Broadly neutralizing Anti-HCMV antibodies and uses thereof
Broadly neutralizing anti-HCMV monoclonal antibodies targeting the gH/gL-complex effectively inhibit HCMV infection and viral spread, addressing the limitations of existing therapeutics by enhancing treatment efficacy through synergistic interactions with antiviral drugs.
Patent Information
- Application Number
- PCT/US2025/031539
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-31
- Filing Date
- 2025-05-30
- Publication Date
- 2025-12-04
AI Technical Summary
Current anti-CMV therapeutics, such as CytoGam®, have limited efficacy and significant side effects, necessitating the development of safer and more effective treatments for immune-compromised individuals and congenital infections.
Development of broadly neutralizing anti-HCMV monoclonal antibodies that target the gH/gL-complex, inhibiting viral entry and dissemination, and synergizing with antiviral drugs like ganciclovir to effectively neutralize diverse HCMV strains across multiple cell types.
The antibodies demonstrate potent neutralization of HCMV across various cell types, limiting viral spread and reducing viral load, and synergize with antiviral drugs to enhance treatment efficacy.
Smart Images

Figure US2025031539_04122025_PF_FP_ABST
Abstract
Description
BROADLY NEUTRALIZING ANTI-HCMV ANTIBODIES AND USES THEREOFCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No. 63 / 654,142, filed on May 31, 2024, which is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under R01 AI139258 awarded by the National Institutes of Health (NIH) and the National Institute of Allergy' and Infectious Diseases (NIAID). The government has certain rights in the invention.REFERENCE TO A SEQUENCE LISTING
[0003] This application contains a Sequence Listing, which has been submitted electronically in xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on May 28, 2025. is named SeqList-084284-00322.xml and is 43,274 bytes in size.FIELD
[0004] The present disclosure relates to broadly neutralizing anti-human cytomegalovirus (anti-HCMV) antibodies, vaccines, and kits, as well as methods of use, including diagnostic and therapeutic methods.BACKGROUND
[0005] Human cytomegalovirus (HCMV) is a ( -herpesvirus with an estimated global seroprevalence rate of 83%. In immune competent hosts, the majority of CMV primary infections are asymptomatic. However, the control of CMV in immune-compromised individuals is of great importance as it can be spread during organ transplantation and across the placenta from mother to fetus, as is the case with congenital CMV infection.
[0006] While CMV vaccine efforts are underway, strategies to prevent transmission include the use of antivirals and CMV hyperimmune globulin (CytoGam®). Despite positive findingsfor the use of CytoGam® as a prophylactic treatment to reduce CMV infections, overall efficacy and side effects severely limit its use.
[0007] Accordingly, safe and effective anti-CMV therapeutics are urgently needed.SUMMARY
[0008] Provided is an antibody or antigen-binding fragment thereof that binds to human cytomegalovirus (HCMV), the antibody or antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region, wherein each of the heavy chain and the light chain variable regions comprises a CDR1, CDR2, and CDR3, and wherein:(a) the sequence of CDR1H comprises GGSISSYY (SEQ ID NO: 15); the sequence of CDR2H comprises IYYSGNT (SEQ ID NO: 16); the sequence of CDR3H comprises VRFGYYGLDV (SEQ ID NO: 17); the sequence of CDR1 L comprises QGIRSD (SEQ ID NO: 18); the sequence of CDR2L comprises AAS; and the sequence of CDR3L comprises LQHNSYPFT (SEQ ID NO: 19);(b) the sequence of CDR1H comprises GFTFSDYT (SEQ ID NO:20); the sequence of CDR2H composes ISRNSNYI (SEQ ID NO:21); the sequence of CDR3H comprises ARDLAAAGAYGYFDY (SEQ ID NO:22); the sequence of CDR1L comprises QGISSW (SEQ ID NO:23); the sequence of CDR2L comprises AAS; and the sequence of CDR3L comprises CQQANSFPYT (SEQ ID NO:24);(c) the sequence of CDR1H comprises GYNFASYW (SEQ ID NO:25); the sequence of CDR2H comprises IYPGDSDT (SEQ ID NO: 26); and the sequence of CDR3H comprises ARLRGTMAGFDF (SEQ ID NO:27); or(d) the sequence of CDR1H comprises GYSFASYW (SEQ ID NO:28); the sequence of CDR2H comprises IYPGDSDT (SEQ ID NO:26); the sequence of CDR3H comprises TRLRGTMAGFDF (SEQ ID NO:29); the sequence of CDR1L comprises QSLVESDGNTY (SEQ ID NO:30); the sequence of CDR2L comprises KIS; and the sequence of CDR3L comprises MKATQYT (SEQ ID NO:31).
[0009] In some embodiments:(a) the sequence of the heavy chain variable region comprises a sequence that is at least 80%, at least 85%. at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or atleast 99% to SEQ ID NO:1 and the sequence of the light chain variable region comprises a sequence that is least at least 80%, at least 85%, at least 90%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:5;(b) the sequence of the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:2 and the sequence of the light chain variable region comprises a sequence that is least at least 80%, at least 85%. at least 90%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:6;(c) the sequence of the heavy chain variable region comprises a sequence that is at least 80%, at least 85%. at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO: 3; or(d) the sequence of the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:4 and the sequence of the light chain variable region comprises a sequence that is least at least 80%, at least 85%, at least 90%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO: 7.
[0010] In some embodiments:(a) the sequence of the heavy chain variable region comprises SEQ ID NO: 1 and the sequence of the light chain variable region comprises SEQ ID NO:5;(b) the sequence of the heavy chain variable region comprises SEQ ID NO:2 and the sequence of the light chain variable region comprises SEQ ID NO:6;(c) the sequence of the heavy chain variable region comprises SEQ ID NO:3; or(d) the sequence of the heavy chain variable region comprises SEQ ID NO:4 and the sequence of the light chain variable region comprises SEQ ID NO: 7.
[0011] In some embodiments, the antibody or antigen-binding fragment thereof is a chimeric antibody, a CDR-grafted antibody, or a humanized antibody or antigen-binding fragment thereof.
[0012] In some embodiments, the antibody or antigen-binding fragment thereof is a monoclonal antibody or antigen-binding fragment thereof.
[0013] In some embodiments, the antibody or antigen-binding fragment thereof is a multispecific or a bispecific antibody or antigen-binding fragment thereof.
[0014] In some embodiments, the antibody or antigen-binding fragment thereof is an scFv, Fv. Fab’. Fab, F(ab’)2. or diabody.
[0015] In some embodiments, the antibody or antigen-binding fragment thereof has isotype IgG2.
[0016] In some embodiments, the antibody or antigen-binding portion thereof is capable of broadly neutralizing an HCMV infection.
[0017] Provided is an isolated nucleic acid encoding the antibody or antigen-binding fragment thereof disclosed herein. Provided is a vector comprising a nucleic acid disclosed herein.
[0018] Provided is a vector or set of vectors encoding an antibody or antigen-binding fragment thereof that binds to HCMV, the antibody or antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region, wherein the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to a sequence disclosed in Table 7 and the sequence encoding the light chain variable region at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to a sequence disclosed in Table 8.
[0019] In some embodiments:(a) the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 8 and the sequence encoding the light chain variable region comprises a sequence that is at least 80%. at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 12;(b) the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 9 and the sequence encoding the light chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 13;(c) the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NOTO; or(d) the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 11 and the sequence encoding the light chain variable region comprises a sequence that is at least 80%. at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 14.
[0020] In some embodiments:(a) the sequence encoding the heavy chain variable region comprises SEQ ID NO: 8 and the sequence encoding the light chain variable region comprises SEQ ID NO: 12;(b) the sequence encoding the heavy chain variable region comprises SEQ ID NO: 9 and the sequence encoding the light chain variable region comprises SEQ ID NO: 13;(c) the sequence encoding the heavy chain variable region comprises SEQ ID NO: 10; or(d) the sequence encoding the heavy chain variable region comprises SEQ ID NO: 11 and the sequence encoding the light chain variable region comprises SEQ ID NO: 14.
[0021] Provided herein is a cell comprising a vector disclosed herein, or a set of vectors disclosed herein. In some embodiments, the cell is a bacterial cell, a yeast cell, or a mammalian cell. The cell may be isolated. The cell may be human.
[0022] Provided herein is a pharmaceutical composition comprising an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein and a pharmaceutically acceptable carrier or excipient.
[0023] Provided herein is a T-cell comprising a chimeric antigen receptor comprising the CDRs of an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein.
[0024] In some embodiments, the anti-HCMV antibody or antigen-binding fragment thereof is conjugated to one or more of a cytotoxin, a fluorescent label, and an imaging agent.
[0025] Provided herein is a kit for detecting the presence of HCMV, or an antigenic fragment of HCMV thereof, in a sample comprising: (i) an anti-HCMV antibody or antigenbinding portion thereof disclosed herein, and (ii) a buffer. In one embodiment, the anti-HCMV antibody or antigen-binding portion thereof is bound to a substrate. In one embodiment, the anti-HCMV antibody or antigen-binding portion thereof is detectably labeled. In one embodiment, the kit further comprises a secondary antibody that specifically binds to the antibody or antigen-binding portion thereof. In one embodiment, the secondary antibody is an anti-IgG antibody. In one embodiment, the secondary antibody is detectably labeled.
[0026] In one aspect, provided is a method of making an antibody or antigen-binding fragment thereof that binds to HCMV. the method comprising:(i) providing a cell comprising one or more nucleic acid molecules encoding the heavy variable chain and / or the light variable chain of an anti-HCMV antibody or antigenbinding fragment thereof disclosed herein;(ii) expressing in the cell the heavy variable chain and / or the light variable chain: and(iii) collecting the heavy variable chain and / or the light variable chain.
[0027] In one aspect, provided is a method of detecting the presence of HCMV, or an antigenic fragment thereof, in a sample comprising:(i) obtaining a sample containing, or suspecting of containing, HCMV, or an antigenic fragment thereof;(ii) contacting the sample with an anti-HCMV antibody or antigen-binding fragment thereof of any disclosed herein; and(iii) detecting the presence of specific binding of the anti-HCMV antibody or antigenbinding fragment thereof to HCMV, or an antigenic fragment thereof.
[0028] In some embodiments, the method further comprises quantifying the amount of HCMV, or antigenic fragments thereof, present in the sample. In some embodiments, the sample is an environmental sample. In some embodiments, the sample is a biological sample.
[0029] In one aspect, provided is a method of treating an HCMV infection in a subject in need thereof, the method comprising administering to the subject an anti-HCMV antibody or antigen-binding fragment disclosed herein. In one embodiment, the method further comprises administering to the individual at least one additional anti-HCMV antibody or antigen-binding portion thereof. In one embodiment, the at least one additional anti-HCMV antibody, or antigen-binding portion thereof, is an anti-HCMV antibody or antigen-binding fragment disclosed herein. In one embodiment, the method comprises administering to the individual at least one additional antiviral composition. In some embodiments, the at least one additional antiviral composition is selected from the group consisting of ganciclovir, valganciclovir, foscamet, cidofovir, and combinations thereof.
