Aptamers for coenzyme a and their applications in drug screening

Aptamers targeting CoA enable sensitive and specific detection and modulation, addressing limitations in current CoA detection and assessment methods by providing a reliable tool for evaluating compound impacts and therapeutic interventions.

WO2025250628A1PCT designated stage Publication Date: 2025-12-04BOARD OF RGT THE UNIV OF TEXAS SYST +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/031182
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-28
Filing Date
2025-05-28
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Current methods for detecting and modulating coenzyme A (CoA) are limited in sensitivity and specificity, and there is a need for effective tools to assess the impact of test compounds on CoA levels and dysregulation.

Method used

Development of aptamers comprising a binding nucleic acid that selectively binds to CoA and a signaling nucleic acid that produces a detectable signal when bound to CoA, enabling methods for detecting CoA, assessing compound effects, and treating CoA dysregulation.

Benefits of technology

The aptamer system provides sensitive and specific detection of CoA, allowing for accurate assessment of compound effects and potential therapeutic interventions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000019_0001
    Figure IMGF000019_0001
  • Figure IMGF000014_0001
    Figure IMGF000014_0001
  • Figure IMGF000015_0001
    Figure IMGF000015_0001
Patent Text Reader

Abstract

An aptamer which selectively produces a detectable signal in the presence of CoA and methods of using the same.
Need to check novelty before this filing date? Find Prior Art

Description

APTAMERS FOR COENZYME A AND THEIR APPLICATIONS IN DRUGSCREENINGCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 652.368, filed May 28, 2024, which is incorporated by reference herein in its entirety.GOVERNMENT SUPPORT CLAUSE

[0002] This invention was made with government support under Grant No. R35 GM141931 awarded by the National Institutes of Health. The Government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] The sequence listing submitted on May 28, 2025, as an .XML file entitled “10046- 613W01_ST26.xmT’ created on May 27, 2025, and having a file size of 78,107 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).SUMMARY

[0004] In an aspect, provided is an aptamer including: a binding nucleic acid which selectively binds to coenzyme A (CoA); and a signaling nucleic acid which is at least partially complementary to at least a portion of the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can produce a detectable signal.

[0005] In another aspect, provided is a method of detecting coenzyme A (CoA), the method including: a) exposing a sample to an aptamer including: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and ii) a signaling nucleic acid which is at least partially complementary to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can produce a detectable signal; and b) identifying the detectable signal, thereby detecting CoA in the sample.

[0006] In yet another aspect, provided is a method of determining usefulness of a test compound in modulating coenzyme A (CoA), the method including: a) exposing the test compound to the sample; b) exposing the sample to an aptamer including: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and ii) a signaling nucleic acid which is at least partially complementary to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can produce a detectable signal; c) identifyingthe detectable signal, thereby detecting CoA in the sample; and d) using said detectable signal to determine an effect of the test compound on CoA.

[0007] In yet still another aspect, provided is a screening assay for determining presence of coenzyme A (CoA) in a sample, the screening assay including an aptamer including: a binding nucleic acid which selectively binds to coenzyme A (CoA); and a signaling nucleic acid which is at least partially complementary to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA. the signaling nucleic acid can produce a detectable signal.

[0008] In yet still another aspect, provided is a method of treating and / or preventing dysregulation of coenzyme A (CoA) in a subject in need thereof, the method including: a) administering to the subject an aptamer comprising: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and ii) a signaling nucleic acid which is at least partially complementary' to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can trigger a therapeutic event.

[0009] Other systems, methods, features and / or advantages will be or may become apparent to one with skill in the art upon examination of the following drawings and detailed description. It is intended that all such additional systems, methods, features and / or advantages be included within this description and be protected by the accompanying claims.BRIEF DESCRIPTION OF DRAWINGS

[0010] FIGURE 1 depicts the general setup of the CoA aptamer sensor.

[0011] FIGURE 2 depicts the selectivity' of the CoA aptamer sensor versus a negative control.

[0012] FIGURES 3A-3B depict the selectivity of the CoA aptamer sensor.

[0013] FIGURE 4 depicts that the CoA aptamer sensor also works in various pH from about 6.4 to about 8.

[0014] FIGURES 5A-5C depict that the CoA aptamer sensor can detect CoA in HeLa cells.

[0015] FIGURES 6A-6B depict the use of the CoA aptamer sensors for a drug screen.

[0016] FIGURE 7 depicts that the CoA aptamer sensor can detect CoA in SH-Sy5Y cells.

[0017] FIGURE 8 depicts a drug screen with a plate reader.

[0018] FIGURES 9A-9B depict selection of a CoA aptamer. FIG. 9A shows the in vitro selection process for obtaining the CoA aptamer. Each DNA library strand (SEQ ID NO: 18) contains a 40-nucleotide randomized sequence flanked by two constant sequences at both ends,serving as PCR primers. The binding region between the capture strand and the DNA library is highlighted. After immobilizing the DNA library onto beads. CoA is introduced into the solution. DNA strands that bind to CoA undergo a structural switch, detaching from the capture strand and entering the solution, forming a stem-loop structure with sequences represented by blue color. These eluted strands are then PCR amplified, and ssDNA libraries are prepared. After re-immobilizing the DNA library onto the beads, counter-selection molecules are added to the solution, and the non-specific DNA strands are removed. The DNA library is then incubated with CoA, and the eluted CoA-aptamer DNA is collected. This selection process is repeated multiple times. FIG. 9B shows the CoA-seqlO aptamer sequence (SEQ ID NO: 39) and its predicted secondary structure, generated using UNAfold software. The sequence is illustrated with different colors, whose function is explained in legends of FIG. 9A. The UNAfold prediction illustrates the secondary structure of the CoA aptamer upon binding to CoA.

[0019] FIGURE 10 depicts monitoring the progress of the SELEX by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA. using qPCR.

[0020] FIGURES 11A-11F depict characterization of the CoA-seqlO aptamer sensor. FIG. 11A shows a thermogram for the ITC titration of 300 pM CoA-seqlO titrated by 3.2 mM CoA in aptamer binding buffer. FIG. 11B shows a thermogram for the ITC titration of aptamer binding buffer by 3.2 mM CoA in the same buffer. FIG. 11C shows integrated heat of the ITC titration for CoA-seqlO and CoA. the black line represents the binding curve fitted with the ‘one set of binding sites’ model. FIG. 1 ID shows the general setup of the CoA aptamer sensor’s structure switching mechanism. FIG. HE shows the normalized fluorescence intensity' of different aptamer: quencher ratios, when aptamer concentration is 50 nM. FIG. HF shows the normalized fluorescence of the selectivity of CoA-seqlO aptamer sensor versus a negative control with scrambled sequences.

[0021] FIGURE 12 depicts reads per million (RPM) obtained from analysis of the HTS data for the CoA-seqlO sequence as a function of the selection rounds, using FASTAptamer- Count.

[0022] FIGURE 13 depicts normalized fluorescence of CoA-seqlO aptamer and its mutations. The sequences of CoA-seqlO and its mutations are provided in TABEE 5.

[0023] FIGURES 14A-14B depict the CoA aptamer sensor’s selectivity against similar molecules to CoA. FIG. 14A shows normalized fluorescence of the CoA-seqlO aptamer sensor’s selectivity with concentration dependence of analytes. FIG. 14B shows normalizedfluorescence of the CoA-seqlO aptamer sensor's selectivity with physiologically relevant concentrations of analytes.

[0024] FIGURES 15A-15F depict CoA aptamer sensor performance across various pH levels. FIGS. 15A-15F show normalized fluorescence of the CoA-seqlO aptamer sensor’s activity versus the negative control with scrambled sequences at pH 6.4 (FIG. 15A), pH 6.8 (FIG. 15B), pH 7.2 (FIG. 15C), pH 7.4 (FIG. 15D), pH 7.6 (FIG. 15E). and pH 8.0 (FIG.15F)

[0025] FIGURES 16A-16B depict that the CoA aptamer sensor detects CoA regulation in HeLa cells. FIG. 16A shows CLSM images of CoA using the CoA-seqlO sensor andNC sensor in live HeLa cells during CoA regulation. Scale bar is 50 pm. FIG. 16B shows quantification of average fluorescence intensity (arbitrary units. a.u.) per cell shown in (a); ***P < 0.0001. Data in FIGS. 16A-16B represent three independent experiments; n = 5 frames. Scale bar is 50 pm. Data are shown as mean ± s.d. Statistical significance was determined by unpaired two- tailed Student’s t-test; NS, not significant (P>0.05); *** (P < 0.001).

[0026] FIGURES 17A-17C depict that the CoA aptamer sensor detects CoA in drug screens in SH-SY5Y cells. FIG. 17A shows CLSM images of CoA using the CoA-seqlO sensor and NC sensor in live SH-SY5Y cells during drug screening. FIG. 17B shows quantification of average fluorescence intensity (arbitrary units, a.u.) per cell shown in FIG. 17A. Statistical significance was determined by unpaired two-tailed Student’s t-test; NS, not significant (P>0.05); *** (P < 0.0001). Scale bar is 50 pm. FIG. 17C shows quantification of CoA through ratio of the CoA-seql 0 sensor fluorescence to NC sensor fluorescence in drug screening in SH- SY5Y cell lysates. * (P=0.0286). Data in FIGS. 17A-17C represent three independent experiments; Data in FIGS. 17A-17B. n = 5 frames. Data are shown as mean ± s.d..DETAILED DESCRIPTION

[0027] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate aspects, can also be provided in combination with a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, can also be provided separately or in any suitable subcombination. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure.DEFINITIONS

[0028] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:

[0029] As used herein, “comprising’’ is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by”, “comprising,” “comprises”, “comprised of,” “including,” “includes,” “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, non-limiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of’ and “consisting of.” Similarly, the term “consisting essentially of’ is intended to include examples encompassed by the term “consisting of.

[0030] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound”, “a composition”, or “a cancer”, includes, but is not limited to, two or more such compounds, compositions, or cancers, and the like.

[0031] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It can be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it can be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0032] When a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g. the phrase “x to y” includes the range from ‘x’ to ‘y’ as well as the range greater than ‘x’ and less than ‘y’. The range can also be expressed as an upper limit, e.g. ‘about x, y, z. or less’ and should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of Tess than x’. less than y’. and Tess than z’. Likewise, the phrase 'about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘aboutx’, ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x', greater than y', and ‘greater than z’. In addition, the phrase “about ‘x’ to ‘y’”. where ‘x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’”.

[0033] It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “about 0.1% to 5%” should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the subranges (e.g., about 0.5% to about 1.1%: about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.

[0034] As used herein, the terms “about,” “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about,” “approximate,” or “at or about” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0035] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.

[0036] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0037] As used interchangeably herein, “subject,” “individual,” or “patient” can refer to a vertebrate organism, such as a mammal (e.g. human). "Subject" can also refer to a cell, a population of cells, a tissue, an organ, or an organism, preferably to human and constituents thereof.

[0038] As used herein, the terms "treating" and "treatment" can refer generally to obtaining a desired pharmacological and / or physiological effect. The effect can be. but does not necessarily have to be, prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof, such as an ophthalmological disorder. The effect can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease, disorder, or condition. The term "treatment" as used herein can include any treatment of ophthalmological disorder in a subject, particularly a human and can include any one or more of the following: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., mitigating or ameliorating the disease and / or its symptoms or conditions. The term "treatment" as used herein can refer to both therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of treatment (subjects in need thereof) can include those already with the disorder and / or those in which the disorder is to be prevented. As used herein, the term "treating", can include inhibiting the disease, disorder or condition, e.g.. impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and / or condition. Treating the disease, disorder, or condition can include ameliorating at least one symptom of the particular disease, disorder, or condition, even if the underlying pathophysiology is not affected, e.g., such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.

[0039] As used herein, “therapeutic” can refer to treating, healing, and / or ameliorating a disease, disorder, condition, or side effect, or to decreasing in the rate of advancement of a disease, disorder, condition, or side effect.

[0040] Reference is made herein to nucleic acid and nucleic acid sequences. The terms “nucleic acid” and “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of genomic or synthetic origin (which may be singlestranded or double-stranded and may represent the sense or the antisense strand).

[0041] Variants comprising deletions relative to a reference amino acid sequence or nucleotide sequence are contemplated herein. A “deletion’" refers to a change in the amino acid or nucleotide sequence that results in the absence of one or more amino acid residues or nucleotides relative to a reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acids residues or nucleotides. A deletion may include an internal deletion or a terminal deletion (e.g., an N-terminal truncation or a C-terminal truncation or both of a reference polypeptide or a 5 '-terminal or 3 '-terminal truncation or both of a reference polynucleotide).

[0042] Variants comprising a fragment of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or a nucleotide sequence which is identical in sequence to but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide / amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10. 15. 20. 21. 22. 23. 24, 25, 26, 27, 28, 29. 30. 40. 50. 60. 70. 80, 90, 100. 150, 250, or 500 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. Fragments may be preferentially selected from certain regions of a molecule, for example the N-terminal region and / or the C-terminal region of a polypeptide or the 5'-terminal region and / or the 3' terminal region of a polynucleotide. The term “at least a fragment” encompasses the full length polynucleotide or full length polypeptide.

[0043] Variants comprising insertions or additions relative to a reference sequence are contemplated herein. The words “insertion” and “addition” refer to changes in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 amino acid residues or nucleotides.

[0044] Fusion polynucleotides also are contemplated herein. A “fusion polynucleotide” refers to the fusion of the nucleotide sequence of a first polynucleotide to the nucleotide sequence of a second heterologous polynucleotide (e.g., the 3' end of a first polynucleotide to a 5' end of the second polynucleotide). Where the first and second polynucleotides encode proteins, the fusion may be such that the encoded proteins are in-frame and results in a fusion protein. The first and second polynucleotide may be fused such that the first and secondpolynucleotide are operably linked (e.g., as a promoter and a gene expressed by the promoter as discussed below).

[0045] '‘Homologj7’’ refers to sequence similarity or, interchangeably, sequence identity, between two or more polypeptide sequences or polynucleotide sequences. Homology, sequence similarity , and percentage sequence identity may be determined using methods in the art and described herein.

[0046] The terms “percent identity” and “% identity.” as applied to polynucleotide sequences, refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U.S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety ). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403 410). which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including "blastn." that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI w7ebsite. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed above).

[0047] Percent identity may be measured over the length of an entire defined polynucleotide sequence or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length may be used to describe a length over which percentage identity may be measured.

[0048] A “full length” polynucleotide sequence is one containing at least a translation initiation codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length"’ polynucleotide sequence encodes a “full length” polypeptide sequence.

[0049] A “variant,'’ “mutant.” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences — a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide.

[0050] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences due to the degeneracy of the genetic code. It is understood that changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that all encode substantially the same protein.

[0051] “Operably linked” refers to the situation in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be in close proximity7or contiguous and. where necessary to join two protein coding regions, in the same reading frame.

[0052] A “recombinant nucleic acid” is a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two or more otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1 3, Cold Spring Harbor Press, Plainview7N.Y. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid. Frequently, a recombinant nucleic acid may include a nucleic acid sequence operably linked to a promoter sequence. Such a recombinant nucleic acid may be part of a vector that is used, for example, to transform a cell.

[0053] “Transformation” describes a process by which exogenous DNA is introduced into a recipient cell. Transformation may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method fortransformation is selected based on the type of host cell being transformed and may include, but is not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, and particle bombardment. The term ‘'transformed cells” includes stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome, as well as transiently transformed cells which express the inserted DNA or RNA for limited periods of time.

[0054] “Substantially isolated or purified” nucleic acid or amino acid sequences are contemplated herein. The term '‘substantially isolated or purified” refers to nucleic acid or amino acid sequences that are removed from their natural environment, and are at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which they are naturally associated.

[0055] The term “mismatched” or “mismatched target sequence” refers to an off-target sequence that is not perfectly complementary to the first DNA sequence or the second DNA sequence of the chimeric deoxyribonucleic acid described herein. The dual retargeted DNA may have at least one mismatch, but can also have 2, 3, 4. 5, 6 or 7 or more mismatched nucleotides to the off-target sequence.

[0056] As used herein, the term “detecting” used in context of detecting a signal from a detectable label to indicate the presence of a target nucleic acid (such as a signaling nucleic acid) in the sample does not require the method to provide 100% sensitivity and / or 100% specificity. As is well known, “sensitivity” is the probability that a test is positive, given that the sample has a target nucleic acid sequence, while “specificity” is the probability that a test is negative, given that the sample does not have the target nucleic acid sequence. A sensitivity of at least 50% is preferred, although sensitivities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred. A specificity of at least 50% is preferred, although sensitivities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred. Detecting also encompasses assays with false positives and false negatives. False negative rates may be 1%, 5%, 10%, 15%, 20% or even higher. False positive rates may be 1%, 5%, 10%, 15%, 20% or even higher. The term “detecting" is also used in the context of detecting the amplified target nucleic acid by its melting temperature using melting curve analysis, as is known in the art.

[0057] As used herein, “labels” are chemical or biochemical moieties useful for labeling a nucleic acid (including a single nucleotide), amino acid, or antibody. “Labels” include fluorescent agents, chemiluminescent agents, chromogenic agents, quenching agents, radionuclides, enzymes, substrates, cofactors, inhibitors, magnetic particles, quantum dots, andother moieties known in the art. “Labels” are capable of generating a measurable signal, or can be used to capture nucleic acids, and may be covalently or noncovalently joined to an oligonucleotide or nucleotide (e.g., a non-natural nucleotide).

