Biomarker composition for diagnosing muscle loss or muscle atrophy comprising precursor of mirna

Specific precursor miRNAs are used as biomarkers to diagnose muscle loss or atrophy, providing accurate diagnostic tools and treatments by measuring their expression levels, overcoming the limitations of existing methods in diagnosing muscle-related diseases.

WO2025249785A1PCT designated stage Publication Date: 2025-12-04THE IND & ACADEMIC COOP IN CHUNGNAM NAT UNIV (IAC)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/005934
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-31
Filing Date
2025-04-30
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Current diagnostic methods for muscle loss or muscle atrophy, such as sarcopenia, lack clear criteria and effective biomarkers, particularly for precursor miRNAs, which are not consistently correlated with mature miRNAs, complicating the diagnosis and treatment of muscle-related diseases.

Method used

Utilizing specific precursor miRNAs, including miR-206, miR-6516, miR-1291, miR-23a, and miR-664, as biomarkers to diagnose muscle loss or atrophy by measuring their expression levels and comparing them to normal controls, and developing diagnostic kits and treatments based on these miRNAs.

Benefits of technology

The use of these precursor miRNAs provides a clear and effective method for diagnosing muscle loss or atrophy, enabling accurate diagnosis and treatment by identifying specific expression patterns in biological samples, thus addressing the lack of clear diagnostic criteria for muscle-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025005934_04122025_PF_FP_ABST
    Figure KR2025005934_04122025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the diagnosis of muscle loss or muscle atrophy based on a precursor of miRNA and, more specifically, to: a biomarker composition for diagnosing muscle loss or muscle atrophy, comprising the precursor of miRNA; and a method for providing information for diagnosing muscle loss or muscle atrophy. The precursor of miRNA according to the present invention was confirmed experimentally to exhibit a specific expression pattern in subjects with muscle loss or muscle atrophy compared to normal controls. Thus, the precursor of miRNA of the present invention can have various applications in the field of diagnosis and treatment of muscle loss or muscle atrophy.
Need to check novelty before this filing date? Find Prior Art

Description

Biomarker composition for diagnosing muscle loss or muscle atrophy comprising precursor miRNA

[0001] The present invention relates to the diagnosis of muscle loss or muscle atrophy using precursor miRNA, and more particularly, to a biomarker composition for the diagnosis of muscle loss or muscle atrophy comprising the precursor miRNA and a method for providing information for the diagnosis of muscle loss or muscle atrophy.

[0002]

[0003] Sarcopenia is a disease characterized by a gradual decline in muscle mass and strength. The primary symptoms are muscle loss and weakness. While primarily affecting the elderly, sarcopenia has recently been recognized across all age groups. As muscle loss becomes more severe, the body's ability to store energy declines, leading to fatigue. Muscle loss also reduces basal metabolic rate, leading to frequent weight fluctuations and easy weight gain. Furthermore, blood sugar levels fluctuate, and diabetes patients struggle to control their blood sugar levels. Furthermore, due to the loss of muscle mass and strength, patients with sarcopenia experience slower physical reactions, difficulty maintaining balance, and an increased risk of death. Because sarcopenia is a relatively recent disease classification, there are currently no clear diagnostic criteria or methods.

[0004] Meanwhile, miRNAs play a crucial role in regulating mRNA expression at the post-transcriptional level by degrading and / or inhibiting the translation of mRNAs with complementary sequences. These miRNAs are noncoding RNAs of approximately 10 to 22 nt in length. Most mature miRNAs are transcribed from miRNA-encoding DNA, processed into precursor miRNAs (pre-miRNAs), which are then transported to the cytoplasm and processed into miRNAs. Recently, numerous studies have been actively conducted on miRNAs as biomarkers or candidates for muscle disease therapeutics. However, pre-miRNAs do not show a clear positive correlation with mature miRNAs. In particular, the role of precursor miRNAs in muscle loss is largely unknown.

[0005] Accordingly, the inventors of the present invention have attempted to provide a clear method for diagnosing diseases caused by muscle loss or muscle atrophy, and have completed the present invention by confirming that the expression of muscle-derived specific precursor miRNAs is changed in patients and animal models of diseases caused by muscle loss or muscle atrophy.

[0006] Accordingly, the purpose of the present invention is to provide a biomarker composition for diagnosing muscle loss or muscle atrophy, comprising at least one precursor miRNA selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664.

[0007] Another object of the present invention is to provide a composition for diagnosing muscle loss or muscle atrophy, comprising a preparation for measuring the expression level of at least one precursor miRNA selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664.

[0008] Another object of the present invention is to provide a diagnostic kit for diagnosing muscle loss or muscle atrophy comprising the composition.

[0009] Another object of the present invention is to provide a method for providing information for diagnosing muscle loss or muscle atrophy, comprising the steps of: a) measuring the expression level of one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664 from a biological sample of an individual; and b) comparing the expression level of the precursor miRNA measured in step a) with the expression level of the precursor miRNA of a normal control sample.

[0010] Another object of the present invention is to provide a method for diagnosing and treating muscle loss or muscle atrophy, comprising the steps of: a) obtaining a sample for analysis from a subject; b-1) diagnosing the subject with muscle loss or muscle atrophy if the expression level of a precursor miRNA of miR-206 in the sample for analysis of step a) is higher than that in a comparative control group; b-2) diagnosing the subject with muscle loss or muscle atrophy if the expression level of a precursor miRNA of at least one selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664 in the sample for analysis of step a) is lower than that in a comparative control group; and c) administering an effective amount of a muscle loss or muscle atrophy treatment to a subject diagnosed with muscle loss or muscle atrophy in step b).

[0011] To achieve the above purpose, the present invention provides a biomarker composition for diagnosing muscle loss or muscle atrophy, comprising at least one precursor miRNA selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664.

[0012] The present invention also provides a composition for diagnosing muscle loss or muscle atrophy, comprising a preparation for measuring the expression level of one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664.

[0013] The present invention also provides a diagnostic kit for diagnosing muscle loss or muscle atrophy comprising the composition.

[0014] In addition, the present invention provides a method for providing information for diagnosing muscle loss or muscle atrophy, comprising the steps of: a) measuring the expression level of one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664 from a biological sample of an individual; and b) comparing the expression level of the precursor miRNA measured in step a) with the expression level of the precursor miRNA of a normal control sample.

[0015] In addition, the present invention provides a method for diagnosing and treating muscle loss or muscle atrophy, comprising the steps of: a) obtaining an analysis sample from an individual; b-1) diagnosing the individual as having muscle loss or muscle atrophy if the expression level of a precursor miRNA of miR-206 in the analysis sample of step a) is high compared to a comparative control group; b-2) diagnosing the individual as having muscle loss or muscle atrophy if the expression level of a precursor miRNA of at least one selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664 in the analysis sample of step a) is low compared to a comparative control group; and c) administering an effective amount of a muscle loss or muscle atrophy treatment to an individual diagnosed with muscle loss or muscle atrophy in step b).

[0016] The precursor miRNA of the present invention was experimentally confirmed to exhibit a specific expression pattern in subjects with muscle loss or muscle atrophy compared to normal controls. Therefore, the precursor miRNA of the present invention can be utilized in various fields of diagnosis and treatment of muscle loss or muscle atrophy.

