Loop reinforcement expression system for improved cell therapy products

Abstract

This invention pertains in general to, for example, T cell and NK cells for use as cell therapy products, for example in the treatment of a tumor in a patient suffering from cancer. The invention provides heterologous nucleic acids encoding cell surface expressed antigen receptors under the control of a promoter that is induced when the antigen receptor is activated, for example upon interaction between the antigen receptor and its cognate binding partner (antigen) expressed on a (tumor) cell.

Description

[0001] Title: Loop reinforcement expression system for improved cell therapy products

[0002] FIELD OF THE INVENTION

[0003]

[0001] This invention pertains in general to, for example, T cell and NK cells for use as cell therapy products, for example in the treatment of a tumor in a patient suffering from cancer.

[0004]

[0002] The invention provides heterologous nucleic acids encoding cell surface expressed antigen receptors (first nucleic acid part), such as CARs or T cell receptors, under the control of a promoter (second nucleic acid part) that is induced when the antigen receptor is activated, for example upon interaction between the antigen receptor and its cognate binding partner (antigen) expressed on a (tumor) cell, and, optionally, the heterologous nucleic acid further comprising a functional portion of an enhancer (third nucleic acid part), enhancing expression driven by the inducible promoter (second nucleic acid part).

[0005] BACKGROUND OF THE INVENTION

[0006]

[0003] The background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.

[0007]

[0004] Chronic activation of cell therapy products due to tonic signaling, or prolonged stimulation of activation receptors leads to differentiation of T cells from memory phenotype to effector phenotype, and into an exhausted state.

[0008]

[0005] For example, it has been demonstrated that seemingly “fit” CAR-engineered T cell products fail to control hematologic cancers in patients (Singh N. et al, Sci. Transl. Med. 2016;8:320ra3. doi: 10.1126 / scitranslmed.aad5222; Das R.K. et al. Cancer Discov. 2019;9:492-499. doi: 10.1158 / 2159-8290.CD-18-1314) and that higher disease burden increases the likelihood of therapeutic failure (Schultz L.M. et al. J. Clin. Oncol. 2022;40:945-955. doi: 10.1200 / JC0.20.03585).

[0009]

[0006] Studies that investigated the impact of persistent CAR stimulation have consistently demonstrated that chronic CAR activation, either through tonic signaling (Lynn R.C. et al. Nature. 2019;576:293-300. doi: 10.1038 / s41586-019-1805-z; Long A.H. et al. Nat. Med. 2015;21 :581-590. doi: 10.1038 / nm.3838) or via engagement with target antigen (Singh N. et al, Sci. Transl. Med. 2016;8:320ra3. doi: 10.1126 / scitranslmed.aad5222; Good C.R. et al. Cell. 2021 ; 184:6081-6100.e26. doi: 10.1016 / j. cell.2021 .11.016.) drives the onset of T cell dysfunction that mimics clinical CAR T cell failure.

[0010]

[0007] For example, it has been shown that that tonic CAR CD3Zeta phosphorylation, triggered by antigen-independent clustering of CAR, can induce early exhaustion of CAR T cells that limits anti-tumor efficacy (Long A.H. et al. Nat. Med. 2015;21 :581- 590. doi: 10.1038 / nm.3838)

[0011]

[0008] Less differentiated and less exhausted phenotypes are associated with improved T cell function; therefore, it is preferable to delay differentiation and exhaustion to maximize therapeutic potential of cell therapy products.

[0012]

[0009] It has been previously reported that tonic signaling induced exhaustion can be delayed by culturing cells in the presence of kinase inhibitors (dasatinib), or using a small molecule regulated engineered antigen receptor (e.g. ON CARs) and culturing such regulatable CAR-T cells at the OFF-state ex vivo (Weber et al. Science. 2021 Apr 2;372(6537):eaba1786).

[0013]

[0010] However, prevention of T cell activation in vivo using dasatinib leads to immunosuppression due to inhibition of kinases in T, B and NK cells. In addition, Weber et al. demonstrated that an ON CAR composed of a chimeric antigen receptor fused to a degron domain can be used to delay exhaustion and differentiation of such CAR-T cells, but the antigen signaling is not fully suppressed at the OFF state (see Figure 1 B and 1 D of the reference Weber et al. Science. 2021 Apr 2;372(6537):eaba1786 where 40 % IFN gamma signaling remained in the absence of small molecule activator of the ON CAR, Shield-1).

[0014]

[0011] As such, remaining tonic CAR-T signaling can lead to accumulation of exhaustion and differentiated T cell phenotype, particularly in combination with CARs that are prone for self-aggregation and / or when such CAR antigens are also secreted and present in the serum. In such conditions, it would be desirable to prevent or reduce tonic signaling of CAR-T cells and / or activation of CAR-T cells due to antigen present in serum at low concentrations by additional mechanisms.

[0015]

[0012] In light of this, new products, compositions, methods and uses related to cell therapy products, such as CAR T cells or CAR NK cells, in the treatment of medical conditions such as cancer would be highly desirable but are not yet readily available.

[0013] In particular, there is a clear need in the art for reliable, efficient, and reproducible products, compositions, methods and uses that delay or prevent unwanted premature differentiation of (engineered) cells from a memory phenotype to an effector phenotype, and / or that delay or prevent unwanted premature exhaustion of such (engineered) cells, e.g. T cells and / or NK cells, (e.g. T cell exhaustion and / or NK cell exhaustion), and that are useful in the treatment of medical conditions such as cancer.

[0016]

[0014] Accordingly, a technical problem underlying the present invention can been seen in the provision of such products, compositions, methods and uses for complying with any of the aforementioned needs, or at least providing the public with a useful choice. The technical problem is solved by the embodiments characterized in the claims and herein below. / pct SUMMARY OF THE INVENTION

[0017]

[0015] As embodied and broadly described herein, the present invention is directed to the surprising finding that differentiation and exhaustion of cell therapy products, in particular of immune cells, such as T cells and NK cell, can be delayed by modification of the cells.

[0018]

[0016] In particular it was found that cells modified to express an antigen receptor, such as a T cell receptor, a NK cell receptor, or a chimeric antigen receptor (e.g. in T cells or in NK cells) from a promoter than is induced (i.e. becomes active) when the antigen receptor that is expressed at the cell surface of the cell is activated, for example, upon binding of the antigen receptor with an antigen, shows delayed exhaustion in comparison to cell wherein the antigen receptor is not expressed from such inducible promoter but, for example, from a constitutive promoter.

[0019]

[0017] It was also surprisingly found that when, in addition to the inducible promoter, the cells are modified to include an enhancer, or functional part thereof, the enhancer, upon induction of the inducible promoter, further promotes or enhances transcription of the antigen receptor by the inducible promoter.

[0020]

[0018] It was found that the cells according to the invention display reduced baseline antigen receptor expression, for example in comparison to cells wherein the expression of the antigen receptor is not operably linked to an inducible promoter that is induced when the antigen receptor (on the cell surface of the cell) is activated. In other words, the cells according to the invention have reduced expression of the antigen receptor under conditions that the cell are not activated, thereby reducing, or preventing, for example, self-activation as the consequence of self-aggregation of the antigen receptors or the presence of low concentration of antigen in, for example, the environment of the cell, for example serum. It was surprisingly found that therewith premature differentiation and / or exhaustion of the cell, e.g. T cells is delayed or prevented.

[0021]

[0019] At the same time, the cell are able to respond to activation of the antigen receptor upon binding with its antigen, for example present at the cell surface of a cancer cell. Upon binding of an antigen with the antigen receptor, signaling as the consequence of the binding of the antigen with the antigen receptor induces transcription of the gene encoding the antigen receptor that is operably linked to the inducible promoter, preferably in the presence of the enhancer, and further activation of the cell, for example T cell.

[0022]

[0020] It was surprisingly found that a cell according to the invention with induced expression of an antigen receptor limit tonic (baseline) expression of the antigen receptor.

[0023]

[0021] At the same time, it was found that the cell according to the invention displays reduced tonic activation of the cells, for example T cells.

[0024]

[0022] It was also found that the cell according to the invention may display improved antigen expression upon activation of the cells, for example upon binding of the antigen receptor with its cognate antigen expressed on the cell surface of a cancer cells.

[0025]

[0023] It was also found that the cell according to the invention has improved functionality, for example T cell functionality. In other words, the cells according to the invention become more activated and are more effective towards, for example, cancer cells.

[0026]

[0024] It was also found that the cell according to the invention can display increased cytokine production as compared to cells wherein the antigen is not operably linked to an inducible promoter, but, for example, operably linked to another, for example, constitutive, promoter.

[0027]

[0025] It was also found that the cell according to the invention can display increased IFNg (interferon gamma) production as compared to cells wherein the antigen is not operably linked to an inducible promoter, but, for example, operably linked to another, for example, constitutive, promoter.

[0028]

[0026] It was also found that production of cytokine(s) and / or interferon gamma can be further boosted in the cell according to the invention by treatment of the cells with an immunomodulatory drug (IMiD) such as lenalidomide.

[0029]

[0027] The current invention thus allows for strict regulation of the expression of an antigen receptor and can prevent undesired or accidental expression of the antigen receptor. It also reduced or prevents accidental expression of the antigen receptor on the cell surface of cancer cells and subsequent antigen escape resulting from epitope masking (see, Short et al. Trends Pharmacol Sci. 2024 Apr 12:S0165-6147(24)00052- X).

[0030]

[0028] The current invention further allows to operably link further nucleic acids, encoding protein of interest to the inducible promoter. For example, the protein of interest may be a cytokine. In such case, the cell according to the invention displays low expression of the antigen receptor and the cytokine at baseline, i.e. low tonic expression, whereas but antigen receptor expression and production of the cytokine is induced upon activation of the antigen receptor, for example, upon binding with an antigen expressed on the cell surface of a cancer cell.

[0031]

[0029] It was also found that preferably the enhancer (of functional part thereof) comprises the consensus motif CGCCATNTT, wherein N stand for any base selected from C, G, A and T, preferably CGCCATTTT.

[0032]

[0030] It was also found that preferably the enhancer is a viral enhancer, a T-cell specific enhancer, a NK-cell specific enhancer, a lymphocyte-specific enhancer, a U3 LTR enhancer, a lentiviral U3 LTR enhancer, a retroviral U3 LTR enhancer, a MSCV U3 LTR enhancer, MoMLV enhancer, FMLV enhancer, SFFVP enhancer, TCR alpha and beta enhancer, a CD3 enhancers, or a CD2 gene enhancer, more preferably the enhancer is a MSCV U3 LTR enhancer.

[0033]

[0031] It was also found that, where in case the nucleic acid part comprising the enhancer may display independent promoter activity, for example as in case of U3 LTR enhancers, it is preferred that the nucleic acid part comprising the enhancer is oriented in the recombinant nucleic acid comprising the gene encoding the antigen receptor, the inducible promoter to which the gene encoding the antigen receptor is operably linked, and the nucleic acid part comprising the enhancer such that the promoter in the nucleic acid part comprising the enhancer is not operably linked to the gene encoding the antigen receptor, for example, is oriented in a direction opposite to the direction of the inducible promoter, for example as shown in the examples. In this way the enhancer further enhances expression of the antigen receptor by the inducible promoter, without the promoter activity that is present in the nucleic acid part interfering with the expression of the antigen receptor. Thus, where, for example, the inducible promoter direction is directed towards the 5’region of the sense strand of the antigen receptor, the promoter present in the nucleic acid part comprising the enhancer is oriented towards the 3’ region of the same strand (i.e. towards the 5’ region of the complementary strand). The skilled person knows how to achieve this using conventional cloning techniques.

[0034]

[0032] It was also found that the inducible promoter is preferably an ITAM signaling responsive promoter, preferably a NFAT promoted or the like. Upon activation of, for example, a T cell receptor or CAR, for example upon binding with an antigen expressed on the cell surface of a tumor cell, signaling pathways in the cell, for example T cell, become active. A common mechanism of cell activation is by ITAM signaling via the antigen receptor, and preferably the inducible promoter is an ITAM signaling (as induced upon activation of the antigen receptor) responsive promoter.

[0035]

[0033] In a further embodiment, the first recombinant nucleic acid comprising the gene encoding the antigen receptor, operably linked to the inducible promoter and, optionally the enhancer, may further comprise a nucleic acid part encoding for a second protein of interest, and wherein the gene encoding for the second protein of interest is not operably linked to the inducible promoter. For example, the nucleic acid part encoding a second protein of interest may be operably linked to an independent promoter, allowing independent expression of the second protein of interest. For example, the promoter may be a promoter that is comprised in the nucleic acid part comprising the enhancer, and wherein the nucleic acid part comprising the enhancer is oriented such that the promoter therein is not operably linked to the gene encoding the antigen receptor, as mentioned above. By orienting the nucleic acid part comprising the enhancer as such, the enhancer comprised therein may enhance expression of the antigen receptor by the inducible promoter, whereas the promoter activity in the nucleic acid part comprising the enhancer may be used to, independently, express a second protein of interest, Alternatively, the promoter that is operably linked to the gene encoding the second protein of interest is any other suitable constitutive or inducible promoter known in the art.

[0036]

[0034] In some embodiment, the second protein of interest is a recombinant switch system able to bind to the antigen receptor encoded and modify signal transduction that is induced when the antigen receptor is activated. This allows for further regulation of the (level of) activation of the cell, for example, T cell, for example, upon binding of an antigen to the cell surface expressed antigen receptor.

[0037]

[0035] In embodiment of the invention, the first recombinant nucleic acid is integrated in the genome of the cell, for example T cell or NK cell.

[0038]

[0036] In embodiments of the invention, the antigen receptor is a T cell receptor, a NK cell receptor, or a chimeric antigen receptor.

[0039]

[0037] The cell according to the invention can be used as a medicament. For example, the cell according to the invention may be used in the treatment of cancer or of a tumor in a subject.

[0040]

[0038] The fist recombinant nucleic acid according to the invention may be provide, for example in the form of an expression cassette, of a vector, or as such.

[0041]

[0039] This and other aspects, problems solved by the invention, and / or technical teachings of the invention encompassed and embodied by the invention will be apparent for the skilled person from the description, examples, and claims.

[0042] BRIEF DESCRIPTION OF THE FIGURES

[0043]

[0040] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

[0044]

[0041] Figure 1 : Enhanced functionality of enhancer and NFAT promoter driven antigen receptor expressing T cells compared to constitutive promoter driven antigen receptor expressing T cells. A) Schematic representation of expression cassette designs (right), and code numbers of lentiviral vectors that contain corresponding expression cassettes (left). B) Primary human T cells were modified with indicated vectors in (A). Data depict surface Fibronectin EDB CAR expression by staining with goat anti-human AF647 antibody that detects ScFv domain of the CAR. C) Data depict secreted IFN gamma upon co-culture with or without Fibronectin EDB positive A549 cells in the presence of 500 nM lenalidomide or DMSO control. Error bars represent standard deviation (n=3). D) Data depict surface truncated human EGFR (huEGFRt) expression by staining with cetuximab-PE antibody. E) A549 tumor cells were modified with indicated vectors in (A). Data depict surface Fibronectin EDB CAR expression by staining with goat anti-human AF647 antibody. MFI: Mean Fluorescence Intensity

[0042] Figure 2: Therapeutic cargo molecules, such as cytokine encoding genes can be placed within the same open reading frame together with the enhancer and NFAT promoter driven antigen receptor. A) Schematic representation of expression cassette designs (right), and code numbers of lentiviral vectors that contain corresponding expression cassettes (left). B) Primary human T cells were modified with indicated vectors in (A). Data depict surface Fibronectin EDB CAR expression by staining with goat anti-human AF647 antibody that detects ScFv domain of the CAR. C) Data depict secreted IFN gamma upon co-culture with or without Fibronectin EDB positive A549 cells in the presence of 500 nM lenalidomide or DMSO control. Error bars represent standard deviation (n=3). MFI: Mean Fluorescence Intensity

[0045]

[0043] Figure 3: Synergistic effects of enhancer and NFAT promoter driven CAR expression, and RheoBrick switch on T cell functionality. A) Schematic representation of expression cassette designs (right), and code numbers of lentiviral vectors that contain corresponding expression cassettes (left). B) Primary human T cells were modified with indicated vectors in (A). Data depict transduction efficiency as measured by percentage EGFP positive cells. C) Data depict surface Fibronectin EDB CAR expression by staining with goat anti-human AF647 antibody that detects ScFv domain of the CAR. D) Data depict secreted IFN gamma upon co-culture with or without Fibronectin EDB positive A549 cells in the presence of 500 nM lenalidomide or DMSO control. Error bars represent standard deviation (n=3). MFI: Mean Fluorescence Intensity

[0046]

[0044] Figure 4: Enhanced functionality of enhancer and NFAT promoter driven CD19 CAR expressing T cells compared to enhancer and constitutive promoter driven CD19 CAR expressing T cells. A) Schematic representation of expression cassette designs (right), and code numbers of lentiviral vectors that contain corresponding expression cassettes (left). B) Primary human T cells were modified with indicated vectors in (A). Data depict surface CD19 CAR expression by staining with goat anti-mouse PE antibody that detects ScFv domain of the CAR. C) Data depict secreted IFN gamma upon co-culture with CD19 positive Nalm6 cells in the presence of 500 nM lenalidomide or DMSO control. Error bars represent standard deviation (n=3).

[0045] Figure 5: Enhanced functionality of enhancer and NFAT promoter driven BCMA CAR expressing T cells compared to enhancer and constitutive promoter driven BCMA CAR expressing T cells. A) Schematic representation of expression cassette designs (right), and code numbers of lentiviral vectors that contain corresponding expression cassettes (left). B) Primary human T cells were modified with indicated vectors in (A). Data depict surface BCMA CAR expression by staining with goat anti-mouse PE antibody that detects ScFv domain of the CAR. C) Data depict secreted IFN gamma upon co-culture with BCMA positive LI266 cells in the presence of 500 nM lenalidomide or DMSO control. Error bars represent standard deviation (n=3). MFI: Mean Fluorescence Intensity

[0047]

[0046] Figure 6: Enhanced functionality of enhancer and NFAT promoter driven PSMA CAR expressing T cells compared to enhancer and constitutive promoter driven PSMA CAR expressing T cells. A) Schematic representation of expression cassette designs (right), and code numbers of lentiviral vectors that contain corresponding expression cassettes (left). B) Primary human T cells were modified with indicated vectors in (A). Data depict surface PSMA CAR expression by staining with goat anti-mouse PE antibody that detects ScFv domain of the CAR. C) Data depict secreted IFN gamma upon co-culture with antigen positive PC3-PSMA cells or antigen negative PC3 cells in the presence of 500 nM lenalidomide or DMSO control. Error bars represent standard deviation (n=3). MFI: Mean Fluorescence Intensity

[0048]

[0047] Figure 7: Upstream conserved region of the retroviral MSCV U3 enhancer / promoter sequence is critical maintain high level of gene expression in the forward direction, and low level of gene expression in the reverse direction prior to exposure to antigen positive target cells. A) Schematic representation of expression cassette designs (right), and code numbers of lentiviral vectors that contain corresponding expression cassettes (left). B) Nucleotide sequence of the retroviral MSCV U3 enhancer / promoter sequence (top row). Upstream conserved region (UCR) sequences derived from MoMLV U3, FMLV U3 and SFVVP U3 regions are used to replace MSCV UCR sequence to create hybrid enhancer / promoter sequences (second, third and fourth rows, respectively). UCR segments are underlined. Last row: Part of the MSCV UCR region was deleted from MSCV U3 enhancer / promoter sequence. C) Primary human T cells were modified with indicated vectors in (A). Data depict surface truncated human EGFR (huEGFRt) expression by staining with cetuximab-PE antibody. D) Data depict surface Fibronectin EDB CAR expression by staining with goat anti-human AF647 antibody that detects ScFv domain of the CAR. E) Relative protein expression in the forward direction versus reverse direction from the bidirectional expression cassette was calculated by dividing MFI of huEGFRt expression to MFI of CAR expression. F) Data depict secreted IFN gamma upon coculture with or without Fibronectin EDB positive A549 cells in the presence of 500 nM lenalidomide or DMSO control. Error bars represent standard deviation (n=3). MFI: Mean Fluorescence Intensity.

[0049] DESCRIPTION

[0050] Definitions

[0051]

[0048] A portion of this disclosure contains material that is subject to copyright protection (such as, but not limited to, diagrams, device photographs, or any other aspects of this submission for which copyright protection is or may be available in any jurisdiction.). The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or patent disclosure, as it appears in the Patent Office patent file or records, but otherwise reserves all copyright rights whatsoever.

[0052]

[0049] Various terms relating to the methods, compositions, uses and other aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein.

[0050] For purposes of the present invention, the following terms are defined below.

[0053]

[0051] As used herein, the singular form terms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a cell” includes a combination of two or more cells, and the like. For example, a method for administrating a cell according to the invention includes the administrating of a plurality of cells (e.g. 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more molecules).

[0054]

[0052] As used herein, “about” and “approximately", when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed invention. Unless otherwise clear from context, all numerical values provided herein include numerical values modified by the term “about.”

[0055]

[0053] As used herein, “and / or” refers to a situation wherein one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.

[0056]

[0054] As used herein, "at least" a particular value means that particular value or more. For example, "at least 2" is understood to be the same as "2 or more" i.e. , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, ... , etc. As used herein, the term "at most" a particular value means that particular value or less. For example, "at most 5" is understood to be the same as "5 or less" i.e., 5, 4, 3, 2, 1 or 0.

[0057]

[0055] As used herein, “comprising” or “to comprise” is construed as being inclusive and open ended, and not exclusive. Specifically, the term and variations thereof mean the specified features, steps or components are included. These terms are not to be interpreted to exclude the presence of other features, steps, or components. It also encompasses the more limiting “to consist of”.

[0058]

[0056] As used herein, “conventional techniques” or “methods known to the skilled person” refer to a situation wherein the methods of carrying out the conventional techniques used in methods of the invention will be evident to the skilled worker. The practice of conventional techniques in molecular biology, biochemistry, cell culture, genomics, sequencing, medical treatment, pharmacology, immunology, and related fields are well-known to those of skill in the art and are discussed, in various handbooks and literature references.

