Engineered cryptic plasmids from c. butyricum
The use of SacB-based allelic exchange in engineered cryptic plasmids from C. butyricum addresses the limitations of existing methods by achieving stable and high-level expression of heterologous genes, suitable for industrial and medical applications.
Patent Information
- Application Number
- PCT/EP2025/064796
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-31
- Filing Date
- 2025-05-28
- Publication Date
- 2025-12-04
AI Technical Summary
Existing methods for gene expression in Clostridium butyricum, such as antibiotic-based vectors and CRISPR-mediated genomic integration, suffer from issues like antibiotic resistance, sub-optimal plasmid stability, and low expression levels, making them unsuitable for industrial and medical applications.
Employing SacB-based allelic exchange to integrate heterologous genes into engineered cryptic plasmids derived from C. butyricum, which allows stable expression without the need for antibiotic-based vectors or chromosomal integration, enabling high expression levels of heterologous genes.
The engineered cryptic plasmids provide stable and high-level expression of heterologous genes, maintaining expression levels through multiple subcultures, suitable for both industrial and medical applications.
Smart Images

Figure EP2025064796_04122025_PF_FP_ABST
Abstract
Description
[0001] ENGINEERED CRYPTIC PLASMIDS FROM C. BUTYRICUM FIELD OF THE INVENTION
[0001] This invention pertains in general to engineered bacterial cells of a species of C. butyricum, wherein the engineered bacterial cell comprises a heterologous nucleic acid that is located in an engineered cryptic plasmid. Further, the invention pertains to said engineered cryptic plasmid and to methods for producing said cryptic plasmids and said bacterial cells. BACKGROUND OF THE INVENTION
[0002] The background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.
[0003] Clostridium butyricum (C. butyricum) is a bacterium species belonging to the genus Clostridium of the order of Eubacteriales. C. butyricum is an anaerobic endospore-forming Gram-positive butyric acid–producing bacillus species. Clostridium butyricum has shown industrial potential in for example bio-fuel productions. In other studies, Clostridium butyricum has shown to possess therapeutical potential, for example as probiotic, but also as a means for overexpressing genes to produce therapeutic proteins, e.g., epidermal growth factor (Ma et al. Appl Microbiol Biotechnol. 2021 Aug;105(14-15):5973-5991. doi: 10.1007 / s00253-021-11472-y) glucagon-like peptide-1 (Wang XL et al. Microb Biotechnol. 2023 Apr;16(4):799-812. doi: 10.1111 / 1751-7915.14196) and antigen proteins such as NY-ESO-1 and SARS-CoV- 2-related Spike_S1 antigens (Zhang, Y., Bailey, T.S., Hittmeyer, P. et al. Microb Cell Fact 23, 119 (2024). https: / / doi.org / 10.1186 / s12934-024-02389-y).
[0004] Present day, overexpression of heterologous genes, such as in an expression system like Clostridium butyricum, is particularly based on antibiotic-based vectors and CRIPSR-mediated genomic integrations. In the pursuit of gene overexpression in C. butyricum, employing antibiotic-based vectors has been a common strategy (Heap et al., (2009) Microbiol Methods. 2009 Jul;78(1):79-85. doi: 10.1016 / j.mimet.2009.05.004). Albeit both methods have their advantages, both methods also suffer from disadvantages.
[0005] Inserting and expressing a heterologous gene in antibiotic-based vectors (e.g., antibiotic-based plasmids) has the benefit of providing relatively high expression levels of said heterologous gene. However, with the addition of antibiotic-resistance genes and the growing global risk of antibiotic-resistance transferring within potentially harmful microorganisms, genomic integration is biosafety-favourable for Clostridium biotechnology. Another limitation of this method is that plasmid stability is sub-optimal as a result of the use of antibiotics to maintain and use antibiotic-based vectors to enable heterologous gene expression. In addition, the administration of an antibiotic is often incompatible with in vivo experimentation or treatment for medical purposes.
[0006] As mentioned above, another method that is commonly used in the same pursuit relates to the use of chromosome-integration, such as CRISPR-Cas-based methods. Such methods offer stability, but lack sufficiently high expression levels (Kubiak Amet al. (2023) Front. Immunol. 14:1241632. doi: 10.3389 / fimmu.2023.1241632) due to the low copy number of the chromosome. Consequently, such methods cannot result in overexpression of heterologous genes and therefore are costly, time-consuming and often cumbersome methods for use in industrial and / medical purposes.
[0007] Overall, available methods for gene expression in C. butyricum suffer from disadvantages, such as those described above. It is an object of the invention to provide for a solution to at least one of these disadvantages of the prior art. SUMMARY OF THE INVENTION
[0008] Surprisingly, the inventors found that by the invention as disclosed herein this object was met. As embodied and described herein, the present invention relates to the surprising finding that engineered cryptic plasmids derived from C. butyricum show particular desirable characteristics making them suitable for their utilization in methods and uses for stable gene expression of heterologous genes in C. butyricum. By employing a SacB-based allelic exchange method the inventors enabled integration of heterologous genes in cryptic plasmids derived from C. butyricum. Unexpectedly, the inventors found significant benefits of these engineered cryptic plasmids according to the invention over existing technologies, including, but not limited to, independence of the use of antibiotic-based vectors and of chromosomal integration methods, such as CRISPR-mediated methods. In addition, the engineered cryptic plasmid derived from C. butyricum according to the invention seem to be particularly suitable for comprising and expressing any heterologous gene (or nucleotide sequence encoding a heterologous protein). Also, such heterologous genes were found to be stably overexpressed in C. butyricum, rendering the engineered cells. It was further surprisingly found that expression of the heterologous gene in engineered bacterial cells of a strain of C. butyricum according to the current invention remained present, at stable and desirable expression levels, after multiple subcultures of the bacterial cells. Thus, the invention allows that bacterial cells may be subcultured without a loss of the expression of the heterologous gene. In one example it was surprisingly found that both a heterologous gene derived from a human and expressing a human cytokine and a biological catalysing enzyme, i.e., cellulase could be expressed by the engineered cryptic plasmid of the current invention. Hence, the herein provided invention offers significant and diverse benefits for industrial and medical applications alike.
[0009] Therefore in a first aspect the invention provides for an engineered cryptic plasmid derived from C. butyricum engineered to comprise a heterologous gene.
[0010] With the engineered cryptic plasmid as previously disclosed, the engineering of a bacterial cell of a strain of C. butyricum can also be performed in a desirable manner, e.g., without the use of antibiotic-based vectors and / or without chromosome- integration methods, and resulting exhibiting desirable expression levels of heterologous genes.
[0011] Antibiotic-based vectors comprise antibiotic-selective vectors.
[0012] Thus, in a second aspect the invention provides for an engineered bacterial cell of a strain of C. butyricum comprising the engineered cryptic plasmid according to the invention.
[0013] With the engineered bacterial cell it is envisioned that methods of culturing the cells can be performed to obtain a population of engineered bacterial cells.
[0014] Thus, in a third aspect the invention provides for a population of said engineered bacterial cells.
[0015] With the aim of obtaining the engineered cryptic plasmids as previously disclosed herein, a method was implemented. The method allows for the obtaining of said engineered cryptic plasmids in a desirable manner, for example without the use of antibiotic-based vectors and / or without chromosome-integration methods. With the disclosed method, a SacB-based allelic exchange method, cryptic plasmids native (also referred to as “native-cryptic plasmids”) to C. butyricum could surprisingly be engineered to comprise a heterologous gene, thus obtaining the engineered cryptic plasmid as previously disclosed. The SacB-based method used and provided herein comprises the use of an antibiotic-marker. However, said antibiotic-marker will be eliminated during one or more steps of the method. The method results in heterologous gene insertion into native-cryptic plasmid only. Hence, the native-cryptic plasmid that is engineered by the method to comprise a heterologous gene does not comprise a (sequence encoding) an antibiotic or antibiotic marker.
[0016] Thus, in a fourth aspect the invention provides for a method for producing an engineered cryptic plasmid according to the invention by integrating a heterologous nucleic acid in the DNA of a cryptic plasmid derived from C. butyricum using SacB- based allelic exchange method. / epp
[0017] By using conventional methods for transforming and / or conjugating cells, the inventors were able to introduce the engineered cryptic plasmids previously described herein in a host cell and / or in a strain of bacterial cell to which these cryptic plasmids are native. It was surprisingly found that, by using the engineered cryptic plasmid, high expression levels of heterologous genes were present in engineered bacterial cell of the species Clostridium butyricum.
[0018] Thus, in a fifth aspect the invention provides for a method for producing an engineered bacterial cell of the species Clostridium butyricum according to any one of claims by transferring the engineered cryptic plasmid according to the invention, from a host bacterial cell to a bacterial cell of the species C. butyricum. In one aspect there is provided for Clostridium butyricum obtained by said method.
[0019] The inventors hypothesized that the engineered cryptic plasmids and / or engineered bacterial cells of the species Clostridium butyricum previously described would have many industrial applications. By way of the examples the invention shows that different heterologous genes can be brought to expression by using the methods and matter as disclosed herein.
[0020] Thus, in a final aspect the invention provides for uses of the engineered bacterial cell or the population of engineered bacterial cells according to the invention for the production of proteins. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:
[0022] Figure 1: Overview of the SacB-based allelic exchange method used for providing an engineered cryptic plasmid derived from C. butyricum and for providing engineered C. butyricum. GOI = gene of interest (heterologous gene)
[0023] Figure 2: The details of the SacB-based allelic exchange method. (a) The schema of the suicide backbone vector pGG121SacB. (b) The schema of pCB101 (GenBank: CP040628.1), pCB102 (GenBank: CP040629.1) with numbered ORFS, and the suicide vectors for the IFP2.0 integration. (c) The schema of the allelic exchange process. MCS, multiple cloning site; TtyrS, terminator; TraJ, conjugal transfer element; p15a, replicon in E. coli; U / D, homologous arms; pCB101-F / R and pCB102-F / R, colony PCR primer pairs.
[0024] Figure 3: The integration and expression of the IFP2.0 reporter in the native- cryptic plasmids of C. butyricum. (a) Colony PCR to check the segregation of the pCB101-IFP2.0 and pCB102-IFP2.0 mutants (3549 and 3488 bp, respectively) through multiple streaking.1–8, PCR products from single colonies; W, PCR products from the wild type; M, molecular weight standard. (b) Normalized intensity of NIR fluorescence in various constructs expressing IFP2.0, during consecutive subcultures. (c) Stability of antibiotic-based vectors upon sub-culturing. (d) Growth curves of strains with engineered native-cryptic plasmids. The data represent the mean ± SD of three biological replicates. Empty, C. butyricum harboring pGG2121 vector; CB_INIFP2.0, C. butyricum with IFP2.0 integrated into the chromosome; CB_WT, wild type C. butyricum.