[0017] Figure 1a is a diagram showing the results of observing the differentiation process of human muscle cells.

[0018] Figure 1b is a diagram showing the results of confirming whether human muscle cells were differentiated through analysis of differentiated MYOD expression.

[0019] Figure 1c is a diagram showing the results of confirming whether exosomes derived from differentiated muscle cells were extracted through exosome positive / negative marker expression analysis.

[0020] Figures 1d and 1e are diagrams showing the results of quantitative analysis of the expression of selected precursor miRNAs.

[0021] Figures 2aa and 2ab are diagrams showing the results of analyzing the correlation between PHF20, YY1, muscle differentiation markers, muscle atrophy markers, and their upstream transcription factors in the PHF20 TG mouse model.

[0022] Figure 2b is a diagram showing the results of analyzing the protein expression of PHF20 and the muscle atrophy marker MuRF1 in the PHF20 TG mouse model.

[0023] Figure 2c is a diagram showing the results of analyzing the expression of mRNA of Phf20 and Trim63 in the PHF20 TG mouse model.

[0024] Figure 2d is a diagram showing the results of evaluating the muscle strength of the PHF20 TG mouse model through a grip strength test.

[0025] Figure 2e is a diagram showing the results of measuring the cross-sectional area of ​​muscle tissue of the PHF20 TG mouse model through H&E staining.

[0026] Figure 3a is a diagram showing the manufacturing process of a fixed mouse model.

[0027] Figure 3b is a diagram showing the results of measuring the cross-sectional area of ​​muscle tissue in a fixed mouse model.

[0028] Figure 4a is a diagram showing the results of analyzing the expression of five precursor miRNAs in the gastrocnemius muscle of the PHF20 TG mouse model and the immobilized mouse model (IMO).

[0029] Figure 4b is a diagram showing the results of analyzing the expression of five precursor miRNAs in the anterior tibialis anterior muscle of the PHF20 TG mouse model and the immobilized mouse model (IMO).

[0030] Figure 4c is a diagram showing the results of analyzing the expression of five precursor miRNAs in the soleus muscle of the PHF20 TG mouse model and the immobilized mouse model (IMO).

[0031] Figure 5a is a diagram briefly illustrating the experimental process for confirming the therapeutic effect of miR-6516 on sarcopenia using a fixed mouse model.

[0032] Figure 5b is a diagram showing the results of analyzing the cross-sectional area of ​​muscle tissue according to miR-6516 in a fixed mouse model.

[0033] Figure 5c is a diagram showing the results of investigating the predicted target mRNA of miR-6516, which was confirmed to have a muscle atrophy inhibitory effect.

[0034] Figure 5d is a diagram showing the results of analyzing the expression of Pax7 and Myod1, which are early muscle regeneration markers, in muscles administered with Mimic-miR-6516.

[0035] Figure 6 is a diagram showing the sarcopenia-related mechanism of miR-206 and miR-6516.

[0036] Hereinafter, the present invention will be described in detail.

[0037] According to an aspect of the present invention, the present invention provides a biomarker composition for diagnosing muscle loss or muscle atrophy, comprising at least one precursor miRNA selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664.

[0038] The precursor miR-206 may be represented by the base sequence of SEQ ID NO: 7, 8, 15 or 16, the precursor miR-6516 may be represented by the base sequence of SEQ ID NO: 19 or 20, the precursor miR-1291 may be represented by the base sequence of SEQ ID NO: 3, 4, 17 or 18, the precursor miR-23a may be represented by the base sequence of SEQ ID NO: 21 or 22, the precursor miR-664a may be represented by the base sequence of SEQ ID NO: 11 or 12, and the precursor miR-664 may be represented by the base sequence of SEQ ID NO: 23 or 24.

[0039] In a preferred embodiment of the present invention, the biomarker composition for diagnosing muscle loss or muscle atrophy preferably comprises precursor miR-206 or precursor miR-6516.

[0040] The greatest feature of the present invention is that the precursor miRNA is used as a biomarker to diagnose muscle loss or muscle atrophy, and further to diagnose and predict the onset of a disease caused by muscle loss or muscle atrophy.

[0041] In a specific embodiment of the present invention, the muscle loss or muscle atrophy may be at least one selected from the group consisting of sarcopenia, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myotonic dystrophy, amyotrophic lateral sclerosis, myasthenia, and cachexia, but is not limited thereto.

[0042] The composition can be used to diagnose whether there is a decrease in muscle size, a decrease in muscle mass, and / or atrophy of skeletal muscle (i.e., muscle wasting or muscle atrophy), and further, to diagnose a disease caused by muscle wasting or muscle atrophy.

[0043] In the present invention, the miRNA (microRNA) refers to a non-translated RNA of about 10-22 nt that acts as a post-transcriptional repressor through base binding to the 3' untranslated region (UTR) of mRNA. The commonly referred to miRNA refers to mature miRNA, and mature miRNA is completed through a process in which it is transcribed from DNA, processed into a precursor miRNA (pre-miRNA), and then translocated to the cytoplasm and processed into miRNA. The expression patterns of the mature miRNA and precursor miRNA may not be consistent, and thus it is difficult to predict the expression patterns without experimentation.

[0044] That is, the precursor miRNA is approximately 30 nt in length, and through the processing process, a mature miRNA (approximately 10-22 nt) that exhibits function is generated. Precursor miRNA and mature miRNA can be extracted from the same sample (e.g., serum, etc.), but their detection methods are different.

[0045] In the present invention, "diagnosis" means confirming the presence or characteristics of a pathological condition. This diagnosis encompasses not only the presence or absence of a disease, but also the prognosis, course, and stage of the disease. For the purposes of the present invention, "diagnosis" means confirming the onset, prognosis, course, stage, or characteristics of muscle loss or atrophy.

[0046] In the present invention, a “biomarker” is a diagnostic marker or can also be used as a diagnostic marker, and means a substance that can diagnose the onset of muscle loss or muscle atrophy in a biological sample.

[0047] The precursor miR-206 is overexpressed in cases of muscle loss or muscle atrophy compared to the precursor miRNA expression level of the normal control group. In addition, one or more precursor miRNAs selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664 are underexpressed compared to the normal control group in cases of muscle loss or muscle atrophy. Therefore, the five precursor miRNAs can be utilized as biomarkers for determining (i.e., diagnosing) the occurrence of muscle loss or muscle atrophy.

[0048] In the present invention, high expression and low expression used when referring to the expression level of miRNA refer to a value (or level) of a biomarker in a biological sample that is higher / lower than the range of values ​​(or levels) of the biomarker detected in a biological sample obtained from a healthy or normal subject or a comparative subject, when the biomarker is indicative of or a sign of an abnormal process, disease or other pathological condition in the subject.

[0049]

[0050] According to another aspect of the present invention, the present invention provides a composition for diagnosing muscle loss or muscle atrophy, comprising a preparation for measuring the expression level of one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664.

[0051] In the present invention, the “agent for measuring the expression level of precursor miRNA” means a substance that can detect a biomarker by specifically binding to one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664 in a biological sample of a patient with muscle loss or muscle atrophy, and confirming the expression level thereof.

[0052] Unless otherwise specified herein, the expression “measuring the expression level of precursor miRNA” used herein means detecting the target to be detected within the sample.

