[0034] At this time, in the step (e), the glial cells may be at least one selected from the group consisting of astrocytes and microglia.
[0035] At this time, the stellate cells are 1×10 3 1×10 5 It is a dog, and the microglia are 1×10 2 1×10 4 It could be personal.
[0036] At this time, the substance that activates the Hedgehog and Wnt signal pathways in the step (c) may be treated for 5 to 10 days.
[0037] At this time, in the above step (e), the culture may be performed for 10 to 20 days.
[0038] In addition, the present invention provides a whole brain assembly manufactured by the above method.
[0039] Furthermore, the present invention provides a forebrain assembler comprising a single rosette structure including six cortical layers and a cavity, characterized in that the cortical layer includes glial cells and uniformly expresses ChR2.
[0040] At this time, the above-mentioned forebrain assembler may be a human forebrain assembler.
[0041] At this time, the cortical layer may be a first layer expressing RELN, a second layer expressing CUX2, a third layer expressing BRN2, a fourth layer expressing SATB2, a fifth layer expressing CTIP2, and a sixth layer expressing TBR1.
[0042] At this time, the glial cells may be at least one selected from the group consisting of astrocytes and microglia.
[0043] At this time, the above-mentioned forebrain assembler may exhibit neural activity by light stimulation.
[0044] At this time, the light stimulus may have a wavelength of 400 to 550 nm.
[0045] The ChR2-expressing forebrain assembler of the present invention continuously expresses ChR2 in all cells, making optogenetic analysis experimentally easy, and has a single rosette shape and shows a maturity similar to that of an actual human brain, including mature cortical layers and glial cells. Therefore, the forebrain assembler of the present invention and its manufacturing method have high utility value.
[0046] Figure 1a shows the process for inserting ChR2 into hPSCs, Figure 1b shows the AAVS1 gene locus into which EF1α-ChR2 is inserted, Figure 1c shows the genotyping strategy for selecting ChR2 inserted clones, Figure 1d shows the results of genotyping hPSC clones into which ChR2 was introduced through PCR, Figure 1e shows the results of the recombination site base sequence analysis of ChR2 inserted clones, and Figure 1f shows the results of the recombination site base sequence of the non-target allele in ChR2 heterozygous clones.
[0047] Figure 2a shows the results of analyzing the relative expression levels of ChR2 in hPSCs into which the ChR2 gene has been inserted and in control hPSCs, Figure 2b shows the results of Western blot analysis of ChR2-introduced hPSCs, Figure 2c shows the results of visualizing ChR2 protein through immunofluorescence analysis, Figure 2d shows the results of quantifying ChR2 expression based on immunofluorescence analysis, Figure 2e shows the results of evaluating the stability of ChR2 expression according to cell passage, Figure 2f shows the immunofluorescence analysis for the pluripotency indicator OCT4, and Figure 2g shows the immunofluorescence analysis for the pluripotency indicator SOX.
[0048] Figure 3a shows the process of manufacturing a ChR2-expressing forebrain assembler, Figure 3b shows an immunostaining image for neural progenitor cell (SOX2) and neuron (TUJ1) markers, Figure 3c shows an immunostaining image for mature neuron and synapse markers, Figure 3d shows an immunostaining image for the astrocyte marker GFAP, and Figure 3e shows an immunostaining image for the ChR2 protein.
[0049] Figure 4a is a schematic diagram showing the observation of neural activity after photostimulation in a ChR2-expressing forebrain assembler through calcium imaging using Cal-590 AM, Figure 4b shows Cal-590 AM fluorescence images before and after photostimulation, Figure 4c shows a graph of changes in calcium signals per cell after photostimulation, and Figure 4d shows the results of quantitative analysis of the amplitude of calcium signals induced by photostimulation.
[0050] Hereinafter, the present invention will be described in more detail.
[0051] Meanwhile, each description and embodiment disclosed herein can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the present invention. Furthermore, the scope of the present invention is not limited by the specific descriptions described below.
[0052] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described in this application. Furthermore, such equivalents are intended to be encompassed by the present invention.
[0053] As described above, the inventors of the present invention have produced a forebrain assembler that exhibits a maturity similar to that of the human brain and expresses ChR2 to enable optogenetic analysis, and confirmed that calcium activity and neural stimulation occur when optical stimulation is applied, thereby completing the present invention.
[0054] In a specific embodiment of the present invention, as shown in Fig. 1, hPSCs expressing ChR2 protein were produced by introducing the ChR2 gene into the AAVS1 gene. As a result, six heterozygous clones and four homozygous clones in which ChR2 was precisely inserted without mutation were obtained.
[0055] In another specific embodiment of the present invention, uniform and stable expression of the ChR2 protein was confirmed in hPSCs into which the ChR2 gene was introduced (Fig. 2). Furthermore, it was confirmed that the hPSCs maintained pluripotency.
[0056] Furthermore, in another specific embodiment of the present invention, mature forebrain assemblers were produced from the ChR2-transduced hPSCs (Fig. 3). Furthermore, it was confirmed that the forebrain assemblers uniformly expressed the ChR2 protein.