[0025] Figure 4: The integrations and expressions of the GusA reporter and the Cel9M cellulase in pCB102 of C. butyricum. (a) Colony PCR to check the segregation of the pCB102-gusA mutants (4334 bp) through multiple streaking. (b) Normalized glucuronidase activity in various constructs expressing GusA during consecutive subcultures. (c) Colony PCR to confirm the pCB102-cel9M mutant (4103 bp). (d) CMC endoglucanase activity (clear halos) of supernatants and (e) Coomassie staining analysis of protein samples from various constructs expressing Cel9M (1, 2, 3) versus CB_WT (W) at the first and twentieth subcultures. S, cell-free supernatant; L, cell lysate. (f) Growth difference between pCB102-cel9M mutant and wild type upon CMC addition. The data represent the mean ± SD of three biological replicates. (ns, p > 0.05). Empty, C. butyricum harboring pGG2121 vector; CB_INgusA / cel9M, C. butyricum with GusA / Cel9M integrated into the chromosome; CB_WT, wild type C. butyricum.
[0026] Figure 5: The integration and expression of the bioactive hIL10 in pCB102 of C. butyricum. (a) Colony PCR to confirm the pCB102-hIL10 mutant (3080 bp). (b) Normalized hIL10 production of supernatants and (c) Western blotting analysis of protein samples from various constructs expressing hIL10 (1, 2, 3) versus Empty (0), at the first and twentieth subcultures. S, cell-free supernatant; L, cell lysate; P, commercial hIL10 protein. (e) Proliferation of PHA-L-stimulated PBMCs and (f) IFN / ISG response of LPS-stimulated THP-1 cells with various treatments of supernatants. The data represent the mean ± SD of three biological replicates. (ns, p > 0.05; *, **, ***, and ****, p < 0.05). Empty, C. butyricum harboring pGG2121 vector; CB_INhIL10, C. butyricum with hIL10 integrated into the chromosome; CB_WT, wild type C. butyricum; rhIL10, bioactive recombinant hIL10; S_empty / hIL10, supernatants from the Empty / pGG2121-hIL10 strain
[0027] Figure 6: Plasmid curings in generation of pCB101-IFP2.0 and pCB102-IFP2.0 mutants under 17 µg / mL thiamphenicol (Tm).
[0028] Figure 7: CMC endoglucanase activity (clear halos) of supernatants when growing the pCB102-cel9M mutant and wild type, and PYTG media was used as the control. DEFINITIONS
[0029] A portion of this disclosure contains material that is subject to copyright protection (such as, but not limited to, diagrams, device photographs, or any other aspects of this submission for which copyright protection is or may be available in any jurisdiction.). The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or patent disclosure, as it appears in the Patent Office patent file or records, but otherwise reserves all copyright rights whatsoever.
[0030] Various terms relating to the methods, compositions, uses and other aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein.
[0031] For purposes of the present invention, the following terms are defined below.
[0032] As used herein, the singular form terms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a cell” includes a combination of two or more cells, and the like. For example, a method for culturing a cell includes the culturing of a plurality of cells (e.g., 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more).
[0033] As used herein, “about” and “approximately", when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed invention. Unless otherwise clear from context, all numerical values provided herein include numerical values modified by the term “about.”
[0034] As used herein, “and / or” refers to a situation wherein one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.
[0035] As used herein, "at least" a particular value means that particular value or more. For example, "at least 2" is understood to be the same as "2 or more" i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, …, etc. As used herein, the term "at most" a particular value means that particular value or less. For example, "at most 5" is understood to be the same as "5 or less" i.e., 5, 4, 3, ….-10, -11, etc.
[0036] As used herein, “comprising” or “to comprise” is construed as being inclusive and open ended, and not exclusive. Specifically, the term and variations thereof mean the specified features, steps or components are included. These terms are not to be interpreted to exclude the presence of other features, steps, or components. It also encompasses the more limiting “to consist of.”
[0037] As used herein, “conventional techniques”, “conventional methods” or “methods known to the skilled person” refer to a situation wherein the methods of carrying out the conventional techniques used in methods as disclosed herein will be evident to the skilled worker. The practice of conventional techniques in cell culture, biology, molecular biology, biochemistry, genomics, sequencing, and related fields are well- known to those of skill in the art and are discussed, in various handbooks and literature references.
[0038] As used herein, "exemplary" or “for example” means "serving as an example, instance, or illustration," and should not be construed as excluding other configurations, including those disclosed herein.
[0039] As used herein, the term “cryptic” when used in conjunction with a plasmid (thus, “cryptic plasmid” refers to an extrachromosomal DNA element in a bacterium that encodes a phenotype without known function and / or without characterization besides a replication function.
[0040] As used herein, the term “heterologous”, for example when used in conjunction with gene (“heterologous gene”) refers to a gene which is comprised in a nucleic acid, e.g., a DNA or RNA, of an organism and wherein said gene is derived from a different organism. Thus, a heterologous gene is a gene of one organism that is inserted in a nucleic acid of a different organism. Metthods and kits suitable for inserting heterologous genes are known and generally available in the art. Generally, said heterologous genes are expressed to produce proteins which are normally not produced in the organism wherein the heterologous gene is expressed. “Heterologous gene” and “nucleotide sequence encoding a heterologous protein” may be used interchangeably. DETAILED DESCRIPTION
[0041] It is contemplated that any method, use or composition described herein can be implemented with respect to any other method, use or composition described herein. Embodiments discussed in the context of methods, use and / or compositions of the invention may be employed with respect to any other method, use or composition described herein. Thus, an embodiment pertaining to one method, use or composition may be applied to other methods, uses and compositions of the invention as well.
[0042] The existence of native-cryptic plasmids has been found in several Clostridium species and the native-cryptic Clostridium butyricum plasmids has been reported for decades. (Collins et al. J Gen Microbiol. 1985 Aug;131(8):2097-105. doi: 10.1099 / 00221287-131-8-2097. PMID: 2997368.) with their replicons finding widespread application in Clostridium molecular biology. Despite this, leveraging these plasmids has been explored only to a limited extent in Clostridium species, unlike in other bacteria, e.g., of the genus E.coli.
[0043] As embodied and described herein, the present invention comprises the surprising finding that cryptic plasmids derived from C. butyricum can be engineered to comprise a heterologous gene.
[0044] Further, the present invention comprises a bacterial cell of the species C. butyricum comprising a cryptic plasmid derived from a bacterial cell of the species C. butyricum and comprising a heterologous gene. It was found that C. butyricum, being a bacterial species regularly utilized in industrial applications, could be engineered to comprise native-cryptic plasmids (i.e., cryptic plasmids occurring naturally in Clostridia,) expressing heterologous genes. It was surprisingly found that the engineered C. butyricum was able to express heterologous genes producing industrially applicable and medically applicable proteins effectively and with surprisingly desirable yields. This heterologous gene preferably was inserted into the cryptic plasmid by using the SacB-based allelic exchange methods. The inventors found that by using for example this SacB-based allelic exchange method stable cryptic plasmids derived from C. butyricum could be generated comprising such a heterologous gene. Subsequently, the inventors transformed host bacterial cells suitable for expression or for bacterial conjugation with C. butyricum for expression of said plasmid. In other words, the inventors have generated novel engineered cryptic plasmids derived from C. butyricum which are very suitable for comprising and expressing heterologous genes.
[0045] As previously indicated, a first aspect of the invention is an engineered cryptic plasmid derived from C. butyricum engineered to comprise a heterologous gene. In other words, herein provided is a cryptic plasmid that is derived from C. butyricum, wherein the cryptic plasmid is engineered to comprise a heterologous gene thus obtaining an engineered cryptic plasmid. As described, the cryptic plasmid is derived from C. butyricum. This refers to that the cryptic plasmids utilized and provided in the present invention are cryptic plasmids native to (a strain of) the species C. butyricum (i.e., native-cryptic plasmids), In other words, the engineered cryptic plasmids used and provided in the present invention are native-cryptic plasmids of a strain of C. butyricum of which the nucleic acid is engineered to comprise a heterologous gene, and so obtaining an engineered cryptic plasmid native to said strain of C. butyricum.
[0046] It will be appreciated by a skilled person that in the current invention with an “engineered cryptic plasmid comprising a heterologous gene” is meant that the concerning native-cryptic plasmid derived from a strain of C. butyricum is genetically engineered to comprise a heterologous gene. In particular embodiments, the method used to engineer the cryptic plasmids in accordance with the invention is a method known in the art as SacB-based allelic exchange.
[0047] By engineering the DNA of the cryptic plasmid derived from C. butyricum, the DNA of the plasmid will be altered such as to comprise a heterologous gene, thus obtaining an engineered cryptic plasmid derived from C. butyricum. Thus, it will be understood that a heterologous gene can be comprised in the DNA of an engineered cryptic plasmid in accordance with the invention. The heterologous gene can be inserted in the plasmid’s nucleic acid at a suitable insertion site, preferably between a first and second open reading frame (ORF), in the engineered cryptic plasmid.
[0048] It will be appreciated by the skilled person that the heterologous gene is not particularly bound by length of the gene to be suitable for insertion in the engineered cryptic plasmid according to the invention. It will be appreciated by a skilled person that since the inventors have been able to provide engineered cryptic plasmids comprising either a heterologous gene encoding a cellulase, a heterologous gene encoding an integrating reporter, such as glucuronidase, a heterologous gene encoding human interleukin-10 or a heterologous gene encoding a NIR fluorescent protein, many other heterologous genes may also be provided in the context of the invention to obtain engineered cryptic plasmids according to the invention comprising a heterologous gene selected from numerous possible heterologous genes. It is preferred that the heterologous gene is codon-optimized for Colostridia, preferably for C. butyricum.
[0049] In some embodiments, the heterologous gene encodes an animal protein, such as a human protein. In other embodiments the heterologous gene encodes a bacterial protein.
[0050] The heterologous nucleic acid may encode any protein. Preferably, the nucleic acid encodes a protein from the group of an enzyme or cell-signaling molecule. In some examples, to which the invention is not limited, the enzyme is a cellulase, more preferably Cel9M. In some examples, to which the invention is not limited, the cell- signaling molecule is a cytokine, preferably human cytokine, more preferably a human interleukin, most preferably human interleukin 10.
[0051] In some embodiments it is preferred that the heterologous gene comprises a nucleic acid sequence which comprises between more than 0 and at most 25.000 nucleotides. It is contemplated that a heterologous gene having between 100 – 20.000 nucleotides is highly suitable for insertion in any one of the engineered cryptic plasmids according to the invention. In some preferred embodiments the nucleic acid representing the heterologous gene comprises between 750 – 3000 nucleotides, preferably about 2000 nucleotides.
[0052] In some preferred embodiments the heterologous gene comprises at least 90% sequence identity, more preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to a gene having a nucleic acid sequence of SEQ ID NO: 8, 9, 10 and / or 11.
[0053] As will be illustrated in the examples, to which the invention is not limited, the heterologous gene can be a gene encoding an integrating reporter, such as glucuronidase (GusA) e.g., comprising 2078 nucleotides according to SEQ ID NO: 10, or a NIR fluorescent protein (e.g., IFP2.0) e.g., comprising 1232 nucleotides according to SEQ ID NO: 11. In some examples, to which the invention is not limited, the heterologous gene is a gene encoding human interleukin-10, e.g., comprising 824 nucleotides according to SEQ ID NO: 9, or a gene encoding a cellulase (Cel9M), e.g., comprising 1847 nucleotides according to SEQ ID NO: 8.