[0053] In a specific embodiment of the present invention, the agent may be an antisense oligonucleotide, primer or probe that specifically binds to one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a and miR-664.

[0054] In the present invention, a primer refers to a short nucleic acid sequence having a short free 3' hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. Specifically, muscle loss or atrophy can be diagnosed by performing PCR amplification using the sense and antisense primers of the TrioBP polynucleotide and determining whether a desired product is produced. PCR conditions and the lengths of the sense and antisense primers can be modified based on those known in the art.

[0055] In the present invention, a probe refers to a nucleic acid fragment, such as RNA or DNA, ranging from a few bases to several hundred bases in length, capable of specifically binding to mRNA, and is labeled to enable detection of the presence or absence of a specific mRNA. The probe can be produced in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, etc. The selection of an appropriate probe and hybridization conditions can be modified based on those known in the art.

[0056] The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, "capping," substitution with one or more homologs of a natural nucleotide, and modifications between nucleotides, such as modification with uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.).

[0057] The expression level of miRNA can be measured by methods commonly used in the biokit field, including but not limited to reverse transcriptase polymerase reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, or gene chips.

[0058]

[0059] According to another aspect of the present invention, the present invention provides a diagnostic kit for muscle loss or muscle atrophy comprising the diagnostic composition.

[0060] The above kit may include not only a preparation for measuring the expression level of the precursor miRNA, but also tools, reagents, etc. commonly used in the art suitable for use as a diagnostic kit for muscle loss or muscle atrophy.

[0061] Examples of the above tools or reagents include, but are not limited to, suitable carriers, labeling substances capable of generating a detectable signal, chromophores, solubilizers, detergents, buffers, stabilizers, etc. When the labeling substance is an enzyme, it may include a substrate and a reaction terminator capable of measuring enzyme activity. The carrier may be a soluble carrier or an insoluble carrier. An example of a soluble carrier is a physiologically acceptable buffer known in the art, such as PBS, and an example of an insoluble carrier may be a polymer such as polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, cross-linked dextran, polysaccharides, magnetic microparticles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof.

[0062] For example, the diagnostic kit of the present invention may be a kit containing the essential elements necessary for performing RT-PCR. In addition to each primer pair specific for a marker miRNA, the RT-PCR kit may include a test tube or other appropriate container, a reaction buffer (with varying pH and magnesium concentrations), deoxynucleotides (dNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC water, sterile water, and the like.

[0063] Since the kit of the present invention comprises the biomarker and composition described above, description of duplicated contents is omitted to avoid excessive complexity of the present specification.

[0064]

[0065]

[0066] According to another aspect of the present invention, there is provided a method for providing information for diagnosing muscle loss or muscle atrophy, comprising the steps of: a) measuring the expression level of one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664 from a biological sample of an individual; and b) comparing the expression level of the precursor miRNA measured in step a) with the expression level of the precursor miRNA of a normal control sample.

[0067] In this specification, “biological sample” means any sample obtained from an individual in which expression of the biomarker of the present invention can be detected.

[0068]

[0069] In a specific embodiment of the present invention, the biological sample may be any one selected from the group consisting of blood, serum, saliva, biopsy, tissue, liquid culture, feces, and urine.

[0070] Unless otherwise specified herein, the term "normal control" as used herein refers to an individual who does not experience muscle loss or muscle atrophy.

[0071] In a specific example of the present invention, step b) may be a diagnosis of muscle loss or muscle atrophy when the precursor miRNA expression level of miR-206 is highly expressed compared to the precursor miRNA expression level of a normal control group.

[0072] In a specific embodiment of the present invention, step b) may be a diagnosis of muscle loss or muscle atrophy when the expression level of one or more precursor miRNAs selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664 is underexpressed compared to the expression level of precursor miRNAs of a normal control group.

[0073]

[0074] According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating a disease caused by muscle loss or muscle atrophy, comprising: (a) an agent that inhibits the expression of precursor miR-206; (b) at least one precursor miRNA selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664; or (c) an agent that promotes the expression of at least one precursor miRNA selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664.

[0075] In a specific embodiment of the present invention, the agent that promotes the expression of miR-6516 may be hsa-miR-6516-3p miRNA Mimic.

[0076] In a specific example of the present invention, the disease caused by muscle loss or muscle atrophy is preferably selected from the group consisting of sarcopenia, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myotonic dystrophy, amyotrophic lateral sclerosis, myasthenia, and cachexia, but is not limited thereto.

[0077] In the present invention, "prevention" refers to any action that inhibits or delays the onset of a disease caused by muscle loss or atrophy by administering a pharmaceutical composition according to the present invention. Furthermore, "treatment" refers to any action that improves or beneficially alters the symptoms of a disease caused by muscle loss or atrophy by administering a pharmaceutical composition according to the present invention.

[0078] The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive. At this time, the pharmaceutically acceptable additive may include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, maltose, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, white sugar, etc. The pharmaceutically acceptable additive according to the present invention is preferably included in the composition in an amount of 0.1 to 90 parts by weight, but is not limited thereto.

[0079] In addition, the pharmaceutical composition of the present invention can be administered in various oral or parenteral dosage forms during actual clinical administration. When formulating, it can be prepared using diluents or excipients such as commonly used fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants, and it is preferable to use a suitable agent known in the art. Carriers, excipients, and diluents that can be included in the composition include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, mineral oil, and the like.

[0080] The above solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. In addition, the above liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. may be included.

[0081] The above parenteral administration preparations include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases may include witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin, and the like. The above parenteral administration may be administered externally or by intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection.

[0082] The dosage of the pharmaceutical composition of the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity, and may be administered once a day or divided into several times.

[0083] The pharmaceutical composition of the present invention can be administered to a subject via various routes.

[0084] The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers for the prevention or treatment of diseases caused by muscle loss or muscle atrophy.

[0085]

[0086] According to another aspect of the present invention, the present invention provides a health functional food composition for preventing or improving muscle loss or muscle atrophy, comprising: (a) an agent that inhibits the expression of precursor miR-206; (b) at least one precursor miRNA selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664; or (c) an agent that promotes the expression of at least one precursor miRNA selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664.

[0087] In a specific example of the present invention, the prevention or improvement of muscle loss or muscle atrophy is preferably muscle strengthening, muscle augmentation, muscle differentiation or muscle regeneration.

[0088] In the present invention, the term "health functional food" refers to a food group or food composition that has been designed and processed to sufficiently exert its internal regulatory functions, such as regulating biological defense rhythms, disease prevention, and recovery, by using physical, biochemical, or bioengineering techniques to provide added value to the food so that the food's function can be performed and expressed for a specific purpose. For the purpose of the present invention, the health functional food refers to a food that enhances muscle strength, muscle augmentation, muscle differentiation, or muscle regeneration activity.

[0089] When the composition of the present invention is used as a health functional food additive, the composition can be added as is or used together with other health functional food ingredients, and can be used appropriately according to a conventional method. The mixing amount of the active ingredient can be appropriately determined depending on the intended use. Generally, when manufacturing food or beverage, the composition of the present invention can be added in an amount of preferably 50 parts by weight or less, more preferably 25 parts by weight or less, relative to the raw material. However, in the case of long-term intake for the purpose of health control and hygiene, the amount can be below the above range, and since there is no problem in terms of stability, the active ingredient can also be used in an amount above the above range.