[0057] Accordingly, a first aspect of the present invention relates to a method for manufacturing a whole brain assembler capable of optogenetic analysis, comprising the following steps:
[0058] (a) A step of introducing a ChR2 gene into pluripotent stem cells (PSCs) to produce pluripotent stem cells into which ChR2 has been introduced;
[0059] (b) a step of forming a forebrain organoid by culturing the pluripotent stem cells into which the ChR2 has been introduced;
[0060] (c) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;
[0061] (d) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;
[0062] (e) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin (RELN) expressing neurons; and
[0063] (f) A step of producing a forebrain assembler by injecting glial cells into the single rosette forebrain organoid.
[0064] The term "organoid" as used herein refers to a small cultured organism that mimics the shape and function of a tissue or organ. More specifically, an organoid must contain at least one cell type among the various types of cells that constitute an organ or tissue, and the cells must be spatially organized into a shape similar to an organ by clumping together.
[0065] The term "assembled" used in the present invention refers to a tissue and organ mimic manufactured by recombining various types of cells existing in the organoid and actual tissue, and refers to a three-dimensional biological tissue model manufactured by physically / functionally combining two or more different cell types in a modular or stepwise manner, and particularly, in the present invention, according to one embodiment, refers to a biological structure capable of reproducing functional cell-to-cell interactions by including at least neuron and glial cell types. Such an assembled cell is different from the organoid in that it is not a simple aggregate of cells but is functionally connected, and can be used as a patient-specific model for new drug development, artificial organs, disease treatments, and disease treatment.
[0066] In the present invention, the forebrain assembler may be a human forebrain assembler.
[0067] In the present invention, the step (a) is a step for producing ChR2-expressing pluripotent stem cells that express ChR2 protein by introducing a ChR2 gene into pluripotent stem cells, and specifically, the ChR2 gene may be introduced into the AAVS1 locus of the pluripotent stem cells. At this time, the AAVS1 locus may be located in the first intron in the PPP1R12C gene of human chromosome 19 (NCBI Reference Sequence: NC_000019.10), and more specifically, may correspond to the 1867th to 1886th base sequence in the PPP1R12C gene (NCBI Reference Sequence: NC_000019.10).
[0068] In addition, in the present invention, the AAVS1 gene locus includes the base sequence of SEQ ID NO: 1 of Table 1 below, and the ChR2 gene may be introduced after the 17th base of SEQ ID NO: 1, and more specifically, the introduction of the ChR2 gene may mean that the ChR2 gene is inserted between the 17th base and the 18th base of SEQ ID NO: 1, but is not limited thereto.
[0069] Sequence Name Base Sequence (5'→3') Sequence Number AAVS1GGGGCCACTAGGGACAGGAT1
[0070] In the present invention, the ChR2 may be an H134R mutant type, and the ChR2 gene may include the base sequence of sequence number 2.
[0071] In the present invention, in step (a), the ChR2 gene may be introduced homozygously or heterozygously. Homozygously introducing the ChR2 gene means that both alleles are introduced with ChR2, and heterozygously introducing the ChR2 gene means that only one of the alleles is introduced with ChR2.
[0072] In the present invention, in step (a), the introduction may be performed using a single guide RNA (sgRNA) containing the base sequence of sequence number 3.
[0073] The term "sgRNA" used in the present invention refers to a short single-stranded RNA, which includes RNA specific to the target DNA among the base sequences encoding the target gene, and refers to a ribonucleic acid that complementarily binds to all or part of the target DNA base sequence and guides an endonuclease protein to the target DNA base sequence. The CRISPR / CAS9 system, which consists of the sgRNA and the Cas9 protein that cuts a specific base sequence, is a simple and easy method for inducing mutations at a specific genomic locus.
[0074] In the present invention, the sgRNA may be complementary to at least a portion of the AAVS1 gene base sequence, but is not limited thereto.
[0075] In the present invention, the step (b) is a step of forming a forebrain organoid by culturing pluripotent stem cells. The term "pluripotent stem cell" used in the present invention may refer to a cell that has the ability to differentiate into all cells constituting the body, and may generally include induced pluripotent stem cells (iPSCs) and embryonic stem cells (ES cells) that have the common characteristic of differentiating into multiple potent cells. More specifically, embryonic stem cells are induced from the inner cell mass of a blastocyst in the pre-implantation stage. The induced cells are maintained in a specific environment, and are capable of unlimited culture and pluripotent differentiation. Furthermore, induced pluripotent stem cells may refer to pluripotent differentiated cells created by dedifferentiation from somatic cells, and are formed by making somatic cells into a state very similar to embryonic stem cells through a process called reprogramming, such as cell fusion, nuclear transfer, and overexpression of pluripotency regulatory factors. Furthermore, pluripotent stem cells are not limited to embryonic stem cells and induced pluripotent stem cells, and may include any cell possessing both differentiation pluripotency and self-renewal capacity. However, pluripotent stem cells are preferably mammalian cells, and more preferably human-derived induced pluripotent stem cells.
[0076] Specifically, the step (b) may be a step of inducing an embryoid body from a PSC, differentiating the embryoid body into a neuroectoderm lineage, and forming a forebrain organoid composed of multiple rosettes.
[0077] In the present invention, the step (c) is a step of treating a substance that activates the Hedgehog and Wnt signal pathways to induce an increase in rosette size through proliferation of neural progenitor cells, and the substance that activates the Hedgehog and Wnt signal pathways in the step (c) may be CHIR99021 and SAG.