[0059]

[0057] As used herein, "exemplary" or “for example” means "serving as an example, instance, or illustration," and should not be construed as excluding other configurations, including those disclosed herein.

[0060]

[0058] As used herein, “antigen receptor” refers to a protein or protein complex, normally expressed at the surface of the cells, and which consists of an extracellular antigen binding domain, a transmembrane region and one or more intracellular effector domains. Antigen receptors recognize (fragments of) antigen. Examples of antigen receptors include T cell receptors, NK cell receptors and chimeric antigen receptors (CAR). As used herein “T cell receptor” (“TCR”) refers to the antigen receptor present on the surface of T cells which recognizes fragments of antigen as peptides bound to major histocompatibility complex (MHC) molecules. Native TCRs exist in op and y<5 forms, which are structurally similar but exist in different locations and have different functions. The extracellular portion of the TCR has two constant domains and two variable domains. The variable domains contain polymorphic loops which form the binding site of the TCR and are analogous to complementarity determining regions (CDRs) in antibodies. In the context of gene therapies, the TCR is usually genetically modified to change or improve its antigen recognition, therefore in one embodiment, the TCR is genetically modified. As used herein, “chimeric antigen receptors” (“CARs”), refers to an engineered antigen receptor which commonly comprises an extracellular target (antigen) binding domain, optionally a spacer region, a transmembrane region, and one or more intracellular effector domains. CARs have also been referred to as chimeric T cell receptors or chimeric immunoreceptors (CIRs). CARs can be genetically introduced into hematopoietic cells, such as T cells, to redirect specificity for a desired cell-surface antigen. The term “intracellular effector domain” as used herein refers to the domain in the antigen receptor, for example TCR or CAR which is responsible for intracellular signaling following the binding of the antigen to the antigen receptor. The intracellular effector domain is responsible for the activation of at least one of the normal effector functions of the immune cell in which the antigen receptor is expressed. For example, the effector function of a T cell can be a cytolytic activity or helper activity including the secretion of cytokines. References to antigen receptor “signaling” refer to signaling through the effector domain of the antigen receptor, which, for example, results in immunomodulatory cell activation (e.g. triggering target cell killing and T cell activation). As used herein a “NK cell receptor”, or NK receptor, is known to the skilled person and relates to a receptor present on the surface of NK cells which can recognize virus-infected cells, stressed cells, tumour cells, and / or other intracellular pathogens. There are NK activating receptors and inhibitory receptors. NK cell receptors play important functional roles in self-tolerance and the sustaining of NK cell activity.

[0061]

[0059] As used herein, “tumor associated antigen” or “tumor antigen” as used herein, refers to an antigen expressed on a tumor cell. This antigen may be uniquely or differentially expressed on a tumor cell when compared to a normal, i.e. non- cancerous, cell.

[0060] As used herein, the term "cancer" refers to the physiological condition in mammals that is typically characterized by unregulated cell growth. The terms "cancer," "neoplasm," and "tumor" are often used interchangeably to describe cells that have undergone a malignant transformation that makes them pathological to the host organism. Primary cancer cells can be distinguished from non-cancerous cells by techniques known to the skilled person. A cancer cell, as used herein, includes not only primary cancer cells, but also cancer cells derived from such primary cancer cell, including metastasized cancer cells, and cell lines derived from cancer cells. Examples include solid tumors and non-solid tumors or blood tumors. Preferably the tumors are solid tumors. Examples of cancers include, without limitation, leukemia, lymphoma, sarcomas, and carcinomas (e.g., colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, lung cancer, melanoma, lymphoma, non-Hodgkin lymphoma, colon cancer, (malignant) melanoma, thyroid cancer, papillary thyroid carcinoma, lung cancer, non-small cell lung carcinoma, and adenocarcinoma of lung.). As is well known, tumors may metastasize from a first locus to one or more other body tissues or sites. Reference to treatment for a "neoplasm, "tumors" or "cancer" in a patient includes treatment of the primary cancer, and, where appropriate, treatment of metastases.

[0062]

[0061] As used herein the terms “chimeric polypeptide”, “chimeric protein”, or “fusion protein” refer to any polypeptide which is not normally found in nature is a species, in particular a polypeptide in which one or more part of the amino acids sequence are not associated with each other in nature. For example, the chimeric protein may comprise an N-terminal part consisting of a first sequence of amino acids and a C- terminal part consisting of a second sequence of amino acids that are not associated with each other in nature and / or are not associated with each other in nature in this order. A chimeric protein may for example be obtained from transcription and translation of a chimeric gene or nucleic acid.

[0063]

[0062] As used herein, “an effective amount” is meant the amount of a required agent or composition comprising the agent to ameliorate or eliminate symptoms of a disease relative to an untreated patient. The effective amount of composition(s) used to practice the methods described herein for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an “effective” amount. Effective amounts can be determined routinely. The term includes both pharmacological effectiveness and physiological safety. Pharmacological effectiveness refers to the ability of the treatment to result in a desired biological effect in the subject such as improvement of symptoms, a cure, a reduction in disease load, reduction in tumor mass or cell numbers, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disease or condition. Physiological safety refers to the level of toxicity, or other adverse physiological effects at the cellular, organ and / or organism level (often referred to as side-effects) resulting from administration of the treatment.

[0064]

[0063] As used herein, the term “enhancer” refers to regulatory DNA sequence in a nucleic acid that, for example when bound by specific proteins called transcription factors, increase the level of transcription of an associated gene from its promoter in a fashion that is relatively independent of the position and orientation of the enhancer element. Within the context of the current invention, preferably the enhancer (or enhancer element) is comprised in the first recombinant nucleic acid according to the invention. Enhancers, and methods on how to establish enhancer activity, are know to the skilled person. A “functional part of an enhancer” refers to a fragment of the full- length enhancer that is sufficient to provide regulate expression of an operably linked gene, for example when bound by a transcription factor. In certain embodiments the regulation is comparable with respect to expression level offered by the full-length enhancer.

[0065]

[0064] The term “exhaustion” as used herein refers to the dysfunctional state of T cells or NK cells when the expression of cytokines and the effector function are decreased, and the T cells or NK cells are resistant to reactivation and exhibit reduced proliferative capacity. For example, it has been shown that a significant decrease in IL-2, IFNgamma and TNFalpha expression as well as cell cycle arrest are the hallmarks of T cell exhaustion. In tandem with this, an increased expression of inhibitory receptors is also observed, such as the receptors PD-1 , Lag3, CD160, CD244, Tim-3 and TIGIT. Exhausted T cells are effector T cells with decreased cytokine expression and effector function. Exhausted T cells are deemed to be resistant to reactivation and exhibit decreased proliferation. T cell exhaustion occurs naturally when the cells are chronically activated at sites of chronic inflammation, such as cancer, autoimmunity, and chronic infection. In a review by Crespo et al., T cell exhaustion was compared to T cell anergy, senescence and sternness in a tumor environment (Crespo et al., Curr Opin Immunol. 25(2): 214-221 , 2013). Several markers and features have been identified that are required to distinguish T cell exhaustion from other T cell dysfunctions. Exhausted T cells show a significant decrease in the cytokines IL-2, I FNY , and TNFalpha expression (E. John Wherry et al., Immunity 27(4), 670-684, 2007), as well as cell cycle arrest. A hallmark of exhaustion is the loss of polyfunctionality which means that an individual cell loses the capacity to make multiple cytokines simultaneously (E. John Wherry et al, Immunity 27(4), 670-684., 2007). Another critical feature of exhausted CD8 T cells is the sustained high expression of multiple inhibitory receptors, including PD-1 , Tim-3, Lag-3, CD160, CD244.TIGIT and others (Jin, H. T. et al. Proc. Natl Acad. Sci. USA, 107 (33): 14733-14738,2010; Johnston, R. J. et al, Cancer Cell, 26 (6): 923-937, 2014 ). Characteristic of exhausted CD8+T cells is also their deficient ability to proliferate. At the molecular level altered expression of transcription factors is a defining feature of exhausted CD8+T cells (Kao, C. et al. Nat. Immunol. 12(7), 663- 671 ,2011), for example changes in expression of Tox and TCF1 can discriminate between fully exhausted T cells and those that retain proliferative capacity (B, C. Miller et al., Nat. Immunol. .20 (3), 326-336, 2019). It has been recognized that T cell exhaustion has an extremely important role in both cancer and chronic infections.

[0066]

[0065] As used herein “immunomodulatory drugs”, “Immunomodulatory imide drugs” or “IMiDs” refers to compounds known in the art. IMiDs include thalidomide, pomalidomide, lenalidomide, iberdomide (CC-220), avadomide (CC-122), and CC- 885, or pharmaceutically acceptable salts thereof; these compounds may also be referred to as cereblon modulators (CRBN modulators). Thalidomide, lenalidomide, and pomalidomide have each been approved for treatment of various diseases while other IMiDs or cereblon modulators are under review. The compounds may be in the form of a free acid or free base, or a pharmaceutically acceptable salt.

[0067]

[0066] As used herein, the term “immunoreceptor tyrosine-based activation motif (ITAM)” refers to a conserved sequence of four amino acids that is repeated twice and is present in the cytoplasmic tails (i.e. , endodomains) of certain cell surface proteins of the immune system. A half-ITAM comprises a tyrosine residue (Y) separated from a leucine residue (L) or isoleucine residue (I) by any two other amino acids. The consensus sequence of half-ITAM is YxxL / l. The two half-ITAMs are normally separated from each other by 6 to 8 amino acids to form a full ITAM. The consensus sequence of ITAM is YxxL / lx(6-8)YxxL / l. ITAMs play an important role in signal transduction in immune cells, and they are, amongst others, found in the cytoplasmic tails of cell signaling molecules in the T cell receptor complex (CD3 epsilon chain, CD3 delta chain, CD3 gamma chain and / or CD3 zeta chain). In NK cells, ITAMs are present in NK cell receptor complexes that contain CD3 zeta chain, gamma (y) chain of the immunoglobulin receptor FCERI and DAP12 (Lanier et al, Nat Immunol. 2008 May; 9(5): 495-502). ITAMs are also present in chimeric antigen receptor (CAR) complexes that comprise CD3 zeta chain (Abate-Daga et al, Mol Ther Oncolytics. 2016; 3: 16014), CD3 epsilon chain (Nolan et al, Clin Cancer Res. 1999 Dec;5(12):3928-41), gamma (Y) chain of the immunoglobulin receptor FCERI (Ren-Heidenreich et al, Cancer Immunol Immunother. 2002 Oct;51(8):417-23) and DAP12 (Tdpfer et al, J Immunol. 2015 Apr 1 ;194(7):3201-12).

[0068]

[0067] As used herein, the term “immunoreceptor tyrosine-based inhibitory motif (ITIM)” refers generally to a conserved sequence of amino acids that is found in the cytoplasmic tails of many inhibitory receptors of the immune system. The ITIM motif comprises a serine residue (S), an isoleucine residue (I), a valine residue (V) or a leucine residue (L), separated by any other amino acid residue (x) from a tyrosine residue (Y), separated by any two other amino acids from an isoleucine residue (I), valine residue (V) or leucine residue (L). The consensus signature is S / l / V / LxYxxl / V / L. In vivo, ITIM-possessing inhibitory receptors interact with their ligand, causing the ITIM motif to become phosphorylated by enzymes of the Src kinases, allowing them to recruit SH2 containing protein tyrosine phosphatases (PTP) such as SHP-1 and SHP- 2 (Coxon et al, Blood. 2017 Jun 29;129(26):3407-3418), and lipid phosphatases such as SHIP-1. PTPs oppose positive regulatory effect of protein tyrosine kinases (PTK) such as Lek and Zap70, and thereby negatively regulate T cell signaling (Lorenz et al, Immunol Rev. 2009 Mar; 228(1): 342-359). By dephosphorylating ITAMs in TCRs, CARs, and other immune receptors, PTPs can reverse the activating effects of ITAM phosphorylation. Lipid phosphatases regulate cell signaling by modifying the concentrations of lipid phosphates versus their dephosphorylated products.

[0068] As used herein, the term “immunoreceptor tyrosine-based switch motif (ITSM)” refers to a conserved sequence of amino acids that is found in the cytoplasmic tails (or cytoplasmic domains or intracellular domain or endodomain; in other words, that part of the protein that is present in the cytoplasm of the cell (and not in the membrane and / or extracellular space) of many inhibitory receptors of the immune system. The ITSM motif comprises a threonine residue (T), separated by any other amino acid residue from a tyrosine residue (Y), separated by any other two amino acids from a valine residue (V) or an isoleucine residue (I). The consensus signature is TxYxxV / l. Similar to ITIM possessing inhibitory receptors, ITSM-possessing inhibitory receptors interact with their ligand, causing the ITIM motif to become phosphorylated by enzymes of the Src kinases, allowing them to recruit SH2 containing phosphates such as SHP-1 and SHP-2 (Lorenz et al, Immunol Rev. 2009 Mar; 228(1): 342-359). Some studies reported both ITIM and ITSM motifs contributed to inhibitory signaling of PD1 (Boussiotis et al, Cancer J. 2014 Jul-Aug; 20(4): 265-271 , Peled et al, Proc Natl Acad Sci U S A. 2018 Jan 16; 115(3):E468-E477). Whereas in other studies, ITSM motif was shown to be primarily responsible for the inhibitory effect of PD1 while ITIM motif was had only limited effect (Chemnitz et al, J Immunol. 2004 Jul 15;173(2):945-54, Yokosuka et al, J Exp Med. 2012 Jun 4;209(6):1201-17).

[0069]

[0069] As used herein, “operably linked” refers to a nucleic acid sequence placed into a functional relationship with another nucleic acid sequence. For example, a promoter is operably linked to a gene when that promoter is placed in a location that permits that promoter to initiate transcription of that gene. An enhancer is operably linked to a gene when that enhancer, for example when bound by an appropriate transcription factor, is able to regulate (e.g., to upregulate) expression of that gene. Operably linked may mean that the DNA sequences being linked are contiguous.

[0070]

[0070] As used herein, “promoter” refers to a nucleic acid fragment that functions to control the transcription of one or more nucleic acids. A promoter fragment is located upstream (5’) with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA- dependent RNA polymerase, transcription initiation site(s) and can further comprise any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. Optionally the term “promoter” may also include the 5’ UTR region (5’ Untranslated Region) (e.g. the promoter may herein include one or more parts upstream of the translation initiation codon of transcribed region, as this region may have a role in regulating transcription and / or translation). A “constitutive” promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An “inducible” promoter is a promoter that is physiologically (e.g. by external application of certain compounds) or developmentally regulated. Within the context of the current invention, preferably the inducible promoter (comprised in the second nucleic acid part) is an ITAM signaling responsive promoter. A “tissue specific” promoter is only active in specific types of tissues or cells. An “functional part of a promoted” refers to a fragment of the full- length promoter that is sufficient to initiate transcription of a gene operably linked to that promoter.

[0071]

[0071] As used herein, the term “pharmaceutical composition” refers to a composition formulated in pharmaceutically acceptable or physiologically acceptable compositions for administration to a cell or subject. The compositions according to the invention may be administered in combination with other agents as well, provided that the additional agents do not adversely affect the ability of the composition to deliver the intended therapy. The pharmaceutical composition often comprises, in addition to a pharmaceutical active agent, one or more pharmaceutical acceptable carriers (or excipients). The pharmaceutical compositions be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; or (5) aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound. Drugs, therapeutic agents, medicaments, and pharmaceutical compositions according to the present invention may be formulated for administration by a number of routes, including but not limited to, parenteral, intravenous, intra-arterial, intramuscular, intratumoral and oral. Drugs, therapeutic agents, medicaments, and compositions may be formulated in fluid or solid form. Fluid formulations may be formulated for administration by injection to a selected region of the human or animal body.

[0072]

[0072] As used herein, the terms “protein” and “polypeptide” refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, three-dimensional structure, or origin. A “fragment” or “portion” or “part” of a polypeptide may thus still be referred to as a “polypeptide”. An “isolated protein” or isolated polypeptide” is used to refer to a protein or polypeptide which is no longer in its natural environment, for example in vitro or in a recombinant host cell.

[0073]

[0073] As used herein “recombinant” is used consistently with its usage in the art to refer to a nucleic acid sequence that comprises portions that do not naturally occur together as part of a single sequence or that have been rearranged relative to a naturally occurring sequence. A recombinant nucleic acid is created by a process that involves the hand of man and / or is generated from a nucleic acid that was created by hand of man (e g , by one or more cycles of replication, amplification, transcription, etc.). A recombinant virus is one that comprises a recombinant nucleic acid. A recombinant cell is one that comprises a recombinant nucleic acid.

[0074]

[0074] As used herein the term “SH2 domain” refers to a SRC Homology 2 domain. The SH2 domain is a structurally conserved protein domain contained within the Src oncoprotein and in many other intracellular signal-transducing proteins. SH2 domains allow proteins containing those domains to dock to phosphorylated tyrosine residues on other proteins. SH2 domains are thus modular protein domains that serve as adaptors and mediate protein-protein interactions by binding to phosphorylated peptides in their respective protein binding partners.

[0075]

[0075] As used herein, a "subject" or “patient” is to indicate the organism to be treated e.g. to which administration is contemplated. The subject may be any subject in accordance with the present invention, including, but not limited to humans, males, females, infants, children, adolescents, adults, young adults, middle-aged adults, or senior adults and / or other primates or mammals. Preferably the subject is a human patient. A subject may have been diagnosed with a cancer or be suspected of having a cancer.

[0076]

[0076] As used herein, "treatment", "treating", "palliating", “alleviating” and "ameliorating" in the context of a subject to be treated, all refer to an approach for obtaining beneficial or desired results including, but not limited to, therapeutic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient can still be afflicted with the underlying disorder.

[0077] Detailed description

[0078]

[0077] The invention is defined herein, and in particular in the accompanying claims. Subject-matter which is not encompassed by the scope of the claims does not form part of the present claimed invention.

[0079]

[0078] Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment envisaged herein. Thus, appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some, but not other features included in other embodiments, combinations of features of different embodiments are also envisaged herein, and form different embodiments, as would be understood by those in the art.

[0080]

[0079] It is contemplated that embodiments described herein in relationship to any method, use, or composition can be implemented with respect to any other method, use or composition described herein. Thus, an embodiment pertaining to one method, use or composition may be applied to other methods, uses and compositions of the invention as well.

[0081]

[0080] Any references in the description to methods of treatment refer to the compounds, pharmaceutical compositions, and medicaments of the present invention for use in a method for treatment of the human (or animal) body by therapy.

[0082]

[0081] As embodied and broadly described herein, the present invention is directed to the surprising finding that differentiation and exhaustion of cell therapy products, in particular of immune cells, such as T cells and NK cell, can be delayed by modification of the cells.

[0082] In particular it was found that cells modified to express an antigen receptor, such as a T cell receptor, a NK cell receptor, or a chimeric antigen receptor (e.g. in T cells or in NK cells) from a promoter than is induced (i.e. becomes active) when the antigen receptor that is expressed at the cell surface of the cell is activated, for example, upon binding of the antigen receptor with an antigen, shows various advantageous effects, including delayed exhaustion, for example in comparison to cell wherein the antigen receptor is not expressed from such inducible promoter but, for example, from a constitutive promoter.

[0083]

[0083] Therefore, there is provided for a cell comprising a first recombinant nucleic acid (integrated in genome or not) wherein the first recombinant nucleic acid comprises:

[0084] (a) a first nucleic acid part, wherein the first nucleic acid part encodes an (cell surface expressed) antigen receptor, and

[0085] (b) a second nucleic acid part, wherein the second nucleic acid part comprises a first inducible promoter, wherein the first inducible promoter is operably linked to the first nucleic acid part, and wherein the first inducible promoter is a promoter that is induced when the antigen receptor encoded by the first nucleic acid part is activated.

[0086]

[0084] The cell according to the invention may be any cell. In some preferred embodiments, the cell is preferably a human cell, a human immune cell, a T cell, a NK cell, a human T cell, or a human NK cell.

[0087]

[0085] The cell according to the invention is a modified cell in that it comprises a recombinant nucleic acid, herein also referred to as a first recombinant nucleic acid.

[0086] The first recombinant nucleic acid may be integrated into the genome of the cell (host cells) wherein said first recombinant nucleic acid has been introduced. For example, the first recombinant nucleic acid may be provided to the cell as an expression cassette provided with means to that allows integration of the expression cassette and / or the first recombinant nucleic acid comprised therein in the genome of the host cell. The skilled person is well aware of methods and means for integration of the first recombinant nucleic acid into the genome of the host cell, for example based on lentivirus systems and vectors such as recombinant lentiviral vectors. As used herein, the term “recombinant lentiviral vector” and the like refers to an artificially created polynucleotide vector, e.g. expression cassette, assembled from a lentivirus and a plurality of additional segments because of human intervention and manipulation. Alternatively, integration of the first recombinant nucleic acid (molecule) according to the invention may be achieved using DNA manipulation techniques including but not limited to CRISPR-Cas, zinc fingers nuclease, Talens and the like.

[0088]

[0087] Alternatively, the first recombinant nucleic acid according to the invention may be comprised in the cell (also referred to as host cell) as a separate nucleic acid molecule, independent of the genome of the (host) cell, for example in the form of a vector, for example an expression vector.

[0089]

[0088] The skilled person is well aware of methods and means for transduction of the first recombinant nucleic acid according to the invention into a cell, for example using methods as described in the accompanying Examples.