[0054] In some particular embodiments, the heterologous gene is codon-optimized for Colostridia. Therefore, in some embodiments, the nucleotide sequences of SEQ ID NO: 8, 9, 10 and / or 11 comprise a sequence identity compared to wild-type (wt) of at least 80%, at least 85%, at least 90%, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%. In some embodiments, the promotor-sequence of any one of the nucleotide sequences of SEQ ID NO: 8, 9, 10 and / or 11 has a sequence identity compared to wild-type of at least 80%, at least 85%, at least 90%, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%.
[0055] It is understood that the sequence identity of any one of the nucleotide sequences of SEQ ID NO: 8, 9, 10 and / or 11 is such that the amino acid sequence for the encoded protein has at least 95%, 96%, 97%, 98%, 99% sequence identity to the corresponding wild-type protein (e.g., wt GusA, preferably GusA of an E. coli, wt IFP2.0, preferably IFP2.0 of a Rhodopseudomonas palustris, wt hIL10, preferably human IL10, wt Cel9M, preferably Cel9M of a Clostridium cellulolyticum).
[0056] In some embodiments, the engineered cryptic plasmid derived from C. butyricum according to the invention comprises more than one heterologous gene. For example, the engineered cryptic plasmid derived from C. butyricum according to the invention may comprise multiple copies of the same heterologous gene. In the case the engineered cryptic plasmid derived from C. butyricum comprises more than one (different or copies of the same) heterologous gene, it is preferred that each heterologous gene is inserted into the DNA of the engineered cryptic plasmid according to the invention at different loci, e.g., a first heterologous gene is interested at a first insertion site, e.g., between a first and second ORF, a second heterologous gene is interested at a second insertion site which is different from the first insertion site, e.g., between a second and third ORF, etc.
[0057] According to the invention, the cryptic plasmid is derived from a strain of C. butyricum. Said native-cryptic plasmid may be isolated from said strain by using methods for the isolation of plasmids from bacteria known and described in the art (e.g., by lysing cells). Said methods are herein encompassed.
[0058] The strain of C. butyricum may be any one of the strains DSM 10702, TK520, NBRC_13949 MIYAIRI 588, JKY6D1, NBRC CBM588, TOA, CDC_51208. A skilled person in the field of C. butyricum is familiar with said strains. For example, the strain C. butyricum MIYAIRI 588 has been widely used as an anti-diarrheal agent in Asian countries since the 1930s and was authorized as a novel food ingredient in Europe in 2014.
[0059] In preferred embodiments the engineered cryptic plasmid according to the invention is derived from the strain C. butyricum DSM 10702. C. butyricum DSM 10702 is a type strain that was originally isolated from pig intestines by Prazmowski in 1880. The strain has shown desirable properties for biofuel and biochemical processes and for medical application (Xin et al, 2013, Genome Announc, 1(4), Shin et al. 2020 J Microbiol Biotechnol, 30(3), 368-377 and Ma et al, 2021, Applied Microbiology and Biotechnology, 105(14), 5973-5991. It was surprisingly found by the inventors that cryptic plasmids derived from the strain C. butyricum DSM 10702 allowed for very suitable candidates for engineering and introducing of heterologous genes in the genome of said cryptic plasmids. Specifically, the inventors found that utilizing these cryptic plasmids allowed for gene expression without the use of antibiotic-based vector and / or without the use of chromosome-integrating methods of a heterologous gene.
[0060] In particular embodiments the engineered cryptic plasmid derived from the strain C. butyricum DSM 10702 is selected from the group consisting of pCB101 and pCB102, preferably pCB101 having GenBankID: CP040628.1 and pCB102 having GenBankID: CP040629.1. Despite their prevalence across various bacteria, native- cryptic plasmids (i.e., cryptic plasmids occurring naturally in Clostridia) remain largely unexplored in Clostridia. pCB101 and pCB102 are cryptic plasmids that are native to bacteria of the strain C. butyricum DSM 10702. Both native-cryptic plasmids have been known in the art to exist in C. butyricum DSM 10702 (also known and described in the art as C. butyricum NCIB 7423) (Collins et al.1985). The replicons of these plasmids have been found widely applicable in Clostriudium molecular biology (Joseph et al. 2018 Front Microbiol, Vol. 9(154), doi: 10.3389 / fmicb.2018.00154). However, leveraging these plasmids has never before been explored in C. butyricum. Preferably, pCB101 has at least 90% sequence identity to the nucleic acid sequence as shown in SEQ ID NO: 1. In some embodiments the pCB101 comprises, with increasing preference, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the nucleic acid sequence as shown in SEQ ID NO: 1. Most preferably, the pCB101 has the nucleic acid sequence of SEQ ID NO: 1. Preferably, pCB102 has at least 90% sequence identity to the nucleic acid sequence as shown in SEQ ID NO: 2. In some embodiments the pCB102 comprises, with increasing preference, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the nucleic acid sequence as shown in SEQ ID NO: 2. Most preferably, the pCB102 has the nucleic acid sequence of SEQ ID NO:2.
[0061] It may be that a combination of pCB101 and pCB102 cryptic plasmids are leveraged as engineered cryptic plasmids for the expression of heterologous genes in accordance with the invention. It was found that the engineered cryptic plasmid, pCB102, derived from the strain C. butyricum DSM 10702 had specific desirable benefits, e.g., by showing stable gene (over)expression after multiple subcultures of C. butyricum DSM 10702, for heterologous gene (over)expression. Thus, in some particular embodiments, the invention pertains to an engineered cryptic plasmid derived from C. butyricum DSM 10702 engineered to comprise a heterologous gene, wherein the cryptic plasmid that is engineered to comprise a heterologous gene is pCB102.
[0062] In particular embodiments the engineered cryptic plasmid according to the invention comprises that the heterologous gene is located between a first open reading frame and a second open reading frame in the DNA of the engineered cryptic plasmid. To allow the heterologous gene to be located between a first open reading frame and a second open reading frame in the DNA of the engineered cryptic plasmid methods for inserting the heterologous gene can be employed as described herein.
[0063] It is contemplated that the insertion site may be anywhere in the DNA of the engineered cryptic plasmid. Preferably, the insertion site avoids the disruption of the cryptic plasmids’ functions in a cell, e.g., a C. butyricum bacterial cell.
[0064] In case the engineered cryptic plasmid comprises that the cryptic plasmid pCB101 is engineered to comprise a heterologous gene, it is preferred that the first open reading frame (ORF) comprises at least 90% sequence identity to SEQ ID NO: 3, with increasing preference at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 3. Most preferably said first open reading frame has the nucleic acid sequence of SEQ ID NO: 3, and the second open reading frame comprises at least 90% sequence identity to SEQ ID NO: 4, with increasing preference at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 4. Most preferably said second open reading frame has the nucleic acid sequence of SEQ ID NO: 4.
[0065] In other words, in case the engineered cryptic plasmid comprises the native- cryptic plasmid pCB101, the first open reading frame comprises the nucleic acid sequence of SEQ ID NO: 3 and the second open reading frame comprises the sequence of SEQ ID NO: 4.
[0066] Thus, the skilled person will appreciate that, in case the engineered cryptic plasmid comprises the native-cryptic plasmid pCB101, the insertion site is between a first ORF comprising a sequence identity of at least 90% or more, most preferably 100%, to SEQ ID NO: 3, and a second ORF comprising a sequence identity of at least 90% or more, most preferably 100%, to SEQ ID NO: 4.
[0067] Thus, in particular embodiments, the invention pertains to an engineered cryptic plasmid derived from C. butyricum DSM 10702 engineered to comprise a heterologous gene, wherein the cryptic plasmid that is engineered to comprise a heterologous gene is pCB101, wherein the heterologous gene is located between a first ORF comprising a sequence identity of at least 90% or more, most preferably 100%, to SEQ ID NO: 3, and a second ORF comprising a sequence identity of at least 90% or more, most preferably 100%, to SEQ ID NO: 4 in the DNA of the engineered cryptic plasmid.
[0068] Further, in case the engineered cryptic plasmid comprises the native-cryptic plasmid pCB102 the first open reading frame comprises at least 90% sequence identity to SEQ ID NO: 5, with increasing preference at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 5. Most preferably said first open reading frame has the nucleic acid sequence of SEQ ID NO: 5. the engineered cryptic plasmid comprises the native-cryptic plasmid pCB102, the second open reading frame comprises at least 90% sequence identity to SEQ ID NO: 6, with increasing preference at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 6. Most preferably said second open reading frame has the nucleic acid sequence of SEQ ID NO: 6.
[0069] In other words, in case the engineered cryptic plasmid comprises the native- cryptic plasmid pCB102, the first open reading frame comprises the nucleic acid sequence of SEQ ID NO: 5 and the second open reading frame comprises the sequence of SEQ ID NO: 6.
[0070] Thus, the skilled person will appreciate that, in case the engineered cryptic plasmid comprises the native-cryptic plasmid pCB102, the insertion site is between a first ORF comprising a sequence identity of at least 90% or more, most preferably 100%, to SEQ ID NO: 5, and a second ORF comprising a sequence identity of at least 90% or more, most preferably 100%, to SEQ ID NO: 6.
[0071] Thus, in particular embodiments, the invention pertains to an engineered cryptic plasmid derived from C. butyricum DSM 10702 engineered to comprise a heterologous gene, wherein the cryptic plasmid that is engineered to comprise a heterologous gene is pCB102, wherein the heterologous gene is located between a first ORF comprising a sequence identity of at least 90% or more, most preferably 100%, to SEQ ID NO: 5, and a second ORF comprising a sequence identity of at least 90% or more, most preferably 100%, to SEQ ID NO: 6.
[0072] In particular embodiments, the engineered cryptic plasmid according to the invention is obtained by inserting the heterologous gene in the nucleic acid sequence of a cryptic plasmid derived from C. butyricum using a method known and referred to in the art as SacB-based allelic exchange. In preferred embodiments, the heterologous gene is inserted in a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% to SEQ ID NO: 1 or SEQ ID NO: 2. Preferably the heterologous gene is inserted in a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% to SEQ ID NO: 1 or SEQ ID NO: 2 and between a first and second ORF as previously described herein.
[0073] The SacB-based allelic exchange method is a conventional method for exchanging alleles and has been used in the art specifically only for chromosome engineering (Marx CJ, 2008, Feb 26, BMC Res Notes 1:1. doi: 10.1186 / 1756-0500-1- 1). The SacB-based allelic exchange method is known to the skilled person and has been described in for example U.S. patent 5,843,664 and in Blomfield I C et al. Mol. Microbiol. 1991 June; 5(6):1447-57. Other methods for the exchanging of alleles in bacteria are described in the art, for example in Lehman et al. (Lehman MK, Bose JL, Bayles KW., 2016, Allelic Exchange. Methods Mol Biol. 1373:89-96. doi: 10.1007 / 7651_2014_187) who describe various methods of allelic exchange in Staphylococcus aureus. Although allelic exchange is a suitable method for many bacteria, it remains very difficult or impractical with others (Jost et al. (1997) Mol Biotechnol 8, 189–191. https: / / doi.org / 10.1007 / BF02752263).