[0078] At this time, the CHIR99021 may be at a concentration of 0.1 to 5 μM, and the SAG may be at a concentration of 100 to 1000 nM. Preferably, the CHIR99021 may be at a concentration of 0.1 to 3 μM, and the SAG may be at a concentration of 200 to 800 nM, more preferably, the CHIR99021 may be at a concentration of 0.1 to 2 μM, and the SAG may be at a concentration of 300 to 500 nM, and most preferably, the CHIR99021 may be at a concentration of 1 μM, and the SAG may be at a concentration of 400 nM.
[0079] In the present invention, the step (d) is a step of forming a single rosette forebrain organoid by separating a forebrain organoid composed of multiple rosettes into a single rosette structure in order to achieve the goal of producing a forebrain assembler with a single rosette structure. The separation may be performed manually. The manual operation may be performed using any tool that can separate into a single rosette while maintaining the rosette structure, but is preferably performed using fine forceps.
[0080] In the present invention, the step (e) is a step of encapsulating and culturing a separated single rosette forebrain organoid with reelin-expressing neurons to form a six-layered structure, wherein the encapsulation may refer to a process of coating the surface of the single rosette forebrain organoid with reelin-expressing neurons. In a specific embodiment of the present invention, the encapsulation is performed with matrigel containing reelin-expressing neurons, but is not limited thereto.
[0081] In the present invention, the manufacturing method may further include a step of manufacturing a reelin-expressing neuron before the step (e), and the reelin-expressing neuron may be manufactured by transducing reelin into neural progenitor cells.
[0082] The term "transduction" used in the present invention refers to a series of processes for delivering and expressing a gene after infecting a cell of interest.
[0083] In the present invention, the relin-expressing neurons are 1×10 3 1×10 5 It can be personal. Preferably 5×10 3 5×10 4 Dog, preferably 1×10 4 It could be a dog.
[0084] In the present invention, the step (f) is a step for securing cell diversity similar to that of an actual brain by injecting glial cells corresponding to non-neuronal cells into a single rosette forebrain organoid encapsulated with relin-expressing neurons, and the glial cells may be at least one selected from the group consisting of astrocytes and microglia.
[0085] The term "glial cell" as used in the present invention refers to a cell that supports and protects nerve cells within the central or peripheral nervous system, and contributes to maintaining metabolic and immunological balance. Glial cells may generally include astrocytes, oligodendrocytes, microglia, and Schwann cells present in the peripheral nervous system. Here, "astrocytes" refer to cells that support the metabolism of nerve cells, regulate ion homeostasis, absorb and release neurotransmitters, and maintain the blood-brain barrier (BBB). In addition, "microglia" refers to cells that are members of the innate immune system of the central nervous system and are involved in the removal of pathogens, phagocytosis of damaged cells, and regulation of inflammatory responses. In the present invention, glial cells may include not only natural cells, but also glial cells differentiated from human or animal-derived stem cells, genetically engineered glial cells, or glial-like cells manufactured using a tissue engineering method.
[0086] In the present invention, the astrocytes and microglia may be produced by differentiating from PSCs.
[0087] In the present invention, the stellate cells are 1×10 3 1×10 5 It is a dog, and the microglia are 1×10 2 1×10 4 It may be individual. Preferably, the astrocytes are 5×10 3 5×10 4 It is a dog, and the microglia are 5×10 2 5×10 3 Dog, most preferably, said stellate cells are 1×10 4 It is a dog, and the microglia are 1×10 3 It could be personal.
[0088] In the present invention, in the step (f), the glial cells may be injected into the outer cortical layer of a single rosette forebrain organoid.
[0089] In the present invention, the substance activating the Hedgehog and Wnt signal pathways in step (c) may be treated for 5 to 10 days. Preferably, it may be treated for 6 to 8 days, and most preferably, for 7 days.
[0090] In the present invention, in step (e), the culturing may be performed for 10 to 20 days. Preferably, it may be performed for 12 to 18 days, more preferably, for 14 to 16 days, and most preferably, for 15 days.
[0091] In the present invention, the manufacturing method may further include a step of further culturing and maturing the forebrain assembler for 10 to 40 days after step (f). Preferably, the culturing may be further performed for 20 to 40 days, and most preferably, for 30 days.
[0092] In addition, the second aspect of the present invention relates to a whole brain assembler manufactured by the above method.
[0093] Furthermore, a third aspect of the present invention relates to a forebrain assembler comprising a single rosette structure comprising six cortical layers and a cavity, wherein the cortical layers contain glial cells and uniformly express ChR2.
[0094] In the present invention, the forebrain assembler may be a human forebrain assembler.
[0095] In the present invention, the cortical layer may be a first layer expressing RELN, a second layer expressing CUX2, a third layer expressing BRN2, a fourth layer expressing SATB2, a fifth layer expressing CTIP2, and a sixth layer expressing TBR1.
[0096] In the present invention, the glial cells may be at least one selected from the group consisting of astrocytes and microglia.
[0097] In a specific embodiment of the present invention, it was confirmed that when a light stimulus is applied depending on ChR2 expression, a calcified spike, i.e., neural activation, appears (Fig. 4).