[0090] The health functional food composition of the present invention may contain various conventional flavoring agents or natural carbohydrates as active ingredients as additional components. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., conventional sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As the above-mentioned flavoring agent, natural flavoring agent (thaumatin), stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agent (saccharin, aspartame, etc.) can be advantageously used.

[0091]

[0092] According to another aspect of the present invention, the present invention provides a method for diagnosing and treating muscle loss or muscle atrophy, comprising the steps of: a) obtaining an analysis sample from a subject; b-1) diagnosing the subject as having muscle loss or muscle atrophy if the expression level of a precursor miRNA of miR-206 in the analysis sample of step a) is high compared to a comparative control group; b-2) diagnosing the subject as having muscle loss or muscle atrophy if the expression level of a precursor miRNA of at least one selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664 in the analysis sample of step a) is low compared to a comparative control group; and c) administering an effective amount of a muscle loss or muscle atrophy treatment to the subject diagnosed with muscle loss or muscle atrophy in step b).

[0093] In the present invention, the muscle wasting or muscle atrophy treatment agent refers to a preparation for alleviating / treating symptoms of muscle wasting or muscle atrophy.

[0094] In a specific embodiment of the present invention, the muscle loss or muscle atrophy treatment agent may be at least one selected from the group consisting of an anabolic steroid, a selective androgen receptor modulator (SARM), a myostatin inhibitor, an anti-inflammatory agent, a metabolic regulating drug, and an insulin-like growth factor-1 (IGF-1) pathway stimulator, and preferably at least one selected from the group consisting of Androgel, Nebido, Testim, Sustanon, Oxandrin, Megace, Increlex, Inspra, and Aldactone, but is not limited thereto.

[0095] The muscle loss or muscle atrophy of the present invention may be at least one selected from the group consisting of sarcopenia, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myotonic dystrophy, amyotrophic lateral sclerosis, myasthenia, and cachexia, but is not limited thereto.

[0096]

[0097] Duplicate contents are omitted in consideration of the complexity of this specification, and terms not otherwise defined in this specification have meanings commonly used in the technical field to which the present invention belongs.

[0098]

[0099] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0100]

[0101] [Experimental Example]

[0102] Experimental Example 1. Plasma samples from patients and normal subjects

[0103] This study was approved by the Chungnam National University Hospital Institutional Review Board (2022-11-087). All human plasma samples were provided by the Chungbuk National University Hospital Biobank. All human plasma samples were pre-collected and stored by the Biobank. The normal control and patient groups were plasma samples collected from patients with disease codes Z00 (no symptoms or reported diagnosis) and N18.5 (stage 5 chronic kidney disease) according to the Korean Classification of Diseases (KCD). The patient group was also additionally defined as having diabetes.

[0104] Additionally, clinical information on age, disease codes, and additional diseases for the normal control group and patient group was provided by the biobank. One ml of plasma was collected from each of the normal and patient groups.

[0105]

[0106] Experimental Example 2. Experimental Animals

[0107] The Institutional Animal Care and Use Committee (IACUC) of Chungnam National University approved all animal care and experimental protocols (202305A-CNU-083, 202309A-CNU-155). All mice were housed and maintained in a controlled environment (12-h light / 12-h dark cycle, 50-60% humidity, 22°C). All mouse experiments were performed in the animal facility according to institutional guidelines.

[0108]

[0109] Experimental Example 3. PHF20 (plant homeodomain finger protein 20) transgenic mouse

[0110] PHF20 transgenic mice were generated by subcloning the human PHF20 cDNA into the pcDNA3 vector downstream of the CMV promoter. The resulting transgenic mice were confirmed to be positive by Southern blotting against wild-type C57BL / 6 mice for four generations.

[0111]

[0112] Experimental Example 4. Isolation of cell-free RNA from plasma

[0113] Plasma stored at -80°C was rapidly thawed at room temperature and centrifuged at 4°C and 2,000 × g for 10 min. After centrifugation, the supernatant was transferred to a sterile 1.5-ml tube. 15 μl of concentrated cell-free RNA was extracted from the supernatant and immediately stored at -80°C. The cell-free RNA extraction was performed using the Quick-cfRNA Serum&Plasma Kit (#1059, Zymo Research, USA) according to the manufacturer's instructions.

[0114]

[0115] Experimental Example 5. RT-qPCR

[0116] cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (#18064022, Invitrogen, USA) according to the manufacturer's instructions. Specifically, 300 ng of human plasma-derived cfRNA, 500 ng of mouse gastrocnemius and tibialis anterior cfRNA, 300 ng of mouse soleus cfRNA, and 500 ng of mouse gastrocnemius total RNA were used for cDNA synthesis. cDNA was diluted 1:50 using Gotaq qPCR Master Mix (#A6001, Promega, USA) to prepare analytical samples. RT-qPCR was performed by mixing the prepared analytical samples with the primers listed in Table 1.

[0117] 이름서열서열번호precursor of has-miR-12136FCCATGGGGTTGGCTTGAAAC1RCAAAAAAGGAAGGAATCGAACCCC2precursor of has-miR-1291FTGTACTGTGGCTGTTGGTTTCA3RCAGGAAGACAGTCCTTTAGGCCTC4precursor of has-miR-3651FGATTCGATGGGCCATAGCA5RTGAGGAGAAGCAGCCTCC6precursor of has-miR-206FTTCCCGAGGCCACATGCTTC7RCCATAGCAAAGTAATCCATATGGGG8precursor of has-miR-133bFCCTCAGAAGAAAGATGCCC9RTCTCCAAGGACTGGGCAT10precursor of has-miR-664aFGAACATTGAAACTGGCTAGG11RTTTTTCATTTTGTAGGCTGG12humanU6FCTCGCTTCGGCAGCACA13RAACGCTTCACGAATTTGCGT14precursor of mmu-miR-206FCCAGGCCACATGCTT15RTTCCATAGTGCTGAGATATC16precursor of mmu-miR-1291FAGAATCAAGGGATGGGAGGTTACC17RGAAGACAGTTCTCTAGGCGTCTGC18precursor of mmu-miR-6516FAACCTCTTCCCTGGGGTTAG19RCCACCAAACTGCTGCTAGG20precursor of mmu-miR-23aFGATTTGATGCCAGTCACA21RGGGTCAGTTGGAAATCC22precursor of mmu-miR-664FTGACTGGATAGAAAACATTATTC23RCTTTCATGTGTAGGCTGG24mousesnoRNA202FGCTGTACTGACTTGATGAAAGTAC25RCATCAGATGGAAAAGGGTTCAA26mousePhf20FCATTGACTACGAAGAAGGGAG27RCTTCTCTAAAGGGCGCAGATA 28mouseTrim63FGCTGTGGAAAACATCATTGACAT29RCATCGGGTGGGCTGCCTTT30mouseCdkn1bFTCAAACGTGAGAGTGTCTAACGG31RAGGGGCTTATGATTCTGA AAGTCG32mouseUsp25FCAGAAGCACCAGCAGACATTT33RTGGCATTCTTTGCAGTGAGGA34mousePax7FGTGCCCTCAGTGAGTTCGATTAGC35RCCACATCTGAGCCC TCATCCA36mouseMyod1FCCACTCCGGGACATAGACTTG37RAAAAGCGCAGGTCTGGTGAG38mouseGapdhFGACCCCTTCATTGACCTC39RGCCATCCACAGTCTTCTG40

[0118] The expression levels of each precursor of miRNA and mRNA were normalized to the expression levels of U6 for hsa-miRNA, snoRNA202 for mmu-miRNA, and GAPDH for mRNA. Cq values ​​were defined using Bio-Rad CFX Maestro 2.8 software. Relative RNA amounts were quantified using the 2-△△Cq method (△Cq = CQ target gene - CQ normalized gene), and △△Cq was used to calculate the P-value.