[0074] This is the first time that the SacB-based allelic exchange method was used for allelic exchange in native-cryptic plasmids derived from a strain of C. butyricum, thus the outcome was unpredictable and unexpected.
[0075] SacB is known in the art as one of counter-selectable marker (or negative selectable marker) (Reyrat et al. Infect Immun. 1998 Sep;66(9):4011-7. doi: 10.1128 / IAI.66.9.4011-4017.1998). The gene is originally derived from a B. subtilis gene encoding levansucrase that converts sucrose to levans. Levans is a toxic product produced by expression of the SacB gene, thus plating of cells on a sucrose-containing medium will segregate cells that contain constructs that have lost the SacB gene from cells that comprise and express the SacB gene. In a previous study, SacB has been used as a counter-selectable marker in C. butyricum (Zhang et al. 2022, ACS Synth Biol.11(11) 3817-3828).
[0076] The SacB-based allelic exchange method as used and provided for in the current disclosure comprises the following steps: a) Constructing a suicide plasmid, suitable for SacB-based allelic exchange, comprising upstream and downstream fragments suitable for insertion of the heterologous gene in the native-cryptic plasmid and comprising a heterologous gene, from a suicide backbone vector, which contains a SacB gene, via ligation of the upstream and downstream fragments and heterologous gene in said vector. b) Transforming the suicide plasmid containing the heterologous gene into a host bacterial cell via a conventional method. c) Conjugating the host bacterial cells with a bacterial cell of interest to facilitate the transferring of the suicide plasmid containing the heterologous gene of the host bacterial cell to the bacterial cell of interest. d) Allowing integration of the suicide plasmid in the native-cryptic plasmid of the bacterial cell of interest. e) Contacting the bacterial cells of interest with a sucrose-containing culture medium to select for and obtain engineered cryptic plasmids according to the invention and / or bacterial cells of interest comprising engineered cryptic plasmids according to the invention.
[0077] By using this method the bacterial cells of interest comprising engineered cryptic plasmids comprising heterologous genes according to the invention were obtained. An schematic illustration of the SacB-based method as used in certain embodiments of the invention is shown in Fig.1. One non-limiting example of the SacB method to insert the heterologous gene IFP2.0 in a cryptic plasmid derived from a strain of C. butyricum, thus obtaining an engineered cryptic plasmid derived from a strain of C. butyricum comprising the IFP2.0 gene is shown in Fig.2c.
[0078] In step a) of the above-described method, the suicide backbone vector comprises the SacB-gene. In particular embodiments the suicide backbone vector has a nucleic acid sequence of at least 90% sequence identity to SEQ ID NO: 7. Preferably, the suicide backbone vector has at least 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 7. In most preferred embodiments the suicide backbone vector has a nucleic acid sequence according to SEQ ID NO: 7. It is preferred that the suicide backbone vector is pGG121SacB. It is preferred that the suicide backbone vector is obtained by methods for obtaining these vectors as described and exemplified herein, however a skilled person will appreciate that any conventional methods that can result in the obtaining of a SacB-gene containing suicide backbone vector, particularly a pGG121SacB, having a nucleic acid sequence of at least 90% sequence identity to SEQ ID NO: 7, may be likewise implemented and is therefore encompassed herein. The suicide backbone vector beneficially also comprises an antibiotic-resistant gene, preferably a Cm / Tm-resistant gene (CatP), although other antibiotic-resistant genes may be used in case another antibiotic is used in the SacB-based allelic exchange method (e.g., as preferably used in step d)). It is understood that the antibiotic gene will be eliminated with the suicide plasmid during the above-described method and will not be present in the resultant engineered cryptic plasmids.
[0079] It is preferred that, in step a), the heterologous gene is comprised in an expression cassette.
[0080] Preferably, the suicide plasmid constructed and obtained in step a) comprises the suicide backbone vector as described above and an expression cassette comprising a heterologous gene. The suicide plasmid may be constructed by ligation of upstream and downstream fragments from insertion sites in cryptic plasmids and the heterologous gene. Preferably, the ligation is performed using a method known in the art as Golden Gate assembly (or Golden Gate cloning) (Engler C et al. (2008) PLOS ONE 3(11): e3647. https: / / doi.org / 10.1371 / journal.pone.0003647).
[0081] In general, a suicide plasmid is a non-replicable plasmid used for the transferring of a heterologous gene to a recipient cell.
[0082] The upstream and / or downstream fragments comprise sequences that comprise, or correspond to, sequences of insertion sites on the nucleic acid, such as of ORF ends, e.g., preferred ORFs as described herein, of a native-cryptic plasmid of a bacterial cell of interest. An illustrative example is shown in Fig. 2c. Said upstream and / or downstream fragments aid in facilitating the engineering of a native-cryptic plasmid.
[0083] In the methods described herein the upstream and / or downstream fragments for a cryptic plasmid as described herein can be amplified by using a suitable primer. For example, for amplifying an upstream fragment of the cryptic plasmid pCB101 a primer comprising a nucleic acid having at least 90% sequence identity to SEQ ID NO: 16 and / or 17 may be used. For example, for amplifying an downstream fragment of the cryptic plasmid pCB101 a primer comprising a nucleic acid having at least 90% sequence identity to SEQ ID NO: 18 and / or 19 can be used. Preferably, for the upstream fragment amplification a pCB101-U-F-BsaI and pCB101-U-R-BsaI primer is used, wherein the pCB101-U-F-BsaI has a nucleic acid sequence according to SEQ ID NO: 16, and pCB101-U-R-BsaI has a sequence according to SEQ ID NO: 17. Preferably, for the downstream fragment amplification of pCB102 a pCB101-U-F-BsaI and pCB101-U-R-BsaI primer is used, wherein the pCB101-D-F-BsaI has a nucleic acid sequence according to SEQ ID NO: 18, and pCB101-D-R-BsaI has a sequence according to SEQ ID NO: 19.
[0084] For amplifying an upstream fragment of the cryptic plasmid pCB102 a primer, for example comprising a nucleic acid having at least 90% sequence identity to SEQ ID NO: 20 and / or 21 may be used, and for the amplifying an downstream fragment of the cryptic plasmid pCB102, for example, a primer comprising a nucleic acid at least 90% sequence identity to SEQ ID NO: 22 and 23 can be used. Preferably, for the upstream fragment amplification a pCB102-U-F-BsaI and pCB102-U-R-BsaI primer is used, wherein the pCB102-U-F-BsaI has a nucleic acid sequence according to SEQ ID NO: 20, and pCB102-U-R-BsaI has a sequence according to SEQ ID NO: 21. Preferably, for the downstream fragment amplification of pCB102 a pCB102-D-F-BsaI and pCB102-D-R-BsaI primer is used, wherein the pCB102-U-D-BsaI has a nucleic acid sequence according to SEQ ID NO: 22, and pCB102-D-R-BsaI has a sequence according to SEQ ID NO: 23.
[0085] Preferably, the restriction sites of the primers for amplification of upstream and downstream fragments used and described herein, preferably as shown in SEQ ID Nos 16 - 23 comprise a nucleotide sequence corresponding to a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to GGTCTC.
[0086] In step b), the host bacterial cell used for the transformation of the suicide plasmid into said host bacterial cell may be any suitable host bacterial cell known to the skilled person. In particular embodiments, the host bacterial cell of an E. coli strain. In preferred embodiments the host bacterial cell is of the E. coli strain S17-1 and / or E.coli strain 10-ß.
[0087] The bacterial cell of interest is a bacterial cell from a strain of C. butyricum to which the cryptic plasmids, which are fused with the suicide plasmid, are native. Preferably the bacterial cell of interest is a bacterial cell from the strain C. butyricum DSM 10702.
[0088] The transformation of suicide plasmids obtained in step a) may be performed by using methods known in the art for transforming plasmids into host cells, preferably for transforming plasmids into cells from a strain of E. coli. An example of such a method, and which may be used herein, is described by Froger et al. (Froger A et al. J Vis Exp.2007;(6):253. doi: 10.3791 / 253).
[0089] The step of conjugation, bacterial conjugation, of step c) can be performed by using methods of the art, such as a method described by Zhang et al. (Zhang Y. et al. 2023. Microbiol Spectr 11:e02459-23.https: / / doi.org / 10.1128 / spectrum.02459-23). Provided herein, a strain of E. coli is contacted with a strain of C. butyricum wherein the E.coli (cis-conjugant) is the donor of the suicide plasmids to the recipient cells, C. butyricum (trans-conjugant). The cells may be contacted with one another in any suitable cell-culturing medium and / or cell-culturing device.
[0090] Following bacterial conjugation, in step d), integration of the suicide plasmid in the native-cryptic plasmid of the bacterial cell of interest is allowed to occur, preferably intracellularly. The recipient cells, C. butyricum (trans-conjugants) comprising a suicide plasmid and a native-cryptic plasmid are allowed to undergo the natural process of single and / or double cross-over (e.g., as illustrated in Fig.2c). The single cross-over process integrates the suicide plasmid into a native-cryptic plasmid of said recipient cells, C. butyricum (trans-conjugant). The double cross-over process may result in the suicide vector being eliminated from the native-cryptic plasmid, without integration of the heterologous gene in the nucleic acid of the native-cryptic plasmid, or may result in the suicide vector being eliminated from the native-cryptic plasmid, thereby integrating the heterologous gene in the nucleic acid of the native-cryptic plasmid and obtaining an engineered cryptic plasmid according to the invention. The single and / or double cross-over step may result in a “pure” mutant, which is a cell containing engineered native-cryptic plasmid (preferably pCB101 and pCB102) according to the invention and without the wild-type, or in a “mixed” mutant, representing a cell containing both wild-type native-cryptic plasmids and engineered native-cryptic plasmids according to the invention. It may be that a population of cells comprises both these so-called “pure” and “mixed” mutants.
[0091] Thus, in the step d) bacterial cells of interest may be obtained that contain engineered cryptic plasmids according to the invention.
[0092] In some embodiment the SacB-based allelic exchange method comprises, between step c) and step e), the step of performing a PCR utilizing the pCB101- F / pCB101-R and pCB102-F / pCB102-R primer pairs to screen for “mixed”, “pure” mutants and / or for engineered native-cryptic plasmid (e.g., as illustrated in Fig.3a).
[0093] Following bacterial conjugation e.g., subsequent to step c), before, during or subsequent to step d), and / or before step e), bacterial cells of interest harboring the suicide plasmid, native-cryptic plasmid, native-cryptic plasmid comprising an integrated suicide plasmid and / or an engineered native-cryptic plasmid according to the invention may be plated onto a suitable cell-culturing device, such as but not limited to an agar plate, comprising a cell-culture medium. The current invention is not limited by cell-culturing devices, thus any form, sort, type and / or size of cell-culturing device is encompassed herein. Preferably, the cell-culturing devices comprise a form, sort, type and / or size suitable for industrial applications, thus, a cell-culturing device may be e.g., a bioreactor.