[0098] Therefore, in the present invention, the forebrain assembler may exhibit neural activity by light stimulation.
[0099] In the present invention, the light stimulus may have a wavelength of 400 to 550 nm. Preferably, it may have a wavelength of 450 to 550 nm, and most preferably, it may have a wavelength of 488 nm.
[0100] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention.
[0101] <Example 1>
[0102] 1. Experimental methods and materials
[0103] 1-1. hPSC culture
[0104] Human pluripotent stem cells (hPSCs) were maintained in a 37°C incubator under 5% CO2 conditions. The hPSCs were cultured on mitomycin C-treated mouse embryonic fibroblasts (MEFs), and the medium used (hPSC medium) contained the following components: DMEM / F12 (Gibco), 20% KnockOut Serum Replacement (Gibco), 1X Glutamax (Gibco), 1X Non-essential amino acids (Gibco), 1% penicillin-streptomycin, 100 μM 2-Mercaptoethanol (Sigma), and 10 ng / mL human basic FGF (PeproTech). The medium was changed daily, and the cells were passaged using manual dissection when they reached 70% confluency. IMR90, the hPSC used as a control, was obtained from the Coriell Institute for Medical Research.
[0105] 1-2. Cloning
[0106] To induce homologous-directed repair (HDR), a donor template containing the EF1α promoter and channelrhodopsin-2 (ChR2) was constructed. The EF1α promoter was amplified from pL-CRISPR-EFS-GFP (Addgene #57818), and ChR2 was amplified from pAAV-CAG-hChR2-mCherry-WPRE-SV40 (Addgene #100054), respectively, and then cloned into the pAAVS1-P-MCS (Addgene #80488) vector. The cloned vector was transformed into Stbl3 cells, cultured overnight at 30°C in LB medium (containing 100 μg / mL ampicillin), and harvested by centrifugation.
[0107] The base sequence of the ChR2 gene is as shown in Table 2 below.
[0108] 서열 이름염기 서열(5'→3')서열 번호ChR2atggactatggcggcgctttgtctgccgtcggacgcgaacttttgttcgttactaatcctgtggtggtgaacgggtccgtcctggtccctgaggatcaatgttactgtgccggatggattgaatctcgcggcacgaacggcgctcagaccgcgtcaaatgtcctgcagtggcttgcagcaggattcagcattttgctgctgatgttctatgcctaccaaacctggaaatctacatgcggctgggaggagatctatgtgtgcgccattgaaatggttaaggtgattctcgagttcttttttgagtttaagaatccctctatgctctaccttgccacaggacaccgggtgcagtggctgcgctatgcagagtggctgctcacttgtcctgtcatccttatccacctgagcaacctcaccggcctgagcaacgactacagcaggagaaccatgggactccttgtctcagacatcgggactatcgtgtggggggctaccagcgccatggcaaccggctatgttaaagtcatcttcttttgtcttggattgtgctatggcgcgaacacattttttcacgccgccaaagcatatatcgagggttatcatactgtgccaaagggtcggtgccgccaggtcgtgaccggcatggcatggctgtttttcgtgagctggggtatgttcccaattctcttcattttggggcccgaaggttttggcgtcctgagcgtctatggctccaccgtaggtcacacgattattgatctgatgagtaaaaattgttgggggttgttgggacactacctgcgcgtcctgatccacgagcacatattgattcacggagatatccgcaaaaccaccaaactgaacatcggcggaacggagatcgaggtcgagactctcgtcgaagacgaagccgaggccggagccgtg2
[0109] 1-3. Production of hPSCs with ChR2 gene insertion
[0110] First, hPSCs were cultured to 70% confluency on culture dishes coated with Matrigel (hES-qualified, Corning) and pretreated with Y-27632 (10 μM) 1 h before electroporation. Electroporation was performed using a NEPA21 electroporator (CUY650P5) under the following conditions:
[0111] Poring pulse: voltage 125 V, pulse length 2.5 ms, interval 50 ms, total 2 times, attenuation 10%, positive polarity
[0112] Transfer pulse: voltage 20 V, pulse length 50 ms, interval 50 ms, total 5 times, decay rate 40%, reverse polarity.
[0113] The electroporation mixture contained: hPSC 4 × 10 5 Dog, 1.8 μg of donor template DNA, 40 pmol of sgRNA from Table 3 below, 36 pmol of Cas9 protein (IDT).
[0114] Sequence Name Base Sequence (5'→3') Sequence Number sgRNAGGGGCCACTAGGGACAGGATTGG3
[0115] The above mixture was placed in a 1-mm-gap NEPA electroporation cuvette and electroporated. After electroporation, cells were recovered in mTeSR medium (StemCell Technologies) containing Y-27632, and the medium was replaced without Y-27632 after 48 h. Starting on the second day after electroporation, puromycin (0.5 μg / mL, Sigma) was added for 7–10 days, and the medium was replaced daily during this period. gRNA was extracted from the cloned cells using the DNeasy Blood & Tissue Kit (QIAGEN), and the genotype was confirmed using the primer sets in Table 4 below.
[0116] Sequence NameBase Sequence (5'→3')Sequence NumberP1TCGACTTCCCCTCTTCCGATG4P2CTCAGGTTCTGGGAGAGGGTAG5P3GAGCCTAGGGCCGGGATTCTC6
[0117] Sequence verification of the amplified product was performed through Sanger sequencing data analysis.