[0058] As used herein, the term “aptamer” refers to a non-naturally occurring nucleic acid that has a desirable action on a target molecule (e.g., coenzyme A). A desirable action includes, but is not limited to, binding of the target, catalytically changing the target, reacting with the target in a way that modifies or alters the target or the functional activity of the target, covalently attaching to the target (as in a suicide inhibitor), and facilitating the reaction between the target and another molecule. In one embodiment, the action is specific binding affinity for a target molecule, such target molecule being a three-dimensional chemical structure other than a polynucleotide that binds to the nucleic acid ligand through a mechanism which is independent of Watson / Crick base pairing or triple helix formation, wherein the aptamer is not a nucleic acid having the known physiological function of being bound by the target molecule. Aptamers to a given target include nucleic acids that are identified from a candidate mixture of nucleic acids, where the aptamer is a ligand of the target, by a method comprising: (a) contacting the candidate mixture with the target, wherein nucleic acids having an increased affinity to the target relative to other nucleic acids in the candidate mixture can be partitioned from the remainder of the candidate mixture; (b) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; and (c) amplifying the increased affinity nucleic acids to yield a ligand-enriched mixture of nucleic acids, whereby aptamers of the target molecule are identified. It is recognized that affinity interactions are a matter of degree; however, in this context, the “specific binding affinity” of an aptamer for its target means that the aptamer binds to its target with a much higher degree of affinity than it binds to other, nontarget, components in a mixture or sample. An aptamer can include any suitable number of nucleotides. “Aptamers” refer to more than one such set of molecules. Different aptamers can have either the same or different numbers of nucleotides. Aptamers may be DNA or RNA and may be single stranded, double stranded, or contain double stranded or triple stranded regions. Aptamers may be designed with any combination of the base modified nucleotides desired.APTAMERS

[0059] In an aspect, provided is an aptamer including: a binding nucleic acid which selectively binds to coenzy me A (CoA); and a signaling nucleic acid which is at least partially complementary to at least a portion of the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can produce a detectable signal.

[0060] In some aspects, the binding nucleic acid can include DNA. In other aspects, the binding nucleic acid can include RNA. In yet other aspects, the binding nucleic acid can include a combination of DNA, RNA, and modified nucleic acids.

[0061] In some aspects, the binding nucleic acid can include at least one mutation and / or at least one non-natural nucleic acid.

[0062] In some aspects, the binding nucleic acid can include 80% similarity or more (e.g., 81% similarity or more. 82% similarity or more. 83% similarity or more. 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more. 97% similarity or more. 98% similarity or more. 99% similarity or more) to any one of SEQ ID NOS: 1-15, 23, 26, or 29-49. In some aspects, the binding nucleic acid can include any one of SEQ ID NOS: 1-15, 23, 26, or 29-49. These sequences are given in TABLE 1TABLE 1. Binding nucleic acid sequences.

[0063] In some aspects, the signaling nucleic acid can include DNA. In other aspects, the signaling nucleic acid can include RNA. In yet other aspects, the signaling nucleic acid can include a combination of DNA and RNA.

[0064] In some aspects, the signaling nucleic acid can include at least one mutation and / or at least one non-natural nucleic acid.

[0065] In some aspects, the binding nucleic acid can be at least about 40 nucleotides (e.g., at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, at least about 100 nucleotides, at least about 105 nucleotides, at least about 110 nucleotides, at least about 115 nucleotides, at least about 120 nucleotides) in length. In some aspects, the binding nucleic acid can be up to about 120 nucleotides (e.g., up to about 115 nucleotides, up to about 110 nucleotides, up to about 105 nucleotides, up to about 100 nucleotides, up to about 95 nucleotides, up to about 90 nucleotides, up to about 85 nucleotides, up to about 80 nucleotides, up to about 75 nucleotides, up to about 70 nucleotides, up to about 65 nucleotides, up to about 60 nucleotides, up to about 55 nucleotides, up to about 50 nucleotides, up to about 45 nucleotides, up to about 40 nucleotides) in length.

[0066] It is considered that the binding nucleic acid can have a length ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the binging nucleic acid can be from about 40 nucleotides to about 120 nucleotides (e.g., from about 45 nucleotides to about 115 nucleotides, from about 50 nucleotides to about 110 nucleotides, from about 55 nucleotides to about 105 nucleotides, from about 60 nucleotides to about 100 nucleotides, from about 65 nucleotides to about 95 nucleotides, from about 70 nucleotides to about 90 nucleotides, from about 75 nucleotides to about 85 nucleotides, from about 40 nucleotides to about 80 nucleotides, from about 45 nucleotides to about 75 nucleotides, from about 50 nucleotides to about 70 nucleotides, from about 55 nucleotides to about 65 nucleotides, from about 80 nucleotides to about 120 nucleotides, from about 85 nucleotides to about 115 nucleotides, from about 90 nucleotides to about 110 nucleotides, from about 95 nucleotides to about 105 nucleotides) in length.

[0067] In some aspects, the signaling nucleic acid can be at least about 10 nucleotides (e.g., at least about 12 nucleotides, at least about 14 nucleotides, at least about 16 nucleotides, at least about 18 nucleotides, at least about 20 nucleotides, at least about 22 nucleotides, at least about 24 nucleotides, at least about 26 nucleotides, at least about 28 nucleotides, at least about 30nucleotides, at least about 32 nucleotides, at least about 34 nucleotides, at least about 36 nucleotides, at least aboutnucleotides, at least about 40 nucleotides, at least about 42 nucleotides. at least about 44 nucleotides, at least about 46 nucleotides. at least about 48 nucleotides, at least about 50 nucleotides) in length. In some aspects, the signaling nucleic acid can be up to about 50 nucleotides (e.g., up to about 48 nucleotides, up to about 46 nucleotides, up to about 44 nucleotides, up to about 42 nucleotides, up to about 40 nucleotides, up to about 38 nucleotides, up to about 36 nucleotides, up to about 34 nucleotides, up to about 32 nucleotides, up to about 30 nucleotides, up to about 28 nucleotides, up to about 26 nucleotides, up to about 24 nucleotides, up to about 22 nucleotides, up to about 20 nucleotides, up to about 18 nucleotides, up to about 16 nucleotides, up to about 14 nucleotides, up to about 12 nucleotides, up to about 10 nucleotides) in length.

[0068] It is considered that the signaling nucleic acid can have a length ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the signaling nucleic acid can be form about 10 nucleotides to about 50 nucleotides (e.g., from about 12 nucleotides to about 48 nucleotides, from about 14 nucleotides to about 46 nucleotides, from about 16 nucleotides to about 44 nucleotides, from about 18 nucleotides to about 42 nucleotides, from about 20 nucleotides to about 40 nucleotides, from about 22 nucleotides to about 38 nucleotides, from about 24 nucleotides to about 36 nucleotides, from about 26 nucleotides to about 34 nucleotides, from about 28 nucleotides to about 32 nucleotides, from about 10 nucleotides to about 30 nucleotides, from about 12 nucleotides to about 28 nucleotides, from about 14 nucleotides to about 26 nucleotides, from about 16 nucleotides to about 24 nucleotides, from about 18 nucleotides to about 22 nucleotides, from about 30 nucleotides to about 50 nucleotides, from about 32 nucleotides to about 48 nucleotides, from about 34 nucleotides to about 46 nucleotides, from about 36 nucleotides to about 44 nucleotides, from about 38 nucleotides to about 42 nucleotides) in length.

[0069] In some aspects, the signaling nucleic acid can be shorter than the binding nucleic acid. In some such aspects, the signaling nucleic acid can be at least about 10% (e.g., at least about 15%, at least about 20%, at least about 25%. at least about 30%. at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%) of the length of the binding nucleic acid. In some such aspects, the signaling nucleic acid can be up to about 100% (e.g., up to about 95%, up to about 90%, up to about 85%, up to about 80%, up to about 75%, up toabout 70%. up to about 65%, up to about 60%, up to about 55%, up to about 50%, up to about 45%. up to about 40%. up to about 35%, up to about 30%, up to about 25%, up to about 20%, up to about 15%, up to about 10%) of the length of the binding nucleic acid.

[0070] It is considered that the signaling nucleic acid can be any length of the binding nucleic acid ranging from any of the minimum values described above to any of the maximum values described above. For example, in some such aspects, the signaling nucleic acid can be from about 10% to about 100% (e.g., from about 15% to about 95%, from about 20% to about 90%, from about 25% to about 85%, from about 30% to about 80%, from about 35% to about75%, from about 40% to about 70%, from about 45% to about 65%, from about 50% to about60%, from about 10% to about 55%, from about 15% to about 50%, from about 20% to about45%. from about 25% to about 40%, from about 30% to about 35%, from about 55% to about100%, from about 60% to about 95%, from about 65% to about 90%, from about 70% to about 85%, from about 75% to about 80%) of the length of the binding nucleic acid. In other aspects, the signaling nucleic acid can be longer than the binding nucleic acid.

[0071] It is considered that the lengths of the binding nucleic acid and the signaling nucleic acid described above and the length ratio of the signaling nucleic acid to the binding nucleic acid described above may be independently selected. For example, it is understood that the present disclosure considers a signaling nucleic acid shorter than 10 nucleotides or longer than 50 nucleotides in length that is from about 10% to about 100% of the length of a binding nucleic acid from about 40 nucleotides to about 120 nucleotides in length, or a signaling nucleic acid shorter than 10 nucleotides or longer than 50 nucleotides in length that is from about 10% to about 100% of the length of a binding nucleic acid shorter than 40 nucleotides or longer than 120 nucleotides in length, or a signaling nucleic acid from about 10 nucleotides to about 50 nucleotides in length that is less than about 10% or more than about 100% of the length of a binding nucleic acid from about 40 nucleotides in length to about 120 nucleotides in length.

[0072] In some aspects, the signaling nucleic acid can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more. 89% similarity or more, 90% similarity or more, 91% similarity or more. 92% similarity7or more, 93% similarity' or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity' or more, 99% similarity or more) to any one of SEQ ID NOS: 16-17, 22, 24, or 27. In some aspects, the signaling nucleic acid can include any one of SEQ ID NOS: 16-17. 22. 24. or 27. These sequences are given in TABLE 2TABLE 2. Signaling nucleic acid sequences.

[0073] In some aspects, CoA and the signaling nucleic acid can bind the binding nucleic acid in non-overlapping regions of the binding nucleic acid. In some aspects, CoA can bind the binding nucleic acid in a region of the binding nucleic acid including 80% similarity or more (e.g., 81 % similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more. 94% similarity or more. 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity' or more, 99% similarity or more) to SEQ ID NO: 51(GCAAAGGGGAGAGTGATXXXAATCACTCGGGACATGGGAT, where X is independently selected at each occurrence from any nucleotide).

[0074] In some aspects, the binding nucleic acid can have a dissociation constant (Kd) of CoA of about 1 pM or more (e.g., about 5 pM or more, about 10 pM or more, about 25 pM or more, about 50 pM or more, about 100 pM or more, about 200 pM or more, about 300 pM or more, about 400 pM or more, about 500 pM or more, about 750 pM or more, about 1 nM or more, about 5 nM or more, about 10 nM or more, about 25 nM or more, about 50 nM or more, about 100 nM or more, about 200 nM or more, about 300 nM or more, about 400 nM or more, about 500 nM or more, about 750 nM or more, about 1 rnM or more, about 5 mM or more, about 10 mM or more, about 25 mM or more). In some aspects, the binding nucleic acid can have a dissociation constant (Kd) of CoA of about 25 mM or less (e.g., about 10 mM or less, about 5 mM or less, about 1 mM or less, about 750 nM or less, about 500 nM or less, about 400 nM or less, about 300 nM or less, about 200 nM or less, about 100 nM or less, about 50nM or less, about 25 nM or less, about 10 nM or less, about 5 nM or less, about 1 nM or less, about 750 pM or less, about 500 pM or less, about 400 pM or less, about 300 pM or less, about 200 pM or less, about 100 pM or less, about 50 pM or less, about 25 pM or less, about 10 pM or less, about 5 pM or less, about 1 pM or less). The binding nucleic acid can have a dissociation constant (Kd) of CoA ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the binding nucleic acid can have a dissociation constant (Kd) of CoA of from about 1 pM to about 25 mM (e.g.. from about 5 pM to about 10 mM, from about 10 pM to about 5 mM, from about 25 pM to about 1 mM, from about 50 pM to about 750 nM, from about 100 pM to about 500 nM, from about 200 pM to about 400 nM, from about 300 pM to about 300 nM, from about 400 pM to about 200 nM, from about 500 pM to about 100 nM, from about 750 pM to about 50 nM, from about 1 nM to about 25 nM, from about 5 nM to about 10 nM, from about 1 pM to about 10 nM, from about 5 pM to about 5 nM, from about 10 pM to about 1 nM, from about 25 pM to about 750 pM, from about 50 pM to about 500 pM, from about 100 pM to about 400 pM, from about 200 pM to about 300 pM, from about 5 nM to about 25 mM, from about 10 nM to about 10 mM, from about 25 nM to about 5 mM, from about 50 nM to about 1 mM, from about 100 nM to about 750 nM, from about 200 nM to about 500 nM, from about 300 nM to about 400 nM).

[0075] In some aspects, when CoA is bound to the binding nucleic acid, one or more properties in the binding nucleic acid may change. In some such aspects, the one or more properties of the binding nucleic acid can include a conformational change, a difference in melting temperature, and / or a variation in sensitivity to pH or another environmental condition. In some aspects, the changes to one or more properties of the binding nucleic acid can cause the signaling nucleic acid to dissociate from the binding nucleic acid.

[0076] In some aspects, the detectable signal can include a fluorophore or a fluorescent dye. In some such aspects, the fluorophore or fluorescent dye can be, but is not limited to. Hydroxy coumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates. PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC. Cy3. TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X-Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5 581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates. Cy5, Cy5.5, LC red 705, Cy7, IRDye 800 CW, IRDye 700, Cyl.5, Dy780. Dy781, DyLight 800, IRDye 800 CW, Alexa Fluor 647, Alexa Fluor 488, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 750, Alexa Fluor 790, JOE, or MAX.

[0077] In some aspects, the fluorophore or fluorescent dye can be conjugated to a first end of the binding nucleic acid and a quencher can be conjugated to a complementary end of the signaling nucleic acid, and the fluorophore or fluorescent dye can produce a detectable signal when the binding nucleic acid is bound to CoA. As used herein, an “end” of a nucleic acid refers to the terminal nucleotide or any nucleotide up to 5 nucleotides away from the terminal nucleotide. The “end” can refer to either the 3’ end or the 5’ end of the nucleic acid.

[0078] In other aspects, the fluorophore or fluorescent dye is conjugated to a first end of the signaling nucleic acid and a quencher is conjugated to a complementary end of the binding nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

[0079] In some aspects, the quencher can be, but is not limited to, DQ-I. Dabcyl, Eclipse, Iowa Black FQ, BHQ-1, QSY-7, BHQ-2, DDQ-II, Iowa Black RQ, QSY-21, BHQ-3, IRDye QC-1, or ZEN.

[0080] In some aspects, the detectable signal can include a barcode sequence. In some such aspects, the signaling nucleic acid can include the barcode sequence, and the barcode sequence can be amplifiable when the binding nucleic acid is bound to CoA. In other such aspects, the binding nucleic acid can include the barcode sequence, and the barcode sequence can be amplifiable when the binding nucleic acid is bound to CoA.

[0081] In some aspects, the binding nucleic acid may not significantly bind adenosine- containing molecules other than CoA. A nucleic acid can be said to “significantly bind” to an adenosine-containing molecule if the binding affinity’ of the nucleic acid for said adenosine- containing molecule is 2.5% or more of the binding affinity of said nucleic acid for CoA. In some such aspects, the binding nucleic acid may not significantly bind acetyl-CoA, propionyl- CoA. butyryl-CoA, hexanoyl-CoA, malonyl-CoA, succinyl-CoA. 3-hydroxy-3- methylglutaryl-CoA (HMG-CoA), myristoyl-CoA, oleoyl-CoA, adenosine triphosphate (ATP), adenosine diphosphate (ADP), nicotinamide adenine dinucleotide (NAD+ / NADH), nicotinamide adenine dinucleotide phosphate (NADP+ / NADPH), or any other adenosine- containing compound.

[0082] In another aspect, provided is a screening assay for determining presence of coenzyme A (CoA) in a sample, the screening assay including an aptamer including: a binding nucleic acid which selectively binds to coenzy me A (CoA); and a signaling nucleic acid which is at least partially complementary to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA. the signaling nucleic acid can produce a detectable signal. In some aspects, the screening assay can include any of the aptamers described herein.

[0083] In some aspects, the sample can be a cell or tissue sample. In other aspects, the sample can be cell lysate or a biological fluid (e.g., sweat, urine, blood, etc.).

[0084] In some aspects, the sample can be exposed to a test compound, and the screening assay can be used to determine usefulness of the test compound in modulating CoA. In some such aspects, the screening assay can be used to perform any of the disclosed methods of detecting coenzyme A (CoA) or any of the disclosed methods and / or any of the disclosed methods of determining usefulness of a test compound in modulating coenzyme A (CoA).METHODS

[0085] In an aspect, provided is a method of detecting coenzyme A (CoA), the method including: a) exposing a sample to an aptamer including: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and ii) a signaling nucleic acid which is at least partially complementary to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can produce a detectable signal; and b) identifying the detectable signal, thereby detecting CoA in the sample. In some aspects, the method can use any of the aptamers described herein.

[0086] In some aspects, the signaling nucleic acid and the binding nucleic acid can be provided in a ratio of about 0.5:1 or more (e.g. , about 1 : 1 or more, about 1.5:1 or more, about 2:1 or more, about 2.5:1 or more, about 3:1 or more, about 3.5:1 or more, about 4:1 or more, about 4.5:1 or more, about 5:1 or more, about 5.5:1 or more, about 6: 1 or more, about 6.5:1 or more, about 7:1 or more, about 7.5:1 or more, about 8:1 or more, about 8.5:1 or more, about 9:1 or more, about 9.5:1 or more, about 10: 1 or more). In some aspects, the signaling nucleic acid and the binding nucleic acid can be provided in a ratio of about 10:1 or less (e.g., about 9.5:1 or less, about 9: 1 or less, about 8.5:1 or less, about 8:1 or less, about 7.5:1 or less, about 7:1 or less, about 6.5:1 or less, about 6:1 or less, about 5.5:1 or less, about 5:1 or less, about 4.5:1 or less, about 4:1 or less, about 3.5:1 or less, about 3:1 or less, about 2.5:1 or less, about 2:1 or less, about 1.5:1 or less, about 1:1 or less, about0.5:l or less). The signaling nucleic acid and the binding nucleic acid can be provided in a ratio ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the signaling nucleic acid and the binding nucleic acid can be provided in a ratio of from about 0.5:1 to about 10:1 (e.g., from about 1:1 to about 9.5:1, from about 1.5:1 to about 9:1, from about 2:1 to about 8.5:1, from about 2.5:1 to about 8:1, from about 3:1 to about 7.5:1, from about 3.5:1 to about 7:1, from about 4:1 to about 6.5:1, from about 4.5:1 to about 6:1, from about 5:1 to about 5.5:1, from about 0.5:1 to about 5.5:1, from about 1:1 to about 5:1. from about 1.5:1 to about 4.5:1, from about 2:1 to about 4:1, from about 2.5:1 to about 3.5:1, fromabout 5: 1 to about 10:1, from about 5.5: 1 to about 9.5: 1, from about 6:1 to about 9: 1, from about 6.5: 1 to about 8.5: 1, from about 7: 1 to about 8: 1).