[0094] It is preferred that the cell-culturing medium is supplemented with an antibiotic, such as thiamphenicol (Tm). The antibiotic may eliminate bacterial cells of interest that do not comprise an antibiotic-resistant gene, preferably a Cm / Tm-resistant gene (CatP). Thus, any “mixed” and / or “pure” mutants, i.e., any bacterial cells of interest comprising , native-cryptic plasmid comprising an integrated suicide plasmid and / or an engineered native-cryptic plasmid according to the invention are maintained.
[0095] It is preferred that subsequent to a first exposure to an antibiotic, obtained colonies of the recipient cells may be contacted with a fresh cell-culturing medium and / or plated onto a fresh cell-culturing device, optionally containing escalating concentrations of an antibiotic, such as Tm.
[0096] Concentrations of Tm used herein may be selected from any concentration between 1µg / mL – 500 µg / ml. Preferably, the concentrations of Tm are selected from concentrations between 30 µg / mL and 150µg / ml. Supplementation of the cell culturing medium with an antibiotic, such as Tm, has the effect of segregating bacterial cells of interest comprising a wild-type cryptic plasmid, engineered cryptic plasmid, or both a wild-type cryptic plasmid and engineered cryptic plasmid, detected by colony PCR.
[0097] It may be that in the SacB-based allelic exchange method as described herein, for example during (e.g., in parallel to) or prior to step e), e.g., between step c) and step e), screening for mixed or complete segregations may be carried out through colony-PCR utilizing primer pairs suitable for example selected from pCB101-F (SEQ ID NO: 12) / pCB101-R (SEQ ID NO: 13) (5’-tccaaaacggaatataaacgct-3’ / 5’- ttacactttggcagaccttgtg-3’) and / or pCB102-F (SEQ ID NO: 14) / pCB102-R (SEQ ID NO: 15) (5’-gaattggaatgatattgcacag-3’ / 5’-acgctgatgggctagaaggagt-3’). Preferably, the screening for mixed or complete segregations through colony-PCR may be carried out subsequent to any one of the steps comprising the exposure of bacterial cells of interest to an antibiotic.
[0098] In step e), which also may be subsequent to any one of the steps comprising the exposure of bacterial cells of interest to an antibiotic, the cells comprising engineered cryptic plasmid are contacted for a period of time to a sucrose-containing medium. By the contacting of these cells with sucrose-containing medium, the native- cryptic plasmids comprising integrated suicide plasmids (which have undergone only a single cross-over in step d)) are eliminated. Thus, in other words, on the one hand exposure to sucrose allows for the obtaining of (a population of) engineered bacterial cells comprising only an engineered native-cryptic plasmid comprising a heterologous gene, without antibiotic-resistance gene. On the other hand, exposure to sucrose may result in the cryptic plasmids comprising integrated suicide plasmids to reverse to wild- type native-cryptic plasmids. An illustrative example of intracellular allelic exchange is shown in Fig.1 and Fig.2c.
[0099] Thus, the elimination of cells via sucrose selection, results in cells without antibiotic-resistance gene and containing only engineered native-cryptic plasmid according to the invention or only wild-type native-cryptic plasmids.
[0100] The period of time for contacting the bacterial cells of interest with a sucrose- containing medium may be for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, 36 or 48 hours. It is preferred that the cells are contacted for between 24 – 48 hours with a sucrose-containing medium.
[0101] Preferably, the sucrose-containing medium comprises an amount of sucrose that is sufficient to enable convert the sucrose to levans, toxic to cells. Preferably, the medium contains between about 1 g / L to about 1 kg / L, for example between 10 g / L - 500 g / L, between 25 g / L -250 g / L, between 50 g / L – 150 g / L, more preferably about 100 g / L.
[0102] In another optional step and subsequent to step d), the fully segregated colonies, i.e., the (population of) engineered cell(s)-of-interest comprising the engineered native-cryptic plasmid according to the invention, may be validated by using conventional methods in the art, such as colony PCR and optionally Sanger sequencing of the PCR product.
[0103] The introduction of the heterologous gene in the bacterial cell of interest, preferably in a cell belonging to a strain of C. butyricum, does not take place chromosomally. Thus, the chromosomes of the bacterial cell of interest is not mutated and / or affected during the engineering of the bacterial cell of interest to express a heterologous gene.
[0104] It is preferred that the engineered native-cryptic plasmids obtained and according to the invention do not comprise an antibiotic-resistant marker. It is contemplated without being bound by theory that the antibiotic-resistant marker, e.g., the Cm / Tm-resistant marker present on the suicide plasmid is eliminated as a result of the elimination of the suicide plasmid by exposure (of the cells) to sucrose.
[0105] Thus, in particular embodiments, the invention pertains to an engineered cryptic plasmid derived from C. butyricum DSM 10702 engineered to comprise a heterologous gene, wherein the cryptic plasmid is pCB101 or pCB102, wherein the heterologous gene is located between a first ORF and a second ORF in the DNA of the engineered cryptic plasmid, wherein the native-cryptic plasmid of C. butyricum DSM 10702 is engineered by using a SacB-based allelic exchange method, said method at least comprising the steps of: a) Constructing a suicide plasmid, suitable for SacB-based allelic exchange, comprising upstream and downstream fragments suitable for insertion of the heterologous gene in the native-cryptic plasmid and comprising a heterologous gene, from a suicide backbone vector, which contains a SacB gene, via ligation of the upstream and downstream fragments and heterologous gene in said vector. b) Transforming the suicide plasmid containing the heterologous gene into a host bacterial cell via a conventional method. c) Conjugating the host bacterial cells with a bacterial cell of interest to facilitate the transferring of the suicide plasmid containing the heterologous gene of the host bacterial cell to the bacterial cell of interest. d) Allowing integration of the suicide plasmid in the native-cryptic plasmid of the bacterial cell of interest. e) Contacting the bacterial cells of interest with a sucrose-containing culture medium to select for and obtain engineered cryptic plasmids according to the invention and / or bacterial cells of interest comprising engineered cryptic plasmids according to the invention.
[0106] As previously indicated, another aspect of the invention corresponds to an engineered bacterial cell of a strain of C. butyricum comprising the engineered cryptic plasmid as broadly described herein. It is understood that an engineered bacterial cell of a strain of C. butyricum means that it comprises at least one engineered cryptic plasmid, preferably selected from pCB101 and pCB102, according to the invention. It is contemplated that in said engineered bacterial cell wildtype native-cryptic plasmids remain present after performing of the SacB-based allelic exchange method. In other words, by using the methods as previously described cells of a strain of C. butyricum could be engineered by at least partially engineering the native-cryptic plasmids in C. butyricum and retaining wildtype native-cryptic plasmids of said strain of C. butyricum in the cell. In preferred embodiments, the strain of C. butyricum is the strain C. butyricum DSM 10702.
[0107] As broadly described herein, the heterologous nucleic acid is located in the engineered cryptic plasmid. Accordingly, the heterologous nucleic acid is not located in a chromosome of the engineered bacterial cell.
[0108] Also, another aspect of the invention is a population of engineered bacterial cells as provided herein. In some embodiments, said population is from continuous subculture. Subculturing (or passaging) of cells comprises the transferring of cells grown in a culture vessel to a new vessel, thereby largely maintaining the cell culture on a continuous basis. The inventors found that the engineered cryptic plasmids and methods according to the invention enabled the engineered bacterial cells to stably overexpress heterologous genes after multiple subcultures, e.g., after 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. As exemplified herein, the inventors found that the engineered bacterial cells secreted stable levels heterologous proteins expressed by the heterologous genes after more than 5, in some instances even more than 20 subcultures. In other words, the subculturing of the engineered cells did not substantially affect the expression of heterologous genes.
[0109] In preferred embodiments, the population of engineered bacterial cells is from a strain of C. butyricum DSM 10702.
[0110] In some embodiments, the population of cells obtained as a result of the SacB- based allelic exchange method as described herein comprises that at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, preferably at least most of the cells comprised in said population, such as at least, 51%, 55%, 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80% 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the cells of said population comprise an engineered cryptic plasmid according to the invention, more preferably that comprise an engineered cryptic plasmid according to the invention and do not comprise wild- type native-cryptic plasmids of said bacterial cell anymore.
[0111] As previously described herein, the disclosure also provides for methods for producing an engineered cryptic plasmid in accordance with the invention, by integrating a heterologous nucleic acid in the DNA of a cryptic plasmid derived from C. butyricum using SacB-based allelic exchange method. The SacB-based allelic exchange method is known in the art and is broadly described herein as a method for obtaining engineered cryptic plasmids and / or engineered bacterial cells in accordance with the current invention.
[0112] As previously described herein, the disclosure also provides for a method for producing an engineered bacterial cell of the species Clostridium butyricum in accordance with the invention, by transferring the engineered cryptic plasmid of the invention from a host bacterial cell to a bacterial cell of the species C. butyricum.
[0113] In preferred embodiments, the method is substantially free from the use of at least one of: non-native plasmids, antibiotic-based vectors, antibiotic-marker vectors. Consequently, the engineered cryptic plasmid and / or engineered bacterial cell of a species of C. butyricum according to the current invention is substantially free, if not completely free, from any antibiotic, preferably from antibiotic-based vectors and / or antibiotic-marker vectors. In other words, the inventors found that the gene overexpression in the engineered bacterial cell of the current invention is substantially free from the use of at least one of: non-native plasmids, antibiotic-selective vectors, antibiotic-marker vectors and antibiotics.
[0114] In one further aspect there is provided for a bacterial cell of the species Clostridium butyricum obtained by the method for producing an engineered bacterial cell of the species Clostridium butyricum as described herein. Preferably, the bacterial cell / cells of the species Clostridium butyricum is engineered Clostridium butyricum and comprise the engineered cryptic plasmids according to the invention. Preferably, the bacterial cell / cells of the species Clostridium butyricum is of the strain DSM 10702. The bacterial cell / cells of the species Clostridium butyricum obtained by the method of the invention is understood to be recognizably different from wild-type bacterial cell / cells of the species Clostridium butyricum, and therefore is regarded as engineered bacterial cell / cells of the species Clostridium butyricum, in that the cell / cells comprise engineered cryptic plasmids that are different from native-cryptic plasmids of said Clostridium butyricum in that these engineered cryptic plasmids comprise a heterologous gene. It is understood that the difference may be observed by a skilled person using methods known in the art.
[0115] Using methods known in the art such as Congo red staining, ELISA etc. for the quantification of the secretion of the protein produced by the heterologous gene comprised in the engineered cryptic plasmid may be used to confirm the presence of a the engineered cryptic plasmid according to the invention in the Clostridium butyricum obtained by using methods as provided herein. Other methods used to confirm the presence of the engineered cryptic plasmid according to the invention in the Clostridium butyricum obtained by using methods as provided herein may be analysing gene expression levels with IR fluorescent methods or other methods known in the art for quantification of gene expression levels, or methods for determining plasmid constructs such as colony PCR.