[0090]

[0089] According to the invention, the first recombinant nucleic acid comprises at least a first nucleic acid part and a second nucleic acid part. Within the context of the current invention, the term “nucleic acid part” refers to a distinct part comprised in the first nucleic acid according to the invention, consisting of adjacent nucleotides and providing for the indicated functionality or feature (e.g. encoding for an antigen receptor or comprising promoter functionality or comprising enhancer functionality within the context of the current invention). A first nucleic acid part, a second nucleic acid part and any further nucleic acid part comprised in the first recombinant nucleic acid according to the invention are preferably non-overlapping nucleic acid part. A nucleic acid part does not need to be directedly adjacent to another nucleic acid part in the first recombinant nucleic acid according to the invention, and may be separated by additional regions of nucleotides, but preferably two or more nucleic acid parts are directly adjacent to each other. Together the nucleic acid parts form the first recombinant nucleic acid according to the invention; in other words, are comprised in the first recombinant nucleic acid according to the invention. Said first recombinant nucleic acid according to the invention may be introduced in the cell according to the invention and be present in the cell as a separate molecule or be integrated in the genome of the cell.

[0091]

[0090] The first nucleic acid part encodes for an antigen receptor, in particular an antigen receptor, that is expressed at the cell surface of a cell. The skilled person understand that within the context of the invention, the invention is not in particular limited to a particular antigen receptor and any antigen receptor that is able of induction of intracellular signaling upon activation of the antigen receptor by binding with an antigen, and activation of, for example, at least one of the normal effector functions of the cell, for example, immune cell in which the antigen receptor is expressed. For example, the effector function of a T cell can be a cytolytic activity or helper activity including the secretion of cytokines. Preferably, the antigen receptor is an antigen receptor the cognate binding partner of which is expressed (on the cell surface) by a cancer cell, i.e. a tumor antigen. The skilled person is well aware of suitable antigen receptor in the context of the current invention and of methods and means for providing a cell with such antigen receptor, for example using methods as described in the accompanying Examples.

[0092]

[0091] The second nucleic acid part comprises an inducible promoter, herein referred to as the first inducible promoter. In the first recombinant nucleic acid according to the invention, the first inducible promoter is operably linked to the first nucleic acid part, i.e. to the nucleic acid or gene encoding the antigen receptor. In other words, expression of the gene encoding the antigen receptor is, in the first recombinant nucleic acid according to the invention, regulated by the inducible promoter / initiated via the inducible promoter comprised in the second nucleic acid part. Preferably the inducible promoter comprised in the second nucleic acid part is the only promoter in the first recombinant nucleic acid according to the invention that is operably linked to the gene encoding the antigen receptor (i.e. the first nucleic acid part). As will be understood by the skilled person, this normally means that the inducible promoter, and hence the second nucleic acid part is oriented upstream of the first nucleic acid part, that is to say towards the 5’region of the sense strand or coding strand. In other words, the inducible promoter in the second nucleic acid part is oriented relative to the first nucleic acid strand such that it is operably linked to the first nucleic acid and allows for transcription of the sequence encoding the antigen receptor. The skilled person is well aware off how to operably link a promoter to a gene of interest, and how the promoter can be oriented relative to the gene of interest and on methods and means for achieving this within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying Examples.

[0092] The promoter that is comprised in the second nucleic acid part is an inducible promoter, i.e. a promoter that is active under specific physiological conditions in the cell, in contrast to a constitutive promoter that is active under normal or most physiological conditions. With the context of the current invention, the physiological condition that causes the inducible promoter to become active is when in the cell comprising the first recombinant nucleic acid according to the invention, the antigen receptor encoded by the first nucleic acid part is activated. As is shown in the examples, it was found that under normal physiological conditions (e.g. conditions wherein the cells is not or hardly being contacted by an antigen (i.e. antigen of the antigen receptor), the cells have reduced expression of the antigen receptor encoded by the first nucleic acid part on the cell surface. Such reduced of low expression level of the antigen receptor encoded by the first nucleic may be referred to as baseline expression or tonic expression of the antigen receptor.

[0093]

[0093] However, once the cell according to the invention is contacted with an antigen that binds with the antigen receptor encoded by the first nucleic acid part, the antigen receptor expressed on the cell surface is activated by binding to the antigen and can induce, for example, by effector domains comprised in the antigen receptor, cause intracellular signaling, normally resulting in, in the case of immune cells, for example immunomodulatory cell activation (e.g. T cell activation).

[0094]

[0094] Under such physiological conditions (antigen receptor signaling as the consequence of activation of the antigen receptor, for example upon binding with an antigen, for example an antigen expressed on the cell surface of another cell, for example tumor cell) the first inducible promoter comprised in the second nucleic acid part becomes active. Within the context of the current invention, the first inducible promoter comprised in the second nucleic acid part is a promoter that, as the consequence of the antigen receptor signaling upon binding with the antigen, becomes activated. In other words, the first inducible promoter is a promoter that is induced when the antigen receptor encoded by the first nucleic acid part is activated.

[0095] It was surprisingly found that upon activation of the first inducible promoter, and subsequent expression / transcription of the gene encoding the antigen receptor, cell surface expression of the antigen receptor is improved, leading to more antigen receptor mediated signaling (upon binding of the antigen receptor with its antigen, for example expressed on a tumor cell), thereby causing as what may be referred to as a loop of cell, for example immune cell, for example T cell activation. Surprisingly, the baseline expression of the antigen receptor on the one hand delays or prevents premature activation or exhaustion of the cell, while at the same time is sufficient to activate the cell to, for example an activated T cell, upon encountering antigen, for example expressed on the cell surface of a tumor cell.

[0095]

[0096] The first inducible promoter may be any promoter that is induced when the receptor is activated by the activating signal and signal transduction through the cell in response to activation of the receptor is allowed. In other words, the first inducible promoter is a promoter that is induced upon activation of the receptor and subsequent signal transduction through the cell.

[0096]

[0097] In a preferred embodiment, the first inducible promoter comprised is the second nucleic acid part is an inducible promoter as disclosed herein, in particular in the examples.

[0097]

[0098] Within the context of the current invention, the skilled person is well aware of how to select a suitable inducible promoted to be comprised in the second nucleic acid part, and how such promoter can be oriented relative to the gene of interest and of methods and means for achieving this within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying Examples.

[0098]

[0099] Also provided is for a cell according to the invention wherein the first recombinant nucleic acid further comprises:

[0099] (c) a third nucleic acid part, wherein the third nucleic acid comprises all or a functional portion of an enhancer, preferably whereby the enhancer or functional part thereof enhances transcription of the first nucleic acid part operably linked to the first inducible promoter comprised in the second nucleic acid part.

[0100]

[0100] In preferred embodiments, the first recombinant nucleic acid according to the invention comprises, in addition to the first nucleic acid part and the second nucleic acid part as third nucleic acid part.

[0101]

[0101] The third nucleic acid part may be located anywhere within the first recombinant nucleic acid relative to the first nucleic acid part. The third nucleic acid part may be located anywhere within the first recombinant nucleic acid relative to the second nucleic acid part. For example, the third nucleic acid part may be located upstream or downstream of the first nucleic acid part (wherein upstream (towards the 5’region) or downstream (towards the 3’ region) is defined relative to the sense strand of the gene encoding the antigen receptor). Preferably the third nucleic acid part is upstream from the first nucleic acid part.

[0102]

[0102] The third nucleic acid part may also be located upstream or downstream of the second nucleic acid part (wherein upstream or downstream is defined relative to the sense strand of the gene encoding the antigen receptor). Preferably the third nucleic acid part is upstream from the second nucleic acid part. Preferably the third nucleic acid part is upstream of both the first nucleic acid part and the second nucleic acid part. Preferably, with the first recombinant nucleic acid, the second nucleic acid part is located between the first nucleic acid part and the second nucleic acid part.

[0103]

[0103] The third nucleic acid comprises all or a functional part of an enhancer. An enhancer is a regulatory DNA sequence in a nucleic acid that, under given physiological conditions further increase the level of expression of an associated gene from its promoter. In other words, within the context of the current invention, an enhancer is a regulatory sequence that is comprised in the third nucleic acid part and that, in the cell according to the invention, further increases expression of the antigen receptor encoded in the first nucleic acid part upon activation of the inducible promoter that is comprised in the second nucleic acid part.

[0104]

[0104] In some embodiments, the enhancer enhances transcription of the first nucleic acid operably linked to the first inducible promoter upon activation of the antigen receptor encoded by the first nucleic acid part. In such embodiments, the enhancer itself is activated upon antigen receptor signaling, for example by binding specific transcription factors. However, the enhancer comprised in the third nucleic acid may be any enhancer capable of further enhancing of the first nucleic acid upon activation of the inducible promoter.

[0105]

[0105] The enhancer may be a full enhancer, for example as may be found in the genome of an organism, of a functional part thereof, i.e. the part that retains its enhancer function within the context of the current invention.

[0106]

[0106] The enhancer may enhance transcription of the first nucleic acid by the first inducible promoter comprised in the second nucleic acid by, for example, 10% or more, for example 20%, 50%, 80%, 100%, 150%, 200%, 300% or more.

[0107] Within the context of the current invention, the skilled person is well aware off how to select a suitable enhancer to be comprised in the third nucleic acid part, and how such enhancer may be oriented relative to the gene encoding the antigen receptor (the first nucleic acid part) and the inducible promoter comprised in the second nucleic acid part, and of methods and means for achieving this within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying Examples.

[0107]

[0108] Also provided is for a cell according to the invention wherein the third nucleic acid part that comprises all or a functional portion of an enhancer comprises a second promoter, and, preferably, wherein the second promoter is not operably linked to the first nucleic acid part.

[0108]

[0109] Often, DNA regions that comprise enhancer functionality, i.e. that comprise an enhancer, may also comprise promoter functionality, i.e. comprise a promoter. For example, suitable enhancers for use in the current invention include so called U3 LTR enhancers that are found in, for example, in the long-term repeats of lentiviruses or retroviruses. As is well-known to the skilled person, under natural conditions, the U3 region contains both enhancer and promoter elements that modulate basal and induced expression of the viral genome in infected cells and in response to cell activation.

[0109]

[0110] It will thus be understood than when, for example, such DNA region, comprising both an enhancer and a promoter is comprised in the third nucleic acid part, the third nucleic acid part does not only comprise an enhancer but in addition comprises a promoter, herein referred to as a second promoter. In such embodiment, the first recombinant nucleic acid according to the invention thus comprises, in addition to the first inducible promoter in the second nucleic acid part, a second promoter, comprised in the third nucleic acid part.

[0110]

[0111] As will be explained herein elsewhere, said second promoter may be operably linked to a further nucleic acid part (herein referred to as the fifth nucleic acid part), for example, encoding one or more particular protein of interest (herein referred to as a second protein of interest).

[0111]

[0112] The second promoter, included in the third nucleic acid part, may be a constitutive promoter or may itself also be an inducible promoter, for example an inducible promoter that is induced when the antigen receptor encoded by the first nucleic acid part is activated. Preferably, the promoter is a promoter that is naturally associated with the enhancer that is comprised in the third nucleic acid part, for example, in case an enhancer from the U3 region of a long term repeat of a lentivirus or retrovirus is used, the second promoter is the promoter that is naturally present in said U3 region, together with the enhancer. Alternatively, the promoter is a promoter that is not naturally present together with the enhancer that is comprised in the third nucleic acid part.

[0112]

[0113] As the skilled person will understand, in a preferred embodiment, the second promoter that may be comprised in the third nucleic acid part, is not operably linked with the first nucleic acid part (encoding the antigen receptor). In other words, in a preferred embodiment, expression of the antigen receptor does not, or only to a very limited extent, involves transcription initiated from the second promoter that may be comprised in the third nucleic acid part.

[0113]

[0114] As shown in the Examples, and discussed herein elsewhere, this may, for example, be achieved by including the third nucleic acid part in the first recombinant nucleic acid that the second promoter in the third nucleic acid part is oriented in the direction opposite to the direction of the first inducible promoter that is operably linked to the first nucleic acid. However, any other mean to prevent that the second promoter in the third nucleic acid part is operably linked to the first nucleic acid may suitable used.

[0114]

[0115] Within the context of the current invention, the enhancer may be a natural occurring enhancer, or may be a synthetic enhancer, or may be a hybrid enhancer, and wherein the enhancer comprises DNA sections from two or more different enhancers, for example as shown in the examples.

[0115]

[0116] In a preferred embodiment, the enhancer comprised is the third nucleic acid part is an enhancer as disclosed herein, in particular as disclosed in the examples. In a preferred embodiment, the second promoter that may be comprised in the third nucleic acid part is a second promoter as disclosed herein, in particular in the examples.

[0116]

[0117] Within the context of the current invention, the skilled person is well aware off how to select a suitable second promoter that may be comprised in the third nucleic acid part, and how such second promoter can be oriented relative to the first nucleic acid part such that the second promoter is not operably linked to first nucleic acid part. The skilled person is well aware of methods and means for achieving this within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying examples.

[0117]

[0118] Also provided is for a cell according to the invention wherein the enhancer or functional part thereof comprised in the third nucleic acid part comprises the consensus motif CGCCATNTT, wherein N stand for any base selected from C, G, A and T, preferably CGCCATTTT.

[0118]

[0119] The skilled person understands that the enhancer or functional part thereof as comprised in the third nucleic acid part may be any enhancer of functional part that may suitably be used in the first recombinant nucleic acid according to the invention.

[0119]

[0120] Discussed herein above, an enhancer or functional part thereof is suitable when it enhances transcription of the first nucleic acid part (encoding an antigen receptor, expressed on the cell surface) by the first inducible promoter comprised in the second nucleic acid part, in comparison to a situation wherein such enhancer or functional part thereof is absent.

[0120]

[0121] At the same time, as described in the Examples herein, it was found by the inventors that enhancer or functional parts thereof and that comprise the consensus motif CGCCATNTT, wherein N stands for any base, preferably selected from C, G, A and T, are examples of such suitable enhancers or functional parts thereof. Therefor in preferred embodiments, the enhancer or functional part thereof is an enhancer that comprises the consensus motif CGCCATNTT, wherein N stands for any base, preferably selected from C, G, A and T. Preferably, the consensus motif comprised in the enhancer is CGCCATTTT.

[0121]

[0122] The consensus motif CGCCATNTT is a motif that is recognized by Yin Yang 1 (YY1). Yin Yang 1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins and, depending on the DNA context, that can activate promoters and enhance transcription.

[0122]

[0123] Therefore, in embodiments of the invention, the enhancer or functional part thereof comprised in the third nucleic acid part comprises a YY1 binding motif, and may be a natural occurring enhancer, a hybrid enhancer, or a synthetic enhancer.

[0123]

[0124] Therefore, in embodiments of the inventions, the enhancer or functional part therefor comprised in the third nucleic acid part comprises CGCCATNTT, wherein N stands for any base, preferably selected from C, G, A and T, and may be a natural occurring enhancer, a hybrid enhancer, or a synthetic enhancer.

[0124]

[0125] Therefore, in embodiments of the inventions, the enhancer or functional part therefor comprised in the third nucleic acid part comprises CGCCATTTT, and may be a natural occurring enhancer, a hybrid enhancer, or a synthetic enhancer.

[0125]

[0126] Also contemplated are enhancer, for example natural enhancers, including those skilled in the art, and wherein the enhancer is modified to comprise the consensus motif CGCCATNTT, preferably CGCCATTTT.

[0126]

[0127] Such consensus motif are found in U3 regions. U3 regions of long-term repeats (LTR) are known to comprise enhancer regions. The U3 region comprise a so-called upstream conserved region (UCR) that contains regulatory elements (Wahlers et al. Mol Ther. 2002 Sep;6(3):313-20. doi: 10.1006 / mthe.2002.0671), and deletion of such segment has been reported to attenuate gene expression in the direction of the U3 promoter, i.e. , of a nucleic acid part that is operably linked to the promoter (function) of such U3 region. As shown in the Examples, it was surprisingly found that deletion of a UCR from a U3 region in a first recombinant nucleic acid according to the invention has an opposite effect on expression in the opposite direction of the U3 promoter. Deletion of the UCR region increased expression of the antigen receptor encoded by the first nucleic acid part that was operably linked to the first inducible promoter that is comprised in the second nucleic acid part, and wherein the first inducible promoter is oriented in a direction reverse to that of the U3 promoter (and wherein the first nucleic acid is not operably linked to such U3 promoter). These experiments were performed in the absence of antigens that can activate any antigen receptor expressed at the cell surface and encoded by the first nucleic acid part and thus reflect baseline (tonic) expression from the first recombinant nucleic acid.

[0127]

[0128] In other words, deletion of the UCR region that is comprised in U3 regions enhances tonic, baseline, non-activated expression of the antigen receptor encoded by the first nucleic acid. It was therefore surprisingly found that the presence of the UCR region in the second nucleic acid part is useful in preventing tonic, baseline expression of the antigen receptor encoded in the first nucleic acid part.

[0128]

[0129] The UCR region or segments derived from MSCV, MoMLV, FMLV and SFFVP U3 regions all contain the consensus motif CGCCATNTT, in particular CGCCATTTT.

[0130] Therefore, in some embodiments, the third nucleic acid part comprises the U3 region derived from MSCV, MoMLV, FMLV and SFFVP (For example, having the sequences thereof provided herein).

[0129]

[0131] Therefore, in some embodiments, the third nucleic acid part comprises the UCR region of the U3 region derived from MSCV, MoMLV, FMLV and SFFVp (for example, having the sequences thereof provided herein).

[0130]

[0132] In a preferred embodiment, the U3 region or UCR region is oriented in the first recombinant nucleic acid such that any promoter therein is not operably linked to the first nucleic acid part, as discussed herein elsewhere.

[0131]

[0133] Also provided is for a cell according to the invention wherein the first inducible promoter comprised in the second nucleic acid part is an ITAM signaling responsive promoter.

[0132]

[0134] Also provided is for a cell according to the invention wherein the first inducible promoter comprised in the second nucleic acid part is an NFAT promoter, a synthetic NFAT promoter, (synthetic) NF-kB promoter, an AP-1 promoter, a (natural) IL-2 promoter, an IFN gamma promoter, a TNF alpha promoter, an IL-6 promoter, a CD69 promoter, a CD137 promoter, a IFN gamma promoter, a TNF alpha promoter, a GM- CSF promoter, a IL-2 promoter, a IL-4 promoter, a IL-6 promoter, a IL-8 promoter, a IL-13 promoter, or a IL-17 promoter, preferably the promoter is an NFAT promoter.

[0133]

[0135] The skilled person understand that the first inducible promoter comprised in the second nucleic acid part may be any promoter that is induced when the antigen receptor encoded by the first nucleic acids is activated, as explained above.

[0134]

[0136] As the skilled person will understand, suitable first inducible promoters for use according to the invention may thus depend on the antigen receptor and the signal transduction pathway(s) that is / are activated upon activation of the antigen receptor. The skilled person knows how to identify or select a suitable first inducible promoter for use in the current invention and based on the disclosure herein.

[0135]

[0137] According to the invention, the inducible promoter may be any promoter that is induced upon activation of the receptor and subsequent signal transduction though the cell. In some embodiments, the inducible promoter that is operably linked to the nucleic acid encoding the protein of interest is any promoter the activation of which is responsive to a transcriptional factor that is increased when immune cells are specifically activated upon activation of the receptor

[0138] At the same time, in embodiments according to the invention, the first inducible promoter comprised in the second nucleic acid part is any promoter the activation of which is responsive to a transcriptional factor that is increased (or decreased in the case of a repressing transcriptional factor) when immune cells, in particular T cells and / or NK cells, are specifically activated upon activation of the antigen receptor encoded by the first nucleic acid part.

[0136]

[0139] In preferred embodiments, the inducible promoter is a promoter that is responsive to ITAM-mediated signaling (see, for example, Love et al. Cold Spring Harb Perspect Biol. 2010 Jun; 2(6): a002485. doi: 10.1101 / cshperspect.a002485), for example signaling initiated by phosphorylation of conserved motifs (ITAMs) contained within the cytoplasmic domains or transmembrane cell surface receptors such as TCR, CAR and NKR (T cell, chimeric antigen, or NK cell receptors). Such ITAM signaling responsive promoters are known to the skilled person. For example, genes under control of such ITAM signaling responsive promoters are not expressed, or only in at a low, baseline, level in absence of ITAM signaling, in particular in the absence of ITAM signaling upon activation of an antigen receptor, such as a CAR or a T cell receptor or a NK cell receptor. Upon induction of ITAM signaling, in particular TCR, CAR or NKR mediated ITAM signaling, expression of genes under control of the ITAM signaling responsive promoters is induced.

[0137]

[0140] In some embodiments, the inducible promoter is a human promoter. In some embodiments, the ITAM signaling responsive inducible promoter is a human promoter.

[0138]

[0141] In preferred embodiments the first inducible promoter comprised in the second nucleic acid part is an NFAT promoter, a synthetic NFAT promoter, (synthetic) NF-kB promoter, an AP-1 promoter, a (natural) IL-2 promoter, an IFN gamma promoter, a TNF alpha promoter, an IL-6 promoter, a CD69 promoter, a CD137 promoter, a IFN gamma promoter, a TNF alpha promoter, a GM-CSF promoter, a IL-2 promoter, a IL-4 promoter, a IL-6 promoter, a IL-8 promoter, a IL- 13 promoter, or a IL-17 promoter, preferably the promoter is an NFAT promoter.

[0139]

[0142] For example, in preferred embodiments according to the invention, the inducible promoter is selected from the group consisting of a (synthetic) NFAT promoter (Jutz et al. J Immunol Methods. 2016 Mar; 430:10-20, Zhang et al. Mol Ther. 2011 Apr; 19(4): 751-759), a (synthetic) NF-kB promoter (Jutz et al. J Immunol Methods. 2016 Mar; 430:10-20), a (synthetic) AP-1 promoter (Jutz et al. J Immunol Methods. 2016 Mar; 430:10-20). Such NFAT, NF-kB and AP-1 promoters are also referred to as synthetic promoters, as they (may) contain multiple copies of NFAT, NF-kB or AP-1 binding motifs, as is understood by those skilled in the art.