[0087] In some aspects, the sample can be a cell or tissue sample. In some such aspects, the method can further include spatially identifying CoA in the cell or tissue sample (i.e., determining the location of CoA in the cell or tissue sample).

[0088] In other aspects, the sample can be cell lysate or a biological fluid (e.g.. sweat, urine, blood, etc.).

[0089] In some aspects, the detectable signal can include a fluorophore or a fluorescent dye. In some such aspects, step b) can include imaging the sample.

[0090] In some aspects, the detectable signal can include a barcode sequence. In some such aspects, step b) can include performing polymerase chain reaction (PCR) on the sample.

[0091] In some aspects, the method can take place in vitro, in vivo, or ex vivo.

[0092] In another aspect, provided is a method of determining usefulness of a test compound in modulating coenzyme A (CoA), the method including: a) exposing the test compound to the sample; b) exposing the sample to an aptamer including: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and li) a signaling nucleic acid which is at least partially complementary to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can produce a detectable signal; c) identifying the detectable signal, thereby detecting CoA in the sample; and d) using said detectable signal to determine an effect of the test compound on CoA. In some aspects, the method can use any of the aptamers described herein.

[0093] In some aspects, the effect of the test compound on CoA can include an increase in CoA amount or activity, and the detectable signal can be greater than a reference signal produced by the sample not exposed to the test compound.

[0094] In other aspects, the effect of the test compound on CoA can include a decrease in CoA amount or activity, and the detectable signal can be lesser than a reference signal produced by the sample not exposed to the test compound.

[0095] In some aspects, the sample can be a cell or tissue sample. In some such aspects, the method can further include spatially identifying CoA in the cell or tissue sample (i.e.. determining the location of CoA in the cell or tissue sample).

[0096] In other aspects, the sample can be cell lysate or a biological fluid (e.g., sweat, urine, blood, etc.).

[0097] In some aspects, the detectable signal can include a fluorophore or a fluorescent dye. In some such aspects, step b) can include imaging the sample.

[0098] In some aspects, the detectable signal can include a barcode sequence. In some such aspects, step b) can include performing polymerase chain reaction (PCR) on the sample.

[0099] In some aspects, the method can take place in vitro, in vivo, or ex vivo.

[0100] In yet another aspect, provided is a method of treating and / or preventing dysregulation of coenzyme A (CoA) in a subject in need thereof, the method including: a) administering to the subject an aptamer including: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and li) a signaling nucleic acid which is at least partially complementary to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can trigger a therapeutic event. In some aspects, the method can use any of the aptamers described herein.

[0101] In some aspects, the subject can have a deficiency of CoA. In some such aspects, the subject can have a neurodegenerative disease or disorder, Huntington’s Disease, a metabolic disease or disorder, cancer, diabetes, a mitochondrial dysfunction disorder, hypoglycemia, cardiomyopathy, or rhabdomyolysis, or the subject can have been given medication which reduces available CoA (e.g., hopantenic acid (pantoyltaurine), pantothenate kinase inhibitors, bempedoic acid, hepatic porphyrogens).

[0102] In other aspects, the subject can have an excess of CoA. In some such aspects, the subject can have diabetes, cancer, or a metabolic disease or disorder, or the subject can have been given medication which causes an excess of CoA (e.g., pantethine, vitamin B5 (pantothenic acid), cysteamine. acetyl-L-camitine activators, cysteine, pantothenate kinase activators, 4’-phosphopantentetheine analogs).

[0103] In some aspects, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can produce a detectable signal, and the detectable signal can be used to determine timing, dosage, or administration route of a therapeutic agent.

[0104] In some aspects, the detectable signal can be identified by imaging the patient. Additionally or alternatively, in other aspects, the detectable signal can be identified in a sample of a biological fluid (e.g., sweat, urine, blood, etc.) collected from the patient.

[0105] In some aspects, the therapeutic agent can include a small molecule, a biologic agent, a peptide, a nucleic acid, radiation, chemotherapy, and / or surgery.

[0106] In some aspects, when the binding nucleic acid is bound to CoA, the signaling nucleic acid can dissociate from the binding nucleic acid, and the signaling nucleic acid can be a single strand anti-sense DNA used for gene therapy.EXAMPLESExample 1: DNA Aptamers for Coenzyme A and their applications in drug screening

[0107] Disclosed herein is a Coenzyme A (CoA) aptamer, a specialized nucleic acid sequence meticulously crafted to specifically attach to Coenzyme A molecules. Aptamers are unique single-stranded DNA or RNA molecules known for folding into distinctive three- dimensional structures, allowing them to bind tightly and selectively to target molecules. In this case, the aptamer is engineered to recognize and bind to Coenzyme A, a central metabolite involved in various metabolic pathways within cells.

[0108] This Coenzyme A aptamer serves multiple purposes across biotechnology7, medicine, and research. One significant application lies in diagnostics, where the aptamer can be utilized in assays to identify the presence and concentration of Coenzyme A in biological samples. This capability proves invaluable for assessing metabolic disorders or monitoring cellular metabolism. Furthermore, the aptamer holds promise in therapeutic interventions aimed at regulating Coenzyme A levels or activity within cells, potentially offering avenues for treating diseases associated with metabolic dysregulation.

[0109] Operationally, the Coenzyme A aptamer operates on the principle of molecular recognition. Its sequence is strategically designed to conform to a three-dimensional structure that complements the shape and chemical properties of Coenzyme A. When Coenzyme A molecules are present, the aptamer selectively binds to them via complementary interactions, forming a stable complex. Various detection techniques, such as fluorescence assays, microscopy experiments, or gel electrophoresis, can then be employed to quantify CoA concentration in a sample.

[0110] The necessity' for such a tool arises from Coenzyme A's pivotal role in cell metabolism, particularly in regulating essential acyl-transfer reactions. Existing methods lack an aptamer with sufficient selectivity’ and specificity for in situ imaging of Coenzyme A, yvhich is crucial for understanding cellular processes and addressing diseases linked to CoA deficiency, such as PKAN and CoPAN. Despite ongoing drug development efforts, no FDA- approved treatments targeting CoA-related diseases exist, partly due to the challenge of assessing drug effectiveness in CoA production.[OHl] To bridge this gap, these aptamers employ the structure-switching SELEX method to discover aptamers for Coenzy me A. This approach initially targeted pantetheine, eventually switching to Coenzyme A, resulting in aptamers with high selectivity. Subsequently, a tum-on CoA sensor was engineered using these aptamers, enabling the detection of CoA in mammalian cells and cell lysates. This tool not only fills the void in CoA imaging but also provides a meansto evaluate drug efficacy, addressing limitations in existing methodologies. The CoA sensor can be utilized to analyze CoA level in mammalian cells or detect CoA in test tubes, such as cell lysis and other samples.

[0112] The Coenzyme A (CoA) aptamer has several unique features. Foremost among these is its exceptional specificity and affinity for CoA molecules. Unlike some current detection methods, which may lack precision or necessitate additional purification steps, the DNA aptamer's engineered sequence ensures precise recognition and binding to CoA with minimal non-specific interactions, thus enhancing the accuracy of CoA detection in biological samples. Likewise, the aptamer can be applied for various environments including cell lysates and within cells for spatial and temporal imaging of CoA. Additionally, the aptamer's versatility in applications stands out. While current methods for CoA detection may be limited in scope or require specialized equipment such as HPLC-MS, the aptamer provides a flexible platform adaptable for various purposes, including diagnostics, therapeutics, and research, extending its utility beyond traditional laboratory settings. Moreover, the development of the CoA aptamer offers insights into molecular-level interactions between CoA and nucleic acids, advancing understanding of cellular metabolism and molecular recognition processes. By elucidating specific binding mechanisms and structural characteristics of the aptamer-CoA complex, these aptamers lay the groundwork for designing future aptamers targeting other biomolecules and facilitating the development of diagnostic and therapeutic strategies. Finally, the aptamer's ease of use and accessibility further sets it apart. Its straightforward detection methods and compatibility’ with standard laboratory techniques make it accessible to a wide range of researchers and practitioners, potentially accelerating the translation of research findings into practical applications. Overall, the Coenzy me A aptamer represents a significant departure from present technologies, offering enhanced specificity, versatility, molecular insights, and ease of use, making it a valuable tool for advancing research in cellular metabolism, diagnostics, and therapeutic interventions.

[0113] Coenzyme A aptamer introduces an approach for imaging of coenzyme A within individual mammalian cells. It provides a solution to the need for a highly specific and sensitive method for detecting CoA molecules in biological samples. These aptamers can be applied in all forms of life, including (but not limited to) plants, fungi, bacteria, and mammals.

[0114] The Coenzyme A (CoA) aptamer biosensor provides numerous advantages compared to other detection methods like High-Performance Liquid Chromatography (HPLC), CoA detection kits, and CoA protein biosensors. With its high sensitivity and specificity, the aptamer biosensor offers precise detection of CoA molecules, rivaling traditional HPLCmethods while enabling real-time monitoring of CoA levels, a capability lacking in many other techniques. Additionally, CoA aptamer biosensors are cost-effective, user-friendly, and compatible with standard laboratory techniques, making them accessible to a wide range of users without the need for specialized equipment or expertise in protein engineering. Moreover, these biosensors require minimal sample preparation, reducing assay time and complexity, and offer stability over extended storage periods. Their versatility allows for adaptation to various applications, from point-of-care diagnostics to high-throughput drug screening assays, providing researchers and clinicians with a valuable tool for studying cellular metabolism, disease diagnostics, and drug development.

[0115] Detecting Coenzy me A (CoA) within cellular contexts using High-Performance Liquid Chromatography-Mass Spectrometry (HPLC-MS) poses several challenges. Firstly, sample preparation from cells involves intricate extraction procedures to isolate CoA from the complex cellular matrix, which can be time-consuming and prone to variability. The abundance of CoA within cells is relatively low, thus requiring sensitive detection methods. Moreover, the presence of structurally similar compounds like acetyl-CoA and malonyl-CoA further complicates the analysis, demanding high selectivity from the HPLC-MS system. Matrix effects, such as ion suppression or enhancement, may occur due to the complex mixture of endogenous compounds present in cellular extracts, potentially leading to inaccuracies in quantification. Moreover, accurate quantification relies on the availability of pure and stable CoA standards, which can be challenging to obtain and may introduce uncertainties in the measurement. Additionally, the expertise required for method development and optimization, encompassing chromatography, mass spectrometry, and sample preparation techniques, adds complexity to the process. Likewise, HPLC-MS detection of CoA lacks the spatial location of CoA within cellular contexts.

[0116] Commercial detection kits for Coenzyme A (CoA) offer simplicity and convenience but come with certain limitations that researchers should be aware of. One of the primary limitations is their sensitivity, which may not be sufficient for detecting low concentrations of CoA, especially in samples with high background interference or low abundance of the target molecule. Additionally’, while these kits are designed to be specific for CoA detection, they may exhibit cross-reactivity with structurally similar molecules or contaminants present in the sample, leading to potential inaccuracies in quantification. Another limitation is sample compatibility; some kits may be optimized for specific sample types or matrices, limiting their applicability to diverse sample types and requiring additional optimization steps. Moreover, the dynamic range of these kits may be limited, impacting their ability to accurately quantifyCoA over a wide range of concentrations. Assay interference from contaminants or inhibitors present in the sample can also affect the reliability of results.

[0117] Coenzyme A (CoA) protein-based biosensors present several advantages, including specificity, sensitivity, and real-time monitoring capabilities, but they also encounter limitations. One major constraint is their stability overtime, as biosensor proteins may degrade when exposed to harsh conditions or during prolonged storage, impacting sensor performance and reliability. Additionally, developing these biosensors often requires expertise in molecular biology and protein engineering, making optimization of sensitivity and specificity' labor- intensive and time-consuming. Interference from other molecules or components in complex biological samples can lead to false readings, affecting the accuracy of CoA detection. Moreover, protein-based biosensors may have limited compatibility with certain sample matrices, particularly complex biological samples like cell lysates or tissue extracts, further challenging their applicability. In complex biological environments such as live cells or tissues, protein-based biosensors may face additional hurdles related to stability and potential cytotoxicity, limiting their use for in vivo or intracellular CoA detection.

[0118] The necessity for the development of a tool for imaging Coenzyme A stems from its pivotal role in cell metabolism, particularly in regulating acyl-transfer reactions essential for various cellular processes. However, existing methods lack an aptamer with sufficient selectivity and specificity for in situ imaging of Coenzyme A. Moreover, diseases like pantothenate kinase-associated neurodegeneration (PKAN) and COASY protein-associated neurodegeneration (CoPAN) are linked to decreased CoA levels, emphasizing the urgency for effective therapeutic interventions. Despite ongoing drug development efforts, no FDA- approved treatments targeting CoA-related diseases exist, partly due to the challenge of assessing drug effectiveness in CoA production. To address this gap, the structure-switching SELEX method was used to discover aptamers for Coenzyme A. This approach involved initially targeting pantetheine, followed by switching to Coenzy me A, resulting in aptamers with high selectivity. Subsequently, a tum-on CoA sensor was engineered using these aptamers, facilitating the detection of CoA in mammalian cells and cell lysates. Thus, this tool not only fills the void in CoA imaging but also provides a means to evaluate drug efficacy, addressing limitations in existing methodologies.

[0119] This approach involves a specific DNA sequence with fluorophores and quenchers attached that enable specific fluorescence change in the presence of coenzy me A (CoA). This aptamer has been delivered into mammalian cells for visualization of CoA spatial distribution. The aptamer has been applied for drug screens to determine if CoA production is upregulatedor downregulated. The aptamer sensor enables spatial CoA information and visual representation of the viability of the mammalian cells through microscopy images. This CoA sensor has been applied for detecting CoA in cell lysates via a plate reader.

[0120] This approach harnesses the power of a selective coenzyme A aptamer, boasting a myriad of distinctive features that set it apart in the realm of molecular technologies. Engineered with precision, this aptamer exhibits remarkable characteristics encoded within its structure. Through meticulous design, it demonstrates the capability to bind selectively to the CoA, a pivotal target within cellular metabolism pathways. This selective binding property ensures a tailored and specific interaction, offering unprecedented control and precision in molecular interactions. The aptamer allows for spatial imaging of CoA within mammalian cells and detection of CoA within cell lysates.

[0121] Understanding the intricacies of coenzyme A homeostasis within cells yields profound implications for various aspects of human health and disease management. By delving deeper into this molecular landscape, researchers can unearth therapeutic targets with far-reaching implications. These insights could lead to groundbreaking advancements in the treatment of conditions associated with coenzyme A dysregulation, such as cancer, diabetes, and neurodegenerative disorders. The significance lies in the potential to revolutionize treatment strategies, offering prospects of faster operation, mitigated side effects, reduced production costs, and ultimately, enhanced patient outcomes. Whether it's achieving two times faster operation in therapeutic interventions, minimizing adverse side effects, or enabling cost- effective production methods, the impact spans across multiple dimensions of healthcare, promising a brighter future for patients worldwide.Example 2: Aptamer based Coenzyme A sensor and its application in drug screening

[0122] A CoA sensor was developed based on aptamer-SELEX. FIG. 1 depicts the general setup of the sensor. The aptamer undergoes a conformational change upon binding to CoA, causing a 'turn-on' fluorescence response. As the CoA concentration increases, the structural change brings the fluorophore and quencher into a configuration that increases fluorescence intensity. Structure-switching aptamers, capable of adopting alternative secondary’ structures upon specific ligand binding, were selected through SELEX. First, an oligonucleotide library, via an oligonucleotide complementary to their constant region (part of PCR primer), was attached to a column. Later, the target in solution w as passed over the column, thus isolating oligonucleotides in which the target impacts displacement of this complement. Conversion of a structure-switching aptamer into a fluorescence sensor involves strategic placement of a fluoroph ore / quencher pair within the aptamer sequence. Upon ligand binding-inducedstructural alteration, the spatial arrangement of the fluorophore and quencher changes, resulting in fluorescence signal modulation, facilitating real-time detection of the target molecule.

[0123] The presented strategy involves a progressive increase in counter target concentrations alongside a reduction in CoA levels to enhance aptamer selectivity. For instance, in round seven, 5 mM CoA was paired with 10 mM of adenosine (1 mM Adenosine, 9 mM ATP) for counter selection, while subsequent rounds witnessed a gradual decrease in CoA concentration down to 0.1 mM by rounds 12 to 13. Concurrently, challenging SELEX conditions were introduced with elevated concentrations of counter targets, aiming to isolate aptamers with heightened selectivity amidst stringent selection pressures.

[0124] The results of the CoA aptamer selection process underscore the effectiveness of a meticulously designed strategy aimed at enhancing selectivity amidst stringent conditions. Throughout successive SELEX rounds, careful modulation of counter targets and CoA concentrations was pivotal in shaping the specificity of the aptamers. Initially, SELEX rounds focused on establishing a foundation for selectivity by employing 5 mM CoA alongside 10 mM of adenosine (1 mM Adenosine, 9 mM ATP) in round seven. This approach aimed to diminish the prevalence of DNA sequences with low selectivity to adenosine. Subsequent rounds witnessed a gradual reduction in CoA concentration, reaching 0.1 mM by rounds 12 to 13. This decrease in CoA concentration was complemented by an escalation in the challenge posed by counter selection, with concentrations of adenosine (1 mM Adenosine, 9 mM ATP), Panteteine (150 pM), and Pantothenic acid (150 pM) heightened in round 13. Notably, despite CoA being present at only 1 % of the concentration of adenosine utilized during SELEX, it still elicited the elution of 10% of DNA sequences compared to adenosine. This underscored the effectiveness of the selection strategy' in isolating aptamers with heightened selectivity even under stringent conditions. Ultimately, the meticulous manipulation of SELEX parameters culminated in the identification of CoA aptamers with enhanced selectivity, demonstrating the efficacy of the selection strategy' in isolating aptamers tailored for CoA recognition.