[0030] In one aspect, provided is a method of preventing an HCMV infection in a subject comprising administering to the individual an anti-HCMV antibody or antigen-binding fragment thereof of disclosed herein.
[0031] In one aspect, provided is a method of diagnosing a subject as having an HCMV infection comprising:(i) identifying a subject;(ii) obtaining from the subject a biological sample containing HCMV or an antigenic fragment thereof:(iii) contacting the sample with an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein;(iv) detecting the presence of specific binding of the anti-HCMV antibody or antigenbinding fragment thereof to HCMV, or an antigenic fragment thereof; and(v) diagnosing the subject as having an HCMV infection.
[0032] In one aspect, provided is a method of inhibiting binding of HCMV glycoprotein gH and / or glycoprotein gL to a cellular surface protein, the method comprising contacting gH and / or gL with an anti -HCMV antibody or antigen-binding fragment thereof disclosed herein. In some embodiments, the cellular surface protein is selected from the group consisting of Nectin 1 , EphA2, Nrp2, PDGFRalpha.
[0033] Provided herein is an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein for use in medicine.
[0034] Provided herein is an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein for use in treating or preventing an HCMV infection.
[0035] Provided herein is the use of an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein in the manufacture of a medicament for use in treating or preventing an HCMV infection.
[0036] The subject may be a human.BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1A, FIG. IB, FIG. 1C, and Fig. ID illustrate the screening and selection of hybridoma clones that neutralize HCMV elicited from Veloclmmune® mice. FIG. 1A. Hybridoma clones (1440) generated from a Veloclmmune® mouse immunized with TB40 / E and VHL / E were screened using a neutralization assay for AD169R (MOI = 0.2) in ARPE-19 epithelial cells. Percent neutralization was calculated relative to virus alone (set at 100%) and plotted as a heat map for clones assessed across 10 96-well plates. FIG. IB. Hybridoma clones 7H6, 1C10, 1H1, 2D4, 4F9, 7G07, 8A5, and 9H1 were assessed for neutralization of AD169R (MOI = 0.2) in NHDF and ARPE-19 epithelial cells. Relative infection (%) was calculated based on virus alone as 100%. FIG. 1C. The gH / gL complexes expressed in U373 cells were recovered by immunoprecipitation (IP) of mAbs 5C3, 1C10, 4F9, 8A5, 2D4, and 7H6 from U373-gH / gL cell lysates. The U373-gH / gL total cell lysate (TCL) (lane 1) and IPs of protein A beads alone (lane 3), W6 / 32 antibody (anti-MHC-I, lane 4), anti-HCMV mAbs (lanes 5-9), and isotype control clone 7H6 (lane 10) were resolved on a non-reducing SDS-polyacrylamide gel and then subjected to anti-gL immunoblot. Lane 2 was blank. The relative molecular weight markers and recovered polypeptides are indicated. FIG. ID illustrates the recognition and recovery of HCMV trimer and pentamer complexes by Veloclmmune®-elicited mAbs. Trimer and pentamer glycoprotein complexes expressed on the surface of HCMV virions were recovered by immunoprecipitation of mAbs 5C3, 1C10. 4F9, 8A5, 2D4. and 7H6 from purifiedHCMV-TB40 / E virion lysate. HCMV-TB40 / E virus lysate (lane 1) and IPs of protein A beads alone (lane 3). W6 / 32 antibody (anti-MHC-I, lane 4), anti-HCMV mAbs (lanes 5-9), and isotype control (lane 10) were resolved on a non-reducing SDS-polyacrylamide gel and then subjected to anti-gL immunoblot. Relative molecular weight markers and recovered polypeptides are indicated.
[0038] FIG. 2A, FIG. 2B, FIG. 2C. FIG. 2D, Fig. 2E, FIG. 2F, and FIG. 2G illustrate the ability of anti-HCMV mAbs to neutralize infection of diverse HCMV strains in epithelial cells. MAbs 1C10 (FIG. 2A), 2D4 (FIG. 2B), 4F9 (FIG. 2C), and 8A5 (FIG. 2D), and HCMV hyperimmune globulin (CytoGam®, FIG. 2E) were evaluated for neutralization of TB40 / E, AD169R, and TR (M0I = 0.2) in ARPE-19 epithelial cells. mAb 1C10 (FIG. 2F) and HCMV hyperimmune globulin (CytoGam, B, FIG. 2G) (0-50 pg / mL) were also evaluated for neutralization of Towne and Davis (MOI = 0.2) in NHDF fibroblast cells. Relative infection (%) was calculated based on virus alone as 100%. Error bars represent standard deviation from the mean. Statistical significance is denoted as: *,p < 0.05; ***, p < 0.001< 0.0001.
[0039] FIG. 3A, FIG. 3B, FIG. 3C. FIG. 3D, and Fig. 3E illustrate the anti-HCMV mAbs’ neutralization of HCMV in fibroblasts. MAbs 1C10 (FIG. 3A). 2D4 (FIG. 3B), 4F9 (FIG. 3C), and 8A5 (FIG. 3D), and HCMV hyperimmune globulin (CytoGam®, FIG. 3E) were evaluated for neutralization of TB40 / E, AD169R, TR, and AD169-IE2-YFP (MOI = 0.2) in NHDF cells. Relative infection (%) was calculated based on virus alone as 100%. Error bars represent standard deviation from the mean. Statistical significance is denoted as: *, p < 0.05; **,p < 0.01 ;0.001; **** p < 0.0001.
[0040] FIG. 4A, FIG. 4B, FIG. 4C, and FIG. 4D illustrate that anti-HCMV mAb 1C10 neutralizes HCMV infection of placenta- and monocyte-derived cells. MAb 1C10 (FIG. 4A and FIG. 4C) and HCMV hyperimmune globulin (CytoGam®, FIG. 4B and FIG. 4D) (0- 50 mg / ml) were analyzed for neutralization of TB40 / E and AD169R (MOI = 0.2) in HTR- 8 / SVneo placenta-derived trophoblast cells (FIG. 4A and FIG. 4B) and THP-1 monocyte- derived cells (FIG. 4C and FIG. 4D) Relative infection (%) was calculated based on virus alone as 100%. Error bars represent standard deviation from the mean. Statistical significance is denoted as: *. / 0.05; ***, xO.OOI; ****. / ?<().()()() I based on untreated sample, respectively.
[0041] FIG. 5 illustrates that mAb 1C10 binds to a distinct region of gH. Competition assays were performed with U373-gH / gL cells incubated with a fixed amount (2 pg / rnL) of AF647-labeled 1C10 and increasing concentrations (0.4, 2. 4, 20 pg / mL) of unlabeled antibody. The relative MFI of AF647-positive cells is depicted after normalization to theaverage MFI of AF647-labeled 1C10 incubated with a lOfold excess of irrelevant influenza antibody PY102. The data depicted are an average of at least n = 2 experimental replicates.
[0042] FIG. 6A, FIG. 6B, FIG. 6C. FIG. 6D, and Fig. 6E illustrate that anti-gH / gL mAbs limit virus infection of fibroblast and epithelial cells in a post-attachment step. MAbs 1C10, 2D4, 4F9, 7H6, 8A5, and CytoGam® were incubated with TB40 / E prior to attachment of virus or added to cells post-attachment of virus to NHDF (FIG. 6A) or ARPE- 19 epithelial (FIG. 6B) cells and evaluated for inhibition of infection with virus alone set to 100%. Left bars: pre-attachment. Right bars: post-attachment. FIG. 6C Schematic depiction of the time-of-addition study to evaluate mAbs’ kinetics of inhibition. MAbs 1C10, 2D4, 4F9, 7H6, 8A5 were added to NHDF (FIG. 6D) or ARPE-19 epithelial (FIG. 6E) cells at the indicated timepoints relative to infection of TB40 / E (MOI = 0.2) and evaluated for infection with virus alone set to 100 %. FIG. 6D: Figure legend as in FIG. 6E. Traces by endpoint from top to bottom: 7H6, 8A5, 4F9, 2D4, 1C10. FIG. 6E: Traces by endpoint from top to bottom: 7H6, 2D4, 8A5, 1C10, 4F9. Error bars represent standard deviation from the mean.
[0043] FIG. 7A, FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E, FIG. 7F, and FIG. 7H illustrate that anti-gH / gL mAbs limit HCMV proliferation. MAbs 1C10. 2D4. 4F9. 7H6. and 8A5 were examined in a TB40 / E (MOI=0.01) proliferation assay in ARPE-19 epithelial cells. Relative infection compared to virus alone (FIG. 7A) and number of viral foci (>5000 pm2) (FIG. 7B) were quantified at 9 dpi. CytoGam®, ganciclovir, and no treatment (-) were utilized as controls. Relative infection (%) was calculated based on virus alone set as 100%. Error bars represent standard deviation from the mean. Statistical significance is denoted as: ***, ><0.001; ****, £><0.0001. MAbs 1C10, 4F9, 8A5, 2D4, and 7H6 were evaluated in a virus proliferation assay by measuring relative HCMV genome levels in ARPE-19 epithelial (FIG. 7C) or NHDF (FIG. 7D) cells infected with TB40 / E (MOI = 0.01) at 9 dpi. CytoGam®, ganciclovir, and no treatment (-) were utilized as controls. HCMV genome levels were quantified relative to mock (uninfected) cells after normalizing to housekeeping gene RPS11 expression. The bar represents the relative mean. Statistical significance is denoted as: *, p < 0.05; ***, £> < 0.001; **** p < 0.0001. FIG. 7E. HCMV infection and dissemination is unaffected by periodic removal and replacement of media. HCMV-TB40 / E (MOI = 0.05) was added to NHDF fibroblast cells alone or in the presence of mAh 7H6 (10 pg / mL) or ganciclovir (10 pM). Media containing treatments was left unaltered (three left bars) or removed and replaced with fresh media containing treatments at days 3 and 6 post-infection (three right bars), before quantification of total number of infected cells at day 9 post-infection. All conditions were performed in technical triplicate. FIG. 7F. Isotype mAb 7H6 (20 pg / mL) andletermovir (20 nM) were used as controls. HCMV genome levels were quantified relative to mock (uninfected) cells after normalizing to housekeeping gene RPS 11 expression. FIG 7G. HCMV-TB40 / E (MOI=0.05) was added to NHDF fibroblast cells, and infection was allowed to proceed for 24 hours prior to addition of isotype mAb 7H6 (10 pg / mL), ganciclovir (GCV, 10 pM), CytoGam® (Cyto, 10 pg / rnL), or mAb 1C10 (10 pg / mL). Media containing treatments was replaced at days 4 and 7 post-infection, before quantification of total # of infected cells at day 10 post-infection and calculation of % infection relative to untreated cells (set as 100%). FIG. 7H. TB40 / E infection (MOI=0.05, 0.01, 0.005, 0.001) of NHDF cells was allowed to proceed for 24 hours prior to addition of mAb 1C10 (10 pg / rnL). Media containing treatment was replaced at days 4 and 7 post-infection, before quantification of total # of infected cells at day 10 post-infection and calculation of % infection relative to untreated cells (set as 100%). Error bars represent standard deviation from the mean. Statistical significance is denoted as: **, / ?<0.01; ***, / ?<0.001; ****, ^><0.0001 based on untreated sample, respectively. FIG. 8A and FIG. 8B illustrate that combinations of anti-gH 1C10 and anti-gB 8F9 mAbs effectively limit HCMV dissemination. Combinations of increasing concentrations of mAbs 1C10 and 8F9 were evaluated for limiting TB40 / E (MOI = 0.05) dissemination in ARPE-19 epithelial cells. Relative infection (%) was calculated at 9 days post-infection based on virus alone as 100% (FIG. 8A) and these values were used to determine the Loewe synergy scores (FIG. 8B) FIG. 8A: Bars from left to right as shown in figure legend from top to bottom. Error bars represent standard deviation from the mean. Statistical significance is denoted as: ****, ? < 0.0001.