[0118] 1-4. Creating a Brain Assembled
[0119] Colonies cultured on MEFs treated with mitomycin C were reacted with collagenase IV for 1 hour at 37°C, and then attached cells were removed. The removed cells formed embryoid bodies (EBs) and were cultured for 7 days in DMEM / F12 medium supplemented with 20% KnockOut Serum Replacement, 1X Glutamax, 1X Non-essential amino acids, 1% penicillin-streptomycin, 100 μM 2-Mercaptoethanol, 10 ng / mL human basic FGF, 2 μM dorsomorphin (Sigma), and 2 μM A83-01 (Tocris).
[0120] After 7 days, the EBs were plated in Growth Factor Reduced Matrigel and cultured for an additional 7 days in DMEM / F12 medium supplemented with the following components: 1X Glutamax, 1X Non-essential amino acids, 1% penicillin-streptomycin, 1X N-2 supplement (Gibco), and 10 μM SB-431542 (Sigma).
[0121] On the 14th day of culture, the neuroepithelial structures embedded in Matrigel were gently dissociated by pipetting, and a rosette structure was clearly observed. The cells were then cultured in a shaking incubator using differentiation medium (DMEM / F12) supplemented with the following components: 1X Glutamax, 1X Non-essential amino acids, 1% penicillin-streptomycin, 100 μM 2-Mercaptoethanol, 1X N-2 supplement, 1X B-27 supplement (Gibco), and 2.5 μg / mL Insulin (Sigma). From day 25 to day 32, the Hedgehog (Hh) and Wnt signaling pathways were pharmacologically activated to promote the proliferation and expansion of NPCs.
[0122] On day 32 of culture, rosette structures were identified under a microscope and manually dissected using precision forceps. The isolated rosettes were cultured for an additional 3 days to ensure structural stability. From day 35, Matrigel was mixed with the differentiation medium and cultured.
[0123] On day 35, single rosette organoids were reconstituted with hPSC-derived neurons engineered to express RELN (hereinafter referred to as "RELN-expressing neurons"). Specifically, each single rosette organoid was encapsulated in a thin layer of Matrigel seeded with RELN-expressing neurons and cultured for an additional 15 days.
[0124] On the 50th day of culture, 1 × 10 hPSC-derived glial cells 4Assembled cells were microinjected into the outer cortical layer using a microinjector (Eppendorf). The assembled cells were then cultured in maturation medium (Neurobasal medium (Gibco)) supplemented with the following components: 1X B-27 supplement, 1% penicillin-streptomycin, 100 μM 2-Mercaptoethanol, 0.2 mM ascorbic acid (Sigma), 20 ng / mL BDNF (Peprotech), 20 ng / mL GDNF (Peprotech), and 0.5 mM cAMP (Sigma). All cultures from day 14 to day 80 were performed in a shaking incubator, and the medium was changed every other day.
[0125] 1-5. Western blot
[0126] hPSCs that had proliferated to 70% confluence were collected by RIPA lysis and extraction buffer (Thermo) containing 1X Halt Protease Inhibitor Cocktail (Thermo). Total cell lysates (30-40 μg / lane) were separated by SDS-PAGE (Bio-Rad) for 2 h and transferred to 0.2 μm nitrocellulose membranes for 2 h at room temperature. Transfer was confirmed by Ponceau S staining, and Western blot analysis was performed using anti-ChR2 antibody (1:500, PROGEN) and anti-beta actin antibody (1:5000, Santacruz) as primary antibodies. Secondary immunoreaction was performed using horseradish peroxidase-conjugated goat anti-mouse antibody (1:5000, Abcam). The labeled blot was incubated for 5 minutes using Amersham ECL Prime (Cytiva), and luminescence was observed until the target band appeared. Luminescence images were acquired using ImageQuant 800 (Cytiva).
[0127] 1-6. RT-qPCR
[0128] First, hPSC colonies were dissociated into single cells using Accutase (Sigma), and total RNA was extracted using the RNeasy Plus Mini Kit (QIAGEN). For RT-qPCR, cDNA was first synthesized using the High-Capacity cDNA Reverse Transcriptase Kit containing oligo dT (Applied Biosystems) from first-strand cDNA. Subsequently, qPCR was performed using SYBR Green Supermix (Applied Biosystems), and the reaction was performed on a StepOnePlus Real-Time PCR System (Applied Biosystems). Gene expression levels were normalized to the housekeeping gene GAPDH.
[0129] 1-7. Immunofluorescence analysis
[0130] First, the samples were fixed in 4% paraformaldehyde (PFA) solution for 15 minutes, washed with PBS, and immersed in 30% sucrose solution overnight at 4°C. The samples were then embedded in OCT compound (Leica) and frozen at -20°C. The frozen OCT blocks were sectioned at 20 μm thickness using a cryostat (Leica). The sectioned tissues were again fixed in 4% PFA for 20 minutes, washed three times with PBS, and blocked in PBS buffer containing 2% goat serum and 0.25% Triton X-100 for 1 hour at room temperature. The primary antibody was then diluted in blocking buffer and reacted overnight at 4°C. The primary antibodies used were as follows: TUJ1 (1:300, BioLegend), ChR2 (1:100, PROGEN), SOX2 (1:300, Abcam), MAP2 (1:300, Abcam), OCT4 (1:100, Santacruz), PSD95 (1:200, Cell Signaling), and GFAP (1:300, Dako). After primary antibody reaction, the samples were washed three times with 0.25% PBS-T, and the secondary antibodies (Life Technologies, 1:1000 dilution) diluted in PBS-T were reacted for 1 hour at room temperature. After washing with 0.25% PBS-T, the slides were mounted using Prolong Gold mounting reagent (Invitrogen).
