Optogenetics tool for light-operated induced protein degradation as well as construction method and application of optogenetics tool

Abstract

The invention relates to the field of optogenetics, in particular to an optogenetics tool for light-operated induced protein degradation and a construction method and application of the optogenetics tool. The invention relates to an optogenetics tool for light-operated induced protein degradation, which is characterized by comprising a fusion system of a truncated body mTRIM211-80 of mTRIM21 and CRY2, the base sequence of the mTRIM211-80 is shown as SEQ ID NO. 1, and the base sequence of the mTRIM211-80 is shown as SEQ ID NO. The base sequence of the CRY2 is as shown in SEQ ID NO. 2. The optogenetics tool is used for inducing the TRIM21 to form a polymer by utilizing the blue light photosensitive protein CRY2 and is used for the targeted regulation and control of the protein degradation under the driving of the blue light. Targeted degradation of protein can be achieved by utilizing Intrabody (intracellular antibody), time and space targeting is achieved, and after an optogenetics toolbox is optimized, the sensitivity and the reaction rate of the optogenetics toolbox are further improved.

Description

Technical Field

[0001] This invention relates to the field of optogenetics, specifically to an optogenetic tool for light-controlled induced protein degradation, its construction method, and its application. In particular, it relates to an optogenetic tool that utilizes the blue light-sensitive protein CRY2 to induce TRIM21 to form multimers and utilizes the intracellular antibody Intrabody to achieve blue light-driven targeted regulation of protein degradation. Background Technology

[0002] Protein homeostasis is essential for the normal functioning of cellular proteins. The accumulation of abnormal proteins, such as damaged, misfolded, or aggregated proteins, is associated with many diseases, including cancer. Therefore, rapid, controlled, and targeted degradation of misfolded proteins to maintain protein homeostasis is crucial for cellular function and overall health.

[0003] Currently, genetic methods for regulating protein homeostasis at the DNA and RNA levels, such as 1) the CRISPR system, which knocks out target proteins by interfering with corresponding genes at the genomic DNA level, and 2) techniques using siRNA or shRNA to silence mRNA, have been proven to effectively regulate protein expression levels. However, these methods lack spatiotemporal specificity, permanently knocking out or reducing protein expression at the gene level, and are not suitable for degrading already synthesized proteins. Furthermore, proteolytic targeting chimeras (PROTACs) and molecular glues target and degrade proteins through the ubiquitin-proteasome system (UPS). Despite their potential, these methods also face challenges in the design and development of new drugs, including a lack of spatiotemporal specificity and difficulties in screening design.

[0004] The ubiquitin-proteasome pathway is an important system for regulating protein levels in the body. TRIM21 (Tripartitemotif containing 21), as a member of the E3 ubiquitin ligase RING family, contains several key domains: the RING domain, which promotes ubiquitin ligase activity and mediates substrate protein ubiquitination; the B-box domain, which participates in dimerization and polymerization with other TRIM family members or itself; the coiled-coil domain, which enables TRIM21 to form homodimers or polymers; and the PRYSPRY domain, which provides antibody binding capability. Figure 1 A).

[0005] The development of optogenetics has made it possible to regulate the targeted degradation of proteins in vivo. CRY2 is a light-sensitive protein with a maximum absorption peak under blue light at a wavelength of ~470nm. TRIM21 functions as an E3 ubiquitin ligase in the ubiquitin-proteasome pathway. Summary of the Invention

[0006] To address the shortcomings of current technologies for rapidly degrading proteins to maintain protein homeostasis, such as poor protein targeting, unsatisfactory sensitivity, and unreliable reaction rates, we have developed a degradation system that combines the ubiquitin-proteasome system with optogenetics to achieve rapid, reversible, and spatiotemporally precise degradation of misfolded proteins. This system allows for photo-regulated targeted protein degradation with temporal and spatial precision.