[0044] FIG. 9A, FIG. 9B, FIG. 9C, and FIG. 9D illustrate that mAb IClO / ganciclovir combinations synergistically inhibit HCMV dissemination. Combinations of increasing concentrations of mAb 1C10 and ganciclovir were evaluated for limiting TB40 / E (MOI=0.05) dissemination in ARPE-19 epithelial (FIG. 9A and FIG. 9C) and NHDF (FIG. 9B and FIG. 9D) cells at 9 dpi. Relative infection (%) was calculated based on virus alone as 100% (FIG. 9A and FIG. 9B) and these values were used to determine the Loewe synergy scores (FIG. 9C and FIG. 9D). FIG. 9A and FIG. 9B: Bars from left to right as shown in figure legend from top to bottom. Error bars represent standard deviation from the mean. Statistical significance is denoted as: **, > < 0.01; ***, p <0 .001 ; ****, p < 0.0001.
[0045] FIG. 10A and FIG. 10B illustrate that anti-gH mAbs exhibit synergy in combination with ganciclovir, but to varying degrees. Combinations of increasing concentrations of mAb 15G11 and ganciclovir were evaluated for limiting TB40 / E (MOI=0.05) dissemination in ARPE-19 epithelial (FIG. 10A and FIG. 10B) cells at 9 dpi. Relative infection(%) values based on virus alone as 100% (FIG. 10A) were used to determine the Loewe synergy’ scores (FIG. 10B). FIG. 10A: Bars from left to right as shown in figure legend from top to bottom. Error bars represent standard deviation from the mean. Statistical significance is denoted as:0.0001.DETAILED DESCRIPTION
[0046] Prevention, treatment, and management of HCMV infection and associated disease presents striking challenges to design and optimization of clinical therapeutics. The virus is near-ubiquitous worldwide, and patient populations at high risk of morbidity and mortality due to infection / reactivation are those whose immune systems are already weakened or suppressed.
[0047] Provided herein are anti-HCMV human monoclonal antibodies (mAbs) that effectively inhibit HCMV infection, block viral entry, limit viral dissemination, and reduce viral load over multiple replicative cycles. Further, broadly neutralizing mAbs targeting HCMV gH / gL-complexes act additively or synergistically with an anti-gB neutralizing mAb and antiviral ganciclovir, respectively.
[0048] Human cytomegalovirus
[0049] Human cytomegalovirus (HCMV) is the largest 0-herpesvirus with a linear dsDNA genome of 235 kb, which codes for >165 viral proteins and contains several miRNAs and ncRNAs. Like all herpes viruses, HCMV establishes a lifelong infection, maintaining a latent reservoir within the bone marrow. Viral shedding can occur after reactivation or after reinfection with a second strain of HCMV. The estimated global seroprevalence of HCMV is 83%. There is strong evidence for a higher prevalence in lower socio-economic groups and women of childbearing age, the latter attributed to increased contact with young children. Infections in immune competent hosts are typically asymptomatic but can cause severe, lifethreatening complications in individuals who are immune compromised or have immature immune systems. High-risk groups for HCMV include patients with immune disorders such as AIDS, transplant recipients and infants. Congenital HCMV infections occur when the mother has a reactivation or primary infection immediately before, during or after pregnancy and passes the virus to the infant. Congenital CMV infection is the leading cause of neurological damage in children and can be associated with severe birth defects including sensorineural hearing loss, microcephaly, and periventricular calcifications. Although multiple clinical trials have been conducted to identify a safe and effective therapy to reduce transmission and / orreduce disease severity in congenitally infected infants, none have been approved, further emphasizing the importance of identifying improved strategies to treat CMV.
[0050] Most of the current FDA-approved drugs for the treatment of CMV (including ganciclovir, valganciclovir, foscamet and cidofovir) target viral replication by interfering with DNA polymerase with varying efficacy and dose-related cytotoxicity. The use of hyperimmune globulin (HIG) isolated from CMV seropositive donors has been approved as a prophylaxis of CMV disease for kidney and renal transplant patients. However, the use in other designations such as patients with AIDS, HSCT or congenital CMV infection, has not been approved. The use of HIG requires high doses. Further, due to HIG’s short half-life, the drug needs to be given frequently. Additionally, the drug requires IV administration, contains antibodies that are not specific to CMV, and exhibits significant lot-to-lot variability, which can impair treatment efficacy.
[0051] Of the herpesviruses, HCMV harbors the most genes dedicated to evading the host immune response, including adaptive immunity7. The viral envelope of HCMV contains various protein complexes that enable wide viral tropism, utilizing multiple glycoprotein complexes to attach and fuse with host cell membranes including the membranes of fibroblasts, epithelial, endothelial, and myeloid cells. As such, HCMV represents a significant and life-long burden of antigenic T-cell surveillance and immune dysfunction.
[0052] Glycoproteins gB. gH, and gL comprise the core fusion machinery for the virus and exist in various protein complexes on the virion surface. Glycoprotein gB catalyzes membrane fusion during viral entry, and gH and gL likely serve as factors that activate gB to permit pH- independent fusion at the cellular membrane. In addition to the gH / gL heterodimer, gH and gL exist in the trimeric gH / gL / gO complex, which is important for viral entry into fibroblasts. The pentameric complex (PC), which consists of gH / gL and three additional proteins UL128, ULI 30 and UL 131a, is important for viral entry into epithelial, endothelial, and myeloid cells where the virion enters through a low pH-dependent endocytosis mechanism. The glycoprotein complex gH / gL / gO (gH trimer) is important for infection of all cell types, while the gH / gL / UL128 / 130 / 131a (gH pentamer) complex imparts specificity in infecting epithelial, endothelial, and myeloid cells. Given that the amount of gH / gL / gO trimer on the viral surface correlates with levels of CMV entry in both epithelial and fibroblast cells, gH may contribute to viral entry primarily through activation of the fusion event, rather than serving a receptorbinding role. Without wishing to be bound by theory, anti-gH antibodies may function by interrupting a fusion-triggering signal to gB.
[0053] In the experiments disclosed herein, human anti-HCMV mAbs were generated using Veloclmmune® mice immunized with intact, clinical-like HCMV virions. Screening identified human mAbs that targeted gH / gL-containing envelope protein complexes and neutralized diverse strains of HCMV in epithelial cells. As such, provided herein are antibodies that potently neutralize HCMV infection across multiple cell types, indicating that the antibodies’ epitope is conserved among strains. Importantly, the anti-gH / gL mAbs limit virus dissemination and were demonstrated to function synergistically with HCMV antiviral drugs to inhibit virus proliferation.
[0054] Antibodies
[0055] The term '’antibody" is used in the broadest sense and includes monoclonal antibodies (including full length or intact monoclonal antibodies), polyclonal antibodies, multivalent antibodies, multispecific antibodies (e g., bispecific antibodies), antibody fragments, and antigen-binding portions thereof (e g., paratopes, CDRs), so long as they exhibit the desired biological activity’ and specificity. The terms “antigen-binding portion” or “antigenbinding fragment” as used herein may refer to a region on an antibody that binds to its antigen.
[0056] As used herein, “antibody variable domain” refers to the portions of the light and heavy chains of antibody molecules that include amino acid sequences of Complementarity7Determining Regions (CDRs; / .e., CDR1, CDR2, and CDR3), and Framework Regions (FRs). VH refers to the variable domain of the heavy chain. VL refers to the variable domain of the light chain. The amino acid positions assigned to CDRs and FRs may be defined according to Kabat or according to Chothia. The term “framework regions” (FR) refers to those variable domain residues other than the CDR residues.
[0057] As used herein, the term “Complementarity Determining Regions” (CDRs) refers to portions of an antibody variable domain that are (typically) involved in antigen-binding. Each variable domain typically has three CDR regions identified as CDR1, CDR2 and CDR3. Each CDR can comprise amino acid residues from a CDR as defined by e.g. Kabat (i.e., about residues 24-34 (LI), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (Hl). 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain (Kabat et al.. Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1987, 1991)). Each CDR can also comprise amino acid residues from a “hypervariable loop” i.e., about residues 26-32 (LI), 50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26-32 (Hl). 53-55 (H2) and 96-101 (H3) in the heavy7chain variable domain (Chothia & Lesk 196 J. Mol. Biol. 901 (1987)). In some instances, a CDR can includeamino acids from both a CDR region defined according to Kabat and a hypervariable loop. The Kabat residue designations do not always correspond directly with the linear numbering of the amino acid residues (primary amino acid sequence). The actual linear amino acid sequence may contain fewer or additional amino acids than in the strict Kabat numbering corresponding to a shortening of, or insertion into, a structural component, whether framework or CDR, of the basic variable domain structure. The correct Kabat numbering of residues may be determined for a given antibody or antigen-binding fragment thereof by alignment of residues of homologj’ in the sequence of the antibody or antigen-binding fragment thereof with a “standard” Kabat numbered sequence. Alternatively, a CDR can be defined according to the ImMunoGeneTics (IMGT) system (Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003)).
[0058] Provided herein are also antibodies that comprise CDR and / or variable chain sequences that have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with any of the sequences disclosed herein.
[0059] As used herein, the term “identity” refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by companng a position in each sequence which may be aligned for purposes of comparison. For example, when a position in the compared nucleotide sequence is occupied by the same base, then the molecules are identical at that position. A degree identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at shared positions. For example, polypeptides having at least 85%, 90%, 95%, 98%, or 99% identity to specific polypeptides described herein and preferably exhibiting substantially the same functions, as well as polynucleotides encoding such polypeptides, are contemplated. Methods and computer programs for determining both sequence identity and similarity are publicly available, including, but not limited to, the GCG program package (Devereux et al.. Nucleic Acids Research 12: 387, 1984), BLASTP, BLASTN, FASTA (Altschul et al., J. Mol. Biol. 215:403 (1990), and the ALIGN program (version 2.0). The well-known Smith Waterman algorithm may also be used to determine similarity. The BLAST program is publicly available fromNCBI and other sources (BLAST Manual. Altschul. et al., NCBI NLM NIH. Bethesda, Md. 20894; BLAST 2.0 at http: / / ww wncbi.nlm.nih.gov / blast / ). In comparing sequences, these methods account for various substitutions, deletions, and other modifications.