[0119] Experimental Example 6. Cell Culture

[0120] Human skeletal muscle cells (CC-2561) were cultured in SkBM basal medium (CC-3161) containing SkGM SingleQuot kit Supplement & Growth Factor (CC-4139). Exosome-depleted FBS (#A2720801, Gibco, USA) was used as FBS. Cells were cultured in a humidified incubator at 37°C and 5% CO2. Cells were subcultured when confluent. HSkMC differentiation medium (Cell Application, 151D-250) was used to differentiate human skeletal muscle cells. Cells were differentiated for 5 days at 60% confluence. The medium was changed daily during the differentiation period.

[0121]

[0122] Experimental Example 7. Immunoblot Analysis

[0123] Cells were placed on ice and extracted with PRO-PREP™ protein extraction solution (#17081, Intron Biotechnology). Specifically, cell lysates were centrifuged at 13,000 rpm for 30 min to extract proteins. The extracted proteins were separated by 10.0–7.5% SDS-PAGE and transferred to Immobilon-P membranes (Millipore). The transferred membranes were then blocked for 1 h in 1X tri-buffered saline buffer (140 mM NaCl, 2.7 mM KCl, 250 mM Tris-HCl, pH 7.4) containing 5% skim milk and 0.2% Tween-20. After blocking, the membranes were washed and incubated with primary antibodies overnight at 4°C. After incubation, the membrane was washed and incubated with secondary antibody for 1 hour at room temperature.

[0124] The primary antibodies used in this experiment were anti-MYOD (#sc-377460, Santa Cruz Biotechnology), anti-PHF20 (#3934S, Cell signaling), anti-MuRF1 (#sc-398608, Santa Cruz Biotechnology), anti-TSG101 (#sc-7964, Santa Cruz Biotechnology), anti-Calnexin (#2679, Cell Signaling), and anti-GAPDH (#A19056, Abclonal). The secondary antibodies used in this experiment were anti-Rabbit (#7074V, Cell Signaling) and anti-Mouse (#31430).

[0125] Protein expression was visualized using ProNA ECL (#TLP-112.1, TransLab) according to the manufacturer's instructions. All protein expression levels were normalized to the expression level of the housekeeping protein GAPDH.

[0126]

[0127] Experimental Example 8. Exosome Isolation from Conditioned Medium

[0128] ExoQuick-TC TM Exosomes were isolated from the growth medium of skeletal muscle cells before and after differentiation using (EXOTC50A-1, system Biosciences). Specifically, 20 mL of concentrated medium was centrifuged at 3000 g for 15 min to remove cells and cell debris. An equal volume of ExoQuick-TC was added to the obtained supernatant. TM was added. After inverting at least five times, the mixture was incubated overnight at 4°C and centrifuged at 1500 g for 30 min. The supernatant was discarded, and the pellet was collected. The obtained pellet was resuspended in Trizol (15596026, Invitrogen) and analyzed for exosomal RNA. After resuspending the exosomes in Trizol, they were immediately stored at -80°C.

[0129]

[0130] Experimental Example 9. Precursor miRNA Profile Analysis

[0131] Sequencing libraries were constructed using the SMARTer smRNA-Seq kit for Illumina (Takara Bio, Shiga, Japan). The prepared libraries were verified for size and concentration according to the Illumina qPCR Quantification Protocol Guide. Sequence alignment and detection of known and novel miRNA precursors were performed using the miRDeep2 software algorithm. Reads aligned to each precursor were selected from the read alignment results of the miRDeep2 Quantifier module. Among the selected reads, reads assigned to mature miRNAs were excluded, and those with a precursor length of ≥50% were selected. The RPM was calculated using the sum of the total reads for each sample obtained from the selected results. All procedures for exosomal precursors in miRNA sequencing analysis were performed at Macrogen (Seoul, Korea).

[0132]

[0133] Experimental Example 10. RNA extraction from skeletal muscle

[0134] Cardiac perfusion was performed prior to muscle collection to minimize blood contamination. The gastrocnemius, soleus, and tibialis anterior (TA) muscles from the hind limbs of mice were excised, and adipose tissue was carefully removed without further damage to the muscle tissue. For cfRNA isolation, fresh skeletal muscle tissue was collected from the mice. The collected skeletal muscle tissue was immediately placed in a 3.5 cm dish containing Dulbecco's Modified Eagle's Medium (#LM001-06, Welgene, Korea) supplemented with 10% exosome-depleted FBS (#A2720801, Gibco, USA), 4 mM L-glutamine, and 5.5 mM D-glucose. The skeletal muscle tissue was cultured for 24 h in an incubator set to 37°C and 5% CO2 to release muscle-derived cell-free RNA under conditions similar to the in vivo environment. Afterwards, 15 ul of concentrated cell-free RNA was extracted using the Quick-cfRNA Serum&Plasma Kit (#1059, Zymo Research, USA).

[0135] Additionally, total RNA was isolated and extracted from the gastrocnemius muscle using Trizol.

[0136]

[0137] Experimental Example 11. Grip Strength Test

[0138] To measure hindlimb grip strength, mice were placed on a grip dynamometer, and the tail and nape of the neck were gently pulled. Each mouse performed the test five times, with a five-minute rest period between each test. Values ​​were recorded and normalized to total body weight.

[0139]

[0140] Experimental Example 12. RNA Correlation Analysis

[0141] To evaluate the expression relationships between genes in skeletal muscle, we used gene expression profiling interactive analysis 2 (GEPIA2) (http: / GEPIA2.cancer-pku.cn / index.html). Within GTEx {Consortium, 2015 #72}, only the skeletal muscle tissue database (n=396) was used as the analysis database.

[0142]

[0143] Experimental Example 13. Histological Analysis of Muscle Tissue

[0144] Skeletal muscle tissue was fixed in 4% paraformaldehyde and paraffin-embedded sections of 4 μm thickness were prepared. Paraffin sections were stained with H&E according to a standard protocol. Cross-sectional area (CSA) was measured using Image J software. For each cross-sectional area, six different views were randomly selected for measurement.

[0145]

[0146] Experimental Example 14. Muscle Damage and MiRNA Administration

[0147] To deliver miR-6516 to the TA muscle, a mixture of mimic-miR-6516 (#SMM-003, Bioneer, Korea) was prepared using RNAiMAX (#13778030, Invitrogen, USA). The mixture was injected on days 5 and 10 of a 14-day fixation period, and the Velcro was replaced after injection.

[0148]

[0149] Experimental Example 15. Immobilized Mouse Model

[0150] The right hind limb of a 10-week-old male C57 / BL6 mouse was used. As described in a previous study, surgical tape was applied to the area to be fixed, starting from the distal end of the paw. Velcro was then applied to the hind limb, starting from the distal end. If any adverse effects were observed while the hind limb was loose or immobilized, the Velcro was replaced. The forelimb and left hind limb were free, allowing the mice free access to food and water.