[0007] This application constructed TRIM21 truncated variants of varying lengths, retaining the complete N-terminal RING domain and a small number of α-helices, and used the optogenetic protein CRY2 to simulate TRIM21 polymerization. To improve the efficiency of photoinduced protein degradation, the effects of different CRY2 photosensitivity mutants on this system were investigated. After screening, mCherry-CRY2 was selected as the most suitable mutant. PHR Clust-mTRIM21(1-80) is defined as a Flash-Away system for photo-controlled protein degradation. It utilizes intrabody antibodies (including Monobody antibodies, Nanobody antibodies, and Binder peptides (pDI, LCB3)) to specifically target corresponding proteins, thereby achieving a photo-regulated degradation system that specifically targets the target protein.

[0008] The technical solution of the present invention is as follows: In one aspect, this application provides an optogenetic tool for light-controlled induced protein degradation, including a truncated form of mTRIM21. 1-80 The fusion system of CRY2; mTRIM21 1-80 The base sequence is shown in SEQ ID NO. 1; The base sequence of CRY2 is shown in SEQ ID NO. 2.

[0009] As a specific embodiment of this application, the CRY2 includes CRY2 mutant E490G, CRY2 mutant E490R, and CRY2 mutant CRY2-Clust; The base sequence of the CRY2 mutant E490G is shown in SEQ ID NO. 3; The base sequence of the CRY2 mutant E490R is shown in SEQ ID NO. 4; The base sequence of the CRY2 mutant CRY2-Clust is shown in SEQ ID NO. 5.

[0010] In a specific embodiment of this application, the CRY2 is the CRY2 mutant CRY2-Clust.

[0011] As a specific embodiment of this application, the proteins degraded by the optogenetic tool include at least one of MLKL, Actin, a fusion protein with an ALFA tag, MDM2, and Spike protein.

[0012] Secondly, this application provides a method for constructing the aforementioned optogenetic tools, comprising the following steps: (1) mTRIM21 1-80 Construct a fusion system with the light-sensitive protein CRY2; (2) Construct a targeted protein degradation system using intrabody antibodies.

[0013] As a specific implementation of this application, step (1) includes the following process: A1 uses homologous recombination to convert CRY2 PHR Insert mCherry2-C1 to construct the vector mCherry-CRY2 PHR ; amplification of mTRIM21 using pGEMHE-mCherry-mTRIM21 as a template 1-80 Furthermore, an NheI restriction site was introduced, and mTRIM21 was digested via a single NheI restriction site. 1-80 Insert mCherry-CRY2 PHR mTRIM21 was generated in the vector. 1-80 -mCherry-CRY2 PHR ; A2 uses pGEMHE-mCherry-mTRIM21 as a template to amplify mTRIM21. 1-80 Furthermore, BspEI and BglII restriction sites were introduced, and BspEI and BamHI (BglII and BamHI are isoskeletal enzymes) were used to cleave mCherry-CRY2. PHR The vector was digested with enzymes, and mTRIM21 was added. 1-80 Insert into mCherry-CRY2 PHR In the process, mCherryCRY2 is generated. PHR - mTRIM21 1-80 .

[0014] As a specific implementation of this application, step (2) includes the following process: The corresponding intracellular antibody, Intrabody, is synthesized using gBlock to specifically recognize the protein to be degraded. The fragment is then inserted into the fusion system of step (1) or mCh-CRY2 using the NheI restriction site. PHR A targeted degradation system was established within the carrier.

[0015] Thirdly, this application provides the application of the above-mentioned optogenetic tools or optogenetic tools constructed by the above-mentioned methods in specifically targeting protein degradation.

[0016] As a specific embodiment of this application, an intracellular antibody (Intrabody) is used to target and degrade the corresponding protein. The intracellular antibody includes one or more of the following: Monobody antibody, Nanobody antibody, and Binder peptide.

[0017] As a specific implementation of this application, Western blotting is used to detect the degradation of the corresponding proteins by confocal time-lapse imaging.

[0018] Beneficial effects of the present invention (1) The designed optogenetic toolkit integrates the photoresponsive ubiquitination activity of the mTRIM21 ring domain for protein degradation, along with specific in vivo targeting. Upon exposure to blue light, the optogenetic toolkit can rapidly and selectively degrade selected proteins with spatiotemporal precision.

[0019] (2) The optogenetic toolkit obtained by the present invention can be used for targeted degradation of proteins in vivo, with temporal and spatial targeting, and after optimization of the optogenetic toolkit, its sensitivity and reaction rate are further increased.