[0131] For immunocytochemistry, cells were cultured in 12-well plates on Matrigel (hESC-qualified, Corning)-coated coverslips. When the cell density reached 80%, the cells were washed with PBS and fixed with 4% PFA for 5 minutes at room temperature. After fixation, the cells were washed three times with PBS and blocked for 40 minutes. The cells were then incubated with diluted primary antibodies for 1–2 hours at room temperature and washed three times with PBS-T. The secondary antibodies were diluted 1:1000 in blocking buffer, incubated for 40 minutes at room temperature, and then washed twice with PBS-T. The cells were mounted on glass slides using Prolong Gold mounting reagent.
[0132] 1-8. Calcium imaging
[0133] Forebrain assembles and forebrain-spinal cord-skeletal muscle hybrid assembles were incubated with 5 μM Cal-590 AM (AAT Bioquest) at 37°C for 30 min. They were then washed once with fresh medium for 10 min. The washed assembles were transferred to a 35 mm confocal dish (SPL) and subjected to optogenetic stimulation (488 nm) using the ND stimulation software module of a Nikon AX confocal microscope. A specific region of interest (ROI) was designated for stimulation of the forebrain assembles, and only that area was selectively stimulated. Calcium activity was measured using a 594 nm filter, and spontaneous calcium activity was continuously captured for 100 frames at a rate of 15 frames / s before and after stimulation, respectively. The acquired calcium spike data were analyzed using Time Series Analyzer V3 of ImageJ software.
[0134] 1-9. Statistical Analysis
[0135] All data according to the present invention are expressed as mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism version 9 software. Intergroup comparisons were analyzed using unpaired t-tests or nested t-tests, as indicated in the figure legends. A significant difference was considered a p value less than 0.05.
[0136] <Example 2>
[0137] 2. Experimental Results
[0138] 2-1. Generation of hPSCs with the ChR2 gene inserted into the AAVS1 locus
[0139] Existing viral systems have limitations, such as the random insertion of foreign genes, which results in non-uniform and inconsistent gene expression across experiments, prone to silencing, and potential for alterations in endogenous gene expression. To address these issues, the present invention established an hPSC cell line that induces uniform and sustained ChR2 expression by stably knocking in the ChR2 gene into the AAVS1 safe harbor locus (Fig. 1a). To this end, a donor plasmid designed to enable ChR2 gene expression under the EF1α promoter was constructed. The EF1α promoter was designed to induce robust gene expression not only in stem cells but also in differentiated cells (Fig. 1b). The constructed donor plasmid was electroporated into hPSCs together with an RNP complex consisting of sgRNA and Cas9 protein targeting the AAVS1 locus (Fig. 1a and 1b). After electroporation, cells were selected with puromycin for 2 weeks, and a total of 13 hPSC colonies survived. To confirm the genotype of these colonies using PCR, primers were designed to amplify the 1.4-kbp normal allele and the 1.2-kbp target insertion allele, and the presence of the target insertion was analyzed (Fig. 1c). As a result, four clones were homozygous, meaning that the ChR2 gene was inserted into both alleles, and nine clones were heterozygous, with one allele harboring the ChR2 insertion and the other being the normal allele (Fig. 1d).
[0140] To confirm that the inserted EF1α-ChR2 cassette was inserted accurately without mutation, the genetic region near the recombination site on the target allele was amplified and sequenced (Fig. 1e). The analysis results confirmed that only clone 5 had several base mismatches in the front of the EF1α-ChR2 cassette, which induced a frameshift of ChR2. In addition, to rule out the possibility of mutations due to non-homologous end joining (NHEJ) in the non-inserted allele of the heterozygous clone, the recombination site between the left and right homology arms of the AAVS1 locus was amplified and sequenced. As a result, deletions near the PAM site were observed in clones 5, 10, and 11, but no mutations were identified in the other clones (Fig. 1f). In summary, the present inventors successfully obtained six heterozygous clones and four homozygous clones in which the EF1α-ChR2 cassette was precisely inserted into the AAVS1 locus without mutation.
[0141] 2-2. Confirmation of uniform and stable expression of ChR2 protein in hPSCs into which the ChR2 gene has been introduced.
[0142] To confirm ChR2 expression at the gene level, RT-qPCR analysis was performed on six heterozygous clones (ChR2-1, 2, 6, 9, 12, 13) and four homozygous clones (ChR2-3, 4, 7, 8) among ChR2-transduced hPSC clones. As a result, the expression level of the ChR2 gene was increased in all ChR2-transduced clones compared to the non-targeted control (Fig. 2a), and in particular, the homozygous clone showed a gene expression level approximately twice as high as the heterozygous clone. To confirm ChR2 expression at the protein level, Western blot analysis using a ChR2 antibody was performed. As a result, functional ChR2 protein was strongly expressed in both heterozygous and homozygous clones, which was identified as a specific band corresponding to the full-length monomer around 34 kDa (Fig. 2b).