[0116] In a final aspect there is provided for uses of the engineered bacterial cell as described herein or for uses of the population of engineered bacterial cells as described herein production of proteins. As disclosed herein, the heterologous gene that is comprised in the engineered cryptic plasmid according to the invention may be any gene, e.g., any nucleotide sequence encoding a heterologous protein. Thus, it is contemplated that the engineered bacterial cell according to the invention may be utilized as expression system for any heterologous protein. Preferably, the heterologous gene encoding the protein comprises between more than 0 and at most 25.000 nucleotides. It is contemplated that a heterologous gene having between 100 – 20.000 nucleotides is highly suitable for insertion in any one of the engineered cryptic plasmids according to the invention. In some preferred embodiments the nucleic acid representing the heterologous gene comprises between 750 – 3000 nucleotides, preferably about 2000 nucleotides. Thus, it is preferred that the protein comprises an amino acid sequence having a length between at least more than 0 and at most about 9.000 amino acids. It is preferred that said proteins for industrial and / or medical applications.
[0117] Preferably, the proteins are cellulases or cytokines. In more preferred embodiments, amino acid sequences representing proteins encoded by any one of the nucleotide sequences of SEQ ID NO: 8 – 11 are herein produced.
[0118] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art (including the contents of the references cited herein), readily modify and / or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein.
[0119] All references cited herein, including journal articles or abstracts, published or corresponding patent applications, patents, or any other references, are entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited references. Additionally, the entire contents of the references cited within the references cited herein are also entirely incorporated by references.
[0120] It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one of ordinary skill in the art.
[0121] It will be understood that all details, embodiments and preferences discussed with respect to one aspect of embodiment of the invention is likewise applicable to any other aspect or embodiment of the invention and that there is therefore not need to detail all such details, embodiments and preferences for all aspect separately. Having now generally described the invention, the same will be more readily understood through reference to the following examples which is provided by way of illustration and is not intended to be limiting of the present invention. Further aspects and embodiments will be apparent to those skilled in the art. EXAMPLES
[0122] This example is one non-limiting demonstration of the current invention.
[0123] The objective of the study in this example shows that heterologous genes can be integrated into the native-cryptic plasmids pCB101 and pCB102 derived from C. butyricum DSM10702 through SacB-based allelic exchange, enabling stable expression of heterologous genes in C. butyricum engineered with the engineered cryptic plasmids. The counter-selectable marker SacB was utilized for the allelic exchange. The reporters IFP2.0 and glucuronidase (GusA) were integrated in the native-cryptic plasmids by way of example for successful integration of heterologous genes. It was herein demonstrated by way of example for potential industrial and medical applications that the engineered C. butyricum expressed a secreted cellulase, Cel9M, and a secreted human interleukin 10 (hIL10). Material and methods E. coli 10-^ and S17-1 strains were employed for plasmid construction and bacterial conjugation, respectively. E. coli strains harboring plasmids were routinely cultured in lysogeny broth (LB) or on 1.5% (wt / vol) agar plates supplemented with 12.5 or 25 µg / mL chloramphenicol (Cm). C. butyricum DSM10702 was procured from the DSMZ- German Collection. Unless specified otherwise, C. butyricum strains were cultivated in peptone yeast thioglycolate (PYT) medium (Kubiak et al., 2021) supplemented with 10 g / L D-glucose (PYTG), or on 1.5% (wt / vol) agar plates. Optionally, appropriate antibiotics [250 µg / mL D-cycloserine, 17 to 102 µg / mL thiamphenicol (Tm), and 15 µg / mL erythromycin] or an inducer of 96 ng / mL anhydrotetracycline were incorporated into the PYTG. Additionally, PYT supplemented with 100 g / L sucrose (PYTS) was employed for SacB-based counter-selection. The pH of all C. butyricum media was adjusted to 7.5, and cultures were maintained at 37°C in an anaerobic chamber (MG1000 Mark II, 27 Don Whitley, UK; 80% N2, 10% CO2, and 10% H2). Plasmids construction and transformation The plasmids employed in this study are outlined in Table 1. Table 1: Plasmids Plasmids Description Sources pGG2121 Golden Gate assembling and E. coli - (Zhang et al., Clostridium shuttle vector, Cmr, Gram−2022) replicon p15a, Gram+replicon pBP1 pPIPL12-FnCas12a Entry vector with tetracycline-Inducible (Zhang et al., expression of FnCas12a in E. coli and 2023) clostridia, ErmrpPfetFn-Target_v2 Entry vector with gRNA expression for (Zhang et al., FnCas12a in E. coli and clostridia, Cmr2023) pGG2121-IFP2.0 pGG2121 ligated with the Pfdx promoter, (Zhang et al., and the IFP2.0 gene 2023) pGG2121-gusA pGG2121 ligated with the Pfdx promoter, (Zhang et al., and the gusA gene 2022) pGG3121 Golden Gate assembling and E. coli - Current Clostridium shuttle vector based on disclosure pGG2121 and pGG3221 (Zhang et al., 2023), Cmr, Gram−replicon p15a, Gram+replicon PCB102 pGG2121-cel9M pGG2121 ligated with the Pfdx promoter, Current and the cel9M gene with ATT start codon disclosure pGG2121-hIL10 pGG2121 ligated with the Pfdx promoter, Current the SpnprM3 signal peptide with ATT start disclosure codon, and the hIL10 gene pGG121SacB The suicide backbone vector based on Current pPfetFn-Target_v2, Cmr. Nucleic acid disclosure sequence of this suicide vector is shown in SEQ ID NO: 7. pGG121SacB- pGG121SacB ligated with the homology Current TpCB101-IFP2.0 arms of the pCB101 and the IFP2.0 gene disclosure expression cassette pGG121SacB- pGG121SacB ligated with the homology Curfrent TpCB102-IFP2.0 arms of the pCB102 and the IFP2.0 gene disclosure expression cassette pGG121SacB- pGG121SacB ligated with the homology Current TpCB101-GusA arms of the pCB101 and the gusA gene disclosure expression cassette pGG121SacB- pGG121SacB ligated with the homology Current TpCB102-GusA arms of the pCB102 and the gusA gene disclosure expression cassette pGG121SacB- pGG121SacB ligated with the homology Current TpCB101-hIL10 arms of the pCB101 and the hIL10 gene disclosure expression cassette pGG121SacB- pGG121SacB ligated with the homology Current TpCB102-hIL10 arms of the pCB102 and the hIL10 gene disclosure expression cassette pGG121SacB- pGG121SacB ligated with the homology Current TpCB102-Cel9M arms of the pCB102 and the cel9M gene disclosure expression cassette pPfetFn- pPfetFn-Target_v2 ligated with the donor Current IncbPyrE::hIL10 DNA template and target for chromosomally disclosure integrating the hIL10 expression cassette into C. butyricum PyrE loci pPfetFn-Incb::Cel9M pPfetFn-Target_v2 ligated with the donor Current DNA template and target for chromosomally disclosure integrating the Cel9M expression cassette into C. butyricum The E. coli-Clostridium shuttle vector pGG2121, utilized for Golden Gate assembly, and the gusA-expressing plasmid pGG2121-gusA were previously constructed (Zhang et al., 2022). Additionally, the CRISPR-Cas12a system, comprising two entry vectors, namely pPIPL12-FnCas12a and pPfetFn-Target_v2, along with the IFP2.0-expressing plasmid pGG2121-IFP2.0, were previously generated (Zhang et al., 2023). A new E. coli-Clostridium shuttle vector, pGG3121, was derived from pGG2121 and pGG3221 through restriction enzyme-based cloning procedures. The primer sequences and codon-optimized gBlock fragments were synthesized by Integrated DNA Technologies. Employing Golden Gate assembly (BsaI-HFv2, NEB), the gBlock fragments and the promoter Pfdx were ligated into pGG2121, yielding the hIL10- expressing plasmid pGG2121-hIL10 and the cel9M-expressing plasmid pGG2121- cel9M. Table 2: Primer sequences for integration into the cryptic plasmids Primers NA sequence SEQ ID NO: Description pCB101-F TCCAAAACGGAATATAAACGCT 12 Colony PCR for the integrations pCB101-R TTACACTTTGGCAGACCTTGTG 13 into the pCB101 pCB102-F GAATTGGAATGATATTGCACAG 14 Colony PCR for pCB102-R ACGCTGATGGGCTAGAAGGAGT 15 the integrations into the pCB102 For the construction of the suicide backbone vector pGG121SacB, the pPfetFn- Target_v2 vector underwent initial digestion with NotI and FseI restriction enzymes to remove the gram-positive replicon, followed by purification of a 4.0 kb fragment as the backbone. Subsequently, a multiple cloning site fragment containing BsaI Golden Gate sites was amplified from the pGG2121 vector using primer pair MCS-F-NotI / MCS-R- FseI, and digested with NotI and FseI restriction enzymes. The multiple cloning site fragment was then ligated into the backbone using T4 DNA ligase, yielding the pGG121SacB vector. To integrate gene expression cassettes into the native-cryptic plasmids, a series of suicide plasmids (pGG121SacB-TpCB101-IFP2.0, pGG121SacB-TpCB102-IFP2.0, pGG121SacB-TpCB101-GusA, pGG121SacB-TpCB102-GusA, pGG121SacB- TpCB101-hIL10, pGG121SacB-TpCB102-hIL10, and pGG121SacB-TpCB102-Cel9M) were constructed using a similar process. Fragments of upstream and downstream sequences were amplified as detailed in Table 3. Expression cassette fragments were then amplified from derivative vectors of pGG2121 using the primer pair Uni-F- BsaI / Uni-R-BsaI. Finally, the fragments of upstream, downstream, and expression cassettes were ligated into the pGG121SacB vector via Golden Gate assembly. Table 3: Amplification primers (restriction sites are underlined) Primer NA Sequence SEQ ID NO: Description pCB101- GGTCTCCTCCATCATTTTTTTAAATATC 16 Amplifying U-F- CTCCC the upstream BsaI fragment for pCB101- GGTCTCCCCTCTTAAAAGAAAATTTCTT 17 the pCB101 U-R- CAATAGT BsaI pCB101- GGTCTCTCTGAATAAAAGAGATAGAAA 18 Amplifying D-F- TTTTCTAC the BsaI downstream pCB101- GGTCTCCGTCTAATAAAAGAGATTCTA 19 fragment for D-R- TTTCTTTC the pCB101 BsaI pCB102- GGTCTCCTCCAATGGCAGATATTAAAG 20 Amplifying U-F- CAACA the upstream BsaI fragment for pCB102- GGTCTCCCCTCCTACTTTTCTGTTTTTC 21 the pCB102 U-R- TTGTAGC BsaI pCB102- GGTCTCTCTGAAAATTTAACTTAATTAT 22 Amplifying D-F- TATAAATACTAAACAAAAG the BsaI downstream pCB102- GGTCTCCGTCTGATCTAAACTAGTAAC 23 fragment for D-R- TGATGCT the pCB102 BsaI For integration of gene expression cassettes into the C. butyricum chromosome, the pPfetFn-IncbPyrE::hIL10 and pPfetFn-Incb::Cel9M plasmids were constructed as described previously for the CRISPR-Cas12a system (Zhang et al., 2023). Then, verification of the C. butyricumINcel9M and C. butyricumINhIL10 mutations was conducted through colony PCR, utilizing the CB_IN-F / CB_IN-R and c.bPyrE-F / M13-R primer pairs, respectively. All plasmids were verified via Sanger sequencing (GENEWIZ) and were transformed into E. coli S17-1 via heat shock. Subsequently, bacterial conjugation facilitated plasmid transformation into C. butyricum, as previously outlined (Zhang et al., 2023). Integrations into native-cryptic plasmids in C. butyricum Following bacterial conjugation, the trans-conjugants harboring the suicide plasmid were plated onto PYT agar plates supplemented with 34 µg / mL Tm. Colonies obtained were subsequently streaked onto fresh PYT agar plates containing escalating concentrations of Tm (34, 51, 68, 85, and 102 µg / mL). Screening for mixed or complete segregations was carried out through colony PCR utilizing the pCB101-F / pCB101-R and pCB102-F / pCB102-R primer pairs. Upon observation of segregations, the resulting colonies were cultured overnight in PYTS media to facilitate the curing of the suicide plasmid. The cultures were then plated onto PYTS agar plates. Finally, fully segregated colonies were validated via colony PCR and subsequent Sanger sequencing of the PCR product. Evaluation of the stability of plasmids and heterologous genes upon continuous subcultures and the growth capacity of strains
[0124] To test plasmid and gene stability in C. butyricum, cultures were continuously sub-cultured in fresh media (2%, v / v). Plasmid stability was assessed by colony counts on agar plates with and without antibiotics. Gene expression levels were measured for IFP2.0 and GusA via near infrared (NIR) fluorescence and enzyme activity assays, respectively, as previously described (Zhang et al., 2022; Zhang et al., 2023). The endoglucanase activity from Cel9M secretion was evaluated through the Congo red method as previously described (Mingardon et al., 2011). Cel9M protein samples in the pellets and supernatants were prepared and reduced as previously described, then separated on a Bis-Tris protein gel (NP0327BOX, Thermo Fisher), followed by Coomassie staining via manufacturer instructions (Brilliant blue R, B0149, Sigma). All images were captured using the Azure 600 Imaging System (Azure Biosystems). The hIL10 secretion was quantified using an enzyme-linked immunosorbent assay (ELISA, 88-7106, Thermo Fisher) as per the manufacturer’s instructions. The chloroform-methanol method (Wessel & Flügge, 1984) was used for the precipitation of hIL10 protein samples in supernatants due to the pH-sensitivity of hIL10. All hIL10 protein samples and recombinant human IL10 (rhIL10, ab284660, abcam) were reduced by 0.1 M dithiothreitol (20290, Thermo Fisher), then separated on a Bis-Tris protein gel (NP0323BOX, Thermo Fisher). The primary antibody diluted at 1:1000 (anti-IL-10 antibody, EPR1114, abcam) and the secondary antibody diluted at 1:2500 (horseradish peroxidase-conjugated anti-rabbit IgG antibody, W4011, Promega) were used for the Western blotting analysis described previously.