[0020] (3) After screening, mCherry-CRY2 PHR Clust-mTRIM21(1-80) is defined as a Flash-Away system for photo-controlled targeted protein degradation. It utilizes intrabody antibodies (including Monobody antibodies, Nanobody antibodies, and Binder peptides (pDI, LCB3)) to specifically target corresponding proteins, thereby achieving a photo-regulated degradation system for specific target proteins. Attached Figure Description

[0021] Figure 1 For the construction of a light-controlled protein degradation system, the structural features of (A) mTRIM21 (top row); the mTRIM21 fragment and mCherry-CRY2 PHR Schematic diagram of the fusion construct (bottom row); (BC) Time-delayed confocal imaging of HeLa cells representing the construct after blue light irradiation; using a 488nm confocal laser (5% output power) for 2 hours with a stimulation interval of 30 seconds; scale bar, 10μm; (D) Data are presented as normalized fluorescence intensity, as mean ± sem; abbreviations: mCh, mCherry; BL, blue light; Figure 2 Optimization of the Flash-Away system; (A) C-terminal amino acid sequences of CRY2-WT, CRY2-Oligo, CRY2-Plus, and CRY2-Clust; (B) Time-lapse confocal imaging of HeLa cells overexpressing the corresponding plasmids under blue light stimulation for 1 hour (using a 488nm confocal laser (5% output power), stimulation interval of 30 seconds); scale bar, 10μm; (C) Data plotted as normalized fluorescence intensity, shown as mean ± sem; (D) Immunoblot analysis of HeLa cells expressing Flash-Away, treated with or untreated with MG132, after 1 hour of blue light irradiation; (E) Statistical analysis of protein levels on the immunoblot; ****P < 0.0001; ns P > 0.05; abbreviations: mCh, mCherry; BL, blue light; Figure 3 To construct a light-controlled protein-targeting degradation system using a monobody; (A) Mb33 binds to human MLKL (PDB ID: 6UX8) via an epitope centered on the α4 helix of the 4HB domain; (B) Confocal images of HeLa cells co-expressing Mb33-Flash-Away and MLKL-Venus before and after blue light irradiation (blue light irradiation conditions: 470nm, using a 488nm confocal laser, output power 5%, irradiation for 1 hour, irradiation interval 30 seconds); scale bar: 10 µm; Figure 4To construct a light-controlled protein-targeting degradation system using nanobodies; (A) Schematic diagram of actin destruction by Flash-Away based on nanobodies; (B) Confocal images of HeLa cells expressing Nb-Actin-Flash-Away and YFP-LifeAct before and after blue light irradiation (irradiated with a 488nm confocal laser at 470nm, output power 5%, for 1 hour, with 30-second intervals); scale bar, 10 µm; (C) Phalloidin staining results of HeLa cells expressing NbActin-Flash-Away or the corresponding control group (Nb-Actin-mCh-CRY2) before and after blue light irradiation (left side confocal results, blue light irradiation conditions: 470nm, using a 488nm confocal laser, output power 5%, irradiation for 1 hour, with 30-second intervals); scale bar: 10 µm; right side shows statistical results; (D) HeLa cells expressing NbActin-Flash-Away... -Away or corresponding control group (Nb-Actin-mCh-CRY2), followed by transwell assay after blue light irradiation; (E) Schematic diagram of Nb-ALFA binding to ALFA tag (PDB ID of Nb-ALFA: 6I2G); (F) Mid-layer confocal images of HeLa cells co-expressing Nb-ALFA-Flash-Away and ALFA-YFP before and after blue light irradiation (blue light irradiation conditions: 488nm confocal laser, output power 5%, irradiation for 1 hour, 30-second interval); Scale bar: 10µm; Figure 5 To construct a light-controlled protein-targeting degradation system using Binder peptides; (A) Three-dimensional structure of pDI peptide bound to MDM2 (PDB ID: 3JZO); (B) Confocal images of HeLa cells co-expressing GFP-Flash-Away-pDI and MDM2(1-118)-mCh before and after blue light irradiation; (C) Schematic diagram of the SARS-CoV-2 spike protein (top row); Three-dimensional structure of receptor-binding domain (RBD) bound to human ACE2, where the RBD core is slate gray, the binding interface is purple, and ACE2 is gray (PDB ID: 7U0N, bottom row, left image); Cryo-electron microscopy structure of LCB3 (wheat-colored) bound to RBD (slate gray) (bottom row, right image); (D) Confocal images of HeLa cells co-expressing LCB3-Flash-Away and YFP-RBD before and after blue light irradiation. (Blue light irradiation conditions: 470nm, using 488nm confocal laser, output power 5%, irradiation for 1 hour, interval 30 seconds); Scale bar: 10µm. Detailed Implementation