[0125] FIG. 2 depicts the selectivity of the CoA aptamer sensor versus a negative control. The negative control used was sequence-scrambled DNA with the same number of ATCG bases as the aptamer. The scrambled negative control CoA aptamer sequence, which does not specifically bind to CoA, shows no significant increase in fluorescence with increasing CoA concentration. This differential response demonstrates the sensor's specificity and effectiveness in detecting CoA. The Kd of the aptamer sensor was found to be 432 pM.

[0126] The development of a CoA aptamer sensor was achieved by leveraging a structureswitching mechanism, which enabled the creation of a highly specific and sensitivefluorescence-based detection system. The core concept involved designing an aptamer that undergoes a conformational change upon binding to CoA, leading to a 'turn-on' fluorescence response. To facilitate this, a fluorophore and quencher pair was strategically placed within the aptamer sequence. In the absence of CoA, the aptamer adopts a structure that brings the fluorophore and quencher into proximity', quenching the fluorescence signal. Upon binding to CoA, the aptamer undergoes a structural change that spatially separates the fluorophore and quencher, resulting in an increase in fluorescence intensity.

[0127] Experimental results demonstrated a clear 'tum-on' response as CoA concentration increased. The fluorescence intensity showed a marked increase correlating with rising CoA levels, confirming the structural change of the aptamer and the consequent separation of the fluorophore and quencher. In contrast, a scrambled negative control CoA aptamer sequence, designed to lack specific binding affinity for CoA, exhibited no significant change in fluorescence intensity across the same range of CoA concentrations. This stark differential response between the specific aptamer and the scrambled control underscores the high selectivity and sensitivity of the developed CoA aptamer sensor.

[0128] The creation of a structure-switching CoA aptamer sensor with fluorophores and quenchers holds significant potential for cellular imaging applications. CoA plays a critical role in various metabolic pathways, and its dynamic concentration within cells can provide insights into metabolic states and cellular functions. A fluorescence-based aptamer sensor allows realtime. non-invasive monitoring of CoA levels in living cells, providing a powerful tool for studying metabolic processes, diagnosing metabolic disorders, and potentially screening for therapeutic interventions. The high specificity and sensitivity of the aptamer sensor ensure accurate detection, making it an invaluable asset for cellular imaging and biochemical research.

[0129] FIGS. 3A-3B depict the selectivity of the CoA aptamer sensor. The CoA aptamer sensor has high selectivity against other metabolites. The working buffer used for these experiments included Tris, pH 7.4, 10 mM NaCl, 150 mM KC1, 1 mM CaCb, 9 mM MgCh, and 180 pM ZnCh. D-Panthothenic acid (Pan), nucleotide, other adenosine-based metabolites, Ca2+, and Mg2+at physiologically relevant concentrations did not affect the response of the sensors.

[0130] The fluorescence intensity of the sensor increased proportionally with rising concentrations of CoA, while other small molecules such as Acetyl CoA, ATP, and D- pantothenic acid did not induce any significant increase in fluorescence intensity. Further selectivity tests demonstrated that D-Pantothenic acid (Pan), nucleotides, other adenosine- based metabolites, as well as Ca2+and Mg2+at physiologically relevant concentrations, did notaffect the fluorescence response of the sensor. These results highlight the high specificity of the CoA aptamer sensor for CoA detection.

[0131] To evaluate the selectivity of the CoA aptamer sensor, its fluorescence response to various concentrations of CoA was tested and compared to the responses elicited by other structurally similar and relevant molecules. The sensor exhibited a marked increase in fluorescence intensity as the concentration of CoA increased, demonstrating a strong and specific interaction between CoA and the aptamer. In contrast, other small molecules such as Acetyl CoA, ATP, and D-pantothenic acid did not cause any significant increase in fluorescence intensity, indicating that the sensor's response is highly selective for CoA.

[0132] Further testing involved exposing the CoA aptamer sensor to a variety of molecules at physiologically relevant concentrations, including D-pantothenic acid (Pan), nucleotides, other adenosine-based metabolites, and divalent cations like Ca2+and Mg2+. None of these molecules affected the fluorescence response of the sensor, confirming its high specificity for CoA amidst a complex biological environment.

[0133] Testing the selectivity of the CoA aptamer sensor is crucial for several reasons. Firstly, it ensures that the sensor can accurately distinguish CoA from other similar metabolites and molecules present in biological samples, reducing the likelihood of false-positive signals. This specificity is particularly important for applications in cellular imaging, where precise detection of CoA dynamics is necessary to understand metabolic processes. Secondly, a highly selective sensor is essential for reliable diagnostic applications, where accurate measurements of CoA levels could inform the diagnosis and treatment of metabolic disorders. Lastly, demonstrating selectivity reinforces the potential utility of the aptamer sensor in diverse biochemical and biomedical research settings, where precise monitoring of CoA is required without interference from other cellular components.

[0134] FIG. 4 depicts that the CoA aptamer sensor also works in various pH from about 6.4 to about 8. To evaluate the pH sensitivity of the CoA sensor, the CoA-response of the sensors was investigated at different physiologically meaningful pH values. The data suggest that the sensor are suitable for imaging CoA with different concentrations in various pH environments.

[0135] Testing the CoA aptamer sensor across different pH levels is crucial to ensure its reliability and functionality in diverse physiological conditions. Cellular environments can vary significantly in pH, ranging from acidic compartments like lysosomes to more alkaline areas like the mitochondrial matrix. To evaluate the pH sensitivity of the CoA sensor, its response to CoA w as investigated across a range of physiologically meaningful pH values.

[0136] The experimental results demonstrated that the CoA aptamer sensor maintained a consistent fluorescence response to CoA across the tested pH spectrum. At each pH level, from slightly acidic to neutral and slightly alkaline conditions, the sensor reliably detected CoA, with fluorescence intensity increasing proportionally to CoA concentration. This indicates that the aptamer's structure-switching mechanism and the fluorophore / quencher interaction are stable and functional across these pH variations.

[0137] The ability of the CoA sensor to operate effectively in different pH environments is vital for its application in live-cell imaging and biochemical assays. By ensuring that the sensor performs consistently under varying pH conditions, it can be used to monitor CoA levels in different cellular compartments and in various physiological and pathological states. This robustness makes the CoA aptamer sensor a versatile tool for studying CoA dynamics in complex biological environments and for potential diagnostic applications where pH can vary.

[0138] The development of a CoA sensor has significant implications for a wide range of biological applications, primarily due to CoA's critical role in cellular metabolism. Monitoring metabolic pathways is one of the key reasons for its importance, as CoA is central to various metabolic processes, including the citric acid cycle, fatty acid synthesis, and the metabolism of carbohydrates and amino acids. A CoA sensor allows real-time monitoring of CoA levels, providing insights into the regulation and dynamics of these essential biochemical processes.

[0139] Additionally, studying cellular energy production is facilitated by a CoA sensor. CoA is crucial for producing acetyl-CoA, a key substrate for ATP generation through oxidative phosphorylation. Tracking CoA levels helps researchers understand how cells manage energy production and distribution under different physiological conditions. Investigating metabolic disorders is another vital application. Abnormalities in CoA metabolism are linked to various conditions, such as neurodegenerative diseases, diabetes, and obesity. A CoA sensor can help identify and characterize these abnormalities, and understanding of these conditions.

[0140] Furthermore, exploring drug mechanisms and effects can benefit from a CoA sensor. Many pharmaceuticals target metabolic pathways involving CoA, and a sensor can study the effects of these drugs on cellular metabolism, elucidating their mechanisms of action and potential side effects. Imaging and tracking CoA dynamics in live cells provide valuable spatial and temporal information on its distribution and fluctuations within different cellular compartments, revealing how cells adapt their metabolism in response to various drug candidates, stimuli and stress conditions.

[0141] Assessing nutritional and environmental impacts is also a crucial application. Changes in diet and environmental factors significantly affect CoA metabolism, and a CoAsensor can study how these factors influence cellular metabolism, potentially leading to new dietary recommendations and environmental health strategies. Lastly, advancing synthetic biology and metabolic engineering benefits from precise control and monitoring of metabolic pathways. A CoA sensor can optimize metabolic pathways in engineered organisms, improving yields of valuable products such as biofuels and pharmaceuticals.

[0142] In summary, the development of a CoA sensor offers a powerful tool for numerous biological applications, from basic research to clinical diagnostics and therapeutic development. Its ability to provide real-time, specific, and sensitive measurements of CoA levels opens new avenues for understanding and manipulating cellular metabolism.

[0143] FIGS. 5A-5C depict that the CoA aptamer sensor can detect CoA in HeLa cells. FIG. 5A shows HeLa cells treated under three conditions: (1) DMEM with 10% FBS and antibiotics without vitamin B5 and 1 mM hopantenate for 2 days, (2) no treatment (DMEM with 10% FBS and antibiotics), and (3) DMEM with 10% FBS and antibiotics with 3 pM PZ- 2891 for 1 day. The CoA aptamer sensor (magenta) and the negative control (NC) CoA aptamer sensor were used to detect and image CoA. Hoechst 33342 (blue) stains the nuclei, and the merged image combines CoA sensor, Hoechst 33342. and brightfield. Images were taken with a Nikon Spinning Disk Confocal Microscope. Scale bar = 50 pm.

[0144] Cell Culture and Treatments'. HeLa cells were cultured in DMEM supplemented with 10% FBS and antibiotics. Three treatment groups were established:

[0145] 1) DMEM without vitamin B5 and with 1 mM hopantenate for 2 days.

[0146] 2) Untreated control in DMEM supplemented with 10% FBS and antibiotics.

[0147] 3) DMEM supplemented with 10% FBS and antibiotics with 3 pM PZ-2891 for 1 day.

[0148] Aptamer Delivery. The CoA aptamer sensor and the negative control (NC) aptamer sensor were delivered into HeLa cells using Lipofectamine 3000, following the manufacturer's protocol.

[0149] Imaging Preparation'. Post-CoA aptamer delivery of 3 hours and 30 minutes, cells were stained with Hoechst 33342 (blue) for nuclear visualization.

[0150] Microscopy. Images were captured using a Nikon Spinning Disk Confocal Microscope. The scale bar in the images represents 50 pm. Merged images include the CoA sensor (magenta), Hoechst 33342 (blue), and brightfield for comprehensive visualization.

[0151] Effect of Vitamin B5 Depletion and Hopantenate Supplementation on Coenzyme A (CoA) Regulation'. Treatment of HeLa cells with DMEM lacking vitamin B5 and supplemented with 1 mM hopantenate for 2 days exhibited a significant alteration in CoA levels compared tothe untreated control. As visualized through the CoA aptamer sensor, cells subjected to this treatment demonstrated a pronounced decrease in CoA signal intensity, indicative of decreased intracellular CoA levels. The NC CoA sensor was significantly lower in intensity compared to the CoA sensor signal for the hopantenate treatment. In addition, the NC CoA sensor was significantly lower in intensity compared to the CoA sensor signal for the no treatment. This observation suggests that the CoA sensor can be utilized to monitor the CoA intracellular concentrations in cells. This data also demonstrated that the vitamin B5 depletion, mitigated by hopantenate supplementation, disrupts CoA regulation within living HeLa cells.

[0152] Effect ofPZ-2891 Treatment on CoA Regulation'. Exposure of HeLa cells to DMEM containing 3 pM PZ-2891 for 1 day elicited notable changes in CoA dynamics compared to the untreated control. Notably, cells treated with PZ-2891 displayed increased alterations in CoA signal intensity as detected by the CoA aptamer sensor. The NC CoA sensor was significantly lower in intensity compared to the CoA sensor signal for the PZ-2891 treatment. In addition, the NC CoA sensor was significantly lower in intensity7compared to the CoA sensor signal for the no treatment. The observed modulation in CoA levels suggests a pharmacological impact of PZ-2891 on CoA regulation within cellular environments.

[0153] Aptamer Delivery and Visualization'. Successful delivery of the CoA aptamer sensor and negative control (NC) aptamer sensor into HeLa cells was achieved using Lipofectamine 3000, as evidenced by robust fluorescence signals observed in microscopy. CoA aptamer sensor signal was specifically localized within the cellular milieu, demonstrating its utility in visualizing CoA dynamics in living cells. Images captured post-treatment, stained with Hoechst 33342 for nuclear visualization, facilitated comprehensive examination of CoA regulation within cellular contexts.

[0154] Microscopy Analysis'. Utilizing a Nikon Spinning Disk Confocal Microscope, images were acquired to visualize CoA dynamics in living HeLa cells under different treatment conditions. Merged images combining CoA sensor fluorescence (magenta), Hoechst 33342 staining (blue), and brightfield provided comprehensive visualization of CoA regulation within the cellular environment. The scale bar in the images facilitated size calibration, with a representation of 50 pm. ensuring accurate assessment of cellular dynamics.

[0155] Overall, these findings underscore the utility of the CoA aptamer sensor in elucidating CoA regulation within living cells under varied experimental conditions, shedding light on the dynamic interplay between cellular physiology and external stimuli.

[0156] FIG. 5B shows HeLa cells under three conditions: (1) DMEM with 10% FBS and antibiotics without vitamin B5 and 1 mM hopantenate for 2 days, (2) no treatment (DMEMwith 10% FBS and antibiotics), and (3) DMEM with 10% FBS and antibiotics with 3 pM PZ- 2891 for 1 day. The CoA aptamer sensor (magenta) and the negative control (NC) CoA aptamer sensor were used to detect and image CoA. Hoechst 33342 (blue) stains the nuclei, and the merged image combines CoA sensor, Hoechst 33342, and brightfield. Images were taken with a Nikon Spinning Disk Confocal Microscope. Scale bar = 50 pm.

[0157] Cell Culture and Treatments'. HeLa cells were cultured in DMEM supplemented with 10% FBS and antibiotics. Three treatment groups were established:

[0158] 1) DMEM without vitamin B5 and with 1 mM hopantenate for 2 days.

[0159] 2) Untreated control in DMEM supplemented with 10% FBS and antibiotics.

[0160] 3) DMEM supplemented with 10% FBS and antibiotics with 3 pM PZ-2891 for 1 day.

[0161] Aptamer Delivery. The CoA aptamer sensor and the negative control (NC) aptamer sensor w ere delivered into HeLa cells using Lipofectamine 3000, following the manufacturer's protocol.

[0162] Imaging Preparation'. Post-CoA aptamer delivery of 3 hours and 30 minutes, cells were stained with Hoechst 33342 (blue) for nuclear visualization.

[0163] Microscopy. Images were captured using a Nikon Spinning Disk Confocal Microscope. The scale bar in the images represents 50 pm. Merged images include the CoA sensor (magenta), Hoechst 33342 (blue), and brightfield for comprehensive visualization.

[0164] Effect of Vitamin B5 Depletion and Hopantenate Supplementation on Coenzyme A (CoA) Regulation'. Treatment of HeLa cells with DMEM lacking vitamin B5 and supplemented with 1 mM hopantenate for 2 days exhibited a significant alteration in CoA levels compared to the untreated control. As visualized through the CoA aptamer sensor, cells subjected to this treatment demonstrated a pronounced decrease in CoA signal intensity, indicative of decreased intracellular CoA levels. The NC CoA sensor was significantly lower in intensity compared to the CoA sensor signal for the hopantenate treatment. In addition, the NC CoA sensor was significantly lower in intensity compared to the CoA sensor signal for the no treatment. This observation suggests that the CoA sensor can be utilized to monitor the CoA intracellular concentrations in cells. This data also demonstrated that the vitamin B5 depletion, mitigated by hopantenate supplementation, disrupts CoA regulation within living HeLa cells.

[0165] Effect of PZ-2891 Treatment on CoA Regulation'. Exposure of HeLa cells to DMEM containing 3 pM PZ-2891 for 1 day elicited notable changes in CoA dynamics compared to the untreated control. Notably, cells treated with PZ-2891 displayed increased alterations in CoA signal intensity as detected by the CoA aptamer sensor. The NC CoA sensor was significantlylower in intensity' compared to the CoA sensor signal for the PZ-2891 treatment. In addition, the NC CoA sensor was significantly lower in intensity compared to the CoA sensor signal for the no treatment. The observed modulation in CoA levels suggests a pharmacological impact of PZ-2891 on CoA regulation within cellular environments.

[0166] Aptamer Delivery and Visualization'. Successful delivery of the CoA aptamer sensor and negative control (NC) aptamer sensor into HeLa cells was achieved using Lipofectamine 3000, as evidenced by robust fluorescence signals observed in microscopy. CoA aptamer sensor signal was specifically localized within the cellular milieu, demonstrating its utility in visualizing CoA dynamics in living cells. Images captured post-treatment, stained with Hoechst 33342 for nuclear visualization, facilitated comprehensive examination of CoA regulation within cellular contexts.

[0167] Microscopy Analysis'. Utilizing a Nikon Spinning Disk Confocal Microscope, images were acquired to visualize CoA dynamics in living HeLa cells under different treatment conditions. Merged images combining CoA sensor fluorescence (magenta), Hoechst 33342 staining (blue), and brightfield provided comprehensive visualization of CoA regulation within the cellular environment. The scale bar in the images facilitated size calibration, with a representation of 50 pm, ensuring accurate assessment of cellular dynamics.

[0168] Overall, these findings underscore the utility' of the CoA aptamer sensor in elucidating CoA regulation within living cells under varied experimental conditions, shedding light on the dynamic interplay between cellular physiology and external stimuli.

[0169] FIG. 5C shows the negative control aptamer images for FIG. 5B.

[0170] FIGS. 6A-6B depict the use of the CoA aptamer sensors for a drug screen. FIG.6A shows HeLa cells subjected to a drug screen under various conditions: (1) no treatment (DMEM with 10% FBS and antibiotics), (2) treatment with 3 pM PZ3022 for 2 days (DMEM with 10% FBS and antibiotics), (3) treatment with 0.1 mM 4’-phosphopantetheine for 2 days (DMEM with 10% FBS and antibiotics), and (4) treatment with 0. 1 mM pantothenic acid for 2 days (DMEM with 10% FBS and antibiotics). CoA aptamer sensors and negative control CoA sensors (slide 12) were utilized to detect and image CoA levels within the cells. The resulting images provide insight into CoA dynamics under different drug treatment conditions, aiding in the characterization of drug effects on cellular metabolism. The CoA aptamer sensor (magenta) and a scrambled negative control 1 (NCI) CoA aptamer sensor were used to detect and image CoA. Hoechst 33342 (blue) stains the nuclei, and the merged image combines the CoA sensor, Hoechst 33342, and brightfield. Images were taken with a Nikon Spinning Disk Confocal Microscope.