[0143] Subsequently, the intracellular expression pattern and localization of the ChR2 protein were investigated using immunocytochemistry. As a result, unlike the non-targeting control, the ChR2 protein was expressed homogeneously in the ChR2-transduced hPSCs, and the average expression intensity of the homozygous clone ChR2-3 was approximately twice that of the heterozygous clone ChR2-2 (Fig. 2 c and d). In addition, the ChR2 protein was expressed and localized to the cell membrane (Fig. 2 c). To confirm whether ChR2 expression was stably maintained over a long period of time, the ChR2 expression levels were analyzed for clones ChR2-2 and ChR2-3 over several passages (passages 5, 10, and 15). The analysis results confirmed that ChR2 expression was stably and consistently maintained throughout all passages in both clones (Fig. 2 e). In addition, both clones maintained pluripotency by expressing pluripotency markers such as OCT4 and SOX2 (Fig. 2 f and g). From the above results, the present invention has established a system for efficiently producing hPSC cell lines that maintain pluripotency even during long-term culture and uniformly express ChR2 protein, which can be utilized for differentiation into various cells or tissues in the future.
[0144] 2-3. Production of a forebrain assembler with the ChR2 gene introduced
[0145] Forebrain assembloids were generated from a homozygous ChR2-transduced hPSC cell line (ChR2-3) (Fig. 3a). From day 25 to day 32, organoids were cultured in differentiation medium supplemented with 1 μM CHIR99021 and 400 nM SAG (Millipore). On day 32, forebrain organoids containing distinct rosette structures were dissected and isolated into individual rosettes to mimic the architecture of a single ventricular zone (VZ) of the developing brain. Isolated rosettes stably formed into cyst-like organoids in which the neuronal marker TUJ1 was localized in the outer layer (Fig. 3b). The generated single-rosette organoids contained 1 × 10 RELN-expressing neurons. 4 Encapsulated with 1 to 2 μl of Matrigel containing cells / μl concentration, and cultured in 2 ml of differentiation medium for up to 50 days.
[0146] On the 50th day of culture, hPSC-derived astrocytes (1 × 10 4 cells) and microglia (2 × 10 3(Cells) were microinjected into the outer cortical region of the organoids to promote glial integration. This process is essential for supporting both structural organization and functional development. The assembleoids were then cultured for an additional 30 days under conditions that induce maturation, which includes neuronal connectivity, glial cell development, and the formation of functional neural networks. Immunofluorescence analysis confirmed that the produced forebrain assembleoids contained mature synaptic structures positive for the mature neuronal marker MAP2 and the postsynaptic marker PSD95 (Fig. 3c), and GFAP-positive astrocytes exhibited a star-like morphology (Fig. 3d). Thus, the produced assembleoids more precisely reproduced the complexity and cellular diversity of the human developing brain cortex.
[0147] Additionally, immunofluorescence analysis was performed to confirm the expression of ChR2 protein within the fabricated ChR2-introduced forebrain assembler. As a result, it was confirmed that ChR2 protein was expressed homogeneously throughout the cell membrane (Fig. 3e).
[0148] In conclusion, the ChR2 gene-inserted hPSC-derived forebrain assembler fabricated in the present invention successfully reproduced the complexity and cellular diversity of human brain tissue in vivo through a tissue structure including a single VZ-like structure, an outer neural cell layer, and glial cells. In addition, the ChR2 protein was stably and uniformly expressed throughout the assembler, demonstrating that it is a system capable of optogenetic manipulation without structural or functional abnormalities.
[0149] 2-4. Optogenetic control of forebrain assembler with ChR2 gene
[0150] To evaluate and verify the functional integration of ChR2 within the forebrain assembler into which ChR2 was introduced, a series of optogenetic experiments were performed to measure neuronal responses to light stimulation (Fig. 4a). Specifically, target stimulation was performed by irradiating the forebrain assembler expressing ChR2 with blue light at a wavelength of 488 nm for 68 milliseconds, and the resulting neural responses were observed using live calcium imaging technology. The calcium sensor used here was Cal-590 AM (red-shifted fluorescent calcium indicator), which is a fluorescent indicator designed to stably record neuronal activity without crosstalk with the light stimulation wavelength (Fig. 4b).
[0151] After light stimulation, calcium transients were observed in assembleoids transfected with the ChR2 gene, indicating strong neuronal activation following light stimulation (Fig. 4c). In control assembleoids, no calcium response was elicited under the same stimulation conditions, indicating that the response was dependent on the presence of ChR2 (Fig. 4c and d). The observed calcium spikes were interpreted as being induced by optogenetic stimulation, suggesting successful expression of functional ChR2 within the assembleoids.
[0152] Furthermore, to confirm that these neural activities were specifically induced by light stimulation rather than spontaneous activity, the amplitude change (ΔF / F) of the stimulus-induced signal was compared with the change at random time points in the same cell. As a result, the median calcium signal amplitude after light stimulation was significantly higher than that at random time points, which was not observed in the control assembler (Fig. 4d). This analysis clearly demonstrates that the neural response was selectively induced by the stimulus and not a product of spontaneous activity.