[0022] Example 1 Blue light induces the formation of a truncated protein complex between the light-sensitive protein CRY2 and mTRIM21. Figure 1 A).

[0023] Based on the domain characteristics of mTRIM21, a series of truncated bodies of different lengths (mTRIM21-WT, mTRIM21-WT, mTRIM21-WT, mTRIM21-WT) were constructed. 1-80 mTRIM21 1-57 mTRIM21 1-62 ), of which mTRIM21 1-57 Compared to mTRIM21 1-80 72 bases are missing (AACCTCAGGCCCAATAGACATATAGCCA ACATGGTGGAAAACCTTAAACAGATAGCCCAGAATACCAAGTAG), mTRIM21 1-62 Compared to mTRIM21 1-80 A fusion system was constructed with the photosensitive protein CRY2 with 57 fewer bases (AGACATATAGCCAACATGGTGGAAAACCTTAAACAGATAGCCCAGA ATACCAAGTAG), and the photoinduced loop domain of mTRIM21 aggregated, initiating its E3 ligase activity.

[0024] The construction process of the fusion system: Figure 1 A) pGEMHE-mCherry-mTRIM21 (#105522, mouse TRIM21) and mCherry2-C1 (#54563) were obtained from Addgene. Homologous recombination was used to synthesize CRY2... PHR Insert mCherry2-C1 to construct mCherry-CRY2 PHR The mTRIM21 fragment (WT, 1-80, 1-62, 1-57) was amplified using pGEMHE-mCherry-mTRIM21 as a template, and an NheI restriction site was introduced. The mTRIM21 fragment was then inserted into mCherry-CRY2 via a single NheI restriction site. PHR In the vector, (mTRIM21-WT, 1-80, 1-62, 1-57)-mCherry-CRY2 was generated. PHR .

[0025] The mTRIM21 fragment (WT, 1-80, 1-62, 1-57) was amplified using pGEMHE-mCherry-mTRIM21 as a template, and BspEI and BglII restriction sites were introduced. mCherry-CRY2 was then cleaved using BspEI and BamHI (BglII and BamHI are isoskeletal enzymes).PHR The vector was digested with enzymes (Note: BglII and BamHI are isoskeletal enzymes), and the mTRIM21 fragment was inserted into mCherry-CRY2. PHR In the process, mCherryCRY2 is generated. PHR - (mTRIM21-WT, 1-80, 1-62, 1-57).

[0026] After screening, mCherry-CRY2 was selected. PHR Clust-mTRIM21(1-80) is defined as a Flash-Away system for light-controlled targeted protein degradation.

[0027] The optogenetic protein CRY2 was used as a light-controlled switch to simulate the multiplication of TRIM21. Initially, the truncated form was placed in the light-sensitive protein CRY2. PHR At the N-terminus, after 2 hours of blue light irradiation, the fluorescence signal did not decrease significantly. Figure 1 B, D), speculated to be due to space hindrance of mCherry-CRY2 ( Figure 1 B). The truncated section was then moved to end C, and mTRIM21 was found at end C. 1-80 After 2 hours of illumination, the red fluorescence in the experimental group significantly decreased, while other truncated isolates did not exhibit this phenomenon. This suggests that mTRIM21 is the culprit. 1-80 The fragment is placed in CRY2 PHR Effective for C-end ( Figure 1 (C, D). This finding indicates that the mTRIM21 RING domain induced to separate is mTRIM21 1-80 Fragment polymerization can activate E3 ligase activity; mTRIM21 was used in subsequent experiments. 1-80 Excerpt.