[0140]

[0143] Likewise, in preferred embodiments according to the invention the inducible promoter is selected from the group consisting of a (natural) CD69 promoter (Redondo-Anton et al. Front Genet. 2020 Oct 27; 11 :552949), a (natural) CD137 promoter (Kim et al. FEBS Lett. 2003 Apr 24;541(1-3):163-70), a (natural) IFN gamma promoter (Gonsky et al. J Immunol. 2000 Feb 1 ; 164(3): 1399-407), a (natural) TNF alpha promoter (Goldfeld et al. J Exp Med. 1993 Oct 1 ; 178(4): 1365-1379), a (natural) GM-CSF promoter (Cockerill et al. Mol Cell Biol. 1995 Apr; 15(4): 2071- 2079), a (natural) IL-2 promoter (Skerka et al. J Biol Chem. 1995 Sep 22;270(38):22500-6), a (natural) IL-4 promoter (Davydov et al. J Immunol. 1995 Dec 1 ;155(11):5273-9, Macian et al. EMBO J. 2000 Sep 1 ;19(17):4783-95), a (natural) IL- 6 promoter (Faggioli et al. Biochim Biophys Acta. 2004 May 28;1692(1):17-24), a (natural) IL-8 promoter (Okamoto et al. J Biol Chem. 1994 Mar 18;269(11):8582-9), a (natural) IL-13 promoter (Dolganov et al. Blood. 1996 Apr 15;87(8):3316-26), a (natural) IL-17 promoter (Liu et al. J Biol Chem. 2004 Dec 10;279(50):52762-71). These promoters are well known to the skilled person, and included, for example, also those described in WO 2020 / 141106.

[0141]

[0144] Preferably the inducible promoter is an NFAT promoter.

[0142]

[0145] In particular, for example, a NFAT promoter refers to one or more NFAT responsive elements linked to a minimal promoter of any gene, for example, expressed by T-cells. In some embodiments, the minimal promoter of a gene expressed by T-cells is a minimal human IL-2 promoter (see for example, Zhang et al. Mol Ther. 2011 Apr; 19(4): 751-759). The NFAT responsive elements comprise one or more binding motifs that NFAT proteins, such as NFAT1 , NFAT2, NFAT3, and / or NFAT4, bind.

[0143]

[0146] Therefore, the term NFAT promoter, as used herein, is known to the skilled person and refers in its broader meaning to any natural and synthetic inducible promoter that includes NFAT binding motifs. Examples are selected, preferably, from IL-2 promoter, IFNg-promoter and TNFa-promoter, all of them containing NFAT binding motifs.

[0147] The NFAT promoter can comprise any number of binding motifs, e.g., at least one, at least two, at least three, at least four, at least five, or at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, or up to twelve binding motifs. In a preferred embodiment, the sequence of the NFAT binding motif is ggaggaaaaactgtttcatacagaaggcgt (SEQ ID NO: 101).

[0144]

[0148] In embodiments, the NFAT promoter comprises NFAT binding motifs. In an especially preferred embodiment, the NFAT promoter nucleotide sequence comprises or consists of ggaggaaaaactgtttcatacagaaggcgtggaggaaaaactgtttcatacagaaggcgtggaggaaaaactgtttc atacagaaggcgtggaggaaaaactgtttcatacagaaggcgtcgcgaattcgcggagactctagagggtatataat ggaagctcgatttccag (SEQ ID NO: 102). It includes 4 copies of NFAT binding sites, and a minimal promoter (see also Jutz et al. J Immunol Methods. 2016 Mar;430: 10-20).

[0145]

[0149] In a preferred embodiment, the first inducible promoter comprised in the second nucleic acid part is an inducible promoter as disclosed herein, in particular in the examples.

[0146]

[0150] Within the context of the current invention, the skilled person is well aware of how to select a suitable first inducible promoter comprised in the second nucleic acid part and that is an ITAM signaling responsive promoter, and how to include such ITAM signaling response promoter in the first recombinant nucleic acid according to the invention. The skilled person is well aware of methods and means for achieving this within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying examples.

[0147]

[0151] The skilled person is well aware on how, within the context of the current invention, to combine suitable inducible promoters according to the invention and enhancers according to the invention, which combinations can be routinely tested in view of the methodology disclosed in this description. At the same time, the skilled person is well aware on how, within the context of the current invention, to combine suitable inducible promoters according to the invention, enhancers according to the invention, and antigen-receptors according to the invention, which combinations can be routinely tested in view of the methodology disclosed in this description. At the same time, the skilled person is well aware on how, within the context of the current invention, to combine suitable inducible promoters according to the invention, enhancers according to the invention, antigen-receptors according to the invention and the chimeric protein or recombinant switch according to the invention which combinations can be routinely tested in view of the methodology disclosed in this description.

[0148]

[0152] The A relevant technical benefit of the invention results from the presence in a cell of a first recombinant nucleic acid comprising several nucleic acid parts as disclosed herein that are sensitive to the cell activation state, namely due to a first inducible promoter that becomes induced when the antigen receptor is activated, with both inducible promoter and antigen receptor comprised in the first recombinant nucleic acid, and e.g. operably linked.

[0149]

[0153] As illustrated in the examples, a modified differentiation and exhaustion of cell therapy products, and an enhanced transcription of the antigen receptor by the inducible promoter, can be achieved by a first recombinant nucleic acid in a cell that comprises a first inducible NFAT promoter in the second nucleic acid part; and a functional portion of an enhancer that comprises a YY1 binding motif in a third nucleic acid part of the first recombinant nucleic acid.

[0150]

[0154] Therefore, in a preferred embodiment the cell according to the invention comprises a first recombinant nucleic acid comprising:

[0151] (a) a first nucleic acid part, wherein the first nucleic acid part encodes an antigen receptor;

[0152] (b) a second nucleic acid part, wherein the inducible promoter in the second nucleic acid part comprises a first inducible NFAT promoter; and c) a third nucleic acid part, wherein the third nucleic acid comprises all or a functional portion of an enhancer that comprises the consensus motif CGCCATNTT, wherein N stands for any base, preferably selected from C, G, A and T, preferably CGCCATTTT.

[0153]

[0155] The enhancer comprises, thus, a YY1 binding motif, and it may be a natural occurring enhancer, a hybrid enhancer, or a synthetic enhancer.

[0154]

[0156] The enhancer is preferably a viral enhancer, a T-cell specific enhancer, a NK- cell specific enhancer, a lymphocyte-specific enhancer, a U3 LTR enhancer, a lentiviral U3 LTR enhancer, a retroviral U3 LTR enhancer, a MSCV U3 LTR enhancer, MoMLV enhancer, FMLV enhancer, SFFVP enhancer, TCR alpha and beta enhancer, a CD3 enhancers, or a CD2 gene enhancer, more preferably the enhancer is a MSCV U3 LTR enhancer.

[0157] The NFAT promoter may be an NFAT responsive element that comprises one or more binding motifs that NFAT proteins, such as NFAT1 , NFAT2, NFAT3, and / or NFAT4, bind.

[0155]

[0158] A non-exhaustive list of inducible promoters that include NFAT binding motifs includes the IL-2 promoter, the IFNg-promoter and the TNFa-promoter, as previously disclosed.

[0156]

[0159] This particular combination (i.e. , inducible NFAT promoter and enhancers comprising the YY1 motif), which as illustrated in the examples is highly effective, is an actual proof of concept of the rationale behind the invention and of the additional benefits of using a third nucleic acid part that comprises all or a functional portion of an enhancer.

[0157]

[0160] Following the teaching in this description and the examples, inducible promoters that include NFAT binding motifs and that are known by the skilled person can be used and routinely tested in combination with suitable enhancers known to the skilled person.

[0158]

[0161] Also provided is for a cell according to the invention wherein the first recombinant nucleic acid further comprises:

[0159] (d) a fourth nucleic acid part, wherein the fourth nucleic acid part encodes a first protein of interest, wherein the fourth nucleic acid part is operably linked to the first inducible promoter comprised in the second nucleic acid part.

[0160]

[0162] In preferred embodiments, the first recombinant nucleic acid according to the invention comprises, in addition to the first nucleic acid part and the second nucleic acid part, and optionally the third nucleic acid part, a fourth nucleic acid part.

[0161]

[0163] The fourth nucleic acid part encodes a first protein of interest. Preferably the fourth nucleic acid part is operably lined to the first inducible promoter comprised in the second nucleic acid part. In other words, in a preferred embodiment, in the first recombinant nucleic acid according to the invention, the first inducible promoter comprised in the second nucleic acid part and that is operably linked to the first nucleic acid part (encoding the antigen receptor) is at the same time operably linked to the fourth nucleic acid part that encoded for a first protein of interest. Therefore, in such embodiments, upon induction / activation of the first inducible promoter, transcription of both the first nucleic acid part and the fourth nucleic acid part is induced.

[0164] Although it is contemplated that in some embodiments the first protein of interest is produced by the cell according to the invention independent of the first inducible promoter comprised in the second nucleic acid part, in a preferred embodiment the first inducible promoter comprised in the second nucleic acid part is operably linked to the fourth nucleic acid part, thereby regulating expression of the first protein of interest in the same manner as the expression of the antigen receptor encoded in the first nucleic acid.

[0162]

[0165] Therefore, in a preferred embodiment, the fourth nucleic acid part and the first nucleic acid part are adjacent to each other within the first recombinant nucleic acid according to the invention. Is some embodiment, the fourth nucleic acid part is more in the proximity of the first inducible promoter (e.g., in the order second nucleic acid part - fourth nucleic acid part - first nucleic acid part). In some embodiment, the first nucleic acid part is more in the proximity of the first inducible promoter (e.g., in the order second nucleic acid part - first nucleic acid part - fourth nucleic acid part).

[0163]

[0166] As will be understood by the skilled person, the first protein of interest may be any suitable protein that is selected by the skilled person, for example for the purpose of treating a disease, condition, or disorder, for example a tumor, in patient with the cells according to the invention. In particular, the first protein of interest may a protein that supports or enhances the functionality of an activated immune cells, for example T cell or NK cells.

[0164]

[0167] For example, the first protein of interest may be a protein that may contribute to the treatment of a condition or disease, for example in the treatment of cancer, for example aimed at treating a tumor. Therefore, in some embodiments there is provided for that the fourth nucleic acid part encoding the first protein of interest encodes for a cytokine, an interleukin, an interferon, a chemokine, a receptor, a ligand, a costimulatory receptor ligand, an antibody or antibody fragment, a bispecific antibody, a T-cell engager, a bispecific T cell engager, a trispecific T cell engager, a bispecific NK cell engager, a trispecific NK cell engager, a checkpoint inhibitor antagonist, an agonist, an enzyme, a regulatory element, a transcription factor, or a DNA binding domain of a transcription factor. In some embodiments there is provided for that the fourth nucleic acid part encoding the first protein of interest encodes for a cytokine, an interleukin, an interferon, a chemokine, a receptor, a ligand, an antibody or antibody fragment, a bispecific antibody, a T-cell engager, a bispecific T cell engager, a trispecific T cell engager, a bispecific NK cell engager, a trispecific NK cell engager, a checkpoint inhibitor antagonist, an agonist, an enzyme, a regulatory element, a transcription factor, or a DNA binding domain of a transcription factor.

[0165]

[0168] In some embodiments, the cytokine is an interleukin. In some embodiments, the interleukin is IL-2, IL-7, IL-12, IL-15, IL-18, or IL-21. In some embodiments, the interferon is IFN alpha, IFN gamma, or IFN beta.

[0166]

[0169] In some embodiments, the antibody or antibody fragment or bispecific antibody is anti-IL-6, anti-IL-6R, anti-IL-6Ra, anti-TNFalpha, anti-IL-1 , anti-PD1 , anti- CD25, anti-CD3, anti-CD20, anti-CD40 agonistic antibody, anti-IL-8, anti-MCP1 , anti- MIP-1 , anti-TGFp, anti-CD47, anti-CSF1 R, anti-CD28, anti-TIGIT, anti-VEGFR, or anti-FAP.

[0167]

[0170] In some embodiments, the checkpoint inhibitor antagonist is anti-PD-L1 , anti- PD-1 , anti-CTLA4, anti-LAG3, anti-TIM3, anti-2B4, or anti-CD160, anti-CD5.

[0168]

[0171] In some embodiments, the bispecific antibody comprises functional domains of any of but not limited to anti-IL-6, anti-l L-6R, anti-IL-6Ra, anti-TNF alpha, anti-IL- 1 , anti-PD1 , anti-CD25, anti-CD3, anti-CD20, anti-CD40 agonistic antibody, anti-IL-8, anti-MCP1 , anti-MIP-1 , anti-TGF beta, anti-CD47, anti-CSF1 R, anti-CD28, anti- TIGIT, anti-VEGFR, or anti-FAP.

[0169]

[0172] In some embodiments, the chemokine is CCL5, XCL-1 , XCL-2, CCL-19, or CCL-21.

[0170]

[0173] In some embodiments, the chemokine receptor is CCR2, CCR4, CCR7, CXCR2, CXCR3, or CXCR4.

[0171]

[0174] In some embodiments, a transcription factor or regulatory element is T-bet, TCF7, EOMES, a Runx family member, BLIMP1 , Bcl2, Bcl6, FoxP3, FoxO1 , FoxO1- 3A, or c-Jun.

[0172]

[0175] In some embodiments, the costimulatory receptor ligand is 4-1 BBL, CD80, CD86, OX40L, CD154.

[0173]

[0176] The skilled person will understand that the fourth nucleic acid part may encode for one first protein of interest or for more than one first protein of interest, for example for a cytokine and for a bispecific T cell engager. In other words, the fourth nucleic part may encode for one, two, three of more distinct first proteins of interest.

[0177] According to the invention, the first nucleic acid part, encoding the antigen receptor, and the fourth nucleic acid part, encoding (one or more) first protein(s) of interest may be comprised in one and the same open reading frame (i.e. does not comprise any stop codons).

[0174]

[0178] In some embodiments the nucleic acid sequence encoding the antigen receptor and a nucleic acid sequence encoding a first protein of interest may be separated from each other by a sequence that allows for transcription and / or translation in distinct encoded proteins. In a non-limiting example, a sequence encoding, for example, a self-cleaving peptide, for example a self-cleaving 2A peptide may be introduced between, for example, the sequence encoding the antigen receptor and the sequence encoding a first protein of interest. Alternatively, or in addition, sequences encoding for Internal Ribosome Entry Sites (IRES) may be introduced between, for example, the sequence encoding the antigen receptor and the sequence encoding a first protein of interest. In embodiments wherein the fourth nucleic acid part encoded for more than one first protein of interest, the sequences encoding the more than one proteins of interest may be separated from each other in a similar manner.

[0175]

[0179] At the same time, according to the invention there is provided for a method of modulating expression of the antigen receptor encoded by the first nucleic acid part, and or the first protein of interest, encoded by the fourth nucleic acid part, the method comprising in vitro or in vivo providing a cell according to the invention with an antigen able to bind and activate the antigen receptor encoded by the first nucleic acid part.

[0176]

[0180] Within the context of the current invention, the skilled person is well aware off how to select one or more suitable first proteins of interest to be comprised and encoded by the fourth nucleic acid part, and of methods and means for achieving this within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying examples.

[0177]

[0181] Also provided is for a cell according to the invention wherein the first recombinant nucleic acid further comprises:

[0178] (e) a fifth nucleic acid part, wherein the fifth nucleic acid part encodes a second protein of interest and wherein the fifth nucleic acid part is operably linked to a promoter (constitutive or inducible), wherein the promoter is a third promoter or, preferably, wherein the promoter is the second promoter comprised in the third nucleic acid part.

[0179]

[0182] In preferred embodiments, the first recombinant nucleic acid according to the invention comprises, in addition to the first nucleic acid part and the second nucleic acid part, optionally the third nucleic acid part, an optionally the fourth nucleic acid part, a fifth nucleic acid part.

[0180]

[0183] The fifth nucleic acid part encoded for (one or more) second protein of interest. The second protein of interest may be a protein that is different from a first protein of interest or may be the same.

[0181]

[0184] As will be understood by the skilled person, the second protein of interest may be any suitable protein that is selected by the skilled person, for example for the purpose of treating a disease, condition, or disorder, for example a tumor, in patient with the cells according to the invention. In particular, the second protein of interest may a protein that supports or enhances the functionality of an activated immune cells, for example T cell or NK cells. The second protein of interest may, for example be, any of the proteins of interest already discussed in the context of the first protein of interest according to the invention.

[0182]

[0185] The skilled person will understand that the fifth nucleic acid part may encode for one second protein of interest or for more than one second proteins of interest, for example for a cytokine and for a bispecific T cell engager. In other words, the fifth nucleic part may encode for one, two, three of more distinct second proteins of interest.

[0183]

[0186] In such embodiments, the more than one second proteins of interest may be comprised in one open reading frame, and may further include, as discussed in the context of the first protein of interest, sequences that allows for translation in distinct encoded proteins. In a non-limiting example, a sequence encoding, for example, a self-cleaving peptide, for example a self-cleaving 2A peptide may be introduced between, for example, a sequence encoding a second protein of interest and a further sequence encoding a further second protein of interest. Alternatively, or in addition, sequences encoding for Internal Ribosome Entry Sites (IRES) may be introduced. In other words, the fifth nucleic acid part may encode for one or more, for example, one, two or three distinct second proteins of interest.

[0187] In contrast to the fourth nucleic acid part, encoding one or more first protein of interest, the fifth nucleic acid part, encoding one or more second protein of interest, is not operably linked to the first inducible promoter comprised in the second nucleic acid part. The fifth nucleic acid is operably linked to a promoter (constitutive or inducible) that is not the first inducible promoter.

[0184]

[0188] In some embodiments the fifth nucleic acid comprises a third promoter. In some embodiments, and wherein the third nucleic acid part is comprised in the first recombinant nucleic acid according to the invention, and wherein the third nucleic acid comprises a second promoter, as discussed herein elsewhere, and wherein the second promoter is not operably linked to the first nucleic acid part, the fifth nucleic acid part is operably linked to the second promoter that is comprised in the third nucleic acid part.

[0185]

[0189] Within the context of the current invention, the skilled person is well aware off how to select one or more suitable second proteins of interest to be comprised and encoded by the fifth nucleic acid part, and of methods and means for achieving this within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying examples.

[0186]

[0190] Also provided is for a cell according to the invention wherein the cell further comprises a chimeric protein, or a recombinant nucleic acid encoding said chimeric protein, wherein the chimeric protein comprises:

[0187] (f) a docking domain that is able to bind to the antigen receptor encoded by the first nucleic acid part and wherein the chimeric protein is able to modify signal transduction that is induced when the antigen receptor encoded by the first nucleic acid part is activated.

[0188]

[0191] In some embodiments, the chimeric protein is encoded by a recombinant nucleic acid that is not comprised in the first recombinant nucleic acid according to the invention. However, in a preferred embodiment, the chimeric protein is encoded by a nucleic acid sequence that is comprised in the first recombinant nucleic acid according of the invention.

[0189]

[0192] In embodiments wherein the chimeric protein is encoded by a nucleic acid sequence that is comprised in the first recombinant nucleic acid according of the invention, the nucleic acid sequence encoding such chimeric protein may be comprised in the fourth nucleic acid part (first protein of interest), in the fifth nucleic acid part (second protein of interest) or in both.

[0190]

[0193] In some embodiments, the first protein of interest, the second protein of interest, and / or the chimeric protein may be part of a complex, for example a protein complex formed by more than one proteins. In such embodiments, the nucleic acid encoding the proteins forming such complex, including any chimeric protein or protein complex, may be comprised in the fourth nucleic acid part (first protein of interest), in the fifth nucleic acid part (second protein of interest) or in both (for example, part of the complex is encoded by the fourth nucleic acid part whereas another part is encoded by the fifth nucleic acid part.

[0191]

[0194] The chimeric protein is characterized by that it comprises at least a docking domain that is able to bind to the antigen receptor encoded by the first nucleic acid part and wherein the chimeric protein is able to modify signal transduction that is induced when the antigen receptor encoded by the first nucleic acid part is activated. In a preferred embodiment, the docking domain is able to bind to the antigen receptor when the antigen receptor is activated, for example upon binding with an antigen. In another embodiment, the docking domain is able to bind to the antigen receptor when the antigen receptor is not activated.

[0192]

[0195] In other embodiments, the chimeric protein is characterized by that it comprises at least a docking domain that is able to bind to the antigen receptor encoded by the first nucleic acid part and wherein the chimeric protein is able to modify signal transduction that is induced when the antigen receptor encoded by the first nucleic acid part is activated.

[0193]

[0196] For example, in some embodiments according to the invention, the chimeric protein is a cytosolic chimeric protein. In some embodiments, the docking domain that is comprised in the chimeric protein binds to the receptor (only or preferentially) when the receptor has been activated by an activating signal, for example upon binding with an antigen. In such embodiments, the docking domain may comprise a SH2-domain that is able to bind to a phosphorylated immunoreceptor tyrosine-based activation motif (ITAM) that may be comprised in the antigen receptor encoded by the first nucleic acid (wherein the ITAM in the antigen receptor becomes phosphorylated after having received the activating signal; for example, after the antigen receptor has interacted with a ligand, for example antigen). In some embodiments according to the invention the SH2-domain that is comprised in the chimeric protein is from a protein selected from the group consisting of Zap70, Syk, and Lek. In some embodiments the docking domain of the chimeric protein comprises a SH2-domain that is able to bind to a phosphorylated immunoreceptor tyrosine-based activation motif (ITAM) that is comprised in the antigen receptor encoded by the first nucleic acid part, preferably wherein the SH2-domain is from a protein selected from the group consisting of Zap70, Syk, and Lek.