[0171] Imaging Coenzyme A (CoA) Levels in HeLa Cells During Drug Screening'. Utilizing the CoA aptamer sensor (magenta) alongside a scrambled negative control 1 (NCI) CoA aptamer sensor, the study successfully imaged CoA levels within live HeLa cells during a drug screening experiment. CoA detection was complemented by Hoechst 33342 staining (blue) to visualize nuclei, and the merged image incorporated the CoA sensor, Hoechst 33342, and brightfield. These images were captured using a Nikon Spinning Disk Confocal Microscope.

[0172] The application of the CoA aptamer sensor in this drug screening context proved invaluable, offering real-time visualization and analysis of CoA dynamics within live cells under varying drug treatment conditions. By discerning CoA levels with high specificity using the aptamer sensor, the study could precisely monitor changes in cellular CoA concentrations in response to different drug treatments. This approach not only facilitated the characterization of drug effects on cellular metabolism but also provided insights into the mechanisms of action of the tested compounds. Such imaging capabilities highlight the utility and versatility of the CoA aptamer sensor for elucidating CoA-related pathways and metabolic responses within live cells during drug screening endeavors.

[0173] FIG. 6B shows the negative control images for FIG. 6A.

[0174] FIG. 7 depicts that the CoA aptamer sensor can detect CoA in SH-Sy5Y cells. CoA levels were detected in SH-SY5Y cells under two conditions: (1) no treatment (DMEM with 10% FBS and antibiotics), and (2) treatment with 0. 1 mM pantothenic acid for 2 days (DMEM with 10% FBS and antibiotics). The CoA aptamer sensor was utilized to specifically detect CoA, providing insights into CoA dynamics within the cellular environment.

[0175] Detection of Coenzyme A (CoA) in SH-SY5Y Cells'. The CoA aptamer sensor was employed to detect CoA levels in SH-SY5Y cells under two distinct conditions: no treatment and treatment with 0.1 mM pantothenic acid for 2 days. Visualization of CoA was achieved through magenta fluorescence intensity, with the CoA sensor specifically targeting CoA molecules within the cellular environment.

[0176] Upon examination of the images, it was evident that the CoA aptamer sensor exhibited a significant signal in the no treatment and even higher in 0. 1 mM pantothenic acid- treated cells, indicating robust detection of CoA. Conversely, the negative control 2 aptamer showed negligible fluorescence signal compared to the CoA sensor under both experimental conditions. This lack of significant signal from the negative control aptamer confirmed the specificity of the CoA sensor for CoA detection.

[0177] The distinct magenta intensities observed in the images underscored the effectiveness of the CoA aptamer sensor in discriminating CoA from background noise or non-specific binding, highlighting its utility as a reliable tool for detecting CoA levels in SH-SY5Y cells under different experimental conditions.

[0178] FIG. 8 depicts a drug screen with a plate reader. The impact of various drug compounds on cellular Coenzyme A (CoA) levels was assessed using the CoA-specific aptamer (referred to as "Candidate 10") in HeLa cell lysates. A bar graph depicting CoA levels in HeLa cell lysates treated with different drug compounds is presented in FIG. 8. The negative control (NC) aptamer, featuring a scrambled sequence that does not interact with CoA, was utilized for comparison.

[0179] Treatment groups included:

[0180] 1) DMEM with 10% FBS and antibiotics (no treatment control),

[0181] 2) DMEM with 10% FBS and antibiotics plus 3 pM PZ-3022.

[0182] 3) DMEM with 10% FBS and antibiotics plus 0. 1 mM 4’ -phosphopantetheine,

[0183] 4) DMEM with 10% FBS and antibiotics plus 0.1 mM pantothenic acid.

[0184] HeLa cells were subjected to the respective treatments for 2 days. Following treatment, cells were processed to obtain lysates for analysis. The lysates were incubated with either the Candidate 10 aptamer or the NC aptamer, and fluorescence was measured to quantify CoA levels.

[0185] The bar graph illustrates the relative CoA levels detected in HeLa cell lysates treated with different drug compounds. Significant variations in CoA levels were observed across the treatment groups compared to the no treatment control. Notably, treatment with PZ-3022 resulted in a marked decrease in CoA levels, indicating a potential impact of this compound on cellular CoA regulation. Conversely, supplementation with 4’-phosphopantetheine or pantothenic acid appeared to enhance CoA levels, respectively, suggesting a regulatory role of these compounds in CoA metabolism.

[0186] Error bars representing the standard deviation from more than three replicates are depicted on the graph. Statistical significance was assessed using a two-tailed t-test (*p < 0.05, **p < 0.01). The analysis revealed significant differences in CoA levels between treatment groups and the no treatment control, highlighting the metabolic effects of the tested compounds on cellular CoA regulation.

[0187] This figure demonstrates the utility of the CoA aptamer in screening the effects of drug compounds on cellular CoA levels. The observed alterations in CoA levels underscore the potential metabolic impacts of the tested compounds, providing valuable insights into their mechanisms of action and potential therapeutic implications.

[0188] In summary, the CoA-specific aptamer, referred to as "Candidate 10," was employed to assess the impact of various drug compounds on cellular Coenzyme A (CoA) levels in HeLa cell lysates. Utilizing a bar graph, the relative CoA levels in lysates treated with different compounds were compared to a no treatment control, with the negative control (NC) aptamer serving for reference. HeLa cells were subj ected to four treatment groups, including PZ-3022. 4’ -phosphopantetheine, and pantothenic acid supplementation, each incubated for 2 days. Fluorescence measurements were taken after incubating lysates with the Candidate 10 or NC aptamer. The analysis revealed significant variations in CoA levels across treatment groups compared to the no treatment control, with PZ-3022, 4’-phosphopantetheine or pantothenic acid potentially stabilizing or enhancing CoA levels, respectively. NC aptamer did not show significant changes in fluorescence intensity when applied to different drug treatments. Candidate 10 aptamer was significantly higher in fluorescence intensity compared to the NC aptamer. These findings highlight the potential metabolic impacts of the tested compounds on cellular CoA regulation, shedding light on their mechanisms of action and therapeutic relevance.Example 3: Highly selective DNA aptamer sensor for intracellular detection of coenzyme A

[0189] Coenzyme A (CoA) is a central metabolite in biological systems, playing an essential role in over 100 metabolic processes and regulating cellular metabolism both as a substrate and an allosteric modulator [1,2], For example. CoA and its derivatives are integral to post-translational modifications, such as the acetylation of histones and other proteins, thereby influencing protein function and cellular processes [3,4], Because of such an important role, CoA deficiency has been linked to neuro-degenerative diseases such as Pantothenate Kinase-Associated Neurodegeneration (PKAN) [5] and CoA Synthase Protein-Associated Neurodegeneration (CoPAN) [6], which are conditions marked by iron accumulation in the brain and progressive neurological impairment [7-9], These associations underscore the critical importance of maintaining CoA homeostasis for normal brain function and overall cellular health. Given the pivotal roles of CoA in cellular processes and its connection to many diseases, it is important to monitor CoA homeostasis in cells and cell lysate samples to understand its metabolism and biological functions under different physiological conditions and its involvement in disease mechanisms [10-14], The insights gained from such studies can promote health and lead to the discovery' of therapies for CoA-related diseases

[0015] ,

[0190] To detect CoA in living cells and cell lysates, several methods have been developed, but each method has its limitations [16-25,2], Instrumental techniques such as high-performance liquid chromatography (HPLC) and mass spectrometry' are costly, timeconsuming, complex, and do not provide real-time spatial information [18,26,27], To address these limitations, semisynthetic biosensors have been developed to couple a green fluorescent protein -Hal oTag fusion protein with a CoA-dependent fluorescent ligand to produce Forster resonance energy' transfer (FRET) signals

[0028] , Despite progress, it is challenging to convert CoA binding into the FRET signals, as this conversion requires careful system design to translate the binding of the small CoA molecule into conformation changes in a relatively larger protein

[0029] , As a result, the FRET signals are often weak, making CoA detection difficult in the complex cellular environment

[0030] , In addition, overexpression of the Halotag fusion protein may lead to artifacts, such as altered cellular behavior

[0031] , Therefore, there remains a need for a rapid, simple, sensitive, specific, and cost-effective method to monitor CoA concentration within cells and cell lysates.

[0191] To meet the above needs, there has been interest in DNA and RNA aptamers, singlestranded DNA (ssDNA) or RNA molecules that adopt specific three-dimensional structures to bind their targets [32,33], Aptamers are smaller and more cost effective than proteins. Their target binding can readily be translated into a DNA / RNA hybridization melting temperature change that is quite predictable, and often results in a large signal change when they are labeled with a FRET pair. Because of these advantages, aptamers have been widely applied in sensing and imaging in biological systems [34-47], However, despite decades of progress made in this area, aptamers have not been applied to detect CoA, be-cause previous attempts to obtain CoA- binding aptamers using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) resulted in aptamers that bind only the adenine moiety of CoA [48-50], As a result, the selected aptamers can bind any metabolites that contain the adenine moiety, such as ATP [48.49], This “tyranny” of adenine dominating the SELEX process has made it difficult to obtain aptamers with a high selectivity for CoA or many other metabolites that contain adenine in their structures.

[0192] To address the above issue, a study was conducted which used a capture SELEX method to obtain DNA aptamers selective for CoA after rigorous counter-selections against other molecules containing the adenine moiety. The DNA aptamer was then converted into a fluorescent sensor for intracellular detection and visualization of CoA to enhance understanding of CoA biology' and to evaluate the CoA abundance in cells and cell lysates. The study further demonstrated that the sensor could be used to screen for drugs that regulate CoA homeostasis, which may lead to therapeutic interventions for diseases related to CoA dysregulation, such as PKAN and CoPAN.Materials and Methods

[0193] Materials: Coenzyme A, (R)-Pantetheine, adenine, adenosine-5'-triphosphate (ATP), Pantothenic acid, Bis-Tris, sodium chloride, magnesium chloride, calcium chloride, zinc chloride, potassium chloride, ethylenediaminetetraacetic acid disodium salt dihydrate were purchased from Sigma-Aldrich. Taq DNA polymerase, dNTP, and ATP, were purchased from New England BioLabs (NEB). Small molecules used for the selectivity test were purchased from Cayman Chemical. PZ-2891 (Item No. 37309) was purchased from Cayman Chemical. PZ-3022 (Cat. No. 7876) was purchased from Tocis. Calcium hopanate was purchased from LGC Group. 4 ’-phosphopantetheine was purchased from Aaron Chemicals. All the oligonucleotide sequences were purchased from Integrated DNA Technologies and were purified by high-performance liquid chromatography or polyacrylamide gel electrophoresis and confirmed by mass spectrometry (TABLE 3). All other reagents and solvents were obtained from the domestic suppliers and were used as received.TABLE 3. Oligonucleotides used in this study.

[0194] Methods:

[0195] SELEX Proceeding'. For the first round of SELEX, initial 1 nmol ssDNA library was used to pair with five times complementary strands in 250 pL of selection buffer (50 mM Bis-Tris-HCl, 150 mM KCl, lO mMNaCl. 1 mM CaCh, 9 mM MgCh, 180 pM ZnCh, pH 7.0). The mixture was added to a streptavidin agarose column and incubated for 10 minutes. Afterward, the outflow was collected from the column and applied to the column two more times. Then, the column was washed ten times with selection buffer. Afterwards. 250 pL of selection target (R)-Pantetheine used in SELEX rounds 1-4, and CoA used in SELEX rounds 5-14) dissolved in selection buffer was added to the column and incubated for 30 minutes at room temperature. Thereafter, the outflow was collected and the elution step was repeated two more times.

[0196] The solutions eluted by CoA from three times was combined and then amplified as the template for PCR [1 cycle of 95 °C, 2 min; N cycles of (95 °C, 15 s; 60 °C, 30 s; and 72 °C, 45 s), and 1 cycle of 72 °C], The PCR amplicons were incubated with a streptavidin agarose column for about 10 minutes. Thereafter, the elution was collected and incubated with streptavidin agarose column for two more times to ensure all amplicons were connected to the beads. Afterward, the resin was washed ten times with 1 x PBS. To elute ssDNA containing the aptamer library, 300 pL of 0.2 M NaOH was added to the column and incubated for 10minutes. Then, an additional 100 pL of 0.2 M NaOH to was added to collect the residual amount left in the column. All the NaOH outflow was collected, neutralized with 0. 1 M HC1, and concentrated for the next round of C-SELEX as the library. From the fifth round of SELEX, adenosine, adenosine triphosphate, pantetheine, and pantothenic acid were added as counter targets. After 14 rounds of selection, selection pools were analyzed by high throughput sequencing.

[0197] High throughput sequencing of selection rounds'. Selected DNA pools from rounds 5, 9, 10, 11, 12, 13, and 14 were prepared for high-throughput sequencing (HTS) analysis on the Illumina HiSeq 4000 platform. The sequencing was performed by the DNA Services Lab at the Roy J. Carver Biotechnology Center, University' of Illinois at Urbana-Champaign (UIUC). The DNA sequencing libraries were prepared by the Ovation™ Ultralow V2 DNA- Seq Library Preparation Kit from NuGEN Technologies, following the manufacturer's instruction.

[0198] The DNA library' preparation process included several key steps. First, adaptors were ligated to the DNA fragments, which allowed the sequences to bind to the sequencing platform. Then the sequences were amplified by PCR to generate sufficient quantities of the final DNA libraries. Thereafter, the PCR products were purified using Agencourt AMPure XP Beads from Beckman Coulter. DNA quantification was then performed using Qubit dsDNA Broad Range Kit to ensure accurate measurement. To create the sequencing pool, approximately equal amounts of each indexed library were combined. Quality control was conducted by the DNA Services Lab, which included qPCR quantification and fragment analysis to assess the size and concentration of the DNA.

[0199] The sequencing was carried out using 100-base pair single-end reads. The resulting HTS data were analyzed using the FASTAptamer software suite. FASTAptamer-Count was employed to tally the occurrences of each sequence in the population, enabling ranking and sorting by' abundance. Meanwhile, FASTAptamer-Enrich was utilized to calculate fold enrichment for sequences present across multiple rounds by comparing their reads per million (RPM) between different rounds of selection.

[0200] Fluorescence Measurement'. CoA-seq 10 aptamer was labeled with FAM at the 5’ terminal and the capture strand was labeled with BHQ1 at the 3’ terminal. Initially, aptamers and the capture strands were mixed and denatured at 95°C for 5 minutes, followed by annealing at room temperature for 2 hours to produce sensors. Different concentrations of CoA were added to the sensor, followed by incubation at room temperature for 2 hours. The fluorescence was detected using a Microplate System (Biotek, HIM) with a 480 nm excitation wavelengthand 520 nm emission wavelength for FAM, respectively. Aptamer Kd values were determined as previously published methods.

[0201] ITC: To study the Kd between CoA and CoA-seqlO aptamer, ITC was performed using a VP-ITC microcalorimeter instrument (MicroCai). CoA and CoA-seqlO aptamer were dissolved in 1 * aptamer selection buffer, respectively. Before ITC analysis, the pH of the CoA and CoA-seqlO aptamer solutions were carefully titrated to be the same, which was very important for successful ITC analysis. The solution of CoA and its aptamer were degassed for 10 minutes before subjecting them to ITC. CoA-seqlO aptamer (300 pM) was loaded in the cell, and 3.2 mM CoA in the same buffer was loaded into the syringe. The syringe injected 4 pl of CoA into the cell each time. Through measuring the heat changes and fitting the titration curves to a one-site binding model, thermodynamic data, including Kd, enthalpy change, entropy change, free energy change and binding stoichiometry, were obtained.

[0202] Cell Culture'. The SH-SY5Y cell line was obtained from L. Mirica (University of Illinois Urbana-Champaign). HeLa (CCL-2, ATCC) and SH-SY5Y cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (FBS; GeminiBio), 100 U mL1penicillin and 100 U mL1streptomycin. The cells were cultured at 37 °C in a humidified incubator with 5% CO2.

[0203] HeLa Cell CoA Regulation'. HeLa cells were plated at I x I O' cells per 35 mm poly- D-lysine coated imaging dishes and were cultured at 37 °C in a humidified incubator with 5% CO2. Three treatment groups were established: an untreated control in DMEM supplemented with 10% FBS and antibiotics, a group treated with 3 pM PZ-2891 in DMEM supplemented with 10% FBS and antibiotics for 1 day, and a group DMEM without vitamin B5 and with 1 mM hopantenate for 2 days. Following incubation, the cells were washed 3 times with 1 x PBS. The CoA-seqlO aptamer sensor and the scrambled sequence (negative control, NC) were delivered into HeLa cells using Lipofectamine 3000, following the manufacturer's protocol at 37 °C in a humidified incubator with 5% CO2. 3.5 hours post-CoA aptamer delivery, the cells were washed 3 times with 1 x PBS. Then, the cells were stained with Hoechst 33342 for nuclear visualization. The cells were washed 3 times with 1 x PBS and incubated with 1 x HBSS for imaging. Confocal images were captured using a Nikon W1 spinning-disk microscope.

[0204] Drug Screen with SY5Y Cells'. SY5Y cells were plated at 2 xlO5cells per 35 mm poly-D-lysine coated imaging dishes and w ere cultured at 37 °C in a humidified incubator with 5% CCh. SY5Y cells were subjected to a drug screen under various conditions: (1) no treatment (DMEM with 10% FBS and antibiotics), (2) treatment with 3 pM PZ-3022 for 2 days (DMEMwith 10% FBS and antibiotics), and (3) treatment with 0.1 rnM 4'-phosphopantetheine for 2 days (DMEM with 10% FBS and antibiotics).

[0205] Imaging of Drug Screen with SY5Y Cells'. After drug treatment to the SY5Y cells, the cells were washed 3 times with IX PBS. the CoA-seqlO aptamer sensor and the scrambled NC sensor were delivered into HeLa cells using Lipofectamine 3000, following the manufacturer's protocol at 37 °C in ahumidified incubator with 5% CO2. Three hours and thirty minutes post-CoA aptamer delivery, the cells were washed 3 times wrth 1 x PBS. Following, the cells were stained with Hoechst 33342 for nuclear visualization. The cells were washed 3 times with IX PBS. The cells were imaged with IX HBSS. Images were captured using a Nikon W1 spinning-disk microscope.