[0125] Growth capacity was determined by measuring optical density at 600 nm (OD600) at various time points (2, 4, 6, 8, 10, and 24 hours), and optionally, pH or protein activity was evaluated simultaneously. Additionally, CB_WT and pCB102- cel9M cultures were grown in media supplemented with 0.1 g / L carboxymethyl cellulose (CMC) sodium salt, and their OD600 was recorded after 24 hours. Bioassays for secreted hIL10
[0126] To assess the hIL10 bioactivity secreted by C. butyricum, peripheral blood mononuclear cell (PBMC) isolated from healthy volunteers were obtained from the University Hospital RWTH Aachen (Germany) and cryopreserved in freezing medium containing 50% (v / v) FBS, 40% (v / v) RPMI 1640, and 10% (v / v) dimethyl sulfoxide. THP1-Dual™ cells were purchased from InvivoGen for interferon / interferon-stimulated gene (IFN / ISG) response analysis. Overnight cultures of C. butyricum containing pGG2121 and pGG2121-hIL10 plasmids were sub-cultured into fresh PYTG media (2%, v / v). When reaching OD600= 1.0, their supernatants were harvested via centrifugation. These supernatants, along with single fresh PYTG media and the commercially bioactive rhIL10 dissolved PYTG media (20 ng / mL), were filtered (0.22 μm) and stored at -80 ºC for bioassays.
[0127] For the PBMC proliferation assay, thawed PBMCs were recovered in pre- warmed and supplemented RPMI 1640 medium containing 10% (v / v) heat-inactivated FBS, 25 mM HEPES, 1% (v / v) L-glutamine, 1% (v / v) non-essential amino acids, 100 U / ml penicillin, and 100 ng / ml streptomycin for two hours at 37 ºC. Subsequently, PBMCs were counted using the cell counter (DeNovix), and approximately 2 × 105cells in 100 µL were adjusted and added per well of a 96‐well plate, with and without the addition of 5 µg / mL phytohemagglutinin-L (PHA-L, 00-4977-03, Thermo Fisher). Following 24-hour incubation at 37°C under 5% CO2, PHA-L-stimulated cells were treated with the thawed supernatants of 100 µL [20% (v / v) in fresh supplemented medium], while PHA-L-stimulated cells with only the medium served as the positive control. The negative control comprised unstimulated cells with only the medium. After an additional 48-hour incubation under the same conditions, cell proliferation was measured using the cell counting kit 8 (WST-8, ab228554, Abcam). The proliferation ratio (%) of stimulated PBMCs was calculated by dividing the absorbance of treated or untreated-stimulated cells by that of the negative control. For the IFN / ISG response in THP-1 cells, THP1-Dual™ cells were stimulated with 100 ng / mL lipopolysaccharides (LPS) from E. coli K12 (Standard, InvivoGen) and simultaneously treated with 20% thawed supernatants (v / v in medium from the manufacturer) or left untreated with only the medium as the positive control. The negative control comprised untreated, unstimulated cells. Following the manufacturer’s instructions, the IFN / ISG response was measured, and the fold change was calculated by dividing the value of treated or untreated-stimulated cells by that of the negative control. Statistical analysis
[0128] Statistical analyses were conducted employing GraphPad Prism 9 software. The two-way or ordinary one-way ANOVA was utilized with the Šidák multiple comparison test. Significance levels were determined at p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, denoted by *, **, ***, and ****, respectively. Results The SacB-based allelic exchange method enables gene integration into native- cryptic plasmids.
[0129] We constructed a suicide backbone vector named pGG121SacB containing both a Cm / Tm-resistant marker (CatP) and a sucrose-sensitive marker (SacB), as illustrated in Fig. 2a. Before integrating the gene expression cassette, selecting appropriate integration sites in pCB101 and pCB102 is desirable to avoid potential interference with their functions within the cell. We selected the region between two open reading frame (ORF) ends as the integration site, considering the undefined promoter regions in front of the ORFs. In this work, we utilized the IFP2.0 gene, encoding a NIR fluorescent reporter. The IFP2.0 expression cassette, along with homology arms of 0.8–1.0 kb (U and D), was ligated into pGG121SacB, yielding two suicide plasmids, pGG121SacB-TpCB101-IFP2.0 and pGG121SacB-TpCB102-IFP2.0 (Fig. 2b). As depicted in Fig. 2c, following bacterial conjugation, the natural occurrence of a single crossover may integrate the suicide plasmid into the native-cryptic plasmid, which can be selected using the Tm antibiotic. Subsequent exposure to sucrose may eliminate the suicide plasmid through the natural event of double crossover, resulting in either mutation or restoration of the native-cryptic plasmid.
[0130] Building upon previous optimizations of segregation conditions during engineering of native-cryptic plasmids in cyanobacteria (Armshaw et al., 2015), we employed glucose- free PYT media supplemented with a high concentration of Tm antibiotic for integration into native-cryptic plasmids in C. butyricum. For the pCB102-IFP2.0, we observed that with 34 µg / mL Tm, a few trans-conjugants contained both mutated and wild-type pCB102, indicating the potential occurrence of both single and double crossovers simultaneously within the cell, possibly due to the presence of multiple copies of the native-cryptic plasmid. Subsequently, these mixed trans-conjugants were streaked on new agar plates with 34 µg / mL Tm, and colony PCR confirmed complete segregation of the pCB102 mutation (Fig. 3a). Following the addition of 100 g / L sucrose, the overnight culture of these colonies was serially diluted and plated, resulting in the isolation of C. butyricum_pCB102-IFP2.0 mutations (termed pCB102-IFP2.0) confirmed through their inability to grow under 17 µg / mL Tm (Fig. 6) and Sanger sequencing. In contrast, trans-conjugants obtained using pGG121SacB-TpCB101-IFP2.0 hardly exhibited a mixture of pCB101. Subsequent streaking of the cells on agar plates with increasing concentrations of Tm (34, 51, 68, 85, and 102 µg / mL) revealed colonies containing both mutated and wild-type pCB101 at 85 µg / mL Tm (Fig.3a). However, complete segregation of the pCB101 mutation could not be achieved even with further screening on a new agar plate with 102 µg / mL Tm. Following the addition of 100 g / L sucrose, colony PCR confirmed complete segregation of the pCB101 mutation or wild type. Subsequent confirmation through their inability to grow under 17 µg / mL Tm (Fig. 6) and Sanger sequencing led to the isolation of C. butyricum_pCB101- IFP2.0 mutations (termed pCB101-IFP2.0). These results illustrate the feasibility of engineering native-cryptic plasmids in C. butyricum DSM 10702 through SacB-based allelic exchange. The IFP2.0 reporter within native-cryptic plasmids exhibits sustained NIR fluorescence across continuous subcultures.
[0131] To assess IFP2.0 expression levels mediated by these plasmids and their stability in C. butyricum DSM 10702, ten consecutive subcultures were conducted. At each 6-hour time point, NIR fluorescence intensity (660 / 730 nm Ex / Em) was measured in the subculture and normalized against OD600. Control strains included C. butyricum DSM 10702 harboring the empty antibiotic-selective vector pGG2121 (termed Empty) and previously engineered strains with IFP2.0 integrated into the chromosome (Zhang et al., 2023) (termed CB_INIFP2.0). Notably, without antibiotic supplementation, C. butyricum DSM 10702 expressing IFP2.0 via the antibiotic-selective vector (termed pGG2121-IFP2.0) exhibited a gradual decrease in NIR fluorescence intensity over multiple subcultures, with a roughly 17- fold reduction compared to the original intensity (Fig.3b). Concurrently, both pGG2121 and pGG2121-IFP2.0 plasmids were gradually lost during continuous subcultures (Fig.3c). It is worth mentioning that the stability of the antibiotic-selective vector can vary depending on the used replicons and Clostridium spp. (Joseph et al., 2018), and given the origin of the pBP1 replicon from Clostridium botulinum in the pGG2121 vector, it was substituted with the PCB102 replicon from C. butyricum DSM 10702. However, the resultant pGG3121 vector was nearly lost after just two subcultures without antibiotics (Fig.3c), indicating the potential instability of antibiotic-selective plasmids in C. butyricum DSM 10702 in the absence of antibiotics.