[0151]

[0152] Experimental Example 16. Statistical Analysis

[0153] Data are expressed as the mean and standard error of the mean (SEM) from at least three independent experiments. GraphPad Prism (version 8.1.1, Dotmatics) was used for statistical analysis. Unless otherwise specified, quantitative data are presented as mean ± SEM. Comparisons between two groups were evaluated using an unpaired Student's t-test or Mann-Whitney U test, depending on the Shapiro-Wilk test. For multiple comparisons, a one-way ANOVA was performed, followed by Dunnett's post hoc test. A P value of <0.05 was considered to indicate a statistically significant difference.

[0154]

[0155] [Example]

[0156] Example 1. Screening of biomarker candidates

[0157] 1-1. Confirmation of muscle cell differentiation

[0158]

[0159] Recently, it has been discovered that miRNA expression levels are not always proportional to precursor miRNAs. This suggests that miRNA levels that change during muscle atrophy may be quantitatively different from precursor miRNA levels.

[0160] To profile skeletal muscle-derived miRNA precursors secreted into plasma as a biomarker of muscle atrophy, we first observed differentiation of human muscle cells and performed sequencing analysis on exosomal miRNA precursors, a type of cfRNA. The results of observing the muscle cell differentiation process are shown in Figure 1a, and the results confirming differentiation are shown in Figure 1b.

[0161] As shown in Figures 1a and b, a fusion morphology of cells was observed in differentiated muscle cells, and increased expression of MYOD was confirmed.

[0162]

[0163] 1-2. Extraction of exosomes from muscle cells

[0164] Exosomes were extracted from differentiated muscle cells. Exosome extraction was confirmed by Western blotting, which detected the expression of the exosome-positive marker TSG101 and the exosome-negative marker Calnexcin. The Western blotting results are shown in Figure 1c.

[0165] As shown in Fig. 1c, the exosome positive marker TSG101 was detected, while the exosome negative marker Calnexcin was not detected.

[0166]

[0167] 1-3. Base Sequence Analysis of Precursor MiRNAs in Exosomes and Selection of Biomarker Candidates

[0168] We performed a sequence analysis of precursor miRNAs contained in exosomes.

[0169] Based on the sequence analysis results, abundant precursor miRNAs with a cutoff point of 700 Reads per Million (RPM) or higher were selected as biomarker candidates. Precursor miRNA biomarker candidates include the precursor of miR-206, a muscle-specific miRNA; and miR-133b, which has been shown to be regulated in patients with sarcopenia.

[0170] Previous studies have shown that some small nucleolar RNAs (snoRNAs) can also function as miRNA precursors. Furthermore, it was confirmed that miR-1291 and miR-3651 can be derived from snoRA2C and snoRD84, respectively, and that these snoRNAs share highly similar nucleotide sequences with their respective miRNA precursors. Therefore, snoRA2C and snoRD84 were considered precursors of miR-1291 and miR-3651 and were included in further analysis. Other snoRNAs that were not confirmed to be degraded into miRNAs or miRNA precursors with sequence overlap with specific mRNAs were excluded from the analysis. Furthermore, the precursor of miR-4449 was excluded from the analysis due to its structural specificity of 86% G+C, making primer design and RT-PCR difficult.

[0171] Therefore, in human plasma, the precursors of miR-206, miR-12136, miR-1219, miR-664a, miR-3651, and miR-133b were selected as genes to be analyzed.

[0172] Precursor miRNA biomarker candidates are shown in Table 2.

[0173] Precursor miRNARPM; Reads per millionAdditional selected myomiRPre-DifferentiatedDifferentiatedPre-DifferentiatedDifferentiatedSkeletal muscle(Skm)-specificSarcopeniaassociatedmiR-12136miR-121366.7 x 10 5 1.18 x 10 5 miR-206miR-133bmiR-1291miR-12916.72 x 10 3 7.97 x 10 2 miR-23amiR-23a8.52 x 10 2 5.31 x 10 2miR-3651miR-36512.7 x 10 3 8.4 x 10 4 miR-4449miR-44494.83 x 10 3 1.75 x 10 4 miR-6516miR-65162.79 x 10 3 1.38 x 10 4 miR-664a-1.04 x 10 3 -miR-664b-7.1 x 10 2 --let-7a-31.89 X 10 2 7.97 x 10 2 -miR-103949.47 X 107.97 x 10 2 Abundant pre-miRNAs in exosomes derived from human skeletal muscle cells

[0174] 1-4. Quantitative analysis of expression of biomarker candidates

[0175] In the above examples 1-3, precursor miRNAs to be analyzed were selected from human plasma.

[0176] In this experiment, due to the lack of patients diagnosed with sarcopenia, we investigated diseases that could potentially cause sarcopenia as a complication and used samples from patients with these diseases. Because sarcopenia is highly prevalent in diabetes and chronic kidney disease, we quantitatively analyzed the expression of biomarker candidates using plasma from patients with these diseases and plasma from healthy individuals aged 20-30. The results of the analysis of biomarker expression are presented in Figures 1d and e. The p-values ​​for each experimental group are also presented in Table 3.

[0177] HumanGene symbolPatients of Chronic kidney disease with DiabetesPrecursor ofChangep-valueSignificanthas-miR-206Up0.0235Yeshas-miR-644aUp0.0297Yeshas-miR-12136Up0.1294Nohas-miR-1291Down0.4945Nohas-miR-133bDown0.2843Nohas-miR-3561Up0.1069NoQuantitative analysis table of cfRNA derived from human plasma

[0178] As shown in Figures 1d and e, among the biomarker candidates, the precursor expression of miR-206 and miR-664a was significantly increased in the patient group (Figure 1d). In contrast, there was no significant difference in the expression levels of precursor miR-133b, miR-1291, miR-3651, and miR-12136 (Figure 1e). These results imply that increased expression of miR-206 and miR-664a precursors derived from circulating plasma cfRNA may be associated with sarcopenia, a disease characterized by muscle atrophy.

[0179]

[0180] Example 2. Confirmation of muscle atrophy in the PHF20 TG mouse model

[0181] 2-1. Correlation Analysis of Muscle-Related Markers

[0182] The patient group analyzed in this study was only a group expected to have muscle atrophy as a complication, but muscle atrophy was not clearly confirmed. Therefore, to analyze muscle-derived cfRNA in a muscle atrophy mouse model, we confirmed the induction of muscle atrophy in mice overexpressing PHF20. Furthermore, PHF20 is known to negatively affect muscle differentiation through positive regulation of YY1. In this regard, we evaluated the correlation between muscle differentiation markers (MYH2, TNNT1, and TNNT3). In addition, we investigated the relationship between muscle atrophy markers MuRF1 (TRIM63) and Atrogin-1 (FBXO32) and their upstream transcription factor FOXO3a. The results of the correlation analysis are shown in Figures 2aa and 2ab.

[0183] As shown in Figures 2aa and 2ab, we confirmed a negative association between PHF20 and muscle differentiation marker genes, juxtaposed with a positive association with muscle atrophy marker genes. Notably, the correlation patterns between YY1 and each marker gene were similar to those observed for PHF20. These results suggest that PHF20 overexpression can inhibit muscle differentiation and promote muscle atrophy.