[0028] Example 2 Degradation process (1) HeLa cells were cultured in DMEM supplemented with 10% fetal bovine serum at 37°C in a 5% CO2 incubator.

[0029] (2) When the cell density reaches 70-80%, transfect the cells using Lipofectamine 3000 (Invitrogen) according to the instructions. The steps are as follows: Diluting Lipofectamine™ 3000 reagent: Prepare a sterile centrifuge tube, add an appropriate amount of Opti-MEM™ culture medium (serum-free), and then add the corresponding amount of Lipofectamine™ 3000 reagent. Mix thoroughly by pipetting several times, and then let stand at room temperature for 5 minutes before use.

[0030] Preparation of DNA master mix: Take another sterile centrifuge tube, add an appropriate amount of Opti-MEM™ medium, add the DNA to be transfected in the recommended ratio, and gently mix to dilute. Add P3000™ reagent to the diluted DNA solution according to the recommended ratio of DNA to P3000™ reagent (usually 1 μg DNA corresponds to 1-2 μL P3000™ reagent). Slowly pipette the mixture 5-10 times to ensure thorough mixing, then let it stand at room temperature for 5 minutes to complete the preparation of the DNA master mix.

[0031] Mixing DNA with Lipofectamine™ 3000 reagent: Add the diluted DNA solution prepared in step 2 to the diluted Lipofectamine™ 3000 reagent tubes from step 1 at a 1:1 volume ratio. Gently vortex the centrifuge tubes to ensure thorough mixing.

[0032] Incubation: Incubate the mixed DNA-lipid complex solution at room temperature for 15-20 minutes to allow the liposomes to fully bind with the DNA and form a stable complex.

[0033] Adding cells: Slowly add the incubated DNA-lipid complex to the cell culture dish using a pipette, ensuring even distribution of the complex. Continue culturing under standard cell culture conditions. Observe the transfection effect or perform relevant tests as needed for the experiment.

[0034] (3) Incubate the cells in a 5% CO2 incubator at 37°C for 24 hours. Note that the HeLa cells should be replaced with a different medium 8 hours after plasmid transfection.

[0035] (4) Observe the protein degradation under blue light irradiation.

[0036] Confocal time-lapse imaging: Using a 488nm confocal laser at 5% output power, irradiating once every 30 seconds for 1 hour, the degradation of the corresponding proteins was observed.

[0037] Western Blot: Using a 470nm LED lamp (4mW cm⁻¹) -2 (Irradiation was performed every 30 seconds for 1 hour) and the degradation of the corresponding proteins was detected using Western blotting.

[0038] Example 3 To improve the efficiency of light-induced protein degradation, the effect of CRY2 photosensitivity mutant on the system was investigated.

[0039] CRY2 mutants E490G and E490R (referred to as CRY2 Oligo and CRY2 Plus, respectively) and CRY2-Clust (containing an additional 9 amino acids ARDPPDLDN at the C-terminus) were constructed, and the corresponding variants were selected to replace wild-type CRY2 as the activation switch. Figure 2 A).

[0040] The base sequence of the CRY2 mutant E490G is shown in SEQ ID NO. 3; The base sequence of the CRY2 mutant E490R is shown in SEQ ID NO. 4; The base sequence of the CRY2 mutant CRY2-Clust is shown in SEQ ID NO. 5.

[0041] Wild-type CRY2 was replaced with CRY2 mutants E490G (CRY2 Oligo), E490R (CRY2 Plus), and CRY2-Clust (containing 9 additional amino acids at the C-terminus). Figure 2 A), construct the fusion protein and transfect it into HeLa cells. After blue light activation, all CRY2 variants completed dimerization and aggregation within 2 minutes, but the fluorescence reduction rate differed. Under blue light irradiation, the CRY2-Clust system could rapidly reduce the red fluorescence level, with a half-life of 7.01±0.05 minutes; the half-lives of CRY2 Oligo and CRY2 Plus were 28.65±0.82 and 18.92±0.33 minutes, respectively; the half-life of wild-type CRY2-WT was approximately 50.54±1.39 minutes. Figure 2 B, C). Based on its performance advantages, CRY2-Clust was selected as the photo-activated switch. Western blot analysis showed that after blue light irradiation, Flash-Away-CRY2... PHR Clust protein levels were significantly reduced, and treatment with the proteasome inhibitor (MG132) significantly inhibited light-dependent Flash-Away-CRY2. PHR Clust system degradation ( Figure 2 D, E).