[0060] Provided herein are antibodies or antigen-binding fragments thereof comprising any of the sequences in any one of Tables 1-6, or variations of such sequences.Table 1. Sequence information for selected anti-HCMV antibodies (VH chains).Table 2. Amino acid sequence information for selected anti-HCMV antibodies (VH chains).Table 3. Sequence information for selected anti-HCMV antibodies (VK chains).Table 4. Amino acid sequence information for anti-HCMV selected antibodies (VK chains).Table 5. Amino acid sequence information for selected antibodies (VH chains). CDRs inTable 6. Amino acid sequence information for selected antibodies (VK chains). CDRs in bold.
[0061] Antibody modifications
[0062] In some embodiments of the aspects described herein, amino acid sequence modification(s) of the antibodies or antigen-binding fragments thereof that bind to HCMV described herein are contemplated. Amino acid sequence variants of the antibody or antigenbinding fragment thereof can be prepared by introducing appropriate nucleotide changes into the nucleic acid encoding the antibody or antigen-binding fragment thereof, or by peptide synthesis. Such modifications include, for example, deletions from, and / or insertions into and / or substitutions of, residues within the amino acid sequences of the antibody or antigenbinding fragment thereof. Any combination of deletion, insertion, and substitution is made to arrive at the final construct, provided that the final construct possesses the desired characteristics, e.g, binding specificity, and inhibition of biological activity.
[0063] One type of variant is a conservative amino acid substitution variant. These variants have at least one amino acid residue in the antibody or antigen-binding fragment thereof replaced by a different residue that has similar side chain properties. Amino acids can begrouped according to similarities in the properties of their side chains (see Lehninger, BIOCHEMISTRY (2nd ed„ Worth Publishers, New York, 1975):(1) non-polar: Ala (A), Vai (V), Leu (L), He (I), Pro (P), Phe (F), Trp (W), Met (M);(2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gin (Q);(3) acidic: Asp (D), Glu (E);(4) basic: Lys (K), Arg (R), His (H).As such, a non-limiting example for a conservative amino acid substitution is one that replaces anon-polar amino acid with another non-polar amino acid.
[0064] Alternatively, naturally occurring residues can be divided into groups based on common side-chain properties:(1) hydrophobic: Ala (A), Vai (V), Leu (L), He (I), Met (M);(2) neutral hydrophilic: Ser (S), Thr (T), Cys (C), Asn (N), Gin (Q);(3) acidic: Asp (D), Glu (E);(4) basic: Lys (K), Arg (R), His (H);(5) residues that influence chain orientation: Gly (G), Pro CP):(6) aromatic: Phe (F), Trp (W), Tyr (Y).As such, a non-limiting example for a conservative amino acid substitution is one that replaces a hydrophobic amino acid with another hydrophobic amino acid.
[0065] In some embodiments, the CDRs of an anti-HCMV antibody or antigen-binding fragment disclosed herein have a conservative amino acid substitution.
[0066] Provided herein is an anti-HCMV antibody or antigen-binding fragment disclosed herein that comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitution as compared to another anti-HCMV antibody or antigen-binding fragment disclosed herein disclosed herein. Provided herein is an anti-HCMV antibody or antigen-binding fragment disclosed herein that comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitution as compared to another anti-HCMV antibody or antigen-binding fragment disclosed herein disclosed herein.
[0067] Further contemplated are amino acid sequence insertions, which can include amino- and / or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody or antigen-binding fragment thereof with an N-terminal methionyl residue or the antibody or antigen-binding fragment thereof fused to a cytotoxic polypeptide. Other insertional variants of the antibody or antigenbinding fragment thereof include the fusion to the N- or C- terminus of the antibody or antigen-binding fragment thereof to an enzyme or a polypeptide which increases the serum half-life of the antibody or antigen-binding fragment thereof, such as, for example, biotin.
[0068] Any cysteine residue not involved in maintaining the proper conformation of the antibodies or antigen-binding fragments thereof that bind to HCMV also can be substituted, for example with a serine or an alanine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking.
[0069] Conversely, cysteine bond(s) can be added to the antibody or antigen-binding fragment thereof to improve its stability (particularly where the antibody or antigen-binding fragment thereof is an antibody fragment such as an Fv fragment).
[0070] In some embodiments, the antibodies or antigen-binding fragments thereof have amino acid alterations that alter the original glycosylation pattern of the antibody or antigenbinding fragment thereof. By “altering the original glycosylation patern” is meant deleting one or more carbohydrate moieties found in the antibody or antigen-binding fragment thereof, and / or adding one or more glycosylation sites that are not present in the antibody or antigenbinding fragment thereof. Glycosylation of antibodies is typically either N-linked or O-linked. N- linked refers to the atachment of the carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine and asparagine-X-threonine, wherein X is any amino acid except proline, are the recognition sequences for enzymatic atachment of the carbohydrate moiety to the asparagine side chain. Thus, the presence of either of these tripeptide sequences in a polypeptide creates a potential glycosylation site. O-linked glycosylation refers to the atachment of one of the sugars N-aceylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5- hydroxyproline or 5-hydroxylysine can also be used. Addition of glycosylation sites to the antibodies or antigen-binding fragments thereof that bind to HCMV is accomplished by altering the amino acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). The alteration can also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the original antibody or antigen-binding fragment thereof (for O-linked glycosylation sites).
[0071] In some embodiments, the anti -HCMV antibodies or antigen-binding fragments thereof provided herein are deglycosylated or aglycosylated.
[0072] Where the antibody or antigen-binding fragment thereof comprises an Fc region, the carbohydrate(s) attached thereto can be altered. For example, antibodies with a mature carbohydrate structure that lacks fucose atached to an Fc region of the antibody or antigenbinding fragment thereof have been described. See, e.g, U.S. Patent Pubs. No. 2003 / 0157108;No. 2004 / 0093621. Antibodies with a bisecting N-acetylglucosamine (GlcNAc) in the carbohydrate attached to an Fc region of the antibody or antigen-binding fragment thereof are referenced in WO 03 / 011878; U.S. PatentNo. 6,602,684. Antibodies with at least one galactose residue in the oligosaccharide attached to an Fc region of the antibody or antigen-binding fragment thereof are reported in WO 97 / 30087. See also WO 98 / 58964 and WO 99 / 22764 concerning antibodies with altered carbohydrate attached to the Fc region thereof.
[0073] According to certain embodiments, the contemplated antibodies and antigen-binding fragments thereof also feature humanized frameworks for reduced immunogenicity. In certain embodiments, the CDRs of the contemplated antibody or antigen-binding fragment thereof are located in frameworks obtained from a human antibody or antigen-binding fragment thereof. In other embodiments, surface-exposed framework residues of the contemplated antibody or antigen-binding fragment thereof are replaced with framework residues of a human antibody or antigen-binding fragment thereof. The CDRs may also be located in murine or humanized frameworks linked to human constant regions (z.e., chimeric antibodies).
[0074] Techniques for humanization of murine antibodies are known to one of ordinary skill in the art and are generally reviewed in Safdari et al., (2013) Biotechnol. Genet. Eng. Rev.. 29: 175-86, hereby incorporated by reference in its entirety. Humanization of antibodies generally comprises grafting of CDRs (such as the CDRs disclosed herein) or conservative substituted variants thereof into an appropriate human variable region framework, for example, as disclosed in Jones et al. (1986) Nature 321. 522-525. hereby incorporated by reference in its entirety. Common methods used include, but are not limited to, framework-homology-based humanization, germline humanization, complementary determining regions (CDR)-homology- based humanization and specificity determining residues (SDR) grafting. Proper orientation of the CDRs in the humanized antibody is typically necessary and can be determined by, for example, evaluating the crystal structure of the humanized antibody.
[0075] In one embodiment, the CDRs of a contemplated antibody or antigen-binding fragment thereof are located in frameworks that are a composite of two or more human antibodies. In such embodiments, the contemplated antibodies or antigen-binding fragments thereof comprise two or more sequence segments (“composites”) derived from V-regions of unrelated human antibodies that are selected to maintain monoclonal antibody sequences important for antigen-binding of the starting precursor anti-HCMV monoclonal antibody, and which have all been filtered for the presence of potential T cell epitopes using “in silico tools” (Holgate & Baker, IDrugs. 2009 Apr; 12(4):233-7). The close fit of human sequence segments with all sections of the starting antibody V regions and the elimination of CD4+T cellepitopes prior to synthesis of the antibody or antigen-binding fragment thereof allow this technology to circumvent immunogenicity while maintaining good affinity and specificity through the prior analysis of sequences necessary for antigen-specificity (Holgate & Baker, 2009).
[0076] Antibodies with improved binding to the neonatal Fc receptor (FcRn), and increased half-lives, are described in WO 00 / 42072 and U.S. Patent Pub. No. 2005 / 0014934. These antibodies comprise an Fc region with one or more substitutions therein which improve binding of the Fc region to HCMV. For example, the Fc region can have substitutions at one or more of positions 238, 250, 256, 265, 272, 286, 303, 305, 307, 311, 312, 314, 317, 340, 356, 360, 362, 376, 378. 380, 382, 413, 424, 428 or 434 (Eu numbering of residues). A Fc region comprising an antibody variant with improved FcRn binding may comprises amino acid substitutions at one, two or three of positions 307, 380 and 434 of the Fc region thereof (Eu numbering of residues). In one embodiment, the antibody or antigen-binding fragment thereof has 307 / 434 mutations.
[0077] Antibody Fragments and Types
[0078] In some embodiments of the aspects described herein, the anti-HCMV antibody fragment is a Fab fragment, which comprises or consists essentially of a variable (VL) and constant (CL) domain of the light chain and a variable domain (VH) and the first constant domain (Cnl) of the heavy chain.
[0079] In some embodiments of the aspects described herein, the anti-HCMV antibody fragment is a Fab' fragment, which refers to a Fab fragment having one or more cysteine residues at the C -terminus of the CH 1 domain.
[0080] In some embodiments of the aspects described herein, the anti-HCMV antibody fragment is an Fd fragment comprising or consisting essentially of VH and CHI domains.
[0081] In some embodiments of the aspects described herein, the anti-HCMV antibody portion is an Fd' fragment comprising VH and CHI domains and one or more cysteine residues at the C-terminus of the CHI domain.
[0082] Single-chain Fv or scFv antibody fragments comprise or consist essentially of the VH and VL domains of antibody, such that these domains are present in a single polypeptide chain. Generally, an Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, which allows the scFv to form the desired structure for antigen-binding. See, for example. Pluckthun. 113 Pharmacology’ Monoclonal Antibodies 269 (Rosenburg & Moore, eds., Springer-Verlag, New York, 1994). Accordingly, in some embodiments of the aspectsdescribed herein, the anti-HCMV antibody fragment is a Fv fragment comprising or consisting essentially of the VL and VH domains of a single arm of an antibody.
[0083] In some embodiments of the aspects described herein, the anti-HCMV antibody portion is a diabody comprising two antigen-binding sites, comprising a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain.
[0084] In some embodiments of the aspects described herein, the anti-HCMV antibody portion is a dAb fragment comprising or consisting essentially of a VH domain.
[0085] In some embodiments of the aspects described herein, the anti-HCMV antibody portion is a F(ab')2 fragment, which comprises a bivalent fragment comprising two Fab' fragments linked by a disulfide bridge at the hinge region.