[0132] Furthermore, NIR fluorescence intensity remained consistently low in CB_INIFP2.0 throughout subcultures, whereas pCB102-IFP2.0 exhibited stable and intense fluorescence, approximately four times higher than CB_INIFP2.0 by the tenth subculture. Similarly, pCB101-IFP2.0 maintained strong fluorescence throughout subcultures, albeit with some variability, and by the tenth subculture, exhibited approximately 3.5-fold and 16- fold higher intensity than pCB102-IFP2.0 and CB_INIFP2.0, respectively (Fig. 3b), suggesting a high copy number of pCB101 in C. butyricum DSM 10702. Importantly, the elevated IFP2.0 expression in pCB101-IFP2.0 strains led to growth inhibition compared to the pCB102-IFP2.0 and wild type C. butyricum DSM 10702 (termed CB_WT) (Fig. 3d), underscoring the impact of pCB101-mediated IFP2.0 overexpression on cellular physiology. These findings highlight the ability of two native-cryptic plasmids, pCB101 and pCB102, to sustain IFP2.0 overexpression throughout continuous subcultures in C. butyricum DSM 10702. The glucuronidase reporter in pCB102 consistently displays high enzyme activity through continuous subcultures.
[0133] To verify the functionality of native-cryptic plasmids in C. butyricum DSM 10702 across different heterologous gene contexts, we aimed to integrate an expression cassette containing the GusA reporter (~2.1 kb) into these plasmids. Following a similar procedure as for generating the pCB102-IFP2.0, we obtained the C. butyricum_pCB102-gusA mutation (termed pCB102-gusA) (see Fig.4a).
[0134] Subsequently, continuous sub-culturing was performed five times. At each OD600value of 1.0, samples of the cell culture were collected and subjected to GusA assays. The Empty was used as a control, and previously constructed chromosome-integrated GusA- expressing C. butyricum DSM 10702 (termed CB_INgusA) served as a reference. As illustrated in Fig. 4b, in the absence of antibiotics, C. butyricum DSM 10702 expressing GusA via the antibiotic-selective vector (termed pGG2121-gusA) exhibited a continuous decline in GusA activity with each subculture. Compared to the original culture, a roughly 31-fold decrease in GusA activity was observed after the fifth subculture. The results regarding the plasmid stability in C. butyricum revealed a progressive loss of pGG2121- gusA with continuous subcultures (Fig.3c). Compared to plasmids pGG2121-IFP2.0 and pGG2121, pGG2121-gusA exhibited a faster loss of plasmid, indicating that the stability of antibiotic-selective plasmids in C. butyricum depends on the gene context. Additionally, both CB_INgusA and pCB102-gusA displayed stable GusA activity through sub-culturing, with pCB102-gusA showing approximately 6.5-fold higher GusA activity than CB_INgusA after the fifth subculture. These findings demonstrate that heterologous GusA can be stably overexpressed via the native-cryptic plasmid pCB102 in C. butyricum DSM10702. Secreted expression of Cel9M via pCB102 confers stable endoglucanase activity.
[0135] To explore the potential industrial applications, we aimed to engineer C. butyricum for the secretion of a family 9 cellulase, Cel9M, derived from Clostridium cellulolyticum. The cel9M gene, previously characterized, contains its native signal peptide sequence and encodes the secreted Cel9M cellulase in C. cellulolyticum, demonstrating effective hydrolysis activity on CMC (Belaich et al., 2002). In this study, we utilized the ATT start codon in the cel9M gene (ATT_cel9M) to mitigate potential cloning issues reported previously. Subsequently, C. butyricum DSM 10702 secreting Cel9M via the antibiotic- selective vector (termed pGG2121-cel9M) was generated. Following integration of the Cel9M expression cassette (~1.8 kb) into both the pCB102 plasmid (Fig. 4c) and the chromosome of C. butyricum DSM 10702 (Fig.7), we obtained the C. butyricum_pCB102- cel9M strain (termed pCB102-cel9M) and the Cel9M chromosome-integrated C. butyricum DSM 10702 strain (termed CB_INcel9M).
[0136] Subsequent to the first subculture, the supernatants from cultures of pGG2121- cel9M, pCB102-cel9M, and CB_INcel9M (at OD600= 1.5) exhibited significant endoglucanase activity on CMC plates, while the supernatants from PYTG media and the control strain CB_WT did not (Fig.4d and Fig.7). Notably, the supernatant from pGG2121- cel9M lost its endoglucanase activity on CMC plates after twenty subcultures, whereas both pCB102-cel9M and CB_INcel9M retained stable endoglucanase activity (Fig. 4d). Furthermore, the culture supernatants of pCB102-cel9M showed enhanced endoglucanase activity compared to CB_INcel9M. Coomassie staining analysis (Fig. 4e) confirmed the changes and indicated the presence of secreted Cel9M cellulase with a molecular weight of approximately 50 kDa. These findings demonstrate that Cel9M expression via the pCB102 plasmid confers stable endoglucanase capacity in C. butyricum. Additionally, we observed no significant change in the 24-hour OD600for pCB102-cel9M or CB_WT when supplied with 0.1 g / L CMC (Fig. 4f), suggesting that the presence of CMC and Cel9M reducing sugars cannot be utilized for the growth of C. butyricum strains. Synergistic effects with other cellulases (Contreras et al., 2020), may enhance the utilization of complex carbon sources for industrial applications in C. butyricum. Recombinant C. butyricum was engineered to achieve stable secretion of bioactive hIL10 from pCB102.
[0137] For potential medical applications involving immune regulation, hIL10 was chosen as a potent anti-inflammatory cytokine (Saxena et al., 2015) to enhance the probiotic capacity of C. butyricum DSM 10702. To accomplish this, a plasmid construct, pGG2121- hIL10, was generated as described previously by ligating the ATT start codon-containing signal peptide sequence derived from the nprM3 gene in C. sporogenes, the Pfdx promoter, and the codon-optimized hIL10 gene into the pGG2121 vector. Subsequently, two strains were created: one with hIL10 integrated into the chromosome of C. butyricum DSM 10702 (termed CB_INhIL10, Fig. 7) and another strain carrying the hIL10-expressing plasmid pCB102 (termed pCB102-hIL10, Fig. 5a). Upon continuous sub-culturing for twenty generations, the levels of secreted hIL10 were monitored at the first and twentieth subcultures (at OD600= 1.0). Initially, the pGG2121-hIL10 strain exhibited higher hIL10 production compared to the pCB102-hIL10 and CB_INhIL10 strains. However, after successive sub-cultures, pGG2121-hIL10 showed a disappearance in hIL10 production, while no significant changes were observed in hIL10 secretion for pCB102-hIL10 and CB_INhIL10 (Fig.5b). Western blot analysis confirmed the changes and efficient secretion of recombinant hIL10, which appeared as a band with a size slightly above 17 kDa in the culture supernatant with minimal intracellular accumulation (Fig.5c).
[0138] To assess the bioactivity of secreted hIL10, supernatants from the pGG2121-hIL10 strain (termed S_hIL10) containing a high amount of hIL10 production (approximately 23 ng / mL in the supernatant) were tested on PHA-L-stimulated PBMCs and LPS-stimulated THP-1 monocyte cells. Compared to the supernatant from the Empty (termed S_empty), the S_hIL10 led to less proliferation in the stimulated PBMCs and less IFN / ISG response in the stimulated THP-1. The result was comparable to commercially bioactive rhIL10 (Fig.5e and 5f) and corresponded to the known functions of IL10 (Castleab et al., 1999; Ito et al., 1999). Notably, the PYTG media used for culturing induced significant immune changes in the treated cells, potentially due to its immunogenic components like the used vegetable peptone (Lee et al., 2009). Furthermore, treatments with probiotic C. butyricum have been reported to induce IFN responses in vivo and in vitro (Hour-Young et al., 1987; Hua et al., 2010), as we observed in Fig.5f. Overall, these findings illustrate the successful secretion of bioactive hIL10 from C. butyricum, as well as its stable expression via pCB102. Conclusion
[0139] In this study, the SacB-based allelic exchange method facilitates efficient gene integration into pCB101 and pCB102 native-cryptic plasmids in C. butyricum DSM10702. Additionally, the IFP2.0 reporter in these plasmids shows persistent NIR fluorescence across successive subcultures. The GusA reporter in pCB102 consistently exhibits robust activity over multiple subcultures. Moreover, the ORFs identification in native-cryptic plasmids may enhance understanding of their stability mechanisms. Furthermore, the secretion of Cel9M and bioactive hIL10 from pCB102 underscores its utility in conferring stable enzyme activity and protein expression in engineered C. butyricum for industrial and medical biotechnologies.
Claims
CLAIMS 1. An engineered cryptic plasmid derived from C. butyricum engineered to comprise a heterologous gene.
2. The engineered cryptic plasmid according to Claim 1, wherein the engineered cryptic plasmid is derived from the strain C. butyricum DSM 10702.
3. The engineered cryptic plasmid according to Claim 2, wherein the engineered cryptic plasmid is selected from the group consisting of pCB101 and pCB102.
4. The engineered cryptic plasmid according to any one of the previous claims, wherein the heterologous gene is located between a first open reading frame and a second open reading frame in the genome of the engineered cryptic plasmid.
5. The engineered cryptic plasmid according to any one of the previous claims, wherein the engineered cryptic plasmid is obtained by inserting the heterologous gene in the DNA of a cryptic plasmid derived from C. butyricum using SacB based allelic exchange.
6. An engineered bacterial cell of a strain of C. butyricum comprising the engineered cryptic plasmid of any one of the previous claims.
7. The engineered bacterial cell according to Claim 6, wherein the heterologous nucleic acid is located in the engineered cryptic plasmid.
8. A population of engineered bacterial cells according to any one of Claims 6 or 7.
9. The population of engineered bacterial cells according to Claim 8, wherein said population is from a continuous subculture.
10. A method for producing an engineered cryptic plasmid according to any one of Claims 1 - 5 by integrating a heterologous gene in the DNA of a cryptic plasmid derived from C. butyricum using SacB-based allelic exchange method.
11. A method for producing an engineered bacterial cell of the species Clostridium butyricum according to any one of claims by transferring the engineered cryptic plasmid of any one of Claims 1 – 5, from a host bacterial cell to a bacterial cell of the species C. butyricum.
12. Clostridium butyricum obtained by the method according to any one of Claim 11.
13. Use of the engineered bacterial cell according to any one of Claim 6 or 7 or the population of engineered bacterial cells of Claim 8 or 9 for the production of proteins.
Citation Information
Patent Citations
Method of selection of allelic exchange mutants
US5843664A
High adhesion clostridium butyricum and its preparation method
CN103911337A