[0042] In summary, after screening, mCherry-CRY2 was selected. PHR Clust-mTRIM21(1-80) is defined as a Flash-Away system for light-controlled targeted protein degradation.

[0043] Example 4 Intrabody antibodies, including Monobody antibodies, Nanobody antibodies, and Binder peptides (pDI, LCB3), are used to achieve targeted degradation of corresponding proteins.

[0044] The degradation system includes: (1) Mb33-Flash-Away (targeted degradation of MLKL protein, Figure 3 (2) Nb-Actin-Flash-Away (targeted degradation of Actin protein, Figure 4 AD); (3) Nb-ALFA-Flash-Away (targeted degradation of ALFA-tagged fusion proteins, Figure 4 EF); (4) Flash-Away-pDI (targeted degradation of viral MDM2 protein, Figure 5 AB); (5) LCB3-Flash-Away (targeted degradation of viral Spike protein, Figure 5 CD).

[0045] The construction process of the above intracellular antibody-mediated light-controlled targeted protein degradation system: Fragments of Mb33 (MLKL monobody), Nb-Actin (actin nanobody), Nb-ALFA (ALFA nanobody), pDI (binding MDM2), and LCB3 (binding the RBD domain of ACE2) were synthesized using gBlock. These fragments were then inserted into Flash-away or mCh-CRY2 via the NheI restriction site. PHR In the vector, the following degradation systems were established: (1) Mb33-Flash-Away (targeted degradation of MLKL protein); (2) Nb-Actin-Flash-Away (targeted degradation of Actin protein); (3) Nb-ALFA-Flash-Away (targeted degradation of fusion protein with ALFA tag); (4) Flash-Away-pDI (targeted degradation of viral MDM2 protein); (5) LCB3-Flash-Away (targeted degradation of viral Spike protein).

[0046] The base sequence of Mb33 is shown in SEQ ID NO. 6; The base sequence of the Nb-Actin is shown in SEQ ID NO. 7; The base sequence of the Nb-ALFA is shown in SEQ ID NO. 8; The base sequence of the pDI is shown in SEQ ID NO. 9; The base sequence of the LCB3 is shown in SEQ ID NO. 10.

[0047] (1) A light-controlled protein-targeting degradation system, Mb33-Flash-Away (targeting degradation of MLKL protein), was constructed using a monomeric antibody. Monomeric antibodies are artificially synthesized binding proteins based on the modified fibronectin III (FN3) domain. They can target target molecules with high specificity and have broad application potential in biomedical research, diagnosis and targeted therapy.

[0048] MLKL is a key effector protein in programmed necrosis, and its mediated membrane perforation triggers an inflammatory response, which is associated with various diseases and makes it an important target for drug development. To maintain MLKL homeostasis, this application utilizes the Flash-Away system combined with the MLKL-specific monomeric antibody Mb33 to construct the Mb33-Flash-Away system (…). Figure 3 A).

[0049] In the control group, the fluorescence signal of MLKL-YFP oligomerization in Mb33-mCherry-CRY2 did not decrease significantly, while in the experimental group, the green fluorescence was significantly weakened after blue light irradiation, indicating increased MLKL degradation efficiency and a half-life of approximately 6.28 ± 0.05 minutes. Figure 3 B).

[0050] (2) Using nanobodies to construct light-controlled protein targeted degradation systems Nb-Actin-Flash-Away (targeted degradation of Actin protein); Nb-ALFA-Flash-Away (targeted degradation of fusion protein with ALFA tag); Nanobodies are small antibody molecules extracted from camelids, consisting only of the variable region of a traditional antibody heavy chain, resulting in a smaller molecular weight. They exhibit higher thermal and chemical stability, as well as relatively low immunogenicity. This study utilizes nanobodies to establish Nb-Actin-Flash-Away and Nb-ALFA-Flash-Away systems, respectively targeting Actin (… Figure 4 AD) and fusion proteins with ALFA tags undergo light-controlled degradation. Figure 4 EF). Furthermore, inducing Actin degradation using Nb-Actin-Flash-Away significantly inhibited cell migration function (EF). Figure 4 D).