[0086] Linear antibodies refer to the antibodies as described in Zapata et al. , Protein Engin. , 8(10): 1057-1062 (1995). Briefly, these antibodies comprise a pair of tandem Fd segments (VH- CH1-VH-CH1), which, together with complementary light chain polypeptides, form a pair of antigen-binding regions. Linear antibodies can be bispecific or monospecific. In some embodiments of the aspects described herein, the anti-HCMV antibody fragment is a linear antibody comprising a pair of tandem Fd segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen -binding regions.
[0087] Various techniques have been developed and are available for the production of antibody fragments. Traditionally, these fragments were derived via proteolytic digestion of intact antibodies. See. e.g., Morimoto et al.. 24 J. Biochem. Biophys. Meths. 107 (1992); Brennan et al., 229 Science 81 (1985). However, these fragments can now be produced directly by recombinant host cells. For example, antibody fragments can be isolated from the antibody phage libraries discussed herein. Alternatively, Fab'-SH fragments can be directly recovered from / ■ / coli and chemically coupled to form F(ab')2 fragments (Carter et al., 1992). According to another approach, F(ab')2 fragments can be isolated directly from recombinant host cell culture. Other techniques for the production of antibody fragments will be apparent to the skilled practitioner. In other embodiments, the antibody fragment of choice is a single chain Fv fragment (scFv). See, for example, WO 93 / 16185.
[0088] Contemplated antibodies or antigen-binding fragments may have all types of constant regions, including IgAl, IgA2, IgM, IgG, IgD, and IgE, and any isotype, including IgGl, IgG2, IgG3, and IgG4. In one embodiment, the human isotype IgGl is used. In one embodiment, the human isotype IgG2 is used. In another embodiment, the human isotype IgG4 is used. Light chain constant regions can be X or K. The antibody or antigen-binding fragment thereof may comprise sequences from more than one class or isotype.
[0089] Also disclosed herein are chimeric antigen receptor T-cells (CAR T-cells) that bind to HCMV, In one embodiment, one or more of the CDRs of an anti-HCMV antibody disclosed herein are grafted onto a chimeric antigen receptor (CAR) on a T-cell.
[0090] In some embodiments, the anti-HCMV antibody or antigen-binding fragment thereof is an isolated antibody or antigen-binding fragment thereof. The terms “purified’", or “isolated” antibody, peptide, polypeptide, or protein refers to a peptide, polypeptide, or protein, as used herein, may refer to a peptide, polypeptide, or protein that has been separated from other proteins, lipids, and nucleic acids with which it is naturally associated. The polypeptide / protein can constitute at least 10% (i.e., any percentage between 10% and 100%, e.g., 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 85%, 90%, 95%, and 99%) by dry weight of the purified preparation. Purity can be measured by any appropriate standard method, for example, by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis. An isolated polypeptide / protein (e.g, anti-HCMV antibodies) described in herein can be produced by recombinant DNA techniques.
[0091] Antibody binding
[0092] As used herein, “binding” of an antibody or antigen-binding fragment thereof to HCMV or an epitope on the surface of HCMV includes the selective interaction of the antibody or antigen-binding fragment thereof with HCMV. Binding therefore includes, e.g. , primary and secondary interactions including hydrogen bonds, ionic interactions, salt bridges, as well as hydrophilic and hydrophobic interactions.
[0093] As used herein, “affinity ”, represented by the equilibrium constant for the dissociation (KD) of an antigen with an antigen-binding protein, is a measure of the binding strength between an antigenic determinant and an antigen-binding site on the antigen-binding protein, such as an antibody or antibody fragment thereof. The smaller the value of the KD, the stronger the binding strength between an antigenic determinant and the antigen-binding molecule. Alternatively, the affinity can also be expressed as the affinity7constant (K ), which is 1 / KD). AS will be clear to the skilled person, affinity can be determined in a manner known per se, depending on the specific antigen of interest.
[0094] In certain embodiments, the anti-HCMV antibodies or antigen-binding fragments thereof described herein bind to HCMV with a KD of ICT5to ICT12mol / 1, 10'6to 10'12mol / 1, 10’7to IO’12mol / 1, 10’8to IO'12mol / 1, IO'9to 1 O'12mol / 1, IO’10to IO’12mol / 1, or 10’11to IO'12mol / 1. In other embodiments, the anti-HCMV antibodies or antigen-binding fragments thereof described herein bind to HCMV with a KD of 10'5to 10'11mol / L 10‘6to 10’11mol / L IO'7to 10"11mol / 1, IO'8to 10’11mol / 1, 10’9to 10'11mol / 1, or IO'10to 10’11mol / 1. In other embodiments, the anti-HCMV antibodies or antigen-binding fragments thereof described herein bind to HCMV with a KD of IO'5to 10‘10mol / 1, 10‘6to IO’10mol / 1, 10’7to IO'10mol / 1, 10'8to 10‘10mol / 1, or 10"9to 1 O'10mol / 1. In other embodiments, the anti-HCMV antibodies or antigen-binding fragments thereof described herein bind to HCMV with a KD of 10'5to 10'8mol / 1, 10'6to ICT8mol / 1, or IO’7to 10'8mol / 1.
[0095] Provided herein are antibodies and antigen-binding fragments thereof that bind specifically to HCMV.
[0096] The term “specificity” herein refers to the ability of an antibody or antigen-binding fragment thereof, such as an anti-HCMV antibody or antigen-binding fragment thereof, to recognize an HCMV epitope, while only having little or no detectable reactivity with other epitopes. Specificity' can be relatively determined by competition assays or by epitope identification / characterization techniques described herein or their equivalents known in the art.
[0097] As used herein, an “epitope” can be formed both from contiguous amino acids, or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5, about 9, or about 8-10 amino acids in a particular spatial conformation. An “epitope” includes the unit of structure conventionally bound by an immunoglobulin VH / VL pair. Epitopes define the minimum binding site for an antibody or antigen-binding fragment thereof and thus represent the target of specificity of an antibody or antigen-binding fragment thereof. In the case of a single domain antibody, an epitope represents the unit of structure bound by a variable domain in isolation.
[0098] Provided therein are anti-HCMV antibodies or antigen-binding portions thereof that are capable of binding to a number of different structures on the surface of HCMV, including glycoprotein gH and glycoprotein gL.
[0099] Provided herein are anti-HCMV antibodies or antigen-binding portions thereof that specifically bind to glycoprotein gH. Provided herein are anti-HCMV antibodies or antigenbinding portions thereof that specifically bind to glycoprotein gL. Provided herein are anti- HCMV antibodies or antigen-binding portions thereof that specifically bind to glycoprotein gL and to glycoprotein gH.
[0100] In one embodiment, the contemplated antibody or antigen-binding fragment specifically binds to the same epitope as antibody 1C10, 2D4, 4F9 and / or 8A5.
[0101] In one embodiment, the contemplated antibody or antigen-binding fragment specifically competes with antibody 1C10, 2D4, 4F9 and / or 8A5 for binding to HCMV.
[0102] In some embodiments, an antibody disclosed herein blocks binding of HCMV gL / gH to a cellular surface protein. In some embodiments, an antibody disclosed herein interrupts a fusion-triggering signal to gB.
[0103] As used herein, a ‘"blocking” antibody or an antibody "‘antagonist” is one that inhibits or reduces biological activity of the antigen to which it binds. Inhibition of activity and inhibition of binding includes partial inhibition. Methods for the identification of anti-HCMV antibodies o antigen-binding fragments thereof that block gH / gL interactions are described herein and are known to one skilled in the art. For instance, competing, cross-blocking, and cross-blocked antibodies can be identified using any suitable method known in the art, including competition ELIS As or BIACORE® assays where binding of the competing or crossblocking antibody to human HCMV prevents the binding of an antibody disclosed herein or vice versa.
[0104] Antibody Conjugates
[0105] In some embodiments of the aspects described herein, the antibody or antigenbinding fragment thereof that bind to HCMV are conjugated to a functional moiety7. Examples of useful functional moieties include, but are not limited to, a blocking moiety, a detectable moiety, a diagnostic moiety, a targeting, and a therapeutic moiety.
[0106] Illustrative blocking moieties include moieties of sufficient steric bulk and / or charge such that reduced glycosylation occurs, for example, by blocking the ability7of a glycosidase to glycosylate the antibody or antigen-binding fragment thereof. The blocking moiety may additionally or alternatively, reduce effector function, for example, by inhibiting the ability of the Fc region to bind a receptor or complement protein. Preferred blocking moieties include cysteine adducts and PEG moieties.
[0107] In a preferred embodiment, the blocking moiety7is a cysteine, preferably a cysteine that has associated with a free cysteine, e.g., during or subsequent to the translation of the Fc containing polypeptide, e.g.. in cell culture. Other blocking cysteine adducts include cystine, mixed disulfide adducts, or disulfide linkages.
[0108] In another preferred embodiment, the blocking moiety is a poly alkylene glycol moiety, for example, a PEG moiety and preferably a PEG-maleimide moiety. Preferred pegylation moieties (or related polymers) can be. for example, polyethylene glycol (“PEG”), polypropylene glycol (“PPG”), polyoxyethylated glycerol (“POG”) and otherpolyoxyethylated polyols, polyvinyl alcohol (“PVA”) and other polyalkylene oxides, polyoxyethylated sorbitol, or poly oxy ethylated glucose. The polymer can be a homopolymer, a random or block copolymer, a terpolymer based on the monomers listed above, straight chain or branched, substituted or unsubstituted as long as it has at least one active sulfone moiety. The polymeric portion can be of any length or molecular weight, but these characteristics can affect the biological properties. Polymer average molecular weights particularly useful for decreasing clearance rates in pharmaceutical applications are in the range of 2,000 to 35.000 Daltons. In addition, if two groups are linked to the polymer, one at each end, the length of the polymer can impact upon the effective distance, and other spatial relationships, between the two groups. Thus, one skilled in the art can vary the length of the polymer to optimize or confer the desired biological activity. PEG is useful in biological applications for several reasons. PEG ty pically is clear, colorless, odorless, soluble in water, stable to heat, inert to many chemical agents, does not hydrolyze, and is nontoxic. Pegylation can improve pharmacokinetic performance of a molecule by increasing the molecule's apparent molecular weight. The increased apparent molecular weight reduces the rate of clearance from the body following subcutaneous or systemic administration. In many cases, pegylation can decrease antigenicity and immunogenicity. In addition, pegylation can increase the solubility of a biologically active molecule.
[0109] Examples of detectable moieties which are useful in the methods and antibodies and antigen-binding fragments thereof contemplated herein include fluorescent moieties or labels, imaging agents, radioisotopic moieties, radiopaque moieties, and the like, e.g. , detectable labels such as biotin, fluorophores, chromophores, spin resonance probes, or radiolabels. Illustrative fluorophores include fluorescent dyes (e.g. fluorescein, rhodamine, and the like) and other luminescent molecules (e.g. luminal). A fluorophore may be environmentally-sensitive such that its fluorescence changes if it is located close to one or more residues in the modified protein that undergo structural changes upon binding a substrate (e.g., dansyl probes). Illustrative radiolabels include small molecules containing atoms with one or more low sensitivity' nuclei (13C,15N,2H.125I,123I, "TC,43K.52Fe,67Ga,68Ga,niIn and the like). Other useful moieties are known in the art.