[0194]

[0197] ZAP70 is a protein normally expressed near the cell membrane of T cells and natural killer cells. It plays a critical role in T cell signaling. Its molecular weight is 70 kDa, and it is composed of 2 N-terminal SH2 domains and a C-terminal kinase domain. It is a member of the protein-tyrosine kinase family. Human ZAP70 protein has the UniProtKB accession number P43403. Syk is expressed in thymocytes, intraepithelial gamma delta T cells, naive alpha beta T cell and B cells (Latour et al, Mol Cell Biol. 1997 Aug; 17(8): 4434-4441). Syk is highly homologous to ZAP70 and has the same domain structure of 2 N-terminal SH2 domains and a C-terminal kinase domain. In B cells, deficiency of Syk can be reconstituted by Zap70 (Kong et al, Immunity. 1995 May;2(5):485-92). Similarly, ZAP70 deficiency can be reconstituted by Syk in T cells (Williams et al, Mol Cell Biol. 1998 Mar; 18(3): 1388-99). Human Syk protein has the UniProtKB accession number P43405.

[0195]

[0198] Lek (also known as p56-LCK) is expressed in lymphocytes. Lek plays a critical role in TCR signal transduction pathway. In T cells, it constitutively associates with cytoplasmic domains of CD4 and CD8 co-receptors. Activation of TCR by peptide- MHC complex brings Lek to close proximity of TCR complex and thereby ITAM residues in CD3 subunits are phosphorylated by Lek. Phosphorylated ITAMs function as docking sites for SH2 domains of Zap70 (Simeoni, Oncotarget. 2017 Nov 28; 8(61): 102761-102762). Domain structure of Lek is SH4-Unique domain (UD)-SH3- SH2-kinase domain. The SH2 domain is required for interaction with phosphorylated ITAMs while SH4 is required for membrane association (Ngoenkam et al, Immunology. 2018 Jan; 153(1): 42-50). Human Lek protein has the UniProtKB accession number P06239. Preferably Zap70, Syk, and Lek are human Zap70, Syk, and Lek.

[0196]

[0199] The immunoreceptor tyrosine-based activation motif (ITAM) that may be comprised in the antigen receptor encoded by the first nucleic acid many be any suitable ITAM. However, in a preferred embodiment according to the invention, the ITAM that is present in the antigen receptor is an ITAM that found in for example a TCR, CAR or NKR, more preferably wherein the ITAM is from, or in, a CD3 zeta chain, a CD3 epsilon chain, a CD3 delta chain, a CD3 gamma chain, a FceRI gamma chain, or DAP12.

[0197]

[0200] In preferred embodiments, the cell according to the invention is a T cell expressing a TCR complex and / or CAR complex. Preferably the TCR complex and / or the CAR complex comprise a CD3 zeta chain domain comprising an ITAM, or any other ITAM bearing domain disclosed herein.

[0198]

[0201] In other preferred embodiments, the cell according to the invention is an NK cell expressing an NKR complex and / or CAR complex. Preferably the NKR complex or the CAR complex comprise a CD3 zeta chain domain comprising an ITAM, or any other ITAM bearing domain disclosed herein.

[0199]

[0202] In some embodiment according to the invention, the ITAM is an ITAM comprised in a T cell receptor (TCR) complex and / or a chimeric antigen receptor (CAR) and / or an NKR complex, preferably an ITAM comprised in a CD3 zeta chain, a CD3 epsilon chain, a CD3 delta chain, CD3 gamma chain, gamma chain of the immunoglobulin receptor FceRI and DAP12.

[0200]

[0203] As discussed, the SH2 domain may be from a protein which binds a phosphorylated immunoreceptor tyrosine-based activation motif (ITAM). ITAMs are found in the intracellular domains of cell signaling molecules such as the CD3 zeta ( ), CD3 epsilon (E), the CD3 gamma (y) and the CD3 delta (5) chains of the T cell receptor complex and Fc receptors (Love et al, Cold Spring Harb Perspect Biol. 2010 Jun; 2(6): a002485), such as FceRI.

[0201]

[0204] Such chimeric protein is designed to interact with phosphorylated immunoreceptor tyrosine-based activation motifs (ITAM) in the TCR / CD3 complex and / or CAR and / or NK cell receptor (NKR) and / or macrophage CAR complexes that contain ITAM bearing signaling molecules such as DAP12, gamma (y) chain of the immunoglobulin receptor FceRI or CD3 zeta chain (Lanier et al, Nat Immunol. 2008 May; 9(5): 495-502).

[0202]

[0205] The tyrosine residues within the ITAM motifs become phosphorylated following interaction of the antigen receptors with their ligands (activating signal; antigens) and form docking domains for other proteins involved in the signaling pathways of the cell. By the interaction of the chimeric protein according to the invention with the TOR and / or CAR, the T cell activation (as well as subsequent cytotoxic effects and / or cytokine secretion) is inhibited. Similarly, by the interaction of the chimeric protein according to the invention with the NKR and / or CAR in the NK cells, the NK cell activation (as well as subsequent cytotoxic effects and / or cytokine secretion) of the NK cells is inhibited.

[0203]

[0206] In NK cells, certain activating NK cell receptors (NKR) form complexes with ITAM bearing signaling molecules such as CD3 zeta chain, gamma (y) chain of the immunoglobulin receptor FceRI and DAP12. For example, NK cell receptors (NKR) NKp46 and NKp30 associate with the gamma (y) chain of the immunoglobulin receptor FceRI and the CD3zeta chain while NKp44 associates with the signaling adaptor DAP12 (Barrow et al, Front Immunol. 2019; 10: 909). Therefore, in an embodiment of the current invention, the cell according to the invention is an NK cell.

[0204]

[0207] ITAM bearing domains are also used in chimeric antigen receptor (CAR) designs. CD3 zeta chain contains three ITAMs while CD3 epsilon chain, gamma (y) chain of the immunoglobulin receptor FceRI and DAP12 signaling domains contain one ITAM and they are used in various CAR designs (Ren-Heidenreich et al, Cancer Immunol Immunother. 2002 Oct;51 (8):417-23, Nolan et al, Clin Cancer Res. 1999 Dec;5(12):3928-41 , Tdpfer et al, J Immunol. 2015 Apr 1 ;194(7):3201-12).

[0205]

[0208] The half-ITAM signature can be easily recognized as a tyrosine separated from a leucine or isoleucine by any two other amino acids, giving the signature YxxL / l. Two of these signatures are separated by between 6 and 8 amino acid to constitute ITAM consensus sequence of YxxL / lx(6-8)YxxL / l.

[0206]

[0209] In a preferred embodiment the ITAM-containing domain may be or comprise a CD3 zeta chain domain. In another preferred embodiment the ITAM-containing domain may be or comprise a CD3 epsilon chain domain. Yet, in another preferred embodiment the ITAM-containing domain may be or comprise a gamma (y) chain of the immunoglobulin receptor FceRI. Yet, in another preferred embodiment the ITAM- containing domain may be or comprise a DAP12 domain.

[0207]

[0210] In some embodiments, the ITAM is an ITAM comprised in SEQ ID NO 103 - 108, or that binds to an amino acid sequence having at least 80% identity, preferably at least 81 , 83, 87, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity, to an amino acid sequence according to SEQ ID NO 103 - 108.

[0211] According to a preferred embodiment according to the invention, the docking domain comprised in the chimeric protein further comprises next to the SH2-domain that is able to bind to a phosphorylated ITAM motifs (for example, as present in the receptor that has received an activating signal), also an immunoreceptor tyrosinebased switch motif (ITSM) and / or ITIM, preferably an ITSM and an immunoreceptor tyrosine-based inhibitory motif (ITIM). Such motifs are, for example, present in the inhibitory tail of PD1 and suggested to be implicated in the immunosuppressive effects of PD1 (Boussiotis et al, Cancer J. 2014 Jul-Aug; 20(4): 265-271).

[0208]

[0212] The presence of these ITSM, ITIM, or ITSM and ITIM motifs in the docking domain further improves the modulation, for example blocking, of the signaling by the antigen receptor, in this case of ITAM signaling, by the chimeric protein according to the invention.

[0209]

[0213] Thus whereas the presence of the SH2-domains in the chimeric protein already provide for modulation (blocking) of the ITAM-signaling, such modulation (preferably blocking) is further improved by the presence of the these ITSM, ITIM, or ITSM and ITIM motifs in the docking domain, and enables strict regulation of the signaling through the cells, and subsequently, strict regulation of the induction of the first inducible promoter comprised in the second nucleic acid part, because the inducible promoter used in such case is a promoter that depends on / is induced by said signaling, here ITAM signaling.

[0210]

[0214] It was surprisingly found that the presence of such ITSM, preferably such ITSM and such ITIM, in the docking domain of the chimeric protein, allows the chimeric protein to effectively inhibit signal transduction by the receptor, for example, by the TCR, NKR or CAR (upon ligand binding to the receptor). The inventors have previously shown that use can be made of these ITSM, preferably ITSM and ITIM as present in, for example, the inhibitory tails of inhibitory immune receptor proteins like PD1 , to inhibit TCR and / or CAR signaling in T cells and NKR signaling in NK cells without the need for the extracellular domain of the inhibitory proteins to be present or to be interacting with their ligands (e.g. PD-L1 for PD1). The chimeric protein according to the invention, in particular when it also comprises a drug-regulated protein stability domain that allows for dose-dependent regulation of the amount of the chimeric protein in a cell (e.g. a T cell), thus provides for an efficient and reliable manner to precisely regulate T cell and or NK cell activation, thereby in turn regulating induction of the first inducible promoter according to the invention.

[0211]

[0215] Therefore, according to a preferred embodiment, the docking domain comprises a part comprising an immunoreceptor tyrosine-based switch motif (ITSM), an immunoreceptor tyrosine-based inhibitory motif (ITIM), or preferably an ITSM and an immunoreceptor tyrosine-based inhibitory motif (ITIM).

[0212]

[0216] Preferably the ITIM and / or ITSM is / are from an inhibitory receptor protein, preferably an inhibitory immune receptor protein, preferably from a protein selected from the group consisting of PD1 , BTLA, SIRPalpha, SIGLEC5, SIGLEC9, SIGLEC11 , PECAM1 and LY9. Preferably the inhibitory receptor protein, the inhibitory immune receptor protein, or protein selected from the group consisting of PD1 , BTLA, SIRPalpha, SIGLEC5, SIGLEC9, SIGLEC11 , PECAM1 or LY9 is from human.

[0213]

[0217] PD1 (also known as PD-1) is encoded by PDCD1 gene. PD1 is a type I transmembrane protein. Interaction with its ligands PD-L1 / PD-L2 causes downregulation of effector functions of cytotoxic T cells. Human PD1 has UniProtKB accession number Q15116. This sequence is 288 amino acids in length. Cytoplasmic domain of PD1 contains an ITIM and an ITSM motif. Phosphorylated ITSM in cytoplasmic domain of PD1 recruits SHP-2 phosphatase, which dephosphorylates key signaling molecules in TCR signaling pathway such as ZAP70, PKCtheta and CD3 zeta (CD247) and cause downregulation of TCR signaling (Bardhan et al, Front Immunol. 2016; 7: 550) and CD28 mediated co-stimulation (Hui et al, Science. 2017 Mar 31; 355(6332): 1428- 1433).

[0214]

[0218] B- and T-lymphocyte attenuator (BTLA) is mainly expressed in T cells, B cells and mature lymphocytes (Yue et al, Front Immunol. 2019; 10: 617). It is an immune regulator receptor playing a critical role in immune tolerance. Similar to PD1 , BTLA is a type I transmembrane glycoprotein. Engagement of BTLA receptor induce SHP- 1 / SHP-2 recruitment and downregulation of IL-2 secretion in T cells (Watanabe et al, Nat Immunol. 2003 Jul;4(7):670-9). Human BTLA protein has the UniProtKB accession number Q7Z6A9. This sequence is 289 amino acids in length. Cytoplasmic domain of BTLA contains an ITIM and an ITSM motif.

[0215]

[0219] SIRPA (also known as SIRPalpha, SIRPa, BIT, MFR, MYD1 , PTPNS1 , SHPS1 , SIRP) is expressed in myeloid cells. Upon engagement with is ligand CD47, it negatively regulates phagocytosis, mast cell activation and dendritic cell activation (Timms et al, Curr Biol. 1999 Aug 26;9(16):927-30, Latour et al, J Immunol. 2001 Sep 1 ; 167(5):2547-54, Matlung et al, Immunol Rev. 2017 Mar;276(1):145-164. doi: 10.1111 / imr.12527). In macrophages, SIRPA primarily associate with SHP-1 (Veillette et al, J Biol Chem. 1998 Aug 28;273(35):22719-28). SIRPA is a type I transmembrane protein. Human SIRPA protein has the UniProtKB accession number P78324. This sequence is 504 amino acids in length. Cytoplasmic domain of SIRPA contains two ITIMs and an ITSM motif.

[0216]

[0220] PECAM1 (also known as PECAM-1 , CD31) is expressed in T cell, B cells, platelets, monocytes, macrophages, and neutrophils (Newton-Nash et al, J Immunol. 1999 Jul 15;163(2):682-8). PECAM1 inhibits T cell and B cell signaling via recruitment of SHIP1 , SHP-1 and SHP-2 (Marelli-Berg et al, J Cell Sci. 2013 Jun 1 ;126(Pt 11):2343-52). In macrophages, ligand binding to PECAM1 leads to recruitment of SHP-1 and SHP2, downregulation of TNF-alpha, IL-6, and IFN-beta production and TLR4 signaling (Rui et al, J Immunol. 2007 Dec 1 ; 179(11):7344-51). PECAM1 negatively regulates platelet signaling pathway (Jones et al, FEBS Lett. 2009 Nov 19;583(22):3618-24). PECAM1 is a type I transmembrane protein. Human PECAM1 protein has the UniProtKB accession number P16284. This sequence is 738 amino acids in length. Cytoplasmic domain of PECAM1 contains an ITIM and an ITSM motif.

[0217]

[0221] Sialic acid-binding immunoglobulin-type lectins (Siglecs) are a group of immune regulatory receptors, mainly expressed on the cells of the hematopoietic system (Bornhdfft et al, Dev Comp Immunol. 2018 Sep;86:219-231). SIGLEC5 (also known as CD33L2, OBBP2) is expressed in monocytes, neutrophils, and B cells, SIGLEC9 is expressed in neutrophils, monocytes, dendritic cells, and NK cells while SIGLEC11 is expressed in macrophages (Macauley et al, Nat Rev Immunol. 2014 Oct; 14(10): 653-666). Most Siglecs have inhibitory ITIM / ITSM motifs that recruit SHP1 and SHP2 and act as negative regulators of immune system (Crocker et al, Nat Rev Immunol. 2007 Apr;7(4):255-66, Avril et al, J Biol Chem. 2005 May 20;280(20): 19843-51 , Haas et al, Cancer Immunol Res. 2019 May;7(5):707-718, Angata et al, J Biol Chem. 2002 Jul 5;277(27):24466-74). SIGLEC5, SIGLEC9 and SIGLEC11 are type I transmembrane proteins. They contain ITIM and ITSM motifs in their cytoplasmic domains. Human SIGLEC5 protein has the UniProtKB accession number 015389. This sequence is 551 amino acids in length. Human SIGLEC9 protein has the UniProtKB accession number Q9Y336. This sequence is 463 amino acids in length. Human SIGLEC11 protein has the UniProtKB accession number Q96RL6. This sequence is 698 amino acids in length.

[0218]

[0222] T-lymphocyte surface antigen Ly-9 (also known as LY9, SLAMF3, CD229) is expressed in thymocytes and in mature T and B lymphocytes (de la Fuente et al, Blood. 2001 Jun 1 ;97(11):3513-20). It has been reported to interact with SHIP-1 and SHP-2 (Puhet-Ortiz et al, Front Immunol. 2018 Nov 16;9:2661) and contribute to peripheral cell tolerance by functioning as a negative regulator of immune response (de Salort et al, Front Immunol. 2013; 4: 225). LY9 is a type I transmembrane protein. Human LY9 protein has the UniProtKB accession number Q9HBG7. This sequence is 655 amino acids in length. Cytoplasmic domain of LY9 contains two ITSM motifs.

[0219]

[0223] Thus the ITSM and / or ITIM that is comprised in the third part of the chimeric polypeptide may be an ITSM and / or ITIM that is comprised in SEQ ID No 109 - 116, or having a sequence having at least 80% identity, preferably at least 81 , 83, 87, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity, to an amino acid sequence according to SEQ ID NO 109 - 116.

[0220]

[0224] In some embodiments, the chimeric protein comprises:

[0221] (a) a docking domain that is able to bind to the receptor and to inhibit signal transduction induced when the receptor receives the activating signal, and

[0222] (b) a drug-regulated protein stability domain.

[0223]

[0225] In some embodiments, the drug-regulated protein stability domain is a CRBN polypeptide substrate domain capable of binding to the CRBN protein in response to a drug, preferably thereby promoting ubiquitin pathway-mediated degradation of the chimeric protein.

[0224]

[0226] In some embodiments the drug-regulated protein stability domain comprises a Cys2-His2 zinc finger domain that is able of drug-inducible binding to a CRBN polypeptide, preferably wherein the Cys2-His2 zinc finger domain is a hybrid zinc finger domain.

[0225]

[0227] In some embodiments, the drug that induces drug-inducible binding to the CRBN polypeptide is an immunomodulatory imide drug (IMiD), preferably wherein the IMiD is selected from thalidomide, lenalidomide, pomalidomide, avadomide, iberdomide, CC-885, salts and analogs thereof.

[0226]

[0228] In some embodiments, a cell according to the invention is provided, wherein the ITAM that is present in the antigen receptor encoded by the first nucleic acid part is an ITAM that is present in a TCR, CAR or NKR, more preferably wherein the ITAM is from, or in, a CD3 zeta chain, a CD3 epsilon chain, a CD3 delta chain, a CD3 gamma chain, a FceRI gamma chain, or DAP12.

[0227]

[0229] In some embodiments, a cell according to the invention is provided, wherein the docking domain further comprises an immunoreceptor tyrosine-based switch motif (ITSM), and / or an immunoreceptor tyrosine-based inhibitory motif (ITIM), or an ITSM and an immunoreceptor tyrosine-based inhibitory motif (ITIM), preferably wherein the ITIM and / or ITSM is / are from an inhibitory receptor protein, preferably an inhibitory immune receptor protein, preferably from a protein selected from the group consisting of PD1 , BTLA, SIRPalpha, SIGLEC5, SIGLEC9, SIGLEC11 , PECAM1 and LY9.

[0228]

[0230] The chimeric protein according to the invention may further comprise a drug- regulated protein stability domain that in the presence of a drug causes the chimeric protein to be degraded, therewith releasing the blockade of the signal transduction by the receptor, which release, in turn, allows signal transduction through the cell, and will allow for the production of the protein of interest (or biological) by the cells according to the invention.

[0229]

[0231] By providing a patient, having the cells according to the invention, with the drug, the cells can be tightly regulated in producing the antigen receptor encoded by the first nucleic acid part and / or the first protein of interest of the fourth nucleic acid parts, operably linked to the inducible promoter of the second nucleic acid part, both in a spatial (in a particular microenvironment, where the activating signal may be present) and in a temporal (at a desired moment) way. In addition, varying the amount of the drug, for example provided to the patient, will allow for tight regulation of the level of expression by the first inducible promoter comprised in the second nucleic acid part.

[0230]

[0232] In such embodiments, the invention thus allows for a cell, for example a T cell or a NK cells that under normal physiological conditions, i.e. wherein the cell is nonactivated, for example in the absence of antigen that may activate the antigen receptor, has low baseline expression of the antigen receptor encoded by the first nucleic acid part and that upon induction of signaling by the antigen receptor by binding of antigen, allows expression of the antigen receptor encoded by the first nucleic acid part by the first inducible promoter comprised on the second nucleic acid part, preferably in combination with the enhancer comprised in the third nucleic acid part, and wherein the expression of the antigen receptor can be tightly regulated by the chimeric protein in the absence or presence of varying amounts of the drug.

[0231]

[0233] The invention thus allows for tightly regulating the expression of the antigen receptor at baseline and upon activation of cells in a patient, for example T cells, and the on-site (e.g., in a tumor microenvironment).

[0232]

[0234] In some embodiments according to the invention, the drug-regulated protein stability domain is a CRBN polypeptide substrate domain capable of binding to the CRBN protein in response to a drug, preferably thereby promoting ubiquitin pathway- mediated degradation of the chimeric protein.

[0233]

[0235] In this embodiment, the chimeric protein according to the invention comprises a drug-regulated protein stability domain that is capable of interacting and binding with the CRBN protein in the presence of a drug. For example, various IMiDs, including those described herein, have been shown to bind to the CRBN protein, thereby promoting interaction between the CRBN protein and its target (see also Buhimschi et al. Biochemistry 2019, 58, 861-864), ubiquitination and subsequent degradation of the target protein.

[0234]

[0236] CRBN (Cereblon) is a 442 amino acid protein that forms an E3 ubiquitin ligase complex with damaged DNA binding protein 1 (DDB1), Cullin-4A (CLIL4A) and regulator of cullins 1 (ROC1 ; Angers et al. Nature 443: 590-593). This complex ubiquitinates a number of other proteins. It was shown that thalidomide, lenalidomide, pomalidomide, CC-122 (avadomide), CC-220 (iberdomide) and CC-885 each bind to CRBN (see, for example Lopez - Girona et al. Leukemia 26: 2326- 2335).

[0235]

[0237] The skilled person is aware of CRBN polypeptide substrate domain capable of binding to the CRBN protein in response to a drug, thereby promoting ubiquitin pathway-mediated degradation of the chimeric protein, and that are suitable for use in the current invention.

[0236]

[0238] In a preferred embodiment, the drug-regulated protein stability domain comprises a Cys2-His2 zinc finger domain that is able of drug-inducible binding to a CRBN polypeptide, preferably wherein the Cys2-His2 zinc finger domain is a hybrid zinc finger domain. Such drug-regulated protein stability domain comprises a Cys2- His2 zinc finger domain may also be referred to as “zinc finger degron”.

[0237]

[0239] The Cys2His2-like fold group (C2H2) is a well characterized class of zinc fingers that is extremely common in mammalian transcription factors. These domains adopt a simple ppa fold, forming two short p-strands connected by a turn (zinc knuckle; beta turn) followed by a short helix and have the amino acid sequence motif (Pabo et al. Annual Review of Biochemistry (2001). 70: 313- 40) X2-Cys-X2,4-Cys- X12-His-X3,4,5-His.