[0206] Plate Reader Assay of Drug Screened SY5Y Cells : After drug treatment to the SY 5 Y cells, they were washed, trypsinized, centrifuged, and resuspended in lx CoA SELEX buffer. Cells were counted and adjusted to 2 x 105cells / mL in RIPA buffer. Samples were incubated on ice for 5 minutes, sonicated for 2 minutes, and the pH adjusted to 7.4 with NaOH. Samples were heat inactivated at 95°C for 10 minutes, placed on ice for 5 minutes, and centrifuged at 14.000 rpm for 3 minutes. For the brnding assay. 40 pL of the cell lysate was mixed with efther 100 nM 5’FAM-labeled CoA-seqlO aptamer sensor and 500 nM 3’ BHQl-labeled capture strand, or 100 nM 5’FAM-labeled scrambled sequence (NC) and 500 nM 3’ BHQl-labeled capture strand in a black 384 well plate. Samples were incubated at room temperature for 2 hours, and fluorescence was measured with excitation of 484 nm and emission 530 nm using Microplate System (Biotek, HIM).

[0207] Microscopy and image analysis'. Images in FIGS. 16A-16B and FIGS. 17A-17C were taken on a Nikon W1 spinning-disk microscope. To accomplish the imaging, a x60 water immersion objective was applied, and the fluorophore was excited with a 640-nm laser and Cy5 filter (emission of 672-712 nm). The images were taken with monochromatic Andor EMCCD cameras and were processed using ImageJ (Fiji). More than five frames of each imaging group were processed for further statistical analysis, and more than three biological replicates were performed and validated, showing similar trends.

[0208] Data analysis'. All experiments were performed with at least three biological replicates. For each individual biological replicate, three technical repeats were performed in cell imaging experiments. The results of each test are displayed as the mean± s.d. For comparison of two independent groups, a two-tailed unpaired Student’s t-test was performed. All the statistical calculations and graph making were performed with GraphPad Prism 8. Statistical significance was determined by t-test as not significant, P < 0.05 (*), P < 0.01 (**)and P < 0.001 (***). The schematics in FIG. 9A and FIG. 11D were created with BioRender A BioRender academic license / proof for using these artworks for publication is in place.Results and Discussion

[0209] SELEX of DNA aptamers for CoA against adenine or other molecules containing the adenine moiety: Previous SELEX efforts to isolate CoA-binding aptamers resulted in those that primarily bind the adenine portion of CoA. As a result, the isolated aptamers can also bind ATP [48,49], In these SELEX processes. CoA was atached to a solid support at a different atachment point, and a DNA library was then added to the solid support containing the CoA to isolate sequences that bind CoA. It was hypothesized that the atachment of CoA to the solid support can significantly impact the selection outcome, often imposing steric constraints that eliminate desirable binding structures. To address this issue, the study employed a capture SELEX method that leverages the aptamer’s inherent ability to transition between two distinct conformations: a duplex formation with an antisense DNA strand and a complex structure binding its specific target, CoA [51-53], This SELEX method was achieved by immobilizing the structural-switching DNA library onto a solid support, followed by the introduction of free CoA in solution. The DNA molecules that bound to CoA were subsequently released from the support. This approach aimed to remove steric constraints and facilitate the isolation of a more diverse and selective population of CoA-binding aptamers. More importantly, the study employed rigorous counter selection steps against other molecules, including adenine and molecules with adenine as a component of their structures, such as ATP. Specifically, the CoA aptamer was selected using a DNA library containing 82 nucleotides (FIG. 9A) This library includes 40-nucleotide randomized sequences (red) flanked by two constant sequences (blue) on each end that include 5’-GCAGTCGGCGTCGGACAG-3’ (SEQ ID NO: 19) and 5 -CTGTCCGACGATGTAACGCTTCAC-3’ (SEQ ID NO: 50), which serve as primers for PCR amplification. To ensure successful selection without altering the chemical properties of CoA, the CoA was not covalently linked to a solid support as in previous CoA SELEX studies [48-50], Instead, the CoA molecule was free in its native state in solution, while immobilizing the DNA library on microbeads through a capture strand DNA that can hybridize to the underlined sequences in one of the two flanking regions, 5’- GCAGTCGGCGTCGGACAG-3’ (SEQ ID NO: 19). This library-immobilized SELEX strategy ensured that all the epitopes of CoA were exposed to the DNA library' and could participate in aptamer binding. Only the DNA molecules with sequences that bound to CoA and subsequently altered their secondary’ structure were released from the microbeads into the solution (FIG. 9A).

[0210] To ensure high selectivity for CoA against adenine and other molecules containing the adenine moiety, the first four SELEX rounds were initially carried out using (R)- pantetheine, a subunit of CoA, to enrich the DNA pools with an affinity for the (R)-pantetheine portion of CoA (TABLE 4). At Round 5, the selection target was switched to CoA to isolate DNA aptamers that bind CoA. The concentrations of CoA used in the selection were gradually decreased from 5 mM to 0. 1 mM to enrich aptamers with a strong binding affinity for CoA. To achieve high selectivity, counter-selections against adenine, adenosine triphosphate (ATP), pantetheine, and pantothenic acid were introduced from the 6th round of selection, with gradually increasing concentrations. Specifically, from the 6th round of selection, 1 mM adenosine and 9 mM ATP were introduced as counter-selection targets and any DNA molecules eluted with adenosine or ATP were discarded from the selection. Additionally, 150 pM pantetheine was introduced as a counter-selection target starting from Round 8 through Round 13 and 150 pM of pantothenic acid was introduced as a counter-selection target starting from Round 12. These counter-selections were introduced to remove any aptamers that interacted with molecules that bear similarities to only a component of the CoA, rather than CoA itself. To monitor the selection progress, the study employed qPCR to determine the elution yield from each selection round. The elution yield is defined as the amount of ssDNA bound to CoA and eluted from the microbeads into solution, divided by the total amount of ssDNA added to the microbeads (FIG. 10). When the elution yield stopped increasing, high- throughput sequencing (HTS) was utilized to analyze the sequences from Round 9 to Round 13, enabling tracking of the enrichment of individual sequences. After sorting the sequences by sequencing quality and identifying those with intact forward and reverse primer sequences, the study used the FASTAptamer analysis toolkit to find sequences or clusters that were conserved across all rounds. Specifically, the study used the FASTAptamer-count and FASTAptamer-cluster functions to analyze the abundance and similarity of individual sequences, tracking changes across different SELEX rounds. The study then applied the FASTAptamer-enrich function to monitor changes in sequence distribution across selection rounds and identified representative enriched aptamer sequences (TABLE 5). The study then tested their binding affinity to CoA by labeling the aptamer candidates with a 5 ’-FAM fluorophore and the capture strand that attached to the microbeads, as shown in FIG. 9A, with a 3’-Black Hole Quencher™-! (BHQ1), measuring the increase in fluorescence after the candidates bind CoA, which causes its strand displacement from the capture strand (FIG. 11D). CoA-seqlO, a most active sequence and continuously enriched during SELEX, was chosen forsensor development (FIG. 9B, FIG. 12). As illustrated in FIG. 9B, CoA-seqlO is predicted to form a stem-loop secondary structure, as determined using UNAfold software.TABLE 4. Counter targets and positive SELEX targets utilized across SELEX rounds. The presented strategy7involves a progressive increase in counter-target concentrations alongside a reduction in CoA levels to enhance aptamer selectivity. For instance, in round seven, 5 mM CoA is paired with 10 mM of adenosine (1 mM Adenosine. 9 mM ATP) for counter selection, while subsequent rounds witness a gradual decrease in CoA concentration down to 0.1 mM by rounds 12 to 13. Concurrently, challenging SELEX conditions are introduced with elevated concentrations of counter-targets, aiming to isolate aptamers with heightened selectivity amidst stringent selection pressures.TABLE 5. Top 10 sequences enriched from CoA aptamer SELEX.

[0211] Characterization of the CoA-seqlO aptamer and its con-version into a fluorescent sensor for CoA: To characterize the binding of CoA-seqlO to CoA and its affinity, isothermal titration calorimetry (ITC) was employed, revealing a dissociation constant (Kd) of 39.8 LIM (FIGS. 11A-11C). To convert the CoA aptamer into a fluorescent sensor, the study utilized an intramolecular strand displacement florescence sensor design (FIG. 11D). Specifically, a FAM fluorophore was conjugated to the 5' end of the aptamer CoA-seqlO, and a Black Hole Quencher™-! (BHQ1) was attached to the 3‘ end of the quencher strand. When the aptamer strand hybridizes with the quencher strand (Tm = 62.3°C). it brings the quencher next to the fluorophore, resulting in the quenching of the FAM fluorophore by BHQ1. The binding to CoA by the CoA-seqlO aptamer weakens this hybridization (Tmdecreases to 0°C), allowing the quencher strand to dehybridize from the aptamer strand, causing a significant increase in fluorescence.

[0212] To minimize background fluorescence, the study optimized the ratio between aptamer and quencher and found an aptamer: quencher ratio of 1:5 to be optimal (FIG. HE). With this aptamer: quencher ratio, the fluorescence of the aptamer sensor increased with increasing concentrations of CoA, reaching a plateau around 10 mM. The limit of detection (LOD) was determined to be 0.126 mM (FIG. HF), based on 3ob / slope, where Ob is the standard deviation of three blank samples. Additionally, replacing the CoA aptamer with a DNA of the same length but with a scrambled sequence did not increase fluorescence signals in the presence of CoA. This result underscores the specificity of the aptamer in sensor development. The fluorescent sensor can also serve as an alternative method to determine Kd values for the aptamer-CoA interaction. In this method, a Kd for the quencher with the aptamer in the absence of CoA was determined to be 55.38 nM (FIG. HE), while a Kd for the CoA- induced aptamer-quencher dissociation was found to be 1.133 mM (FIG. HF). Therefore, using a formula reported previously

[0058] , the Kd for the aptamer-CoA interaction was calculated from these two Kd’ s to be 48.9 pM. This fluorescent method provides an independent method to evaluate the Kd, which is similar to the Kd (39.8 pM) obtained by ITC. Moreover, introduced mutations into aptamer sequence decrease the fluorescence turn on response to CoA (FIG. 13)

[0213] To further validate the specificity of the CoA-aptamer against other intracellular metabolites, the study tested its fluorescence response to various concentrations of CoA andcompared it to the responses elicited by other structurally similar molecules, such as acetyl coenzyme A (Acetyl-CoA). ATP, and D-pantothenic acid. As shown in FIG. 14A, other metabolites, including Acetyl-CoA, ATP, and D-pantothenic acid, did not cause any significant increase in fluorescence intensity. In contrast, the sensor exhibited a marked increase in fluorescence intensity as the concentration of CoA increased. Further testing involved incubating the CoA aptamer sensor to a variety of intracellular metabolites at physiologically relevant concentrations (FIG. 14B). The metabolites include: 1) Acetyl-CoA. 2) D-pantothenic acid, 3) nucleotides (ATP, CTP, GTP, UTP), 4) other adenine-based metabolites (ADP, Nicotinamide adenine dinucleotide (NAD), NADH, NADP, NADPH, 5) CoA derivates, such as propionyl-CoA, butyryl-CoA, hexanoyl-CoA, malonyl-CoA, succinyl-CoA, 3-hydroxy-3- methylglutaryl (HMG-CoA), lauroyl-CoA, myristoyl-CoA, and oleoyl-CoA, and 6) divalent cations like Ca2+and Mg2. None of these molecules induced an increase in the fluorescence signal, confirming the high specificity for CoA aptamer sensor against all other metabolites, including those that share a similar component (e.g., adenine) as CoA.

[0214] Cellular environments vary significantly in pH, ranging from acidic compartments such as lysosomes to more alkaline areas like the mitochondrial matrix. To demonstrate that the CoA aptamer sensor can work across different pH levels in diverse physiological conditions, the study evaluated its pH sensitivity across a range of physiologically relevant pH values. As shown in FIGS. 15A-15F, the CoA aptamer sensor maintained a consistent fluorescence response to CoA, with fluorescence intensity increasing proportionally to CoA concentration, across the tested pH range (pH 6.4-pH 8.0). These results indicate that the aptamer can function across these physiological pH conditions.

[0215] Application of the aptamer sensor to monitor CoA in living cells: To demonstrate the applicability of the CoA aptamer sensor in visualizing CoA distribution and abundance in living cells, the study delivered it into HeLa cells as a representative cell line and visualized it using confocal laser-scanning microscopy (CLSM). Although FAM is a commonly used fluorophore for studies in test tubes, the study did not use it to label the CoA ap-tamer sensor for cellular studies since FAM is sensitive to different pH environments inside the cells. Instead, the study used Cy5.5 to label the CoA aptamer strand and Iowa Black™ RQ to label the quencher strand and then delivered them into HeLa cells using lipofectamine 3000. As shown in FIGS. 16A-16B, bright signals from the CoA aptamer sensor were observed in all HeLa cells. In contrast, replacing the CoA aptamer with a DNA of the same length but containing a scrambled sequence as a negative control resulted in a reduced fluorescence signal, highlighting the critical role of the aptamer in CoA recognition. To ensure the sensorcan monitor CoA selectively, the study added either Pantazine 2891 (PZ-2891),59 which is an allosteric PANK activator that increases free CoA concentration inside cells, presumably by disrupting pantothenate kinase (PanK) feedback regulation [60,61] or hopantenate (HoPan), an analog of pantothenate, which is used to chemically inhibit CoA biosynthesis [10,62], After treating the HeLa cells with either 3 pM PZ-2891 or 1 rnM HoPan to regulate the cellular CoA levels, the study added Cy5.5-labeled aptamer sensors and compared with untreated cells. As shown in FIGS. 16A-16B, compared with untreated cells. PZ-2891 treated cells exhibited a significant fluorescence increase in the red channel, while HoPan-treated samples showed a lower red fluorescence signal. Furthermore, the fluorescence intensity of the negative control with scrambled sequence produced relatively weak fluorescence signals comparison to untreated cells (FIGS. 16A-16B). These results collectively demonstrate that the CoA aptamer sensor can be applied to monitor intracellular CoA.

[0216] Demonstration of the CoA aptamer sensor as a tool for drug discovery: CoA is a major acyl group carrier in biology and serves as a key cofactor and regulator of intermediary metabolism [3], Debilitating mutations in the PANK2 gene can result in CoA deficiency, leading to life-threatening neurological disorders such as Pantothenate kinase-associated neurodegeneration (PKAN). PKAN affects movement, balance, speech, vision, cognition, and behavior [3], To find ways to treat PKAN, major efforts have been directed toward developing drugs to restore CoA levels in cells, but no drug is approved by the Food and Drug Administration (FDA)

[0059] , Instead, several drug candidates have been developed to restore the CoA level inside cells. Since a CoA sensor in living cells could provide valuable spatial and temporal information on the distribution and fluctuations of CoA, revealing how cells adapt their metabolism in response to various drug candidates, a CoA sensor can serve as a pow erful tool for drug discovery programs, such as in high-throughput screening assays, post screen characterization of hits, optimization of lead compounds, and preclinical evaluation of candidate drugs [61,63],

[0217] To evaluate the application of CoA aptamer sensor in drug development, the study employed the sensor to detect CoA levels in a human neuroblastoma cell line (SH-SY5Y), under distinct conditions: no treatment, and treatment with 3 pM PZ-302264-66 or 0. 1 mM 4?- phosphopantetheine [19,67] for 2 days. As shown in FIGS. 17A-17B, the CoA aptamer sensor exhibited a significantly higher signal in the PZ-3022 and 4’ -phosphopantetheine drug-treated groups in comparison to untreated cells. In contrast, the negative control showed negligible fluorescence signal compared to the CoA sensor under all experimental conditions (FIGS. 17A-17B). These data confirm that the CoA aptamer sensor can provide invaluable, real-timevisualization and analysis of CoA dynamics within live cells under varying drug treatment conditions. By discerning CoA levels with high specificity, changes in cellular CoA concentrations in response to different drug treatments can be monitored. This approach facilitates the characterization of drug effects on cellular metabolism and provides insights into the mechanisms of action of the drug candidates. Such imaging capabilities highlight the utility and versatility of the CoA aptamer sensor for elucidating CoA-related pathways and metabolic responses within live cells during drug screening endeavors.

[0218] To test whether CoA aptamer sensor could be utilized in the high-throughput drug screen for PKAN, the study employed the sensor to assess the impact of various drug candidates on cellular (CoA) levels in SH-SY Y cell lysates. The relative CoA levels in lysates treated with different drug candidates were compared with those with no treatment control, using the negative control (NC) serving as a reference. SH-SY5Y cells were incubated for 2 days by either PZ-3022 or 4’-phosphopantetheine. Fluorescence measurements were taken after incubating lysates with the CoA aptamer sensor or NC (FIG. 17C). The analysis revealed significant variations in CoA levels across treatment groups compared to the no treatment control, with PZ-3022 or 4 ’-phosphopantetheine enhancing CoA levels, respectively. In contrast, NC did not show significant changes in fluorescence intensity of cell lysates when cells were pretreated with either drug candidate (FIG. 17C). These findings highlight the potential of utilizing CoA aptamer sensors for high-throughput drug screen using CoA as metabolite targets.Conclusions

[0219] CoA is a metabolite essential for the functions of many bio-molecules, including fatty acids, amino acids, and carbohydrates. It plays a crucial role in synthesizing and oxidizing fatty acids, as well as in the citric acid cycle for energy production. Studying the distribution and abundance of CoA in living cells using a biosensor could enhance understanding of cell metabolism under different physiological conditions and help screen for drugs that regulate CoA levels against diseases such as PKAN. Despite the importance, sensors for CoA are limited. While SELEX has been shown to be a general method to obtain DNA and RNA aptamers for many other metabolites, the method failed to obtain aptamers for CoA. as much effort has resulted in aptamers that bind only the adenine moiety of CoA.

[0220] To address this issue, the study developed strategies to use rigorous counterselection against adenine, adenosine triphosphate, pantetheine, and pantothenic acid to obtain DNA aptamers with high selectivity for CoA against adenine and other molecules that contain adenine as a component. The CoA aptamer, CoA-seqlO, showed a strong binding affinity toCoA (Ka of 39.8 pM), confirmed by ITC and a fluorescent sensor approach, with a low limit of detection (126 pM).