[0110] Examples of diagnostic moieties which are useful in the methods and antibodies and antigen-binding fragments thereof contemplated herein include detectable moieties suitable for revealing the presence of a disease or disorder. Typically, a diagnostic moiety allows for determining the presence, absence, or level of a molecule, for example, a target peptide,protein, or proteins, which is associated with a disease or disorder. Such diagnostics are also suitable for prognosing and / or diagnosing a disease or disorder and its progression.
[0111] Examples of therapeutic moieties which are useful in the methods and antibodies and antigen-binding fragments thereof contemplated herein include, for example, anti-viral agents. The functional moiety7may also have one or more of the above-mentioned functions.
[0112] Other types of functional moieties are known in the art and can be readily used in the methods and compositions of disclosed herein based on the teachings contained herein.
[0113] Nucleic Acids
[0114] Also provided herein are nucleic acids encoding the anti-HCMV antibodies and antigen-binding fragments thereof disclosed herein, as well as vectors, host cells, and expression systems.
[0115] The term “nucleic acid’’ as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or desoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double- or multi- stranded DNA or RNA, genomic DNA, cDNA. DNA- RNA hybrids, or a polymer comprising purine and pynmidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
[0116] The nucleic acids encoding anti-HCMV antibodies and antigen-binding fragments thereof may be. e.g, DNA, cDNA, RNA, synthetically produced DNA or RNA, or a recombinantly produced chimeric nucleic acid molecule comprising any of those polynucleotides either alone or in combination. For example, provided is an expression vector comprising a polynucleotide sequence encoding an anti-HCMV antibody or antigen-binding fragment thereof described herein operably linked to expression control sequences suitable for expression in a eukaryotic and / or prokaryotic host cell.
[0117] The term “vector” refers to a vehicle capable of transporting another nucleic acid to which it has been linked. A “vector” includes, but is not limited to, a viral vector, a plasmid, an RNA vector or a linear or circular DNA or RNA molecule which may consist of a chromosomal, non-chromosomal, semi-synthetic or synthetic nucleic acid. The vector can be a nucleic acid and or viral particle. In some embodiments, the employed vectors are those capable of autonomous replication (episomal vector) and / or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available. Viral vectors include retrovirus, adenovirus, parvovirus (e.g., adeno associated viruses, AAV), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e. g., rabies andvesicular stomatitis virus), paramyxovirus (e.g., measles and Sendai), positive strand RNA viruses such as picomavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Ban virus, cytomegalovirus), and poxvirus (e.g, vaccinia, fowlpox and canary pox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of retroviruses include avian leukosis-sarcoma, mammalian C- type. B-type viruses. D type viruses. HTLV-BLV group, lentivirus. and spumavirus.
[0118] A vector may comprise a nucleic acid comprising a marker or reporter gene, such as a gene for example encoding an antibiotic resistance gene, a fluorescent protein (e.g, GFP) or a gene encoding a chemically, enzy matically or otherwise detectable and / or selectable product (e.g, lacZ, alkaline phosphatase (AP). SEAP, Luc, Neo, Bia, etc.) known in the art.
[0119] Polynucleotides, including plasmids, YACs, minichromosomes and minicircles, carrying a target gene containing the expression cassette can also be introduced into a cell or organism by nonviral vector systems using, for example, cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems can also be used to deliver the vector to cells. Other methods for delivering the vector to cells include hydrodynamic injection and electroporation and use of ultrasound, both for cell culture and for organisms. For a review of viral and non-viral delivery' systems for gene delivery see Nayerossadat et al., Viral and nonviral delivery systems for gene delivery, Adv Biomed Res. 2012; 1 :27, incorporated herein by reference. Non-viral delivery systems include using a colloidal dispersion system such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
[0120] A variety of expression vectors have been developed for the efficient synthesis of antibodies and antigen-binding fragments thereof in prokaryotic cells such as bacteria and in eukaryotic systems, including but not limited to yeast and mammalian cell culture systems have been developed. The vectors can comprise segments of chromosomal, non-chromosomal and synthetic DNA sequences.
[0121] Also provided are cells comprising expression vectors for the expression of the contemplated anti-HCMV antibodies or antigen-binding fragments thereof.
[0122] In one aspect, provided is a nucleic acid encoding an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein. The sequences encoding the heavy chain variable region and the light chain variable region of an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein may be located on the same nucleic acid molecules or on different nucleic acid molecules.
[0123] In one embodiment, provided is a nucleic acid encoding the heavy chain variable region of an HCMV antibody or antigen-binding fragment thereof disclosed herein. In one embodiment, provided is a nucleic acid encoding the light chain variable region of an anti- HCMV antibody or antigen-binding fragment thereof disclosed herein.
[0124] In one embodiment, provided is a vector or set of vectors comprising a sequence encoding the heavy chain variable region of an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein and the light chain variable region of an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein. In one embodiment, the heavy chain variable region is encoded by a first vector and the light chain variable region is encoded by a second vector.
[0125] Provided herein are nucleic acids encoding the antibodies in any one of Tables 1-6 or any of the antibodies disclosed herein. Provided herein are nucleic acids comprising any of the nucleic acids in Table 7 or Table 8, or variants of such nucleic acids.Table 7. Nucleic acid sequence information for selected antibodies (VH chains).Table 8. Nucleic acid sequence information for selected antibodies (VK chains).
[0126] The nucleic acid sequences may have conservative substitutions and / or may be codon optimized.
[0127] As used herein, codon optimization refers to an in vitro mutagenesis of a nucleic acid to increase or maximize expression of a gene (e.g. a trans gene relative to the unmodified nucleic acid, without changing (or with minimal change) to the amino acid sequence of the synthesized protein, i.e. synonymous mutations. Codon optimization can affect protein expression rates up to 1,000 x fold, particularly by favoring efficient soluble protein expression. The codons changed are typically ones not generally used by the host cell translation system. Codon bias / codon usage frequency depends on the host organism, and is described, for example, in US patent 8,326,547, hereby incorporated by reference in its entirety.
[0128] Antibody Preparation and Expression Systems
[0129] The antibodies or antigen-binding fragments thereof disclosed herein are typically produced by recombinant expression. Nucleic acids encoding light and heavy chain variableregions, optionally linked to constant regions, are inserted into expression vectors. The light and heavy chains can be cloned in the same or different expression vectors. The DNA segments encoding immunoglobulin chains are operably linked to control sequences in the expression vector(s) that ensure the expression of immunoglobulin polypeptides. Expression control sequences include, but are not limited to, promoters (e.g., naturally associated or heterologous promoters), signal sequences, enhancer elements, and transcription termination sequences. Preferably, the expression control sequences are eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells. Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and the collection and purification of the crossreacting antibodies.
[0130] These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors contain selection markers (e.g., ampicillin-resistance, hygromycin-resistance, tetracycline resistance or neomycin resistance) to permit detection of those cells transformed with the desired DNA sequences (see, e.g.. Itakura et al.. U.S. Pat. No. 4,704,362).
[0131] The expression of the antibodies and antigen-binding fragments contemplated herein can occur in either prokaryotic or eukaryotic cells. Suitable hosts include bacterial or eukaryotic hosts, including yeast, insects, fungi, bird, and mammalian cells either in vivo, or in situ, or host cells of mammalian, insect, bird or yeast origin. The mammalian cell or tissue can be of human, primate, hamster, rabbit, rodent, cow, pig, sheep, horse, goat, dog or cat origin, but any other mammalian cell may be used.
[0132] E. coli is one prokaryotic host particularly useful for cloning the polynucleotides (e.g, DNA sequences). Other microbial hosts suitable for use include bacilli, such as Bacillus subtHus. and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species.
[0133] Other microbes, such as yeast, are also useful for expression. Saccharomyces and Pichia are illustrative yeast hosts, with suitable vectors having expression control sequences (e.g.. promoters), an origin of replication, termination sequences and the like as desired. Typical promoters include 3 -phosphoglycerate kinase and other glycolytic enzy mes. Inducible yeast promoters include, among others, promoters from alcohol dehydrogenase, isocytochrome C, and enzy mes responsible for methanol, maltose, and galactose utilization.
[0134] Further, by use of. for example, the yeast ubiquitin hydrolase system, in vivo synthesis of ubiquitin-transmembrane polypeptide fusion proteins can be accomplished. Thefusion proteins so produced can be processed in vivo or purified and processed in vitro, allowing synthesis of an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein with a specified amino terminus sequence. Moreover, problems associated with retention of initiation codon-derived methionine residues in direct yeast (or bacterial) expression maybe avoided. Sabin et al., 7 Bio / Technol. 705 (1989); Miller et al., 7 Bio / Technol. 698 (1989).
[0135] Any of a series of yeast gene expression systems incorporating promoter and termination elements from the actively expressed genes coding for glycolytic enzymes produced in large quantities when yeast is grown in mediums rich in glucose can be utilized to obtain recombinant anti-HCMV antibodies or antigen-binding fragments disclosed herein. Known glycolytic genes can also provide very efficient transcriptional control signals. For example, the promoter and terminator signals of the phosphoglycerate kinase gene can be utilized.
[0136] Production of anti-HCMV antibodies or antigen-binding fragments thereof in insects can be achieved. For example, by infecting the insect host with a baculovirus engineered to express a transmembrane polypeptide by methods known to those of skill. See Ausubel et al.. 1987, 1993.
[0137] In addition to microorganisms, mammalian tissue culture may also be used to express and produce the antibodies or antigen-binding fragments thereof disclosed herein (e.g., polynucleotides encoding immunoglobulins or fragments thereof). See Winnacker, From Genes to Clones, VCH Publishers, N.Y., N.Y. ( 1987). Eukaryotic cells are actually preferred, because a number of suitable host cell lines capable of secreting heterologous proteins (e.g, intact immunoglobulins) have been developed in the art, and include CHO cell lines, various COS cell lines, HeLa cells, 293 cells, myeloma cell lines, transformed B-cells. and hybridomas. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, and an enhancer (Queen et al., Immunol. Rev. 89:49 (1986)), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences. Preferred expression control sequences are promoters derived from immunoglobulin genes, SV40. adenovirus, bovine papilloma virus, cytomegalovirus and the like. See Co et al., J. Immunol. 148: 1149 (1992).
[0138] Alternatively, nucleotide sequences encoding antibodies or antigen-binding fragments thereof can be incorporated in transgenes for introduction into the genome of a transgenic animal and subsequent expression in the milk of the transgenic animal (see, e.g., Deboer et al., U.S. Pat. No. 5,741,957, Rosen, U.S. Pat. No. 5,304,489, and Meade et al., U.S.Pat. No. 5,849,992). Suitable transgenes include coding sequences for light and / or heavy chains in operable linkage with a promoter and enhancer from a mammary gland specific gene, such as casein or beta lactoglobulin.