[0184]

[0185] 2-2. Confirmation of expression of muscle atrophy-related markers in the PHF20 TG mouse model

[0186] Recent studies have shown that overexpression of PHF20 inhibits muscle differentiation and causes defects in muscle morphology in vivo, suggesting that PHF20 overexpression may induce muscle atrophy. Therefore, in this study, we analyzed the protein expression of PHF20 and the muscle atrophy marker MuRF1 in the PHF20 TG mouse model. We also analyzed the mRNA expression of Phf20 and Trim63, which encode PHF20 and MuRF1, respectively. The results of the protein expression analysis of PHF20 and MuRF1 are shown in Figure 2b, and the mRNA expression analysis of Phf20 and Trim63 are shown in Figure 2c.

[0187] As shown in Fig. 2b, the PHF20 TG mouse model had increased protein expression of PHF20 and muscle atrophy marker MuRF1.

[0188] As shown in Fig. 2c, the PHF20 TG mouse model also confirmed that the mRNA expression of Phf20 and Trim63, which encode PHF20 and MuRF1, was induced.

[0189]

[0190] 2-3. Muscle strength evaluation in the PHF20 TG mouse model

[0191] To assess muscle strength in the PHF20 TG mouse model, a grip strength test was performed. Muscle tissue from the PHF20 TG mouse model was sectioned in paraffin and stained with H&E to observe the cross-sectional area of ​​the muscle. The results of the grip strength test and tissue observation are shown in Figures 2d and e, respectively.

[0192] As shown in Figures 2d and e, the grip strength of the PHF20 TG mouse model was significantly reduced compared to wild-type mice (Figure 2d), and the cross-sectional area of ​​muscle tissue was significantly reduced compared to wild-type mice (Figure 2e). This suggests that overexpression of PHF20 induces muscle atrophy in vivo.

[0193]

[0194] Example 3. Confirmation of muscle atrophy in a fixed mouse model

[0195] 3-1. Fixed mouse model

[0196] As shown in Figure 3a, muscle atrophy was induced in wild-type mice using Velcro immobilization. Previous studies have shown that immobilizing the hind limbs with Velcro for two weeks induces muscle atrophy. Therefore, muscle atrophy was induced by immobilizing the right hind limb of 10-week-old male wild-type mice for two weeks.

[0197]

[0198] 3-2. Measurement of muscle tissue cross-sectional area in a fixed mouse model

[0199] The cross-sectional area (CSA) of the muscle tissue of the fixed mouse model of Example 3-1 above was measured, and the results are shown in Fig. 3b.

[0200] As shown in Figure 3b, the immobilized mouse model showed a significantly reduced cross-sectional area of ​​muscle tissue compared to the normal control group.

[0201]

[0202] Skeletal muscle atrophy induces biochemical and physiological changes in atrophied muscles, leading to altered gene expression. These characteristics suggest that atrophied muscles in PHF20-overexpressing and immobilized mouse models may generate cfRNA with altered expression levels. To investigate these expression changes, we conducted further analyses of candidate muscle atrophy biomarkers.

[0203]

[0204] Example 4. Expression analysis of biomarker candidates in vivo.

[0205] 4-1. Expression analysis of biomarker candidates in PHF20 overexpression and immobilized mouse models.

[0206] The gastrocnemius, soleus, and tibialis anterior (TA) muscles of the PHF20 overexpression model and immobilized mouse models were prepared. The prepared tissues were immediately placed in DMEM containing 10% exosome-depleted FBS, 4 mM L-glutamine, and 5.5 mM D-glucose and cultured for 24 h in an incubator at 37°C and 5% CO2. Subsequently, cfRNA was extracted from the culture medium using a cfRNA extraction kit according to the manufacturer's instructions. Cardiac perfusion was performed before muscle tissue preparation to minimize the influence of other organs when extracting cfRNA from each muscle tissue. For the same reasons that some of the discovered precursor miRNAs were selected for human plasma analysis, the precursors of miR-206, miR-6516, miR-1291, miR-23a, and miR-664 were also selected for mouse precursor miRNA analysis. Because miR-664 is not differentiated into miR-664a or b in mice, the precursor miR-664 was included in the analysis. The expression of precursor miRNAs in the gastrocnemius, soleus, and tibialis anterior muscles of two mouse models is shown in Figures 4a to 4c, respectively. The p-values ​​for each experimental group are also shown in Table 4.

[0207] MouseGene symbolImmobilization-injured mice (IMO)GastrocnemiusTA muscleSoleusPrecursor ofChangep-valueChangep-valueChangep-valuemmu-miR-206Up0.0008Up0.0381Up0.0018mmu-miR-6516Down0.0416Down0.0021Down0.0498mmu-miR-1291--Down0.0012--mmu-miR-23a--Down0.0275--mmu-miR-664------Gene symbolPHF20 TG miceGastrocnemiusTA muscleSoleusPrecursor ofChangep-valueChangep-valueChangep-valuemmu-miR-206--Up0.0013--mmu-miR-6516--Down0.006--mmu-miR- 1291Down0.0168Down9.83E-05--mmu-miR-23aDown0.0007Down0.004--mmu-miR-664--Down0.0081--Quantitative analysis table of cfRNA derived from mouse muscles

[0208] As shown in Figures 4a to c, the immobilized mouse model showed increased expression levels of miR-206 precursor in cfRNA derived from gastrocnemius, tibialis anterior, and soleus muscles, while the expression levels of miR-6516 precursor were decreased (Figures 4a to c). In addition, the expression levels of miR-1291 and miR-23a precursors were decreased in cfRNA derived from tibialis anterior muscles (Figure 4b). The PHF20 overexpressing mouse model showed increased expression levels of miR-206 precursor in cfRNA derived from tibialis anterior muscles (Figure 4b), while the expression levels of miR-6516 precursor were decreased in cfRNA derived from tibialis anterior muscles (Figure 4b). In addition, the expression levels of miR-1291 and miR-23a precursors were decreased in cfRNA derived from gastrocnemius muscles (Figure 4a). Similar to the immobilized mouse model, the PHF20 TG mouse model had reduced precursor expression of miR-1291, miR-23a, and miR-664 in the tibialis anterior muscle (Fig. 4b).

[0209] In particular, miR-206 is a skeletal muscle-specific miRNA, and its precursor miRNA expression was confirmed to be increased in human plasma (Examples 1-4 and Table 4). Furthermore, as shown in Figures 4a to 4c, similar results to those observed in human plasma experiments were observed in two mouse models. This suggests that miR-206 precursors increase in muscle-derived cfRNA during muscle atrophy in mice and also in plasma cfRNA from patients with sarcopenia.

[0210]

[0211] Example 5. Investigation of the effects of upregulation of miR-6516.

[0212] 5-1. Changes in muscle tissue cross-sectional area due to upregulation of miR-6516

[0213] In Example 4 and Figures 3a-c, we confirmed that the expression of miR-6516 precursor was reduced in all muscle-derived cfRNAs analyzed in a Velcro-fastened mouse model induced by muscle disuse atrophy. Based on these results, we investigated the effect of intramuscular miR-6516 administration on muscle disuse-induced atrophy.