[0153] In summary, the forebrain assembler into which the ChR2 gene of the present invention has been introduced can induce strong neural activity in response to light stimulation, demonstrating its effectiveness as an optogenetics-based control model system capable of spatiotemporally understanding the neural circuits and dynamics of the human brain.
[0154] The present invention is an invention carried out through the following tasks.
[0155] [National Research and Development Project Supporting This Invention]
[0156] [Project ID] 1711196338
[0157] [Assignment Number] 00223277 (RS-2023-00223277)
[0158] [Ministry Name] Ministry of Science and ICT
[0159] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea
[0160] [Research Project Name] Biomedical Technology Development
[0161] [Research Project Name] Discovery of a New Stem Cell Population and Development of a Novel Disease Model through the Construction of ATLAS, a Stem Cell System for the Whole Urinary Tract
[0162] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation
[0163] Research Period: April 1, 2023 - December 31, 2027
[0164] [National Research and Development Project Supporting This Invention]
[0165] [Project ID] 1711187403
[0166] [Assignment Number] 2022R1A2C3002702
[0167] [Ministry Name] Ministry of Science and ICT
[0168] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea
[0169] [Research Project Name] Individual Basic Research (Ministry of Science and ICT)
[0170] [Research Project Name] Research on Cell Differentiation Anticancer Treatment for Anticancer Drug-Resistant Tumors Based on Tumor Assembroid Technology
[0171] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation
[0172] Research Period: March 1, 2022 - February 28, 2025
Claims
1. A method for manufacturing a whole brain assembler capable of optogenetic analysis comprising the following steps: (a) A step of introducing a ChR2 gene into pluripotent stem cells (PSCs) to produce pluripotent stem cells into which ChR2 has been introduced; (b) a step of forming a forebrain organoid by culturing the pluripotent stem cells into which the ChR2 has been introduced; (c) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid; (d) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid; (e) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin (RELN) expressing neurons; and (f) A step of producing a forebrain assembler by injecting glial cells into the single rosette forebrain organoid.
2. A method for manufacturing a whole brain assembler, characterized in that the whole brain assembler in the first paragraph is a human whole brain assembler.
3. A method for producing a forebrain assembler, characterized in that in step (a), the ChR2 gene is introduced into the AAVS1 gene locus of pluripotent stem cells.
4. A method for producing a whole brain assembler, characterized in that in step (a), the ChR2 gene is introduced homozygously or heterozygously.
5. A method for producing a whole brain assembler, characterized in that in the third paragraph, the introduction in the step (a) is performed using an sgRNA containing the base sequence of sequence number 3.
6. A method for producing a forebrain assembler, characterized in that in the third paragraph, the AAVS1 gene locus includes the base sequence of sequence number 1, and the ChR2 gene is introduced after the 17th base of sequence number 1.
7. A method for producing a whole brain assembler, characterized in that in the first paragraph, the substances that activate the Hedgehog and Wnt signal pathways in step (c) are CHIR99021 and SAG.
8. A method for producing a whole brain assembler, characterized in that in paragraph 7, the CHIR99021 is at a concentration of 0.1 to 5 μM, and the SAG is at a concentration of 100 to 1000 nM.
9. In the first paragraph, in the step (e), the relin-expressing neuron is 1Х10 3 1Х10 5 A method for manufacturing a brain assembler characterized by individual features.
10. A method for manufacturing a whole brain assembler, characterized in that in step (f), the glial cells are at least one selected from the group consisting of astrocytes and microglia.
11. In the 10th paragraph, the stellate cells are 1Х10 3 1Х10 5 It is a dog, and the microglia are 1Х10 2 1Х10 4 A method for manufacturing a brain assembler characterized by individual features.
12. A method for manufacturing a whole brain assembler, characterized in that in the first paragraph, the substance that activates the Hedgehog and Wnt signal pathways in the step (c) is treated for 5 to 10 days.
13. A method for producing a whole brain assembler, characterized in that in the first paragraph, the culturing in the step (e) is performed for 10 to 20 days.
14. A brain assembler manufactured by any one of the methods of clauses 1 to 13. A forebrain assembler comprising a single rosette structure comprising 15.6 cortical layers and a cavity, characterized in that the cortical layer contains glial cells and uniformly expresses ChR2.
16. In the 15th paragraph, the whole brain assembler is characterized in that the whole brain assembler is a human whole brain assembler.
17. A forebrain assembler according to claim 15, characterized in that the cortical layers are a first layer expressing RELN, a second layer expressing CUX2, a third layer expressing BRN2, a fourth layer expressing SATB2, a fifth layer expressing CTIP2, and a sixth layer expressing TBR1.
18. A forebrain assembler according to claim 15, characterized in that the glial cells are at least one selected from the group consisting of astrocytes and microglia.
19. In the 15th paragraph, the forebrain assembler is characterized in that it exhibits neural activity by light stimulation.
20. A whole brain assembler according to claim 19, characterized in that the light stimulus has a wavelength of 400 to 550 nm.
Citation Information
Patent Citations
Stem cell derived single-rosette brain organoids and related uses thereof
WO2021216846A2