[0238]

[0240] In some embodiment, the chimeric protein comprises a CRBN polypeptide substrate domain that comprises one or more zinc fingers, i.e. , a zinc finger degron.

[0239]

[0241] Although not in particular limited to a particular CRBN polypeptide substrate domain, in particular a C2H2 zinc finger domain, in a some embodiments the CRBN polypeptide substrate domain is selected from the group consisting of IKZF1 , IKZF3, ZFN654, ZNF787, ZNF653, ZFP91 , ZNF276, ZNF827, or a fragment thereof that is capable of small molecule-inducible binding to the CRBN polypeptide, preferably wherein said fragment is selected from the group consisting of IKZF1 ZF2-3, IKZF3 ZF2-3, ZFP91 ZF4-5, ZNF276 ZF4-5, ZNF653 ZF4-5, and ZNF692 ZF4-5.

[0240]

[0242] According to another embodiment, the CRBN polypeptide substrate binding domain used in the method of the invention comprises or further comprises IKZF1 ZF3, preferably wherein the CRBN polypeptide substrate binding domain comprises the beta-turn of ZFP91 ZF4, the alpha-helix of IKZF1 ZF2, and IKZF1 ZF3.

[0241] Preferably the IKZF1 ZF3 is at the C-terminus of the second part of the chimeric protein according to the invention. Also provided is for the cell according to the invention comprising a chimeric protein according to the invention comprising such small molecule-regulated protein stability domain.

[0242]

[0243] The zinc finger degron polypeptide domains (CRBN polypeptide substrate domain(s) capable of binding CRBN in response to drug, thereby promoting ubiquitin pathway-mediated degradation of the chimeric protein) can be included as single degron polypeptide domains or as multiple degron polypeptide domains, optionally where multiple degron polypeptide domains are joined in a series or an array, optionally using polypeptide linkers, such as those known in the art.

[0244] The skilled person is well-aware of zinc finger degrons that are suitable for use in the current invention.

[0243]

[0245] Drugs (e.g. small molecules) suitable for regulation of degradation of the chimeric proteins according to the invention comprising one or more of such C2H2 zinc finger proteins, fragments or domains include the so-called immunomodulatory imide drugs (IMi Ds), including but not limited to thalidomide, lenalidomide, pomalidomide, CC-122 (avadomide), CC-220 (iberdomide) and CC-885 (see for example, Matyskiela et al. J. Med. Chem. 2018, 61 , 2, 535-542; 2017; doi.org / 10.1021 / acs.jmedchem.6b01921 and Gao et al. Biomarker Research (2020) 8:2; doi.org / 10.1186 / s40364-020-0182-y). The skilled person understands how to select a suitable drug, e.g., a suitable IMiD for use in the method according to the invention.

[0244]

[0246] Therefore, there is provided for the cell according to the inventions wherein the drug that allows the CRBN polypeptide substrate domain to bind to the CRBN protein, thereby promoting ubiquitin pathway-mediated degradation of the chimeric protein, is an IMiD, preferably selected from the group consisting of thalidomide, lenalidomide, pomalidomide, CC-122 (avadomide), CC-220 (iberdomide) and CC- 885.

[0245]

[0247] The immunomodulatory imide drug (IMiD) inducible zinc finger degron systems (i.e. examples of drug-regulated stability domains according to the invention, for example comprising a Cys2-His2 zinc finger domain, for example a hybrid Cys2-His2 zinc finger domain (or hybrid zing finger domain) above are as such known from the prior art and have been described, for example, by Sievers et al. Science. 2018 Nov 2;362(6414):eaat0572.

[0246]

[0248] The degron systems, as explained above, employs fusion of, in the context of the current invention, at least the docking domain of the chimeric protein according to the invention, with a short zinc finger degron (sometimes also referred to as (hybrid) zinc finger domain, Cys2-His2 zinc finger domain, and / or zinc finger polypeptide) that facilitates recruitment of the chimeric protein according to the invention to the IMiD / CRBN E3 ligase complex, e.g., in the presence of the small molecules known as IMiDs. It is generally thought that IMiDs bind to Cereblon (CRBN), the substrate receptor of the CRL4CRBN E3 ubiquitin ligase and that CRBN can recruit (fusion)proteins containing a zinc finger degron (as a drug-regulated protein stability domain) through interaction with the zinc finger degron, which interaction is mediated by the IMiDs such as thalidomide and its derivatives. This zinc finger degron system is based on human protein sequences, thus limiting the risk of immune-mediated rejection. In addition, protein stability is regulated by clinically approved small molecules, such as thalidomide, pomalidomide and lenalidomide (as examples of IMiDs), thereby facilitating clinical development of these systems.

[0247]

[0249] In preclinical work, this protein stability control system has demonstrated its value in clinically relevant applications, such as the regulation of CAR-T cell activity, when such zinc finger degrons are fused to CARs (Jan et al. Sci Transl Med. 2021 Jan 6;13(575):eabb6295). Furthermore, the inventors reported the use of the IMiD / zinc finger system in the Chemically Regulated and SH2-delivered Inhibitory Tail (CRASH-IT) switch platform, that, in preferred embodiments, is also used in the current invention (and referred to as rheostat switch and that includes, for example RheoBrick®, and that allows control over cellular activity levels of a variety of cell therapy platforms, such as CAR-T, TCR-T, and NK cells (Sahillioglu et al., WO202 1080427).

[0248]

[0250] Suitable chimeric proteins, zinc finger degrons and methods of preparing the same and that are preferably used in the current invention are known in the art and have been described in detail by the inventors in, for example, WO2021080427 and WO2023177296, and are for those aspects incorporated in here by reference.

[0249]

[0251] For example, in an embodiment of the invention, the chimeric protein (e.g., rheostat switch), may for example be RheoBrick®, and / or may have 3 functional domains: First, an SH2-based docking domain that enables engagement with phospho-ITAM motifs that are present in activated antigen receptors. Second, an inhibitory ITIM / ITSM motif containing domain that enables recruitment of inhibitory SHP1 and / or SHP2 phosphatases and therefore downregulation of the ITAM signaling pathway. Third, a drug regulated-protein stability domain (or degron) that enables dynamic control of rheostat switch, for example RheoBrick®, protein stability, and as a result the degree of ITAM signaling in immune cells. The chimeric protein, i.e. rheostat switch, for example RheoBrick®, can mediate fine control of ITAM signaling of suitable antigen receptors encoded by the first nucleic part and therewith enables regulation of expression levels of the chimeric antigen receptor encoded by the first nucleic acid and / or first protein of interest encoded by the fourth nucleic acid part, which are both under control of the first inducible promoter comprised in the second nucleic part of the first recombinant nucleic acid according to the invention. The expression levels of the antigen receptor (of the first nucleic acid part) and / or of the first protein of interest (of the fourth nucleic acid part) are regulated in an antigen dependent and drug (small molecule) regulated manner. As a consequence, expression of the antigen receptor and / or the first protein of interest is under control of an AND logic gate, which enables precise control of production levels the antigen receptor and / or the first protein of interest in antigen positive tumor microenvironment.

[0250]

[0252] Within the context of the current invention, the skilled person is therefore well aware off how to select one or more suitable chimeric protein according to the invention, preferably encoded by the fourth nucleic acid part and / or the fifth nucleic acid part, preferably the fifth nucleic acid part, and of methods and means for providing such chimeric proteins or nucleic acids encoding such chimeric protein within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying examples, as well as the prior art cited herein.

[0251]

[0253] Also provided is for a cell according to the invention wherein the cell further comprises a recombinant switch system or a nucleic acid encoding said recombinant switch system, wherein the switch system is able to bind to the antigen receptor encoded by the first nucleic acid part and modify signal transduction that is induced when the antigen receptor encoded by the first nucleic acid part is activated.

[0252]

[0254] In addition to the chimeric protein described above, the cell according to the invention may comprise any type of recombinant switch system or a nucleic acid encoding such switch system, wherein the switch system is able modify signal transduction that is induced when the antigen receptor encoded by the first nucleic acid part is activated, increase or decrease immune cell functions, or induce cell death, for example by, in a non-limiting example, binding to the antigen receptor encoded by the first nucleic acid part.

[0253]

[0255] Such switch system may be an ON switch, i.e. a system that leads to activation of signaling via the antigen receptor and / or increase of immune cell functions in the presence of the inducer / regulator of the switch. For example, the switch described in WO2023177296 is an example of such ON switch system.

[0256] Such switch system may also be an OFF switch, i.e. a system that leads to inhibition of signaling via the antigen receptor and / or decrease of immune cell functions and / or induce cell death in the presence of the inducer / regulator of the switch.

[0254]

[0257] For example, the inducible caspase 9 (iCasp9) and Herpes Simplex Virus Thymidine Kinase (HSV-TK) switches described in the review (Sahillioglu et al. Curr Opin Immunol . 2022 Feb:74:190-198. doi: 10.1016 / j.coi.2021 .07.002) are an example of such OFF-switch systems.

[0255]

[0258] Other switch systems suitable for use in the inventions are, for example, RQR8, CAR-SMASh fusion, CAR-FKBV12(F36V) fusion, CAR-LID fusion, iMC switch, split CAR, STOP-CAR, UniCAR, methotrexate repressible CAR that summarized in the review (Sahillioglu et al. Curr Opin Immunol . 2022 Feb:74: 190- 198. doi: 10.1016 / j.coi.2021 .07.002), and disclosed in WO2019089592, WO 2015 / 057834, W02020132039, WO2021188286, WO2017181119, W02019007869. The principle of ON- and OFF-switches for regulating, e.g. CAR, TCR or NKR signaling is, for example, described by Jan et al (Sci Transl Med. 2021 Jan 6; 13(575): eabb6295. doi: 0.1126 / scitranslmed.abb6295).

[0256]

[0259] Within the context of the current invention, a switch system relates to a system within the cell according to the invention, formed by one or more (recombinant or chimeric) proteins that, by binding to the antigen receptor encoded by the first nucleic acid part can regulate signaling by the antigen receptor upon binding thereof with an antigen. The amount of the switch system in the cell may itself be regulated, for example by small drugs, including I M I D drugs as described herein. The switch system may be a system that allows signaling in the presence of the switch system (OFF switch) or the switch system may be a system that allows for signaling in the absence of the switch system (ON switch).

[0257]

[0260] The switch system may be encoded by a nucleic acid comprised in the fourth nucleic acid part, in the fifth nucleic acid part, or in both, preferably the fifth nucleic acid part.

[0258]

[0261] Within the context of the current invention, the skilled person is therefore well aware off how to select one or more suitable switch systems according to the invention, preferably encoded by the fourth nucleic acid part and / or the fifth nucleic acid part, preferably the fifth nucleic acid part, and of methods and means for providing such switch systems or nucleic acids encoding such switch systems within the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying examples, as well as the prior art cited herein.

[0259]

[0262] Also provided is for a cell according to the invention wherein the cell is a T- cell or a NK-cell.

[0260]

[0263] The skilled person understand that the invention is not in particular limited by the type of cell. In some embodiments the cell is a prokaryotic cell. In some embodiments, the cell is a eukaryotic cell. Preferably the cell is a eukaryotic cell.

[0261]

[0264] In preferred embodiments, the cell is an immune cell. In some embodiments, the cell is an animal or human cell, for example human immune cell or for example an animal immune cell. In some embodiments, the cell is a human cell, a rodent cell, a rabbit cell, a rat cell, a mouse cell, or a primate cell. In some embodiments, the cells are stem cells, for example, pluripotent stem cells, for example induced pluripotent stem cells.

[0262]

[0265] In preferred embodiments, the cell is a human immune cell. In preferred embodiments wherein the cell is an immune cell, the immune cell is preferably selected from the group consisting of a T cell, A TCR-expressing T cell, a TCR- modified T cell, a CAR T cell, an NK cell, and a CAR NK cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a CAR T cell. In some embodiments, the cell is an NK cell. In some embodiments, the cell is a CAR NK cell.

[0263]

[0266] In some embodiments, the cell is a macrophage, including a CAR macrophage (see, for example www.pennmedicine.org / news / news- releases / 2022 / january / first-in-human-trial-with-car-macrophages-shows-the-cell- therapy-safe-feasible-for-solid-tumors and eBioMedicine 2022;76: 103873 or doi.org / 10.1016 / j.ebiom.2022.103873).

[0264]

[0267] Preferably, the immune cell is selected from the group consisting of a human T cell, a human CAR T cell, a human TCR-modified T cell (also sometimes referred to as engineered T cell receptor T cells), a human NK cell, a human CAR NK cell and a human macrophage.

[0265]

[0268] The skilled person is well aware of the existence of different cells, including different immune cells, and knows how to recognize such cells. For example, T cells or T lymphocytes play a vital role in cell-mediated immunity. They can be distinguished from other lymphocytes, such as B cells and natural killer cells (NK cells), by the presence of a T cell receptor (TCR) or chimeric antigen receptor (CAR) on the cell surface. A CAR T cell is a T cell expressing a CAR complex.

[0266]

[0269] There are distinct types of T cells, including but not limited to T helper cells (TH cells), cytolytic T cells and regulatory T cells. TH cells express CD4 on their surface and become activated when they are presented with peptide antigens on the surface of antigen presenting cells (APCs). These cells can differentiate into one of several subtypes which secrete different cytokines to facilitate diverse types of immune responses.

[0267]

[0270] Cytolytic T cells (TC cells, or CTLs) destroy virally infected cells and tumor cells and are also implicated in transplant rejection. CTLs express CD8 at their surface. These cells recognize their targets by binding to antigen associated with MHC class I, which is present on the surface of all nucleated cells. Regulatory T cells (Tregs) inhibit immune reactions, for instance by secretion of molecules such as IL-10, and these cells are characterized by expression of the transcription factor FOXP3.

[0268]

[0271] Another example are memory T cells, which are a subset of antigen-specific T cells that persist long-term after an infection has resolved. They quickly expand to large numbers of effector T cells upon re-exposure to their cognate antigen, thus providing the immune system with "memory" against past infections. Memory cells may be either CD4+ or CD8+. Preferably the T cell is a CD4 positive T cell. Preferably the T cell is a CD8 positive T cell.

[0269]

[0272] Natural Killer Cells (or NK cells) are a type cytolytic cells that are part of the innate immune system. NK cells provide responses to innate signals from virally infected cells in a peptide MHC independent manner. NK cells are defined as large granular lymphocytes and constitute the third kind of cells differentiated from the common lymphoid progenitor generating B and T lymphocytes. NK cells are known to differentiate and mature in e.g., bone marrow, lymph node, spleen, tonsils, and thymus. A CAR NK cell is an NK cell expressing a CAR complex (see, for example, Zhang et al. Biomarker Research volume 10, Article number: 12 (2022)).

[0270]

[0273] Macrophages are a type of white blood cell of the immune system that engulfs and digests pathogens, such as cancer cells, microbes, cellular debris, and foreign substances, which do not have proteins that are specific to healthy body cells on their surface. A further type of immune cells that can be suitably used according to the invention are tumor-infiltrating lymphocytes, or TILs. These and other cells are well-known to the skilled person.

[0271]

[0274] Also provided is for a cell according to the invention wherein the first recombinant nucleic acid and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system is integrated in the genome of the cell.

[0272]

[0275] The first recombinant nucleic acid and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system may be integrated into the genome of the cell (host cells) wherein said first recombinant nucleic acid and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system has been introduced.

[0273]

[0276] For example, the first recombinant nucleic acid and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system may be provided to the cell as a expression cassette provided with means that allows integration of the expression cassette and / or the first recombinant nucleic acid comprised and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system therein in the genome of the host cell. The skilled person is well aware of methods and means for integration of the first recombinant nucleic acid and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system into the genome of the host cell, for example based on lentivirus systems and vectors such as recombinant lentiviral vectors. As used herein, the term “recombinant lentiviral vector” and the like refers to an artificially created polynucleotide vector, e.g. expression cassette, assembled from a lentivirus and a plurality of additional segments because of human intervention and manipulation. Alternatively, integration of the first recombinant nucleic acid (molecule) and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system according to the invention may be achieved using DNA manipulation techniques including but not limited to CRISPR-Cas, zinc fingers nuclease, Talens and the like.

[0274]

[0277] Within the context of the current invention, the skilled person is therefore well aware off how to integrate the first recombinant nucleic acid (molecule) and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system according to the invention into the genome of the cells, and of methods and means for achieving this, for example using methods as described in the accompanying examples, as well as the prior art cited herein.

[0275]

[0278] Also provided is for a cell according to the invention wherein the antigen receptor encoded by the first nucleic acid part is a T-cell receptor, a NK-cell receptor, or a chimeric antigen receptor (CAR).

[0276]

[0279] The skilled person understands that the invention is not in particular limited by the type of antigen receptor that is encoded by the first nucleic acid part. In some embodiments, the antigen receptor is a tumor antigen receptor, i.e. a receptor for an antigen that is expressed on the cell surface of a tumor cell, preferably wherein this antigen is not, or only to a limited extent, as compared to expression on by a tumor cells, expressed on non-tumor cells. For example, the antigen may be a neo-antigen. A skilled person understands, within the context of the current invention, antigen receptors suitable for use in the current invention.

[0277]

[0280] In preferred embodiments, the antigen receptor encoded by the first nucleic acid part is a T-cell receptor. In preferred embodiments, the antigen receptor encoded by the first nucleic acid part is a NK-cell receptor. In preferred embodiments, the antigen receptor encoded by the first nucleic acid part is a CAR.

[0278]

[0281] T-cell receptors, NK-cell receptors and CAR are known to the skilled person and the prior art provided well-known examples of T-cell receptors, NK-cell receptors, and CAR suitable for use in the current invention.

[0279]

[0282] As the skilled person knowns, T cell activation via a T-cell receptor commonly relies on the phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMs) present in the cytoplasmic domain of CD3-zeta. Such ITAMS, for example, form CD3-zeta's cytoplasmic domain, are also commonly used in CAR. It will be understood that the first inducible promoter comprised in the second nucleic acid part is preferably a promoter that is induced by CD3-zeta ITAM signaling (upon activation by binding with the antigen).

[0280]

[0283] Also provided is for a cell according to the inventions wherein the enhancer or functional part thereof comprised in the third nucleic acid part is viral enhancer, a T- cell specific enhancer, a NK-cell specific enhancer, a lymphocyte-specific enhancer, a U3 LTR enhancer, a lentiviral U3 LTR enhancer, a retroviral U3 LTR enhancer, a MSCV U3 LTR enhancer, MoMLV enhancer, FMLV enhancer, SFFVP enhancer, TCR alpha and beta enhancer, a CD3 enhancers, or a CD2 gene enhancer, preferably the enhancer is a MSCV U3 LTR enhancer.

[0281]

[0284] These enhancers are known from the prior art. Exemplary, and in some embodiments, preferred sequences of such enhancers are provided herein, for examples in the Table 1 - 6.

[0282]

[0285] In a preferred embodiment, the enhancers or functional parts thereof comprised in the third nucleic acid part are enhancers as disclosed herein, in particular in the examples.

[0283]

[0286] Also provided is for a cell according to the invention wherein the third nucleic acid part is upstream of the second nucleic acid part, or wherein the third nucleic acid part is upstream of the first nucleic acid part and the second nucleic acid part, or wherein the third nucleic acid part is downstream of the second nucleic acid part, or wherein the third nucleic acid part is downstream of the first nucleic acid part and the second nucleic acid part.

[0284]

[0287] The skilled person understands that the invention is not in particular limited by the order of the first, second and / or third nucleic acid part in the first recombinant nucleic acid according to the invention. The skilled person understands that various orders wherein the first, second and / or third nucleic acid are included in the first recombinant nucleic acid allow for the invention, for example, allow for low baseline (tonic) expression of the antigen receptor according to the invention, thereby preventing or inhibiting premature exhaustion of the, for example, T cell and / or for increased, for example, T cell activity (e.g. towards tumor cells) and expression of proteins of interest (e.g. the first protein of interest encoded by the fourth nucleic acid part).

[0285]

[0288] As will be understood by the skilled person, the current invention also allows to regulate (the level of) expression of the protein of interest in a subject, for example a patient, in need thereof. At the same time the invention allows for regulating activity of various cell in response to an activating signal, for example regulate the activity of T cells towards a tumor cell once the TCR recognized an antigen on the tumor cell, and becomes activated, leading to ITAM-mediated signal transduction through the cell. By being able to regulate both expression of the protein of interest and regulate activity of the cell in response to an activating signal, the invention thus allows for robust treatment of a condition to be treated, for example a cancer / a tumor, while at the same allowing to precisely regulate the level of activity of the cell and the level of expression of the protein of interest to a desired level in the subject, for example patient, to be treated.

[0286]

[0289] Therefore, there is provided for the cell according to the invention for use as a medicament, preferably for use in the treatment of a caner and / or for the treatment of a tumor in a subject.

[0287]

[0290] In view of the disclosure herein there is also provided for the cell(s) according to the invention for use as a medicament, preferably for use in the treatment of cancer and / or for use in the treatment of a tumor in a subject, preferably wherein the treatment comprises administering the cells according to the invention to the subject and, optionally, administering of a drug that is able to regulate the drug-regulated protein stability domain comprised in the chimeric protein of switch system.

[0288]

[0291] Therefor there is also provided for the cell(s) according to the invention for use as a medicament, preferably for use in the treatment of cancer and / or for use in the treatment of a tumor in a subject, optionally wherein administering of a drug that is able to regulate the drug-regulated protein stability domain comprised in the chimeric protein and / or in the recombinant switch system comprises varying the dose of the drug that is able to regulate the drug-regulated protein stability domain. By varying the dose, the level of expression of the antigen receptor and / or first protein of interest may be modulated. Such level may, for example be monitored from blood samples, using techniques such as ELISA.