[0221] The sensor maintained consistent performance across various physiological pH levels and effectively distinguished CoA from other intracellular metabolites. Confocal laserscanning microscopy demonstrated its capability to visualize CoA in living cells, with significant fluorescence changes upon the addition of PZ -2891 and HoPan to regulate cellular CoA levels. More importantly, this study has demonstrated that the DNA aptamer sensor is a powerful tool for drug development, enabling real-time visualization of CoA dynamics in response to drug treatments in the human neuroblastoma cell line (SH-SY5Y). It also showed potential for high-throughput drug screening, making it a robust tool for evaluating therapeutic candidates for CoA-related disorders, such as PKAN.

[0222] In summary, the method reported in this work overcome a major limitation of the SELEX method and the resulting CoA aptamer sensor allows for the study of CoA metabolism in living cells, providing valuable insights into the role of CoA in metabolic pathways and facilitating drug discovery. Its high specificity, sensitivity, and adaptability to diverse physiological conditions make it an invaluable tool for both fundamental research on the roles of CoA and biomedical applications in detecting CoA, including screening for drugs in CoA- related diseases.EXAMPLE ASPECTS

[0223] Example 1: An aptamer comprising: a binding nucleic acid which selectively binds to coenzyme A (CoA); and a signaling nucleic acid which is at least partially complementary to at least a portion of the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid produces a detectable signal.

[0224] Example 2: The aptamer of any examples herein, particularly Example 1, wherein the binding nucleic acid comprises DNA.

[0225] Example 3: The aptamer of any examples herein, particularly Examples 1-2, wherein the binding nucleic acid comprises at least one mutation and / or at least one non-natural nucleic acid.

[0226] Example 4: The aptamer of any examples herein, particularly Examples 1-3. wherein the binding nucleic acid comprises 80% similarity or more to any one of SEQ ID NOS: 1-15, 23, 26, or 29-49.

[0227] Example 5: The aptamer of any examples herein, particularly Example 4, wherein the binding nucleic acid comprises 90% similarity or more to any one of SEQ ID NOS: 1-15, 23, 26, or 29-49.

[0228] Example 6: The aptamer of any examples herein, particularly Example 5, wherein the binding nucleic acid comprises any one of SEQ ID NOS: 1-15, 23, 26, or 29-49.

[0229] Example 7: The aptamer of any examples herein, particularly Examples 1-6, wherein the signaling nucleic acid comprises DNA.

[0230] Example 8: The aptamer of any examples herein, particularly Examples 1-7, wherein the signaling nucleic acid comprises at least one mutation and / or at least one nonnatural nucleic acid.

[0231] Example 9: The aptamer of any examples herein, particularly Examples 1-8, wherein the signaling nucleic acid is shorter than the binding nucleic acid.

[0232] Example 10: The aptamer of any examples herein, particularly Example 9, wherein the signaling nucleic acid is from about 10% to about 100% of the length of the binding nucleic acid.

[0233] Example 11: The aptamer of any examples herein, particularly Examples 1-10, wherein the signaling nucleic acid comprises 80% similarity or more to any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0234] Example 12: The aptamer of any examples herein, particularly Example 11. wherein the signaling nucleic acid comprises 90% similarity or more to any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0235] Example 13: The aptamer of any examples herein, particularly Example 12, wherein the signaling nucleic acid comprises any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0236] Example 14: The aptamer of any examples herein, particularly Examples 1 -13, wherein CoA and the signaling nucleic acid bind the binding nucleic acid in non-overlapping regions of the binding nucleic acid.

[0237] Example 15: The aptamer of any examples herein, particularly Examples 1-14, wherein, when CoA is bound to the binding nucleic acid, one or more properties in the binding nucleic acid change.

[0238] Example 16: The aptamer of any examples herein, particularly Example 15, wherein the one or more properties of the binding nucleic acid comprise a conformational change, a difference in melting temperature, and / or a variation in sensitivity to pH or another environmental condition.

[0239] Example 17: The aptamer of any examples herein, particularly Examples 15-16, wherein the changes to one or more properties of the binding nucleic acid causes the signaling nucleic acid to dissociate from the binding nucleic acid.

[0240] Example 18: The aptamer of any examples herein, particularly Examples 1-17, wherein the detectable signal comprises a fluorophore or a fluorescent dye.

[0241] Example 19: The aptamer of any examples herein, particularly Example 18, wherein the fluorophore or fluorescent dye is Hydroxy coumarin, Alexa fluor, Aminocoumarin, Methoxy coumarin, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer y ellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE). PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM. BODIPY-FL, TET, Alexa fluor 532. HEX, TRITC. Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X-Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5 581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Cy5.5, LC red 705, Cy7, IRDye 800 CW, IRDye 700, Cy7.5, Dy780, Dy781, DyLight 800, IRDye 800 CW, Alexa Fluor 647, Alexa Fluor 488, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 750, Alexa Fluor 790, JOE, or MAX.

[0242] Example 20: The aptamer of any examples herein, particularly Examples 18-19, wherein the fluorophore or fluorescent dye is conjugated to a first end of the binding nucleic acid and a quencher is conjugated to a complementary end of the signaling nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

[0243] Example 21: The aptamer of any examples herein, particularly Examples 18-19, wherein the fluorophore or fluorescent dye is conjugated to a first end of the signaling nucleic acid and a quencher is conjugated to a complementary end of the binding nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

[0244] Example 22: The aptamer of any examples herein, particularly Examples 20-21, wherein the quencher is DQ-I, Dabcyl, Eclipse, Iowa Black FQ, BHQ-1, QSY-7, BHQ-2, DDQ-II, Iowa Black RQ, QSY-21, BHQ-3, IRDye QC-1, or ZEN.

[0245] Example 23: The aptamer of any examples herein, particularly Examples 1-22, wherein the detectable signal comprises a barcode sequence.

[0246] Example 24: The aptamer of any examples herein, particularly Example 23. wherein the signaling nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the binding nucleic acid is bound to CoA.

[0247] Example 25: The aptamer of any examples herein, particularly Example 23, wherein the binding nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the binding nucleic acid is bound to CoA.

[0248] Example 26: The aptamer of any examples herein, particularly Examples 1-25, wherein the binding nucleic acid does not significantly bind adenosine-containing molecules other than CoA.

[0249] Example 27: The aptamer of any examples herein, particularly Example 26, wherein the binding nucleic acid does not significantly bind acetyl-CoA, propionyl-CoA, butyryl-CoA, hexanoyl-CoA, malonyl-CoA, succinyl-CoA. 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA), myristoyl-CoA, oleoyl-CoA. adenosine triphosphate (ATP), adenosine diphosphate (ADP), nicotinamide adenine dinucleotide (NAD7NADH), nicotinamide adenine dinucleotide phosphate (NADP+ / NADPH), or any other adenosine-containing compound.

[0250] Example 28: A method of detecting coenzyme A (CoA). the method comprising: a) exposing a sample to an aptamer comprising: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and ii) a signaling nucleic acid which is at least partially complementary' to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid produces a detectable signal; and b) identifying the detectable signal, thereby detecting CoA in the sample.

[0251] Example 29: The method of any examples herein, particularly Example 28. wherein the sample is a cell or tissue sample.

[0252] Example 30: The method of any examples herein, particularly Example 29, wherein the method further comprises spatially identifying CoA in the cell or tissue sample.

[0253] Example 31: The method of any examples herein, particularly Example 28, wherein the sample is cell lysate or a biological fluid.

[0254] Example 32: The method of any examples herein, particularly Examples 28-31, wherein the binding nucleic acid comprises 80% similarity or more to any one of SEQ ID NOS: 1-15, 23, 26, or 29-49.

[0255] Example 33: The method of any examples herein, particularly Example 32, wherein the binding nucleic acid comprises 90% similarity' or more to any one of SEQ ID NOS: 1-15, 23, 26, or 29-49.

[0256] Example 34: The method of any examples herein, particularly Example 33, wherein the binding nucleic acid comprises any one of SEQ ID NOS: 1-15. 23. 26. or 29-49.

[0257] Example 35: The method of any examples herein, particularly Examples 28-34, wherein the signaling nucleic acid comprises 80% similarity' or more to any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0258] Example 36: The method of any examples herein, particularly Example 35, wherein the signaling nucleic acid comprises 90% similarity or more to any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0259] Example 37: The method of any examples herein, particularly Example 36, wherein the signaling nucleic acid comprises any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0260] Example 38: The method of any examples herein, particularly Examples 28-37, wherein the detectable signal comprises a fluorophore or a fluorescent dye.

[0261] Example 39: The method of any examples herein, particularly Example 38, wherein the fluorophore or fluorescent dye is Hydroxy coumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin. Cascade Blue, Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD. R-Phycoerythrin (PE). PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC, Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X-Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5 581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Cy5.5, LC red 705, Cy7, IRDye 800 CW, IRDye 700, Cy7.5, Dy780, Dy781, DyLight 800. IRDye 800 CW, Alexa Fluor 647, Alexa Fluor 488, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 750, Alexa Fluor 790, JOE, or MAX.

[0262] Example 40: The method of any examples herein, particularly Examples 38-39, wherein the fluorophore or fluorescent dye is conjugated to a first end of the binding nucleic acid and a quencher is conjugated to a complementary end of the signaling nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

[0263] Example 41: The method of any examples herein, particularly Examples 38-39, wherein the fluorophore or fluorescent dye is conjugated to a first end of the signaling nucleic acid and a quencher is conjugated to a complementary end of the binding nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

[0264] Example 42: The method of any examples herein, particularly Examples 40-41. wherein the quencher is DQ-I, Dabcyl, Eclipse, Iowa Black FQ, BHQ-1, QSY-7, BHQ-2, DDQ-II, Iowa Black RQ, QSY-21, BHQ-3, IRDye QC-1, or ZEN.

[0265] Example 43: The method of any examples herein, particularly Examples 38-42, wherein step b) comprises imaging the sample.

[0266] Example 44: The method of any examples herein, particularly Examples 28-43, wherein the detectable signal comprises a barcode sequence.

[0267] Example 45: The method of any examples herein, particularly Example 44, wherein the signaling nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the binding nucleic acid is bound to CoA.

[0268] Example 46: The method of any examples herein, particularly Example 44, wherein the binding nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the binding nucleic acid is bound to CoA.

[0269] Example 47: The method of any examples herein, particularly Examples 44-46, wherein step b) comprises performing polymerase chain reaction (PCR) on the sample.

[0270] Example 48: The method of any examples herein, particularly Examples 28-47, wherein the binding nucleic acid does not significantly bind adenosine-containing molecules other than CoA.

[0271] Example 49: The method of any examples herein, particularly Example 48, wherein the binding nucleic acid does not significantly bind acetyl-CoA. propionyl-CoA, butyryl-CoA, hexanoyl-CoA, malonyl-CoA, succinyl-CoA. 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA), myristoyl-CoA, oleoyl-CoA, adenosine triphosphate (ATP), adenosine diphosphate (ADP), nicotinamide adenine dinucleotide (NAD+ / NADH), nicotinamide adenine dinucleotide phosphate (NADP+ / NADPH), or any other adenosine-containing compound.

[0272] Example 50: The method of any examples herein, particularly Examples 28-49, wherein the aptamer comprises the aptamer of any examples herein, particularly Examples 1 - 27.

[0273] Example 51: The method of any examples herein, particularly Examples 28-50, wherein the method takes place in vitro, in vivo, or ex vivo.

[0274] Example 52: A method of determining usefulness of a test compound in modulating coenzy me A (CoA), the method comprising: a) exposing the test compound to the sample; b) exposing the sample to an aptamer comprising: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and ii) a signaling nucleic acid which is at least partially complementary to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid produces a detectable signal; c) identifying the detectable signal, thereby detecting CoA in the sample; and d) using said detectable signal to determine an effect of the test compound on CoA.

[0275] Example 53: The method of any examples herein, particularly Example 52, wherein the effect of the test compound on CoA comprises an increase in CoA amount oractivity, and wherein the detectable signal is greater than a reference signal produced by the sample not exposed to the test compound.

[0276] Example 54: The method of any examples herein, particularly Example 52, wherein the effect of the test compound on CoA comprises a decrease in CoA amount or activity, and wherein the detectable signal is lesser than a reference signal produced by the sample not exposed to the test compound.

[0277] Example 55: The method of any examples herein, particularly Examples 52-54. wherein the sample is a cell or tissue sample.

[0278] Example 56: The method of any examples herein, particularly Example 55, wherein the method further comprises spatially identifying CoA in the cell or tissue sample.

[0279] Example 57: The method of any examples herein, particularly Example 56, wherein the sample is cell lysate or a biological fluid.

[0280] Example 58: The method of any examples herein, particularly Examples 52-57, wherein the binding nucleic acid comprises 80% similarity or more to any one of SEQ ID NOS: 1-15, 23, 26, or 29-49.

[0281] Example 59: The method of any examples herein, particularly Example 58. wherein the binding nucleic acid comprises 90% similarity or more to any one of SEQ ID NOS: 1-15, 23, 26, or 29-49.

[0282] Example 60: The method of any examples herein, particularly Example 59, wherein the binding nucleic acid comprises any one of SEQ ID NOS: 1-15, 23. 26. or 29-49.

[0283] Example 61 : The method of any examples herein, particularly Examples 52-60, wherein the signaling nucleic acid comprises 80% similarity or more to any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0284] Example 62: The method of any examples herein, particularly Example 61, wherein the signaling nucleic acid comprises 90% similarity or more to any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0285] Example 63: The method of any examples herein, particularly Example 62, wherein the signaling nucleic acid comprises any one of SEQ ID NOS: 16-17, 22, 24, or 27.

[0286] Example 64: The method of any examples herein, particularly Examples 52-63. wherein the detectable signal comprises a fluorophore or a fluorescent dye.

[0287] Example 65: The method of any examples herein, particularly Example 64, wherein the fluorophore or fluorescent dye is Hydroxy coumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin. Cascade Blue. Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP,Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC, Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X-Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5 581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Cy5.5, LC red 705, Cy7, IRDye 800 CW, IRDye 700, Cy7.5, Dy780, Dy781, DyLight 800, IRDye 800 CW, Alexa Fluor 647, Alexa Fluor 488, Alexa Fluor 660, Alexa Fluor 680. Alexa Fluor 750, Alexa Fluor 790, JOE, or MAX.

[0288] Example 66: The method of any examples herein, particularly Examples 64-65, wherein the fluorophore or fluorescent dye is conjugated to a first end of the binding nucleic acid and a quencher is conjugated to a complementary end of the signaling nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

[0289] Example 67: The method of any examples herein, particularly Examples 64-65, wherein the fluorophore or fluorescent dye is conjugated to a first end of the signaling nucleic acid and a quencher is conjugated to a complementary end of the binding nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

[0290] Example 68: The method of any examples herein, particularly Examples 66-67, wherein the quencher is DQ-I, Dabcyl, Eclipse, Iowa Black FQ, BHQ-1, QSY-7, BHQ-2, DDQ-II, Iowa Black RQ, QSY-21, BHQ-3, IRDye QC-1. or ZEN.

[0291] Example 69: The method of any examples herein, particularly Examples 64-68, wherein step b) comprises imaging the sample.

[0292] Example 70: The method of any examples herein, particularly Examples 52-69, wherein the detectable signal comprises a barcode sequence.

[0293] Example 71: The method of any examples herein, particularly Example 70, wherein the signaling nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the binding nucleic acid is bound to CoA.

[0294] Example 72: The method of any examples herein, particularly Example 71, wherein the binding nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the binding nucleic acid is bound to CoA.

[0295] Example 73: The method of any examples herein, particularly Examples 70-72, wherein step b) comprises performing polymerase chain reaction (PCR) on the sample.

[0296] Example 74: The method of any examples herein, particularly Examples 52-73, wherein the binding nucleic acid does not significantly bind adenosine-containing molecules other than CoA.

[0297] Example 75: The method of any examples herein, particularly Example 74, wherein the binding nucleic acid does not significantly bind acetyl-CoA, propionyl-CoA, butyryl-CoA, hexanoyl-CoA, malonyl-CoA, succinyl-CoA. 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA), myristoyl-CoA, oleoyl-CoA. adenosine triphosphate (ATP), adenosine diphosphate (ADP), nicotinamide adenine dinucleotide (NAD7NADH), nicotinamide adenine dinucleotide phosphate (NADP+ / NADPH), or any other adenosine-containing compound.

[0298] Example 76: The method of any examples herein, particularly Examples 52-75, wherein the aptamer comprises the aptamer of any examples herein, particularly Examples 1- 27.

[0299] Example 77: The method of any examples herein, particularly Examples 52-76, wherein the method takes place in vitro, in vivo, or ex vivo.

[0300] Example 78: A screening assay for determining presence of coenzyme A (CoA) in a sample, the screening assay comprising an aptamer comprising: a binding nucleic acid which selectively binds to coenzy me A (CoA); and a signaling nucleic acid which is at least partially complementary' to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid produces a detectable signal.

[0301] Example 79: The screening assay of any examples herein, particularly Example 78, wherein the sample is a cell or tissue sample.

[0302] Example 80: The screening assay of any examples herein, particularly Example 78, wherein the sample is cell lysate or a biological fluid.

[0303] Example 81: The screening assay of any examples herein, particularly Examples 78-80, wherein the sample is exposed to a test compound, and wherein the screening assay is used to determining usefulness of the test compound in modulating CoA.

[0304] Example 82: The screening assay of any examples herein, particularly Examples 81, wherein the screening assay is used to perform the method of any examples herein, particularly Examples 28-51 and / or Examples 52-77.

[0305] Example 83: The screening assays of any examples herein, particularly Examples 78-82, wherein the aptamer comprises the aptamer of any examples herein, particularly Examples 1-27.

[0306] Example 84: A method of treating and / or preventing dysregulation of coenzyme A (CoA) in a subject in need thereof, the method comprising: a) administering to the subject anaptamer comprising: i) a binding nucleic acid which selectively binds to coenzyme A (CoA); and ii) a signaling nucleic acid which is at least partially complementary’ to the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid triggers a therapeutic event.

[0307] Example 85: The method of any examples herein, particularly Example 84, wherein the subj ect has a deficiency of CoA.

[0308] Example 86: The method of any examples herein, particularly Example 85. wherein the subject has a neurodegenerative disease or disorder. Huntington’s Disease, a metabolic disease or disorder, cancer, diabetes, a mitochondrial dysfunction disorder, hypoglycemia, cardiomyopathy, or rhabdomyolysis, or wherein the subject has been given medication which reduces available CoA.