[0139] Additionally, plants have emerged as a convenient, safe and economical alternative main-stream expression systems for recombinant antibody production, which are based on large scale culture of microbes or animal cells. Antibodies or antigen-binding fragments thereof can be expressed in plant cell culture, or plants grown conventionally. The expression in plants may be systemic, limited to sub-cellular plastids, or limited to seeds (endosperms). See, e.g., U.S. Patent Pub. No. 2003 / 0167531; U.S. Patent Nos. 6,080,560 and 6,512,162; and WO 0129242. Several plant-derived antibodies have reached advanced stages of development, including clinical trials (see, e.g., Biolex, NC).
[0140] The vectors containing the polynucleotide sequences of interest (e.g, the heavy and light chain encoding sequences and expression control sequences) can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment, electroporation, lipofection. biohstics or viral-based transfection may be used for other cellular hosts. (See generally Sambrook et al., Molecular Cloning: A Laboratory' Manual (Cold Spring Harbor Press, 2nd ed., 1989). Other methods used to transform mammalian cells include the use of polybrene, protoplast fusion, liposomes, electroporation, and microinjection (see generally, Sambrook et al., supra). For production of transgenic animals, transgenes can be microinjected into fertilized oocytes or can be incorporated into the genome of embryonic stem cells, and the nuclei of such cells transferred into enucleated oocytes.
[0141] The antibodies and antigen-binding fragments thereof disclosed herein can be expressed using a single vector or two vectors. When the antibody heavy' and light chains are cloned on separate expression vectors, the vectors can be co-transfected to obtain expression and assembly of intact immunoglobulins. Once expressed, the whole antibodies, their dimers, individual light and heavy’ chains, or other immunoglobulin forms disclosed herein can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, HPLC purification, gel electrophoresis and the like (see generally Scopes, Protein Purification (Springer-Verlag, N.Y., (1982)). Substantially pure immunoglobulins of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity most preferred, for pharmaceutical uses.
[0142] Provided herein is a method of making an antibody or antigen-binding fragment thereof that binds to HCMV, the method comprising: (i) providing a cell comprising one or more nucleic acid molecules encoding an anti-HCMV antibody or antigen-binding fragment disclosed herein; (ii) expressing in the cell the anti-HCMV antibody or antigen-binding fragment thereof; and (iii) collecting the anti-HCMV antibody or antigen-binding fragment thereof.
[0143] In some embodiments, the anti-HCMV antibody or antigen-binding fragment thereof is further purified.
[0144] Kits and Methods of Use
[0145] Provided herein are kits for detecting HCMV present in a sample. These kits may comprise an anti-HCMV antibody or antigen-binding portion thereof disclosed herein and various reagents, for example, reagents that aid in detection of binding between the anti-HCMV antibody and an epitope present on HCMV or an antigenic fragment thereof.
[0146] The term “biological sample’" as used herein may refer to a sample obtained from an organism (e.g.. patient) or from components (e.g, cells) of an organism. The sample may be of any biological tissue, cell(s) or fluid. The sample may be a “clinical sample” which is a sample derived from a subject, such as a human patient. Such samples include, but are not limited to, saliva, sputum, blood, blood cells (e.g., white cells), bodily fluids, lavages, pancreatic juices, gastric juices, discharges. CSF. lymph amniotic fluid, plasma, semen, bone marrow, and tissue or fine needle biopsy samples, urine, stool, peritoneal fluid, and pleural fluid, or cells therefrom, and any combinations thereof. Biological samples may also include sections of tissues such as frozen sections taken for histological purposes. A biological sample may also be referred to as a “patient sample.” A biological sample may also include a substantially purified or isolated protein, membrane preparation, or cell culture. In one embodiment, the sample is an environmental sample. The sample can be, for example, be from, water, soil, biological materials, or waste (liquid, solid, or sludge).
[0147] The kits may be used in vitro assays, such as immunoassays, e.g. enzyme immune assays (EIA), enzyme linked immunosorbent assay (ELISA). ELISPOT (enzyme-linked immunospot), radioimmunoassays (RIAs), immunofluorescence, and other assays known in the art, including but not limited to Western Blot analysis and / or immunoprecipitation methods. The in vitro assays may be competitive, or indirect, such as in a sandwich assay, or may be an antibody capture method.
[0148] An illustrative, but non-limiting, direct ELISA protocol for detecting HCMV present in a sample is provided. For example, a buffered solution of an antigen, e.g, a sample containing HCMV or an antigenic fragment thereof (e.g. a biological sample containing or suspected of containing HCMV) is added to a well of a microtiter plate, e.g. a 96-well plate. A solution of non-reacting protein, e.g. bovine serum albumin or casein is then added to the well. The anti-HCMV antibody or antigen-binding portions thereof conjugated to a reporter molecule enzyme is added, e.g. conjugated to horse-radish peroxidase, although that is not necessarily the enzyme, as other common enzymes include alkaline phosphatase, or |3-D- galactosidase, although other enzymes are conceivable and considered embodied by the present disclosure. A substrate for the enzyme is then added, which leads to a detectable signal. For example, adding TMB to horseradish peroxidase leads to a colored product, in which case the ELISA is a colorimetric assay. ELISAs may be run in a qualitative or quantitative format. Qualitative results provide a simple positive or negative result (yes or no) for a sample. The cutoff between positive and negative is determined by the analyst and may be statistical.
[0149] An illustrative, but non-limiting, sandwich ELISA protocol for detecting HCMV present in a sample is provided. The capture anti-HCMV antibody or antigen-binding portions thereof is bound to (i.e. “immobilized”) on a substrate, e.g. a mictotiter plate. Antigencontaining sample (i.e. sample containing HCMV or an antigenic fragment thereof, is then added to the substrate at which point it is captured by the anti-HCMV antibodies. The substrate is then washed to remove unbound antigen. A second anti-HCMV antibody or antigen-binding portions thereof is added, that binds to a different epitope on HCMV. The second anti-HCMV antibody or antigen-binding portions thereof is bound to a reporter molecule, e.g., an enzyme, although the reporter molecule may be any molecule which leads to a detectable signal. The plate may be washed a second time, and in those instances where the reporter molecule is an enzyme, a substrate may be added, e.g., TMB, that results in a detectable signal (also a colorimetric assay).
[0150] A third type of common ELISA is competitive ELISA, n illustrative, but nonlimiting, competitive ELISA protocol for detecting HCMV present in a sample is provided. In these embodiments, unlabeled anti-HCMV antibody or antigen-binding portions thereof is incubated in the presence of an antigen-containing sample (i.e. sample containing HCMV or an antigenic fragment thereof), which are then added to an antigen-coated well. The plate is washed to remove unbound antibodies. A secondary antibody is added that is specific to the primary antibody, e.g., a secondary’ antibody specific to anti-HCMV antibodies. The secondary antibody is bound to a reporter molecule, as described herein, such as an enzyme (or any othermolecule that may lead to a detectable signal). Some competitive ELISA utilize labeled antigens rather than labeled antibodies; the less antigen in the sample, the more labeled antigen is retained and the stronger a detectable signal results.
[0151] Other forms of common in vitro assays include radioimmunoassays (RIAs). Typically , a know n quantity of an antigen is linked to a radioactive tracer, e.g. 1-125 although others are suitable for use, which is then mixed with a known amount of antibody specific for the antigen, e.g.. anti-HCMV antibodies or antigen-binding portions thereof. Then, a sample containing unknown quantity of an antigen is added, (e.g, a biological sample that contains or is suspected of containing HCMV or an antigenic fragment thereof) is added. This is a direct competitive for specific binding; as the concentration of unlabeled antigen is increased, the binding between the anti-HCMV antibodies and the labeled standard is decreased, which is directly measurable by measuring radioactivity. Other assays are known and a person of ordinary skill in the art would readily recognize their applicability.
[0152] In some embodiments, provide is a method of detecting HCMV or an antigenic fragment thereof in a sample. Such methods may utilize any of the assays described herein, or others that are known in the art. Several of the assays described herein are capable of quantifying the amount of antigen present in a sample, and so accordingly, in some embodiments, the present disclosure is directed to methods of quantifying the amount of HCMV or antigenic fragments thereof present in a sample, e.g., a biological sample.
[0153] The assays containing anti-HCMV antibodies or antigen-binding portions thereof of the present disclosure may or may not be utilized for diagnostic purposes. Accordingly, in some embodiments, provided are methods of diagnostic use of the anti-HCMV antibodies or antigenbinding portions thereof of the present disclosure. Because of the specificity of the anti-HCMV antibodies or antigen-binding portions thereof of the present disclosure, immunoassays containing anti-HCMV antibodies or antigen-binding portions thereof of the present disclosure may be sufficient to diagnose an individual as having an active or latent infection of HCMV. The antibodies or antigen-binding portions thereof need not be restricted to any particular epitopes, so long as the antibodies or antigen-binding portions thereof used are specific to HCMV. For example, in a sandwich assay, the first anti-HCMV antibody or antigen-binding portions thereof may bind to a first epitope, such as a gH or gL glycoprotein, and the second anti-HCMV antibody or antigen-binding portions thereof (which is bound to a reporter molecule) may bind to a second epitope: for example, but not necessarily, if the first anti- HCMV antibody or antigen-binding portions thereof specifically binds to the glycoprotein gH, the second may bind to glycoprotein gL, and the reverse is true as well. In some embodiments,the first antibody or antigen-binding portions thereof and second antibody or antigen-binding portions thereof may bind to the same antigen / gly coprotein, e.g. both may bind to glycoprotein gH and / or gL, or in some embodiments may bind to completely different antigens on surface of HCMV viral envelope.
[0154] Because of the distance between binding sites, these antibodies or antigen-binding portions thereof may be suitable for use in those immunoassays, e.g.. sandwich assays, in which multiple binding sites on the same target (e.g., HCMV or an antigenic fragment thereof) are necessary. Or, in some embodiments, one may target a totally different antigen, e.g.. the first anti-HCMV antibody or antigen-binding portions thereof targets an epitope on glycoprotein gH and / or gL and the second anti-HCMV antibody targets an epitope elsewhere, for example but not necessarily glycoprotein gB, gO, UL128, UL130, and / or UL131a and the antigenic fragments thereof of the corresponding antigens.
[0155] Methods for Modulating gH / gL Activity
[0156] In one aspect, provided are methods of using the antibodies and antigen-binding fragments thereof described herein for decreasing the interaction between gH / gL and cellular surface proteins. Such cellular surface proteins may include, but are not limited to, Nectin 1, EphA2, Nrp2, PDGFRalpha.
[0157] Methods of Treatment
[0158] In one aspect, provided are anti-HCMV antibodies and antigen-binding fragments thereof that are also useful for the treatment of subjects in need thereof or for the prevention of disease.
[0159] By "‘subject” is meant a mammal, including, but not limited to, a human or nonhuman mammal, such as a bovine, equine, canine, ovine, or feline, etc. Individuals and patients are also subjects herein.
[0160] In some embodiments, the subject has received an organ transplant. In some embodiments, the subject is immune compromised.
[0161] The terms “treat.” “treated,” “treating,” or “treatment” as used herein refer to therapeutic treatment, wherein the object is to slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (z.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of thecondition, disorder or disease; amelioration of the condition, disorder or disease state; and remission (whether partial or total) or enhancement or improvement of the condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
[0162] The terms “prevent”, “prevention”, and the like refer to acting prior to overt disease or disorder onset, to prevent the disease or disorder from developing or to minimize the extent of the disease or disorder or slow its course of development.