[0289]

[0292] In even other embodiments according to the invention there is provided for a drug for use as a medicament, preferably for use in the treatment of cancer and / or for use in the treatment of a tumor in a subject, wherein the treatment comprises administering cells according to the invention to the subject and administering the drug, wherein the drug is able to regulate the drug-regulated protein stability domain.

[0290]

[0293] Preferably the drug is at least one I Mi D, preferably selected from the group as disclosed herein, preferably lenalidomide.

[0291]

[0294] Also provided is for a method of preparing the cell according to the invention wherein the method comprises the step of introducing the first recombinant nucleic acid to the cells.

[0292]

[0295] Within the context of the current invention, the skilled person is well aware of how to prepare the cells according to the invention and how to introduce the first recombinant nucleic acid in the cells. The skilled person is well aware of methods and means for achieving this with the first recombinant nucleic acid according to the invention, for example using methods as described in the accompanying examples.

[0293]

[0296] Also provided is for the first recombinant nucleic acid according to the invention, a vector or an expression cassette comprising the first recombinant nucleic acid according to the invention and / or the nucleic acid encoding for the chimeric protein according to the invention and / or the nucleic acid encoding the switch system according to the invention.

[0294]

[0297] The skilled person will understand that in the context of the current invention, such first recombinant nucleic acid, vector or expression cassette may comprise further or additional function features such as, but not limited to polyadenylation signals (e.g. SV40pA), constitutive transport elements (CTEs), posttranscriptional regulatory elements (e.g. WPRE), 3’llTRs and / or (inducible) promoters (in the context of the current invention; for example, pNFAT).

[0295]

[0298] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art (including the contents of the references cited herein), readily modify and / or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein.

[0296]

[0299] All references cited herein, including journal articles or abstracts, published or corresponding patent applications, patents, or any other references, are entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited references. Additionally, the entire contents of the references cited within the references cited herein are also entirely incorporated by references.

[0297]

[0300] It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one of ordinary skill in the art.

[0301] It will be understood that all details, embodiments, and preferences discussed with respect to one aspect of embodiment of the invention is likewise applicable to any other aspect or embodiment of the invention and that there is therefore not need to detail all such details, embodiments, and preferences for all aspect separately.

[0302] Having now generally described the invention, the same will be more readily understood through reference to the following examples which is provided by way of illustration and is not intended to be limiting of the present invention. Further aspects and embodiments will be apparent to those skilled in the art.

[0298]

[0303] Table 1 provides an overview of nucleotide sequences of the expression cassettes as described in Figure 1A, 2A, 3A, 4A, 5A, 6A and 7A.

[0299]

[0300]

[0304] Table 2 provides an overview of full lentiviral vector sequences containing the expression cassettes in Table 1.

[0301]

[0302] 305] Table 3 provides an overview of Nucleotide sequences of regulatory elements as described in Table 1 , and Figure 1A, 2A, 3A, 4A, 5A, 6A and 7A, and are preferred according to the invention, for example preferred (inducible) promoters according to the invention and / or preferred enhancers according to the invention.

[0303]

[0306] Table 4 provided an overview of translated nucleotide sequences as described in Table 1 , and Figure 1A, 2A, 3A, 4A, 5A, 6A and 7A.

[0304]

[0307] Table 5 provided an overview of (preferred) Lentiviral vector structural elements and vector backbone.

[0308] Table 6 provides a non-limiting overview of additional enhancers according to the invention:

[0305]

[0309] In the following, specific embodiments encompassed by the invention are disclosed using letter codes (i.e., A1-A16 and B1-B17) that identify features of the cells, and methods using such cells, according to the invention. Table 7 illustrates the relationship between the identifying letter codes and the corresponding features.

[0306]

[0310] Table 7. Legend with correlation of letter codes and features in embodiments, e.g. of the cell, of the invention:

[0307]

[0311] In preferred embodiments of the enhancers according to the invention, the enhancers defined as A3 - A16 above comprise the consensus motif according to A1 , or more preferably A2. In preferred embodiments of the inducible promoters according to the invention, the enhancers defined as B2 - B17 above, are ITAM signaling responsive promoters.

[0308]

[0312] A non-exhaustive list of embodiments according to the invention include (based on the legend of features shown in table 7), cells according to the invention, and method using such cells, comprising the following combination of features: A1 + B1 , A1 + B2, A1 + B3, A1 + B4, A1 + B5, A1 + B6, A1 + B7, A1 + B8, A1 + B9, A1 + B10, A1 + B11 , A1 + B12, A1 + B13, A1 + B14, A1 + B15, A1 + B16, A1 + B17, A2+B1 , A2+B2, A2+B3, A2+B4, A2+B5, A2+B6, A2+B7, A2+B8, A2+B9, A2+B10, A2+B11 , A2+B12, A2+B13, A2+B14, A2+B15, A2+B16, A2+B17, A3+B1 , A3+B2, A3+B3, A3+B4, A3+B5, A3+B6, A3+B7, A3+B8, A3+B9, A3+B10, A3+B11 , A3+B12, A3+B13, A3+B14, A3+B15, A3+B16, A3+B17, A4+B1 , A4+B2, A4+B3, A4+B4, A4+B5, A4+B6, A4+B7, A4+B8, A4+B9, A4+B10, A4+B11 , A4+B12, A4+B13, A4+B14, A4+B15, A4+B16, A4+B17, A5+B1 , A5+B2, A5+B3, A5+B4, A5+B5, A5+B6, A5+B7, A5+B8, A5+B9, A5+B10, A5+B11 , A5+B12, A5+B13, A5+B14, A5+B15, A5+B16, A5+B17, A6+B1 , A6+B2, A6+B3, A6+B4, A6+B5, A6+B6, A6+B7, A6+B8, A6+B9, A6+B10, A6+B11 , A6+B12, A6+B13, A6+B14, A6+B15, A6+B16, A6+B17, A7+B1 , A7+B2, A7+B3, A7+B4, A7+B5, A7+B6, A7+B7, A7+B8, A7+B9, A7+B10, A7+B11 , A7+B12, A7+B13, A7+B14, A7+B15, A7+B16, A7+B17, A8+B1 , A8+B2, A8+B3, A8+B4, A8+B5, A8+B6, A8+B7, A8+B8, A8+B9, A8+B10, A8+B11 , A8+B12, A8+B13, A8+B14, A8+B15, A8+B16, A8+B17, A9+B1 , A9+B2, A9+B3, A9+B4, A9+B5, A9+B6, A9+B7, A9+B8, A9+B9, A9+B10, A9+B11 , A9+B12, A9+B13, A9+B14, A9+B15, A9+B16, A9+B17, A10+B1 , A10+B2, A10+B3, A10+B4, A10+B5, A10+B6, A10+B7, A10+B8, A10+B9, A10+B10, A10+B11 , A10+B12, A10+B13, A10+B14, A10+B15, A10+B16, A10+B17, A11 + B1 , A11 + B2, A11 + B3, A11 + B4, A11 + B5, A11 + B6, A11 + B7, A11 + B8, A11 + B9, A11 + B10, A11 + B11 , A11 + B12, A11 + B13, A11 + B14, A11 + B15, A11 + B16, A11 + B17, A12+B1 , A12+B2, A12+B3, A12+B4, A12+B5, A12+B6, A12+B7, A12+B8, A12+B9, A12+B10, A12+B11 , A12+B12, A12+B13, A12+B14, A12+B15, A12+B16, A12+B17, A13+B1 , A13+B2, A13+B3, A13+B4, A13+B5, A13+B6, A13+B7, A13+B8, A13+B9, A13+B10, A13+B11 , A13+B12, A13+B13, A13+B14, A13+B15, A13+B16, A13+B17, A14+B1 , A14+B2, A14+B3, A14+B4, A14+B5, A14+B6, A14+B7, A14+B8, A14+B9, A14+B10, A14+B11 , A14+B12, A14+B13, A14+B14, A14+B15, A14+B16, A14+B17, A15+B1 , A15+B2, A15+B3, A15+B4, A15+B5, A15+B6, A15+B7, A15+B8, A15+B9, A15+B10, A15+B11 , A15+B12, A15+B13, A15+B14, A15+B15, A15+B16, A15+B17, A16+B1 , A16+B2, A16+B3, A16+B4, A16+B5, A16+B6, A16+B7, A16+B8, A16+B9, A16+B10, A16+B11 , A16+B12, A16+B13, A16+B14, A16+B15, A16+B16, A16+B17.

[0313] As an illustrative example of the embodiments disclosed above, the embodiment defined by A10 + B2 embodies a cell according to the invention, wherein the second nucleic acid part comprises a first inducible promoter, wherein the first inducible promoter is a NFAT promoter, and wherein the first recombinant nucleic acid further comprises a third nucleic acid part, wherein the third nucleic acid comprises all or a functional portion of an enhancer, and wherein the enhancer is a MSCV U3 LTR enhancer.

[0314] In a preferred embodiment, any of the embodiments disclosed above (based on the legend of features shown in Table 7) is each individually combined with the feature that the antigen receptor is a TCR. In a preferred embodiment, any of the embodiments disclosed above (based on the legend of features shown in Table 7) is each individually combined with the feature that the antigen receptor is a CAR. In a preferred embodiment, any of the embodiments disclosed above (based on the legend of features shown in Table 7) is each individually combined with the feature that the antigen receptor is an NKR.

[0309]

[0315] In preferred embodiment of the above, the cell is a T cell. Even more preferably, the cell is a NK cell.

[0310]

[0316] In a more preferred embodiment, any of the embodiments disclosed above (based on the legend of features shown in Table 7) is each individually combined with the feature that the antigen receptor is a TCR and with the feature wherein the cell comprises a chimeric protein / recombinant switch system according to the invention. In a preferred embodiment, any of the embodiments disclosed above (based on the legend of features shown in Table 7) is each individually combined with the feature that the antigen receptor is a CAR and with the feature wherein the cell comprises a chimeric protein / recombinant switch system according to the invention. In a preferred embodiment, any of the embodiments disclosed above (based on the legend of features shown in Table 7) is each individually combined with the feature that the antigen receptor is a NKR and with the feature wherein the cell comprises a chimeric protein / recombinant switch system according to the invention.

[0311] EXAMPLES

[0312] Example 1

[0313] Results and discussion

[0314]

[0317] Chronic activation of cell therapy products due to tonic signaling, or prolonged stimulation of activation receptors leads to differentiation of T cells from memory phenotype to effector phenotype, and into an exhausted state. Less differentiated and less exhausted phenotypes are associated with improved T cell function; therefore, it is preferable to delay differentiation and exhaustion to maximize therapeutic potential of cell therapy products.

[0315]

[0318] It has been previously reported that tonic signaling induced exhaustion can be delayed by culturing cells in the presence of kinase inhibitors (dasatinib), or using a small molecule regulated engineered antigen receptor (e.g. ON CARs) and culturing such regulatable CAR-T cells at the OFF-state ex vivo (Weber et al. Science. 2021 Apr 2;372(6537):eaba1786).

[0316]

[0319] Novel methods to prevent and / or reverse exhaustion of cell therapy products are desirable, as the current methods have limitations. For example, prevention of T cell activation in vivo using dasatinib leads to immunosuppression due to inhibition of kinases in T, B and NK cells. Weber et al. demonstrated that an ON CAR composed of a chimeric antigen receptor fused to a degron domain can be used to delay exhaustion and differentiation of such CAR-T cells, but the antigen signaling is not fully suppressed at the OFF state (see Figure 1 B and 1 D of the reference Weber et al. Science. 2021 Apr 2;372(6537):eaba1786 where 40 % IFN gamma signaling remained in the absence of small molecule activator of the ON CAR, Shield-1).

[0317]

[0320] As such, remaining tonic CAR-T signaling can lead to accumulation of exhaustion and differentiated T cell phenotype, particularly in combination with CARs that are highly prone for self-aggregation and / or when CAR antigens are also secreted and present in the serum. In such conditions, it would be desirable to offset tonic signaling of CAR-T cells and / or activation of CAR-T cells due to antigen present in serum at low concentrations by additional mechanisms.

[0318]

[0321] In this invention, we disclose a novel method to boost cell functionality in, for example T cells and NK cells, by controlling, in particular lowering, surface antigen receptor density (i.e. expression of an antigen receptor, for example a T-cell receptor, a NK-cell receptor, or a chimeric antigen receptor (CAR)), prior to antigen exposure (e.g. prior to exposure of the cells to the (cognate) antigen), and thereby limiting tonic signaling induced T cell (dys)function.

[0319]

[0322] In the examples, preferred aspects of the invention are described.

[0320]

[0323] Briefly, in the examples, tonic signaling prone L19 ScFv based second generation Fibronectin EDB (Extra-domain B) specific chimeric antigen receptor (Zhang et al. J Immunother Cancer. 2023; 11 (8): e007199) was placed under the control of an ITAM signaling responsive NFAT promoter in combination with an enhancer (e.g. MSCV enhancer (CC239), or CD2 enhancer (CC266), Figure 1A).

[0321]

[0324] Under such configuration, prior to exposure to antigen positive cells, the density of antigen receptors on the T cell surface was significantly lower compared to T cells where the antigen receptor is expressed under a constitutively active promoter (e.g. PGK promoter (CC268)), or a combination of an enhancer and a constitutively active promoter (e.g. MSCV enhancer and CMV promoter (CC132), or MSCV enhancer and PGK promoter (CC264)) (Figure 1A-B).

[0322]

[0325] The low level of surface CAR expression under the control of an enhancer and the NFAT promoter prior to antigen exposure (Figure 1 B) limits the tonic signaling activity due to self-aggregation of receptors and / or activation by antigen present in serum. Surprisingly, when an enhancer and the NFAT promoter driven CAR expressing T cells were co-cultured with the antigen positive target cells (CC239 or CC266), they induced higher levels of cytokine production compared to a constitutively active promoter driven CAR expressing T cells (CC268), or an enhancer and a constitutively active promoter driven CAR expressing T cells (CC132 or CC264, Figure 1C). IFNg production by such T cells can be further boosted by adding an immunomodulatory drug (IMiD) such as lenalidomide (Figure 1C). Lenalidomide, pomalidomide and other IMiDs have costimulatory effects, increase IL-2 and IFNg production, stimulate T-cell proliferation, and enhance cytotoxic T lymphocyte (CTL) and natural killer (NK) effector cell activity (Dredge et al. J Immunol . 2002 May 15;168(10):4914-9. doi: 10.4049 / jimmunol.168.10.4914, Corral et al. J Immunol . 1999 Jul 1 ;163(1):380-6, Geng et al. Cell Chem Biol . 2022 Aug 18;29(8):1260-1272.e8. doi: 10.1016 / j.chembiol.2022.05.012. Epub 2022 Jun 21 , Gdrgun et al. Blood . 2010 Oct 28;116(17):3227-37. doi: 10.1182 / blood-2010-04-279893. Epub 2010 Jul 22)

[0323]

[0326] We have surprisingly showed that A549 adenocarcinoma cells that were transduced with lentiviral vectors CC239 or CC266 (vectors that contain an enhancer and the NFAT promoter driven CAR expression cassettes) displayed only minimal cell surface CAR expression on the tumor cell line, whereas A549 cells that were transduced with lentiviral vectors CC132, CC264 and CC268 (vectors that contain a constitutive promoter driven CAR expression cassettes) displayed strong CAR expression on the tumor cell surface (Figure 1 E).

[0324]

[0327] This surprising finding shows that an enhancer and the NFAT promoter driven CAR expression methodology disclosed herein is particularly attractive in applications such as in situ / in vivo generated CAR-T cells where the accidental CAR expression on the tumor cell surface needs to be avoided. In situ / in vivo CAR-T cell generation approaches (see, Short et al. Trends Pharmacol Sci. 2024 Apr 12:S0165- 6147(24)00052-X) are currently limited by the problem of accidental delivery of the CAR to tumor cells, and the subsequent antigen escape as a result of epitope masking due to interactions between the CAR and the antigen on the surface of tumor cells in cis (Ruella et al. Nat Med. 2018 Oct; 24(10): 1499-1503). The novel expression systems as disclosed herein, such as an enhancer and the NFAT promoter driven CAR expressing expression cassettes, may mitigate this problem by providing reduced CAR expression on tumor cells.

[0325]

[0328] The MSCV enhancer sequence use in the exemplified design has been derived from the U3 region of the 3' long terminal repeat (LTR) of Murine Stem Cell Virus. This sequence also has a promoter function. We orient the MSCV promoter / enhancer (abbreviated as pMSCV or MSCV U3 in the Figures) and NFAT promoter in a “back- to-back” configuration so that the transcription from these promoters are in the opposite direction and away from each other (i.e. bidirectional expression cassette, Figure 1A).

[0326]

[0329] This method enables us to express switch molecules, such as RheoBrick “ON switch” using a minimal sized expression cassette and vector design without creating transcriptional interference (see Figure 2).

[0327]

[0330] In vectors CC132, CC239 and CC264, we placed the reporter gene truncated human EGFRt (huEGFRt) under control of MSCV promoter to demonstrate the constitutive gene expression from this promoter (Figure 1A, D). In the vector CC266, we placed a CD2 enhancer between CMV promoter and NFAT promoter that are in “back-to-back” configuration to create a bidirectional expression system (Figure 1A).

[0328]

[0331] MSCV enhancer / promoter sequence, and related enhancer / promoter sequences derived from long terminal repeats (LTRs) of retroviruses such as MPSV, MoMLV, FMLV and SFFVP have been shown to include endogenous NFAT binding sites that supports expression of downstream genes (Wahlers et al. Mol Ther. 2002 Sep;6(3):313-20. doi: 10.1006 / mthe.2002.0671).

[0329]

[0332] Such promoter / enhancer sequences contain numerous other transcription binding sites including acute myeloid leukemia / core binding factor, basic helix-loop- helix, E twenty-six (ETS), GATA-binding factors, Myb, nuclear factor 1 , and glucocorticoid receptor, SP1 and YY1 , and therefore considered as constitutive promoters such that these promoters are active even in the absence of T cell activation. In contrast, in the invention disclosed here, the NFAT promoter as part of the bidirectional expression system that drives expression of the CAR is in the opposite direction to the MSCV enhancer / promoter sequence, therefore the expression of the CAR is not constitutive but inducible upon T cell activation. This important step, the inducible expression of CAR as a result of T cell activation, enable us to create a positive feedback loop, which in turn boost functionality of cell therapy products.

[0330]

[0333] Enhancer and NFAT promoter driven CAR expression system is believed to rely on a positive feedback loop upon exposure to antigen positive cells: more antigen stimulation yields more CAR expression which in turn yields more T cell stimulation. It was surprisingly found this design works given the facts that 1) antigen receptor expression in the cells is near baseline levels prior to exposure to antigen positive target cells, 2) it was not clear that a positive feedback loop could be established to accumulate critical CAR density on the cell surface to yield significant T cell activation, 3) it was unknown if the feedback loop could be sustained, and 4) it was unknown that the activation levels of CAR-T cells using an enhancer and the NFAT promoter driven CAR expression could surpass the activation levels of CAR-T cells using a constitutively active promoter driven CAR expression, or an enhancer plus a constitutively active promoter driven CAR expression.

[0331]

[0334] The enhancer element in the proximity to the NFAT promoter is important to establish and sustain the feedback loop: T cells or NK cells equipped with a CAR expression cassette that only contain NFAT promoter in the absence of an enhancer (CC248) produce less IFNg compared to T cells equipped with a constitutively active promoter driven CAR expression cassette (CC268), or CAR-T cells equipped with an enhancer and a constitutively active promoter driven CAR expression cassette (CC264, Figure 1C). This finding surprisingly shows that, to sustain the positive feedback loop, antigen receptor expression needs to be driven by an enhancer element and the NFAT promoter, while the NFAT promoter driven antigen receptor expression alone without an enhancer may not be sufficient to sustain positive feedback loop.

[0332]

[0335] Therapeutic cargo molecules, such as cytokine encoding genes can be placed within the same open reading frame together with the antigen receptor, which creates a compact expression system to create gene expression cassettes and / or viral vectors with minimal size.

[0333]

[0336] T cell functionality (e.g. IFNg production levels) can be increased even further by placing a cytokine cargo (e.g. IL18 cytokine cargo) in the same open reading frame together with the CAR, both expressed under an enhancer and the NFAT promoter (CC229; see Figure 3). Surprisingly, the functionality of CC229 modified T cells has been found to be higher compared to CC228 modified T cells, where the CAR and the IL-18 cytokine cargo (encoding the amino acid sequence of the caspase-1 processed form of the IL-18, i.e. the mature IL-18) were expressed in the same open reading frame under the control of an enhancer and the constitutive CMV promoter (Figure 3A and 3D).

[0334]

[0337] Enhancer and NFAT promoter driven CAR expression can be combined with small molecule regulated immune cell activation methods (e.g. “ON switch” or “OFF switch” regulated T cells, specifically the RheoBrick “ON switch” regulated T cells, Figure 2-3).

[0335]

[0338] A first benefit of this combination is the compact size of the expression cassette and / or viral vector. This enables expression of three components: antigen receptor, cargo and switch molecules from a minimal sized expression cassette which provides antigen dependent and small molecule regulated production of therapeutic cargo molecules, such as IL-18 cytokine (CC221 , Figure 2 and CC231 , Figure 3). The second benefit is the surprising synergistic effects on T cell (or NK) functionality (e.g. IFNg production) in e.g. CAR-T cells: The RheoBrick switch containing CAR-T cells produced more IFNg when the CAR was expressed under an enhancer and the NFAT promoter, compared to the RheoBrick switch containing CAR-T cells when the CAR was expressed under an enhancer and the constitutively active CMV promoter (CC231 vs CC230 in Figure 2, CC221 vs CC220 in Figure 3, and CC219 vs CC218 in Figure 3, respectively).