[0214] Specifically, mimic-miR-6516 was injected into the TA muscle of the mice on days 5 and 10 over a 14-day period to induce muscle atrophy through Velcro fixation of the right hind limb, as shown in Fig. 5a, and sacrificed on day 14. The control mice were immobilized mice that were not administered mimic-miR-6516. The cross-sectional area of ​​muscle tissue of the sacrificed mice was analyzed, and the results are shown in Fig. 5b.

[0215] As shown in Figure 5b, the immobilized mouse model administered with mimic-miR-6516 showed a significant recovery in muscle tissue cross-sectional area compared to the control group. This suggests that miR-6516 inhibits the progression of muscle atrophy due to disuse.

[0216]

[0217] 5-2. Investigation of miR-6516's predicted target mRNAs

[0218] We investigated the target mRNAs for the muscle atrophy-inhibiting effect of miR-6516. Using Targetscan human (Ver. 8.0) and Targetscan mouse (Ver. 8.0), we examined mRNAs predicted to be common targets of miR-6516-3p or -5p in humans and mice under conditions where the cumulative weight context score (CWCS) was lower than -0.4. In addition, since muscle atrophy was inhibited by miR-6516 injection, we analyzed the correlation with muscle atrophy markers TRIM63 (MuRF1), FBXO32 (Atrogin1), and FOXO3a (FOXO3a), and the results are shown in Table 5.

[0219] CWCS of predicted targetsPredicted targetsgene symbolhas-miR-6516mmu-miR-6516Correlation(Muscle atrophy genes)-3p-5p-3p-5pNppc-0.57--0.49-NegativeCdkn1b-0.47--0.40-PositivePRND--0.48--0.53NegativeUSP25--0.46--0.80Positive- CWCS; cumulative weighted context score- Cumulative weighted context score (CWCS) of miRNA-6516 predicted targets

[0220] As shown in Table 5, mRNAs (Cdkn1b and USP25) positively correlated with muscle atrophy markers TRIM63 (MuRF1), FBXO32 (Atrogin1), and FOXO3a (FOXO3a) were selected as predicted target mRNAs of miR-6516 associated with muscle atrophy suppression.

[0221] 5-3. Investigation of the effect of miR-6516 upregulation on Usp25 and Cdkn1b expression.

[0222] As in Example 5-1, after injecting Mimic-miR-6516 into a fixed mouse model, the effects on the expression of Usp25 and Cdkn1b were investigated. The results of analyzing the expression of Usp25 and Cdkn1b following miR-6516 upregulation are shown in Figure 5c.

[0223] As shown in Fig. 5c, it was confirmed that the expression of Cdkn1b and Usp25 was significantly reduced in the group of mice injected with mimic-miR-6516.

[0224] Additionally, the expression of Pax7 and Myod1, which are early muscle regeneration markers, increased in muscles administered with Mimic-miR-6516, and the results are shown in Fig. 5d.

[0225] In particular, it is known that muscle fiber diameter is reduced in mice overexpressing Cdkn1b. Since miR-6516 reduces the expression of Cdkn1b, it may also be useful in the treatment of muscle-related diseases.

[0226] That is, as shown in Fig. 6, injection of miR-6516 during muscle atrophy suppresses the expression of Cdkn1b; and promotes skeletal muscle satellite cell proliferation and muscle regeneration; thereby suppressing muscle atrophy caused by muscle rest.

[0227]

[0228] In summary, the present inventors confirmed that (i) the precursor miRNA expression level of miR-206 was overexpressed in the plasma of patients with sarcopenia and in muscle-derived cell-free RNA of a sarcopenia animal model compared to the precursor miRNA expression level of a normal control group, and (ii) the precursor miRNA expression level of one or more selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664 was underexpressed in the muscle-derived cell-free RNA of a sarcopenia animal model compared to the precursor miRNA expression level of a normal control group. Furthermore, the present inventors confirmed that injection of miR-6516 during muscle atrophy suppressed the expression of Cdkn1b; and promoted skeletal muscle satellite cell proliferation and muscle regeneration; thereby suppressing muscle atrophy induced by muscle rest (Fig. 6). Therefore, the five precursor miRNAs can be utilized in various fields of diagnosis and treatment of diseases caused by sarcopenia or muscle atrophy.

[0229]

[0230] While specific aspects of the present invention have been described in detail, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A biomarker composition for diagnosing muscle loss or muscle atrophy, comprising at least one precursor miRNA selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664.

2. A composition according to claim 1, wherein the muscle loss or muscle atrophy is at least one selected from the group consisting of sarcopenia, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myotonic dystrophy, amyotrophic lateral sclerosis, myasthenia, and cachexia.

3. A composition for diagnosing muscle loss or muscle atrophy, comprising a preparation for measuring the expression level of at least one precursor miRNA selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a, and miR-664.

4. In the third paragraph, the composition is an antisense oligonucleotide, primer or probe that specifically binds to one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a and miR-664.

5. A diagnostic kit for diagnosing muscle loss or muscle atrophy comprising the composition of paragraph 3. 6.a) a step of measuring the expression level of one or more precursor miRNAs selected from the group consisting of miR-206, miR-6516, miR-1291, miR-23a and miR-664 from a biological sample of an individual; and b) A method for providing information for diagnosing muscle loss or muscle atrophy, comprising: a step of comparing the expression level of precursor miRNA measured in step a) with the expression level of precursor miRNA of a normal control sample.

7. A method according to claim 6, wherein the biological sample is any one selected from the group consisting of blood, serum, saliva, biopsy, tissue, liquid culture, feces, and urine.

8. In the 6th paragraph, step b) is a method for diagnosing a disease caused by muscle loss or muscle atrophy when the precursor miRNA expression level of miR-206 is overexpressed compared to the precursor miRNA expression level of a normal control group.

9. In the 6th paragraph, step b) is a method for diagnosing muscle loss or muscle atrophy when the expression level of one or more precursor miRNAs selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664 is underexpressed compared to the expression level of precursor miRNAs of a normal control group. 10.a) Step of obtaining an analysis sample from an object, b-1) If the expression level of the precursor miRNA of miR-206 in the analysis sample of step a) is higher than that of the comparative control group, the subject is diagnosed with muscle loss or muscle atrophy. b-2) If the expression level of precursor miRNA of one or more precursor miRNAs selected from the group consisting of miR-6516, miR-1291, miR-23a, and miR-664 in the analysis sample of step a) is lower than that of the comparative control group, the subject is diagnosed with muscle loss or muscle atrophy, and c) A method for diagnosing and treating muscle wasting or muscle atrophy, comprising administering an effective amount of a muscle wasting or muscle atrophy treatment agent to a subject diagnosed with muscle wasting or muscle atrophy in step b).

11. A method for diagnosing and treating muscle loss or muscle atrophy in claim 16, wherein the muscle loss or muscle atrophy treatment agent is at least one selected from the group consisting of Androgel, Nebido, Testim, Sustanon, Oxandrin, Megace, Increlex, Inspra, and Aldactone.

Citation Information

Patent Citations

  • Smart phone case system

    KR1020200101680A

  • Micrornas that regulate muscle cell proliferation and differentiation

    US20130225665A1

  • Methods for diagnosis and therapeutic follow-up of muscular dystrophies

    US20140342937A1