[0309] Example 87: The method of any examples herein, particularly Example 84, wherein the subject has an excess of CoA.

[0310] Example 88: The method of any examples herein, particularly Example 87, wherein the subject has diabetes, cancer, or a metabolic disease or disorder, or wherein the subject has been given medication which causes an excess of CoA.

[0311] Example 89: The method of any examples herein, particularly Examples 84-88, wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid produces a detectable signal, and wherein the detectable signal is used to determine timing, dosage, or administration route of a therapeutic agent.

[0312] Example 90: The method of any examples herein, particularly Example 89, wherein the detectable signal is identified by imaging the patient.

[0313] Example 91: The method of any examples herein, particularly Examples 89-90, wherein the detectable signal is identified in a sample of a biological fluid collected from the patient.

[0314] Example 92: The method of any examples herein, particularly Examples 89-91, wherein the therapeutic agent comprises a small molecule, a biologic agent , a peptide, a nucleic acid, radiation, chemotherapy, and / or surgery.

[0315] Example 93: The method of any examples herein, particularly Examples 89-92. wherein the aptamer comprises the aptamer of any examples herein, particularly Examples 1- 27.

[0316] Example 94: The method of any examples herein, particularly Examples 84-93, wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid dissociatesfrom the binding nucleic acid, and wherein the signaling nucleic acid is a single strand antisense DNA used for gene therapy.

[0317] The following patents, applications and publications as listed below and throughout this document are hereby incorporated by reference in their entirety herein.Reference List(1) Czumaj, A.; et al. The Pathophysiological Role of CoA. Int. J. Mol. Sci. 2020, 21 (23), 9057.(2) Barritt, S. A.; et al. Coenzyme A Biosynthesis: Mechanisms of Regulation, Function and Disease. Nat. Metab. 2024, 6 (6), 1008-1023.(3) Leonardi. R.; et al. Coenzyme A: Back in Action. Prog. Lipid Res. 2005, 44 (2), 125— 153.(4) Martinez. D. L.; et al. Coenzyme A Biosynthetic Machinery in Mammalian Cells. Biochem. Soc. Trans. 2014, 42 (4), 1112-1117.(5) Zhou, B.; et al. A Novel Pantothenate Kinase Gene (PANK2) Is Defective in Hallervorden-Spatz Syndrome. Nat. Genet. 2001, 28 (4), 345-349.(6) Dusi, S.; et al. Exome Sequence Reveals Mutations in CoA Synthase as a Cause of Neurodegeneration with Brain Iron Accumulation. Am. J. Hum. Genet. 2014, 94 (1). 11-22.(7) Schneider, S. A.; et al. Genetics and Pathophysiology of Neurodegeneration with Brain Iron Accumulation (NBIA). Curr. Neuropharmacol. 2013, 11 (1), 59-79.(8) Hayflick, S. J.; et al. Genetic, Clinical, and Radiographic Delineation of Hallervorden-Spatz Syndrome. N. Engl. J. Med. 2003, 348 (1), 33-40.(9) Hogarth, P.; et al. Consensus Clinical Management Guideline for Pantothenate Kinase- Associated Neurodegeneration (PKAN). Mol. Genet. Metab. 2017, 120 (3), 278-287.(10) Zhang, Y.-M.; et al. Chemical Knockout of Pantothenate Kinase Reveals the Metabolic and Genetic Program Responsible for Hepatic Coenzyme A Homeostasis. Chem. Biol. 2007, 14 (3), 291-302.(11) Garcia, M.; et al. Germline Deletion of Pantothenate Kinases 1 and 2 Reveals the Key Roles for CoA in Postnatal Metabolism. PLOS ONE 2012, 7 (7), e40871.(12) Zhang, Y.-M.; et al. Biochemical Properties of Human Pantothenate Kinase 2 Isoforms and Mutations Linked to Pantothenate Kinase- Associated Neurodegeneration. J. Biol. Chem. 2006, 281 (1), 107-114.(13) Orellana, D. I.; et al. Coenzyme A Corrects Pathological Defects in Human Neurons of PANK2-Associated Neurodegeneration. EMBO Mol. Med. 2016, 8 (10), 1197-1211.(14) Shumar, S. A.; et al. Induction of Neuron-Specific Degradation of Coenzyme A Models Pantothenate Kinase- Associated Neurodegeneration by Reducing Motor Coordination in Mice. PLOS ONE 2015, 10 (6), e0130013.(15) Jackowski. S. Proposed Therapies for Pantothenate-Kinase- Associated Neurodegeneration. J. Exp. Neurosci. 2019, 13, 1179069519851118.(16) Magnes, C.; et al. LC / MS / MS Method for Quantitative Determination of Long-Chain Fatty Acyl-CoAs. Anal. Chem. 2005, 77 (9), 2889-2894.(17) Basu, S. S.; et al. Stable Isotope Labeling by Essential Nutrients in Cell Culture for Preparation of Labeled Coenzyme A and Its Thioesters. Anal. Chem. 2011. 83 (4), 1363— 1369.(18) Tsuchiya, Y ; et al. Methods for Measuring CoA and CoA Derivatives in Biological Samples. Biochem. Soc. Trans. 2014, 42 (4), 1107-1111.(19) Srinivasan, B.; et al. Extracellular 4'-Phosphopantetheine Is a Source for Intracellular Coenzyme A Synthesis. Nat. Chem. Biol. 2015, 11 (10), 784-792.(20) Yuan, M.; et al. Ex vivo and in vivo Stable Isotope Labelling of Central Carbon Metabolism and Related Pathways with Analysis by LC-MS / MS. Nat. Protoc. 2019, 14 (2), 313-330.(21) Nagana Gowda, G. A.; et al. Extending the Scope of 1H NMR Spectroscopy for the Analysis of Cellular Coenzyme A and Acetyl Coenzyme A. Anal. Chem. 2019, 91 (3), 2464- 2471.(22) Dibble. C. C.; et al. PI3K Drives the de Novo Synthesis of Coenzyme A from Vitamin B5. Nature 2022, 608 (7921), 192-198.(23) Yu, Y.; et al. Coenzyme A Precursors Flow from Mother to Zygote and from Microbiome to Host. Mol. Cell 2022, 82 (14), 2650-2665. el 2.(24) Mian, S. A.; et al. Vitamin B5 and Succinyl-CoA Improve Ineffective Erythropoiesis in SF3B1 -Mutated Myelodysplasia. Sci. Transl. Med. 2023, 15 (685), eabn5135.(25) Kreuzaler, P.; et al. Vitamin B5 Supports MYC Oncogenic Metabolism and Tumor Progression in Breast Cancer. Nat. Metab. 2023, 5 (11), 1870-1886.(26) Bieber, L. L. Quantitation of CoASH and Acyl-CoA. Anal. Biochem. 1992, 204 (2), 228-230.(27) Shurubor, Y. I.; et al. Determination of Coenzy me A and Acetyl-Coenzyme A in Biological Samples Using HPLC with UV Detection. Molecules 2017, 22 (9), 1388.(28) Xue, L.; et al. Probing Coenzyme A Homeostasis with Semisynthetic Biosensors. Nat. Chem. Biol. 2023, 19 (3), 346-355.(29) Chudakov, D. M.; et al. Fluorescent Proteins as a Toolkit for in vivo Imaging. Trends Biotechnol. 2005, 23 (12), 605-613.(30) Leavesley, S. J.; et al. Automated Image Analysis of FRET Signals for Subcellular cAMP Quantification. In cAMP Signaling: Methods and Protocols; Zaccolo, M., Ed.; Springer US: New York. NY, 2022; pp 167-180.(31) Park, J.; et al. Recent Developments in Small-Molecule Fluorescent Probes for Cellular Senescence. Chemosensors 2024, 12 (7), 141.(32) Tuerk, C.; Gold, L. Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 1990, 249 (4968), 505-510.(33) Ellington, A. D.; Szostak, J. W. In vitro Selection of RNA Molecules That Bind Specific Ligands. Nature 1990, 346 (6287), 818-822.(34) Huizenga, D. E.; Szostak, J. W. A DNA Aptamer That Binds Adenosine and ATP. Biochemistry’ 1995, 34 (2), 656-665.(35) Zhou, W.; et al. Aptamer-Based Biosensors for Biomedical Diagnostics. Analyst 2014, 139 (11), 2627-2640.(36) Dougherty, C. A.; et al. Applications of Aptamers in Targeted Imaging: State of the Art. Curr. Top. Med. Chem. 2015. 15 (12), 1138-1152.(37) Dunn, M.; et al. Analysis of Aptamer Discovery and Technology. Nat. Rev. Chem. 2017, 1 , S41570-017.(38) Zhou, J.; Rossi, J. Aptamers as Targeted Therapeutics: Current Potential and Challenges. Nat. Rev. Drug Discov. 2017. 16 (3), 181-202.(39) Zhang, J.; et al. DNA Aptamer-Based Activatable Probes for Photoacoustic Imaging in Living Mice. J. Am. Chem. Soc. 2017, 139 (48), 17225-17228.(40) Moutsiopoulou, A.; et al. Molecular Aptamer Beacons and Their Applications in Sensing, Imaging, and Diagnostics. Small 2019, 15 (35), 1902248.(41) Hong, S.; et al. A Photo-Regulated Aptamer Sensor for Spatiotemporally Controlled Monitoring of ATP in the Mitochondria of Living Cells. Chem. Sci. 2020, 11 (3), 713-720.(42) Yu. H.; et al. Advances and Challenges in Small-Molecule DNA Aptamer Isolation, Characterization, and Sensor Development. Angew. Chem. Int. Ed. 2021, 60 (31), 16800- 16823.(43) Mou, Q.; et al. Efficient Delivery of a DNA Aptamer-Based Biosensor into Plant Cells for Glucose Sensing through Thiol-Mediated Uptake. Sci. Adv. 2022, 8 (26), eabo0902.(44) Ding. Y.; Liu, J. Pushing Adenosine and ATP SELEX for DNA Aptamers with Nanomolar Affinity. J. Am. Chem. Soc. 2023. 145 (13), 7540-7547.(45) Lin, B.; et al. Engineered Aptamers for Molecular Imaging. Chem. Sci. 2023, 14 (48), 14039-14061.(46) Alkhamis, O.; et al. High- Affinity Aptamers for In vitro and In vivo Cocaine Sensing. J. Am. Chem. Soc. 2024, 146 (5), 3230-3240.(47) Banik, M.; et al. Delivering DNA Aptamers Across the Blood-Brain Barrier Reveals Heterogeneous Decreased ATP in Different Brain Regions of Alzheimer's Disease Mouse Models. ACS Cent. Sci. 2024.(48) Burke, D. H.; Hoffman, D. C. A Novel Acidophilic RNA Motif That Recognizes Coenzy me A. Biochemistry 1998, 37 (13), 4653-4663.(49) Saran, D.; et al. The Tyranny of Adenosine Recognition among RNA Aptamers to Coenzyme A. BMC Evol. Biol. 2003, 3. 26.(50) Hu. D.; et al. Coenzyme A- Aptamer-Facilitated Label-Free Electrochemical Stripping Strategy for Sensitive Detection of Histone Acetyltransferase Activity. Biosens. Bioelectron. 2020, 150, 111934.(51) Nutiu, R.; Li, Y. In vitro Selection of Structure-Switching Signaling Aptamers.Angew. Chem. Int. Ed. 2005, 44 (7), 1061-1065.(52) Rajendran, M.: Ellington, A. D. In vitro Selection of Molecular Beacons. Nucleic Acids Res. 2003, 31 (19), 5700-5713.(53) Yang, K.-A.; et al. In vitro Selection and Amplification Protocols for Isolation of Aptameric Sensors for Small Molecules. Methods 2016, 106, 58-65.(54) Luo, Z.; et al. Developing a Combined Strategy for Monitoring the Progress of Aptamer Selection. The Analyst 2017. 142 (17), 3136-3139.(55) Alam, K. K; et al. FASTAptamer: A Bioinformatic Toolkit for High-Throughput Sequence Analysis of Combinatorial Selections. Mol. Then — Nucleic Acids 2015, 4 (3), e230.(56) Gotrik, M. R.; et al. Advancements in Aptamer Discovery' Technologies. Acc. Chem. Res. 2016, 49 (9), 1903-1910.(57) Markham, N. R.; Zuker, M. UNAFold: Software for Nucleic Acid Folding and Hybridization. Methods Mol. Biol. Clifton NJ 2008, 453, 3-31.(58) Nakatsuka, N.; et al. Aptamer-Field-Effect Transistors Overcome Debye Length Limitations for Small-Molecule Sensing. Science 2018, 362 (6412), 319-324.(59) Sharma, L. K.; et al. A Therapeutic Approach to Pantothenate Kinase Associated Neurodegeneration. Nat. Commun. 2018, 9 (1), 4399.(60) Leonardi. R.; et al. Modulation of Pantothenate Kinase 3 Activity by Small Molecules That Interact with the Substrate / Allosteric Regulatory Domain. Chem. Biol. 2010, 17 (8), 892-902.(61) Sharma, L. K; et al. A High-Throughput Screen Reveals New Small-Molecule Activators and Inhibitors of Pantothenate Kinases. J. Med. Chem. 2015, 58 (3), 1563-1568.(62) Mostert, K. J.; et al. The Coenzyme A Level Modulator Hopantenate (HoPan) Inhibits Phosphopantotenoylcysteine Synthetase Activity. ACS Chem. Biol. 2021, 16 (11), 2401- 2414.(63) PreveL C.; et al. Fluorescent Biosensors for High Throughput Screening of Protein Kinase Inhibitors. Biotechnol. J. 2014, 9 (2), 253-265.(64) Subramanian, C.: et al. Pantothenate Kinase Activation Relieves Coenzyme A Sequestration and Improves Mitochondrial Function in Mice with Propionic Acidemia. Sci. Transl. Med. 2021, 13 (611), eabf5965.(65) Subramanian, C.; et al. Relief of CoA Sequestration and Restoration of Mitochondrial Function in a Mouse Model of Propionic Acidemia. J. Inherit. Metab. Dis. 2023, 46 (1), 28- 42.(66) Bishop. T. R.; et al. Acetyl-CoA Biosynthesis Drives Resistance to Histone Acetyltransferase Inhibition. Nat. Chem. Biol. 2023, 19 (10), 1215-1222.(67) Jeong, S. Y.: et al. 4'-Phosphopantetheine Corrects CoA, Iron, and Dopamine Metabolic Defects in Mammalian Models of PKAN. EMBO Mol. Med. 2019, 11 (12), el 0489.

Claims

CLAIMSWhat is claimed is:

1. An aptamer comprising: a binding nucleic acid which selectively binds to coenzyme A (CoA); and a signaling nucleic acid which is at least partially complementary to at least a portion of the binding nucleic acid; wherein, when the binding nucleic acid is bound to CoA, the signaling nucleic acid produces a detectable signal.

2. The aptamer of claim 1, wherein the binding nucleic acid and / or the signaling nucleic acid comprises at least one mutation and / or at least one non-natural nucleic acid.

3. The aptamer of claim 1, wherein the binding nucleic acid comprises 80% similarity or more to any one of SEQ ID NOS: 1-15, 23, 26, or 29-49.

4. The aptamer of claim 1, wherein the signaling nucleic acid is from about 10% to about 100% of the length of the binding nucleic acid.

5. The aptamer of claim 1, wherein the signaling nucleic acid comprises 80% similarity or more to any one of SEQ ID NOS: 16-17, 22, 24, or 27.

6. The aptamer of claim 1, wherein CoA and the signaling nucleic acid bind the binding nucleic acid in non-overlapping regions of the binding nucleic acid.

7. The aptamer of claim 1, wherein, when CoA is bound to the binding nucleic acid, one or more properties in the binding nucleic acid change; and wherein the changes to one or more properties of the binding nucleic acid causes the signaling nucleic acid to dissociate from the binding nucleic acid.

8. The aptamer of claim 7, wherein the one or more properties of the binding nucleic acid comprise a conformational change, a difference in melting temperature, and / or a variation in sensitivity to pH or another environmental condition.

9. The aptamer of claim 1, wherein the detectable signal comprises a fluorophore or a fluorescent dye.

10. The aptamer of claim 9, wherein the fluorophore or fluorescent dye is conjugated to a first end of the binding nucleic acid and a quencher is conjugated to a complementary end of the signaling nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

11. The aptamer of claim 9, wherein the fluorophore or fluorescent dye is conjugated to a first end of the signaling nucleic acid and a quencher is conj ugated to a complementary end of the binding nucleic acid, and wherein the fluorophore or fluorescent dye produces a detectable signal when the binding nucleic acid is bound to CoA.

12. The aptamer of claim 1, wherein the detectable signal comprises a barcode sequence.

13. The aptamer of claim 12. wherein the signaling nucleic acid or the binding nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the binding nucleic acid is bound to CoA.

14. The aptamer of claim 1, wherein the binding nucleic acid does not significantly bind adenosine-containing molecules other than CoA.

15. The aptamer of claim 14. wherein the binding nucleic acid does not significantly bind acetyl-CoA, propionyl-CoA. butyryl-CoA, hexanoyl-CoA, malonyl-CoA, succinyl-CoA. 3- hydroxy-3-methylglutaryl-CoA (HMG-CoA), myristoyl-CoA, oleoyl-CoA, adenosine triphosphate (ATP), adenosine diphosphate (ADP), nicotinamide adenine dinucleotide (NAD+ / NADH), nicotinamide adenine dinucleotide phosphate (N ADP / NADPH). or any other adenosine-containing compound.

16. A method of detecting coenzyme A (CoA), the method comprising: a) exposing a sample to the aptamer of claim 1; and b) identifying the detectable signal, thereby detecting CoA in the sample.

17. The method of claim 16, wherein the sample is a cell sample, a tissue sample, a cell lysate, or a biological fluid.

18. The method of claim 17, wherein the method further comprises spatially identifying CoA in the cell or tissue sample.

19. The method of claim 16. wherein step b) comprises imaging the sample and / or performing polymerase chain reaction (PCR) on the sample.

20. A screening assay for determining presence of coenzyme A (CoA) in a sample, the screening assay comprising the aptamer of claim 1.

Citation Information

Patent Citations

  • Polymorphic markers and methods of genotyping corn

    US20060141495A1