[0336]

[0339] To demonstrate that the invention, an enhancer and the NFAT promoter driven CAR expression is not limited to the EDB FN CAR, but the technique can also be applied to other antigen receptors, we tested our system using CD19 CAR, BCMA CAR and PSMA CAR (Figures 4-6). These CARs are highly efficient antigen receptors that can induce profound IFNg production levels using the traditional, constitutive promoter driven CAR expression cassettes. Nevertheless, we showed that IFNg production levels of CAR-T cells can be further enhanced by using an enhancer and the NFAT promoter driven CAR expression cassettes (Figures 4-6). Moreover, incorporation of the IL-18 cargo in the same open reading frame together with the PSMA CAR under the control of an enhancer and the NFAT promoter increased IFNg production even further (Figure 6).

[0337]

[0340] If further boosting of T cell functions (IFNg production, proliferation, cytotoxicity etc.) or NK cell function is desired, additional cargo molecules such as anti-tumor cytokines, chemokines, chemokine receptors, antibodies, enzymes, transcription factors, can be added directly into the same expression cassette together with the antigen receptor, and under the control of an enhancer and the NFAT promoter (Figure 2).

[0338]

[0341] The cargo molecules and the antigen receptor can be separated by, for example, a self-cleaving 2A peptide: An enhancer and the NFAT promoter-CAR-2A- cargo or an enhancer and the NFAT promoter-cargo-2A-CAR. Alternatively, CAR and cargo molecule can be separated by an internal ribosome entry site (IRES): and enhancer and the NFAT promoter-CAR-ires-cargo or an enhancer and the NFAT promoter-cargo-ires-CAR.

[0339]

[0342] Such compact expression cassette designs reduce the number of required promoters from two to one. In the prior art TRUCK concept, the antigen receptor was expressed under the constitutively active promoter, and cargo was expressed under inducible promoter such as the NFAT promoter (Chmielewski et al. Expert Opin Biol Ther . 2015; 15(8):1145-54. doi: 10.1517 / 14712598.2015.1046430).

[0340]

[0343] The reduction in the number of open reading frames minimizes complexity of the expression system. The reduction in the size of the expression cassette translates into a smaller lentiviral / retroviral vector, or a smaller site-specific integration cassette design. The smaller expression cassette size is preferable for increasing the viral transduction efficiency and site-specific integration efficiency, respectively.

[0341]

[0344] It is known that U3 regions of LTRs encode enhancer and promoter regions (Maetzig et al. Viruses. 2011 Jun; 3(6): 677-713. doi: 10.3390 / v3060677). It has been previously reported that within the U3 region, the so-called upstream conserved region (UCR) contains a regulatory segment (Wahlers et al. Mol Ther. 2002 Sep;6(3):313-20. doi: 10.1006 / mthe.2002.0671). Deletion of such segment has been reported to attenuate gene expression in the direction of the U3 promoter. We created the UCR segment deleted version (CC277) of the bidirectional expression system where the MSCV promoter-controlled the gene expression is in the forward direction, and NFAT promoter-controlled the gene expression is in the reverse direction. We have surprisingly found that deletion of the UCR segment (CC277, Figure 7A-B) had opposite effects on gene expression in either direction: Deletion of the UCR segment decreased huEGFRt expression in the forward direction (Figure 7C), while deletion of the UCR segment increased CAR expression in the reverse direction (Figure 7D) compared to WT MSCV U3 containing CC239 modified cells.

[0342]

[0345] Moreover, it has been surprisingly found that MSCV UCR segment can be replaced by UCR segments derived from U3 regions of LTRs of different retroviruses (MoMLV, FMLV, SFFVp, Figure 7A-B). Expression cassettes containing hybrid U3 regions, where MoMLV, FMLV and SFFVp UCR segments replaced MSCV UCR segment (CC274, C275 and C276, respectively, Figure 7B-D) displayed high huEGFRt expression in forward direction, and low CAR expression in reverse direction, comparable to WT(wildtype) MSCV U3 region containing bidirectional expression cassette modified cells (CC239). Furthermore, it has been surprisingly found that hybrid U3 regions (e.g. MoMLV UCR / MSCV U3 hybrid in CC274, Figure E) can be used to increase ratio of protein expression in the forward direction (huEGFRt) versus protein expression in the reverse direction (CAR).

[0343]

[0346] These surprising findings show that UCR segment of U3 enhancer / promoter is important to maintain low gene expression in the reverse direction prior to antigen encounter of CAR-T cells, which is important to minimize production of CAR, and therapeutic cargo molecules (cytokines, antibodies, enzymes, etc.) encoded in the same open reading frame together with the CAR (e.g. CC213 in Figure 6A) prior to antigen exposure to minimize risk of toxicity.

[0344]

[0347] Upon exposure to antigen positive cells, wildtype as well as hybrid U3 region / NFAT promoter driven CAR expressing cells (CC274, CC275 and CC276) produced high levels of I FNg, comparable to IFNg production levels of WT MSCV U3 region / NFAT promoter driven CAR expressing cells (CC239), demonstrating that hybrid U3 regions are functional (Figure 7F). In contrast, NFAT promoter driven CARs without any enhancer (CC248) did not produce high levels of IFNg (Figure 7F).

[0345]

[0348] UCR segments derived from MSCV, MoMLV, FMLV and SFFVp U3 regions contain the CGCCATTTT sequence, which is bound by Yin Yang 1 (YY1). YY1 is known to act as a transcription enhancer or repressor depending on the DNA context (Verheul et al. Front Cell Dev Biol. 2020 Sep 30:8:592164. doi: 10.3389 / fcell.2020.592164) and recognizes the consensus motif CGCCATnTT (Kim et al. Genomics. 2009 Feb;93(2):152-8. doi: 10.1016 / j.ygeno.2008.09.013. Epub 2008 Nov 8).

[0346] Material and Methods

[0347]

[0349] Vector DNA preparation

[0348]

[0350] Self-inactivating lentiviral vectors were created using gene synthesis. Briefly, the expression cassettes depicted in Figure 1A, 2A, 3A, 4A, 5A, 6A and 7A were flanked with upstream (RSV promoter, 5’LTR (truncated), HIV-1 (psi), RRE, cPPT / CTS) and downstream (3’LTR deltaUS, SV40 polyA, SV40 ori) lentiviral vector elements derived from the pRRLSIN vector (#12252, Addgene), ordered as gene synthesis products and cloned into the EcoRV site of the pUC-AMP-GW vector backbone (Genewiz / Azenta). The nucleotide sequences of the expression cassettes, and full lentiviral vectors described in the examples are listed in Table 1 and Table 2, respectively. The nucleotide sequences of regulatory elements in these expression cassettes are listed in Table 3, and translated nucleotide sequences from these expression cassettes are listed in Table 4. Structural lentiviral vector sequences and vector backbone sequences are listed in Table 5. Non-limiting examples of additional enhancer sequences according to the invention are listed in Table 6. The retroviral vector encoding MP71 PSMA iresPuro was created by cloning gene synthesized PSMA (Uniprot ref: Q04609) encoding sequence, IRES and puromycin resistance genes in MP71 vector (Engels et al. Hum Gene Ther 2003;14(12):1155-68).

[0349]

[0351] Cell lines and cell culture

[0350]

[0352] FLYRD18 (Sigma) cells were cultured in IMDM / 8% FCS / penicillin-streptomycin (Gibco), HEK293T (ATCC), A549 (ATCC) cells in DMEM / 8% FCS / penicillin- streptomycin (Gibco), PC3 (ATCC) cells were cultured in Advanced DMEM / F-12 / 8% FCS / penicillin-streptomycin (Gibco), Nalm6 (ATCC) cells in RPMI / 8% FCS / penicillin- streptomycin (Gibco) and LI266 (ATCC) cells in RPMI / 15% FCS / penicillin-streptomycin (Gibco). HEK293T, FLYRD18, A549 and PC3 cells were passaged every 3 days with trypsin-EDTA (Gibco). All cell lines were tested for mycoplasma using PCR based screening and found negative.

[0351]

[0353] Lentivirus production

[0352]

[0354] Lentiviral particles were produced in HEK293T packaging cells. In brief, 4,500,000 HEK293T packaging cells were plated per 10 cm dish one day prior to transfection. The next day, cell culture medium was refreshed with DM EM supplemented with 8% FCS without antibiotics. Transfer vectors and packaging plasmids were dissolved in water. The plasmid mixtures were prepared by mixing 3.5 pg transfer vector (Table 2), and packaging plasmids: 3.5 pg pCMVdeltaR8.74 and 3 pg pMD2.G (Zhang et al. Nat Protoc. 2010 Mar; 5(3): 439-456). 15 pl of Lipofectamine 3000 (Invitrogen) was mixed with 750 pl Opti-MEM (Gibco), vortexed and incubated for 5 minutes (Part A). Afterwards, plasmid mixtures were added with 750 pl Opti-MEM and 20 ul P3000 reagent (Invitrogen), and vortexed (Part B). After 5-minute incubation, Part A and Part B were mixed at 1 :1 ratio, and incubated for 15 minutes, and the resulting transfection mixture was added dropwise onto the packaging cells. The lentivirus containing supernatant was harvested 48 hours after transfection, syringe filtered and immediately used.

[0353]

[0355] Retrovirus production

[0354]

[0356] Retroviral particles were produced in FLYRD18 packaging cells. 700,000 FLYRD18 packaging cells were plated per 10 cm dish one day prior to transfection. The next day, cell culture medium was refreshed with IMDM supplemented with 8% FCS without antibiotics. 25 pl of X-tremeGENE 9 was mixed with 800 pl Opti-MEM and incubated for 5 minutes. Subsequently, the Optimem-X-tremeGENE 9 mixture was added on top of 10 pg retroviral plasmid DNA dissolved in water, incubated for 15 minutes, and the resulting transfection mixture was added dropwise onto the packaging cells. The supernatant containing retrovirus was harvested 48 hours after transfection and immediately used.

[0355]

[0357] T cell isolation and activation

[0356]

[0358] Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats from healthy donors (Sanquin, Amsterdam, NL) by Ficoll-lsopaque density centrifugation (Hokland et al. J Immunol Methods. 1980;32(1):31-39) and were stored frozen until further use. To generate activated T cell populations, PBMC were thawed in PBS containing 5 % FCS, counted, and mixed with CD3 / CD28 Dynabeads (CTS) at a 1 : 1 cell to bead ratio, at a density of 107 cells / ml. Following a 30 min incubation at room temperature on a tumbler, the mixture was put on a magnet and unbound cells were removed. Bead bound T cells were subsequently resuspended in T cell media containing RPMI / 10% human serum / penicillin-streptomycin containing 5 ng / ml IL-7 (Peprotech) and 5 ng / ml IL-15 (Peprotech), and plated at a density of 0.75 x 106 cells / ml.

[0359] Spin-transduction of T cells

[0357]

[0360] 6-well non treated cell culture plates were covered with 10 pg / ml retronectin (Takara) overnight at 4 °C. The next day, the retronectin solution was removed and wells were blocked with 2% BSA (Sigma-Aldrich) in PBS for 30 minutes. 2 million activated T cells (1 x 106 cells / ml in RPMI / 10% human serum / penicillin- streptomycin / 12.5 ng / ml IL-7 and 12.5 ng / ml IL-15) were then mixed with 3 ml viral supernatant in retronectin coated 6 well plates. Plates were centrifuged at 2,000 RPM for 90 minutes at room temperature with brakes off. No selection method was used to enrich T cells modified with lentiviral vectors. T cells were incubated with lentivirus for 4 days prior to FACS analysis.

[0358]

[0361] Tumor cell transduction

[0359]

[0362] One day prior to transduction, A549 tumor cells were plated at 90.000 per well density on 6-well plates. Following day, media was replaced with 2 ml fresh DMEM / 8% FCS / penicillin-streptomycin media and mixed with 3 ml lentivirus. A549 cells were incubated with lentivirus for 2 days prior to FACS analysis. PC3 tumor cells that were transduced with retroviral MP71 PSMA iresPuro vector were selected with 2 pg / ml puromycin for 3 days.

[0360]

[0363] Co-cultures

[0361]

[0364] Between days 6-10 after transduction, 100,000 T cells were mixed with 100,000 indicated target cells (or T cells were used alone for no target cell controls) in T cell media in the presence of indicated concentrations of lenalidomide or DMSO control in flat bottom 96-well plates and incubated for 24 hours at 37 °C.

[0362]

[0365] IFN gamma ELISA assay

[0363]

[0366] Co-culture supernatants were analyzed using ELISA MAX™ Deluxe Set Human IFN gamma (Biolegend) according to manufacturer’s instructions. To stay within linear range of the standard curve, ELISA assays were run using serially diluted supernatants.

[0364]

[0367] Flow cytometry

[0365]

[0368] T cells and A549 tumor cells were washed once with PBS and stained with IR dye (Molecular Probes) at 1 :400 dilution for 5 minutes at 4 °C. Subsequently, cells were washed once with FACS buffer (PBS containing 0.5 % BSA) and stained with anti-CD8-PerCP Cy5.5 (1 :20 dilution, BD, #341050), anti-CD4 BV711 (1 :50 dilution, Biolegend, #317440), cetuximab-PE (to stain surface huEGFRt reporter, 1 :200 dilution, R&D Systems, #FAB9577P), goat anti-mouse-PE (to stain mouse ScFv based CARs, 1 :200 dilution, ThermoFisher, #A10542) or goat anti-human-AF647 (to stain human ScFv based CARs, 1 :200 dilution, Jackson ImmunoResearch, #109-605-006) for 20 minutes at 4 °C. Cells were then washed twice with FACS buffer resuspended in 100 pl FACS buffer. Samples were analyzed directly on a Fortessa Special Order analyzer. Data were analyzed using FlowJo and Prism 10 software.

[0366]

[0369] Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation.

[0367]

[0370] Reference to known method steps, conventional methods steps, known methods or conventional methods is not in any way an admission that any aspect, description, or embodiment of the present invention is disclosed, taught, or suggested in the relevant art.

Claims

CLAIMS1. Cell comprising a first recombinant nucleic acid wherein the first recombinant nucleic acid comprises:(a) a first nucleic acid part , wherein the first nucleic acid part encodes an antigen receptor, and(b) a second nucleic acid part, wherein the second nucleic acid part comprises a first inducible promoter , wherein the first inducible promoter is operably linked to the first nucleic acid part, and wherein the first inducible promoter is a promoter that is induced when the antigen receptor encoded by the first nucleic acid part is activated.

2. A cell according to any one of the previous claims wherein the first recombinant nucleic acid further comprises:(c) a third nucleic acid part, wherein the third nucleic acid comprises all or a functional portion of an enhancer, preferably whereby the enhancer or functional part thereof enhances transcription of the first nucleic acid part operably linked to the first inducible promoter comprised in the second nucleic acid part.

3. A cell according to any one of the previous claims wherein the third nucleic acid part that comprises all or a functional portion of an enhancer comprises a second promoter, and, preferably, wherein the second promoter is not operably linked to the first nucleic acid part.

4. A cell according to any one of the previous claims wherein the enhancer or functional part thereof comprised in the third nucleic acid part comprises the consensus motif CGCCATNTT, wherein N stand for any base selected from C, G, A and T, preferably CGCCATTTT.

5. A cell according to any one of the previous claims wherein the first inducible promoter comprised in the second nucleic acid part is an ITAM signaling responsive promoter, preferably wherein the promoter is an NFAT promoter, a synthetic NFAT promoter, (synthetic) NF-kB promoter, an AP-1 promoter, a (natural) IL-2 promoter, an IFN gamma promoter, a TNF alpha promoter, an IL-6 promoter, a CD69 promoter, aCD137 promoter, a GM-CSF promoter, a IL-4 promoter, a IL-6 promoter, a IL-8 promoter, a IL-13 promoter, or a IL-17 promoter, preferably the promoter is an NFAT promoter.

6. A cell according to any of the previous claims wherein the first inducible promoter comprised in the second nucleic acid part is an NFAT promoter; and wherein the first recombinant nucleic acid comprises a third nucleic acid part that comprises all or a functional portion of an enhancer that comprises the consensus motif CGCCATNTT, wherein N stand for any base selected from C, G, A and T, preferably CGCCATTTT.

7. A cell according to any one of the previous claims wherein the first recombinant nucleic acid further comprises:(d) a fourth nucleic acid part, wherein the fourth nucleic acid part encodes a first protein of interest, wherein the fourth nucleic acid part is operably linked to the first inducible promoter comprised in the second nucleic acid part.

8. A cell according to any one of the previous claims wherein the first recombinant nucleic acid further comprises:(e) a fifth nucleic acid part, wherein the fifth nucleic acid part encodes a second protein of interest and wherein the fifth nucleic acid part is operably linked to a promoter (constitutive or inducible), wherein the promoter is a third promoter or, preferably, wherein the promoter is the second promoter comprised in the third nucleic acid part.

9. A cell according to any one of the previous claims wherein the cell further comprises a chimeric protein, or a recombinant nucleic acid encoding said chimeric protein, wherein the chimeric protein comprises:(f) a docking domain that is able to bind to the antigen receptor encoded by the first nucleic acid part and wherein the chimeric protein is able to modify, preferably inhibit or block, signal transduction that is induced when the antigen receptor encoded by the first nucleic acid part is activated.

10. A cell according to any one of the previous claims wherein the cell further comprises a recombinant switch system or a nucleic acid encoding said recombinant switch system, wherein the switch system is able to bind to the antigen receptor encoded by the first nucleic acid part and modify signal transduction that is induced when the antigen receptor encoded by the first nucleic acid part is activated.

11. A cell according to any one of the previous claims wherein the cell is a T-cell or a NK-cell.

12. A cell according to any one of the previous claims wherein the first recombinant nucleic acid and / or the nucleic acid encoding for the chimeric protein and / or the nucleic acid encoding the recombinant switch system is integrated in the genome of the cell.

13. A cell according to any one of the previous claims wherein the antigen receptor encoded by the first nucleic acid part is a T-cell receptor, a NK-cell receptor, or a chimeric antigen receptor (CAR).

14. A cell according to any of the previous claims wherein the enhancer or functional part thereof comprised in the third nucleic acid part is viral enhancer, a T- cell specific enhancer, a NK-cell specific enhancer, a lymphocyte-specific enhancer, a U3 LTR enhancer, a lentiviral U3 LTR enhancer, a retroviral U3 LTR enhancer, a MSCV U3 LTR enhancer, MoMLV enhancer, FMLV enhancer, SFFVP enhancer, TCR alpha and beta enhancer, a CD3 enhancers, or a CD2 gene enhancer, preferably the enhancer is a MSCV U3 LTR enhancer.

15. The cell according to any of previous claims wherein the protein of interest encoded by the fourth nucleic acid is a cytokine, an interleukin, an interferon, a chemokine, a receptor, a chemokine receptor, a ligand, a costimulatory receptor ligand, an antibody or antibody fragment, a bispecific antibody, a T-cell engager, a bispecific T cell engager, a trispecific T cell engager, a bispecific NK cell engager, a trispecific NK cell engager, a checkpoint inhibitor antagonist, an agonist, an enzyme, a regulatory element, a transcription factor, or a DNA binding domain of a transcription factor.

16. The cell according to any of the previous claims wherein the protein of interest encoded by the fourth nucleic acid is a cytokine, and wherein the cytokine is an interleukin, preferably selected from the group consisting of IL-2, IL-7, IL-12, IL-15, IL- 18, or IL-21.

17. The cell according to any one of the previous claims wherein the chimeric protein or the recombinant switch comprises:(a) a docking domain that is able to bind to the receptor and to inhibit signal transduction induced when the receptor receives the activating signal, and(b) a drug-regulated protein stability domain.

18. The cell according to any one of the previous claims, wherein the docking domain of the chimeric protein comprises a SH2-domain that is able to bind to a phosphorylated immunoreceptor tyrosine-based activation motif (ITAM) that is comprised in the antigen receptor encoded by the first nucleic acid part, preferably wherein the SH2-domain is from a protein selected from the group consisting of Zap70, Syk, and Lek.

19. The cell according to any one of the previous claims wherein the drug-regulated protein stability domain is a CRBN polypeptide substrate domain capable of binding to the CRBN protein in response to a drug, preferably thereby promoting ubiquitin pathway-mediated degradation of the chimeric protein.

20. The cell according to any one of the previous claims wherein the drug-regulated protein stability domain comprises a Cys2-His2 zinc finger domain that is able of druginducible binding to a CRBN polypeptide, preferably wherein the Cys2-His2 zinc finger domain is a hybrid zinc finger domain.

21. The cell according to any one of the previous claims wherein the drug that induces drug-inducible binding to the CRBN polypeptide is an immunomodulatory imide drug (IMiD), preferably wherein the IMiD is selected from thalidomide,lenalidomide, pomalidomide, avadomide, iberdomide, CC-885, salts and analogs thereof.

22. The cell according to any one of the previous claims, wherein the ITAM that is present in the antigen receptor encoded by the first nucleic acid part is an ITAM that is present in a TCR, CAR or NKR, more preferably wherein the ITAM is from, or in, a CD3 zeta chain, a CD3 epsilon chain, a CD3 delta chain, a CD3 gamma chain, a FceRI gamma chain, or DAP12.

23. The cell according to any one of the previous claims wherein the docking domain further comprises an immunoreceptor tyrosine-based switch motif (ITSM), and / or an immunoreceptor tyrosine-based inhibitory motif (ITIM), or an ITSM and an immunoreceptor tyrosine-based inhibitory motif (ITIM), preferably wherein the ITIM and / or ITSM is / are from an inhibitory receptor protein, preferably an inhibitory immune receptor protein, preferably from a protein selected from the group consisting of PD1 , BTLA, SIRPalpha, SIGLEC5, SIGLEC9, SIGLEC11 , PECAM1 and LY9.

24. The cell according to any one of the previous claims for use as a medicament, preferably for use in the treatment of a caner and / or for the treatment of a tumor in a subject.

25. A method of preparing the cell according to any one of the previous claims, wherein the method comprises the step of introducing the first recombinant nucleic acid to the cells.

26. The first recombinant nucleic acid as defined in any one of the previous claims, a vector or an expression cassette comprising the first recombinant nucleic acid as defined in any one of the previous claims and / or the nucleic acid encoding for the chimeric protein as defined in any one of the previous claims and / or the nucleic acid encoding the switch system as defined in any one of the previous claims.