[0051] (3) Using Binder peptides to construct the light-controlled protein targeted degradation system Flash-Away-pDI (targeted degradation of viral MDM2 protein); LCB3-Flash-Away (targeted degradation of viral Spike protein).

[0052] Binder peptides are short peptide chains that can specifically recognize and bind to target molecules. They are characterized by their small molecular weight, high penetrability, and ease of modification, and are widely used in drug development, molecular detection, and targeted delivery. This study utilizes binder peptides to establish Flash-Away-pDI and LCB3-Flash-Away systems, respectively targeting the MDM2 protein (…). Figure 5 AB) and the virus Spike undergo photo-controlled degradation ( Figure 5 CD).

Claims

1. An optogenetic tool for light-controlled induced protein degradation, characterized in that, Including the truncated form of mTRIM21 1-80 The fusion system of CRY2; mTRIM21 1-80 The base sequence is shown in SEQ ID NO. 1; The base sequence of CRY2 is shown in SEQ ID NO.

2.

2. The optogenetic tool according to claim 1, characterized in that, The CRY2 includes CRY2 mutants E490G, E490R, and CRY2 mutant CRY2-Clust; The base sequence of the CRY2 mutant E490G is shown in SEQ ID NO. 3; The base sequence of the CRY2 mutant E490R is shown in SEQ ID NO. 4; The base sequence of the CRY2 mutant CRY2-Clust is shown in SEQ ID NO.

5.

3. The optogenetic tool according to claim 1, characterized in that, The CRY2 mentioned is the CRY2 mutant CRY2-Clust.

4. The optogenetic tool according to any one of claims 1-3, characterized in that, The proteins degraded by the optogenetic tool include one of the following: MLKL, Actin, an ALFA-tagged fusion protein, MDM2, and Spike protein.

5. A method for constructing the optogenetic tool according to any one of claims 1-4, characterized in that, Includes the following steps: (1) mTRIM21 1-80 Construct a fusion system with the light-sensitive protein CRY2; (2) Construct a targeted protein degradation system using intrabody antibodies.

6. The construction method according to claim 5, characterized in that, Step (1) includes the following process: A1 uses homologous recombination to convert CRY2 PHR Insert mCherry2-C1 to construct the vector mCherry-CRY2 PHR ; amplification of mTRIM21 using pGEMHE-mCherry-mTRIM21 as a template 1-80 Furthermore, an NheI restriction site was introduced, and mTRIM21 was digested via a single NheI restriction site. 1-80 Insert mCherry-CRY2 PHR mTRIM21 is generated in the vector. 1-80 -mCherry-CRY2 PHR ; A2 uses pGEMHE-mCherry-mTRIM21 as a template to amplify mTRIM21. 1-80 Furthermore, BspEI and BglII restriction sites were introduced, and BspEI and BamHI (BglII and BamHI are isoskeletal enzymes) were used to cleave mCherry-CRY2. PHR The vector was digested with enzymes, and mTRIM21 was added. 1-80 Insert into mCherry-CRY2 PHR In the process, mCherryCRY2 is generated. PHR - mTRIM21 1-80 .

7. The construction method according to claim 5, characterized in that, Step (2) includes the following process: The corresponding intracellular antibody, Intrabody, is synthesized using gBlock to specifically recognize the protein to be degraded. The fragment is then inserted into the fusion system of step (1) or mCh-CRY2 using the NheI restriction site. PHR A targeted degradation system was established within the carrier.

8. The application of the optogenetic tool according to any one of claims 1-4 or the optogenetic tool constructed by the method according to any one of claims 5-7 to specifically target protein degradation.

9. The application according to claim 8, characterized in that, Intrabody antibodies are used to target and degrade corresponding proteins. Preferably, the intracellular antibody includes one or more of the following: Monobody antibody, Nanobody antibody, and Binder peptide.

10. The application according to claim 8 or 9, characterized in that, Western blotting was used to detect the degradation of the corresponding proteins by confocal time-lapse imaging.

Images