[0163] Provided is a method of treating an HCMV infection in a subject in need thereof, the method comprising administering to the subject an antibody or antigen-binding fragment thereof disclosed herein. In some embodiments, the method further comprises administering to the individual at least one additional anti-HCMV antibody or antigen-binding portion thereof. In some embodiments the at least one additional anti-HCMV antibody or antigen-binding portion thereof is an antibody or antigen-binding fragment thereof of disclosed herein.
[0164] Provided is an anti-HCMV antibody or antigen-binding portion thereof disclosed herein for use in treating an HCMV infection in a subject in need thereof. Provided is a set of anti-HCMV antibodies or antigen-binding portions thereof disclosed herein for use in treating an HCMV infection in a subject in need thereof.
[0165] Provided is an anti-HCMV antibody or antigen-binding portion thereof disclosed herein for the manufacture of a medicament for treating an HCMV infection in a subject in need thereof. Provided is a set of anti-HCMV antibodies or antigen-binding portions thereof disclosed herein for the manufacture of a medicament for treating an HCMV infection in a subject in need thereof.
[0166] Provided is an anti-HCMV antibody or antigen-binding portion thereof disclosed herein for use as a medicament. Provided is a set of anti-HCMV antibodies or antigen-binding portions thereof disclosed herein for use as a medicament.
[0167] Provided is a method of treating an HCMV infection in a subject in need thereof, the method comprising administering to the subj ect a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof disclosed herein. In some embodiments, the method further comprises administering to the individual at least one additional pharmaceutical composition comprising an anti-HCMV antibody or antigen-binding portion thereof. In some embodiments the at least one additional anti-HCMV antibody or antigen-binding portion thereof is an antibody or antigen-binding fragment thereof of disclosed herein.
[0168] Provided is a pharmaceutical composition comprising an anti-HCMV antibody or antigen-binding portion thereof disclosed herein for use in treating an HCMV infection in a subject in need thereof. Provided is a pharmaceutical composition comprising a set of anti- HCMV antibodies or antigen-binding portions thereof disclosed herein for use in treating an HCMV infection in a subject in need thereof.
[0169] Provided is a pharmaceutical composition comprising an anti-HCMV antibody or antigen-binding portion thereof disclosed herein for the manufacture of a medicament for treating an HCMV infection in a subject in need thereof. Provided is a pharmaceutical composition comprising a set of anti-HCMV antibodies or antigen-binding portions thereof disclosed herein for the manufacture of a medicament for treating an HCMV infection in a subject in need thereof.
[0170] Provided is a pharmaceutical composition comprising an anti-HCMV antibody or antigen-binding portion thereof disclosed herein for use as a medicament. Provided is a pharmaceutical composition comprising a set of anti-HCMV antibodies or antigen-binding portions thereof disclosed herein for use as a medicament.
[0171] Provided herein are methods in which a therapeutically effective amount of an antibody or antigen-binding portions thereof set forth herein is administered to a mammal in need thereof. Although antibodies or antigen-binding portions thereof set forth herein are particularly useful for administration to humans, they may be administered to other mammals as well. The term “mammal” as used herein is intended to include, but is not limited to, humans, laboratory animals, domestic pets and farm animals. “Therapeutically effective amount” means an amount of antibody or antigen-binding portions thereof set forth herein that, when administered to a mammal, is effective in producing the desired therapeutic effect.
[0172] Provided is a method of reducing spread of HCMV in a subject in need thereof, the method comprising administering to the subject an anti-HCMV antibody or antigen-binding fragment disclosed herein.
[0173] Provided is a method of reducing spread of HCMV in a subject in need thereof, the method comprising administering to the subject an anti-HCMV antibody or antigen-binding fragment disclosed herein.
[0174] Provided is a method of reducing proliferation of HCMV in a subject in need thereof, the method comprising administering to the subject an anti-HCMV antibody or antigen-binding fragment disclosed herein.
[0175] Provided is a method of infection of a cell with HCMV, the method comprising contacting the cell with an anti-HCMV antibody or antigen-binding fragment disclosed herein. The cell may be a trophoblast, a monocyte, a fibroblast, or an endothelial cell.
[0176] In one embodiment, the HCMV is a drug-resistant HCMV strain. In one embodiment, the HCMV is a ganciclovir-resistant HCMV strain.
[0177] In one embodiment, an anti-HCMV antibody or antigen-binding portion thereof disclosed herein is used as part of a combination therapy.
[0178] ‘’Combination” therapy, as used herein, unless otherwise clear from the context, is meant to encompass administration of two or more therapeutic agents in a coordinated fashion, and includes, but is not limited to, concurrent dosing. Specifically, combination therapy encompasses both co-administration (e. .. administration of a co-formulation or simultaneous administration of separate therapeutic compositions) and serial or sequential administration, provided that administration of one therapeutic agent is conditioned in some way on administration of another therapeutic agent. For example, one therapeutic agent may be administered only after a different therapeutic agent has been administered and allowed to act for a prescribed period of time.
[0179] Combination-based therapeutics that target discrete stages of the viral life cycle can provide tolerable, broadly acting treatments for HCMV that retain efficacy over long-term administration. Combination therapies can be effective in preventing the emergence of viral resistance mutations that might abrogate a monotherapy's efficacy, mitigate toxicity effects associated with administration of the higher drug doses necessary for monotherapeutics, and can target diverse variants of HCMV. These are especially pertinent points to consider with regards to the HCMV antiviral ganciclovir, which remains the most prescribed treatment for HCMV. Despite ganciclovir's efficacy, it can induce significant hematological and neurological toxic effects and give rise to drug-resistant HCMV strains in response to longterm treatment. Thus, a combinatorial therapeutic pairing of, for example, ganciclovir with an anti-HCMV antibody or antigen-binding portion thereof disclosed herein can provide an effective treatment while mitigating the negative side effects associated with ganciclovir monotherapy.
[0180] In some embodiments, the broadly neutralizing mAbs and the second anti-viral agent inhibit HCMV infection and spread synergistically.
[0181] In some embodiments, the anti-HCMV antibodies or antigen-binding portions thereof of the present disclosure may be co-administered with one or more additional treatments for HCMV, e.g.. co-administered with one or more antivirals and / or additional anti-HCMV antibodies or antigen-binding portions thereof, including but not limited to additional anti-HCMV antibodies or antigen-binding portions thereof disclosed herein. The most common antiviral treatment for HCMV is ganciclovir, and accordingly in one embodiment the anti- HCMV antibodies or antigen-binding portions thereof of the present disclosure may be coadministered with ganciclovir. Other antivirals that would be acceptable include valganciclovir, forscamet, and cidofovir, either in combination or alone, including in combination with ganciclovir. Additionally, co-administration may or may not be with additional anti-HCMV antibodies or antigen-binding portions thereof. The anti-HCMV antibodies or antigen-binding portions thereof of the present disclosure may be administered with a variety of additional existing antibodies, such as CytoGam®.
[0182] In some embodiment, one or more anti-HCMV antibodies or antigen-binding portions thereof disclosed herein are co-administered with an anti-gB mAb. In some embodiments, one or more anti-HCMV antibodies or antigen-binding portions thereof disclosed herein are co-administered with an anti-gH mAb.
[0183] In embodiments, provided is a method of treatment comprising administering to a subject two anti-viral agents that target HCMV at different stages of the viral life cycle.
[0184] In some embodiments, provided is a method of treating an HCMV infection in a subject in need thereof comprising, the method comprising administering to the subject (i) an antibody or antigen-binding fragment thereof disclosed herein and (ii) at least one additional antiviral composition. In some embodiments, the at least one additional antiviral composition is selected from the group consisting of ganciclovir, valganciclovir, foscamet, cidofovir, and combinations thereof.
[0185] The antibody or antigen-binding fragment thereof disclosed herein and the second antiviral composition (which can, for example, be a second anti-HCMV antibody or antigenbinding fragment thereof), can be administered consecutively or concurrently. The antibody or antigen-binding fragment thereof disclosed herein, and the second antiviral composition do not need to be present in the same packaging or composition.
[0186] In one aspect, provided is a method of preventing an HCMV infection in a subject comprising administering to the subject the antibody or antigen-binding fragment thereof disclosed herein.
[0187] Provided is an anti-HCMV antibody or antigen-binding portion thereof disclosed herein for use in preventing an HCMV infection in a subject in need thereof. Provided is a set of anti-HCMV antibodies or antigen-binding portions thereof disclosed herein for use in preventing an HCMV infection in a subject in need thereof.
[0188] Provided is an anti-HCMV antibody or antigen-binding portion thereof disclosed herein for the manufacture of a medicament for preventing an HCMV infection in a subject in need thereof. Provided is a set of anti-HCMV antibodies or antigen-binding portions thereof disclosed herein for the manufacture of a medicament for preventing an HCMV infection in a subject in need thereof.
[0189] Provided herein is a method of diagnosing a subject as having an HCMV infection comprising:(i) identifying a subject;(ii) obtaining from the subject a biological sample containing HCMV or an antigenic fragment thereof:(iii) contacting the sample with the antibody or antigen-binding fragment thereof disclosed herein;(iv) detecting the presence of specific binding of the antibody or antigen-binding fragment thereof to HCMV, or an antigenic fragment thereof; and(v) diagnosing the subject as having an HCMV infection.
[0190] Also provided are kits for use in a method of treating comprising an anti-HCMV antibody or antigen-binding fragment thereof disclosed herein. Kits can include a suitable container, for example, vials, tubes, mini- or microfuge tubes, test tube, flask, bottle, syringe, or other containers. The disclosed kits can optionally include pharmaceutically acceptable carriers and / or diluents. In one embodiment, a kit includes one or more other components, adjuncts, or adjuvants as described herein. In one embodiment, a kit includes instructions or packaging materials that describe how to administer a compound or composition of the kit. Containers of the kit can be of any suitable material, e.g., glass, plastic, metal, etc., and of any suitable size, shape, or configuration. Where an additional component or agent is provided, the kit can contain one or more additional containers into which this agent or component may be placed. The kit may include instructions.
[0191] Kits herein will also typically include a means for containing an anti-HCMV antibody or antigen-binding fragment thereof disclosed and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.
[0192] It is contemplated that the disclosed kits can be used in connection with the disclosed methods of making, the disclosed methods of using, and / or the disclosed compositions.
[0193] Pharmaceutical Compositions
[0194] In another aspect, provided herein are pharmaceutically acceptable compositions that comprise an anti-HCMV antibody or antigen-binding fragment thereof described herein formulated together with one or more pharmaceutically acceptable excipients.
[0195] The active agent and excipient(s) may be formulated into compositions and dosage forms according to methods known in the art. The pharmaceutical compositions disclosed herein may be specially formulated in solid or liquid form, including those adapted for parenteral administration, for example, by subcutaneous, intratumoral. intramuscular or intravenous injection as, for example, a sterile solution or suspension.
[0196] Therapeutic compositions comprising antibodies or antigen-binding fragments thereof that bind to HCMV may formulated with one or more pharmaceutically-acceptable excipients, which can be a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, carrier, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), solvent or encapsulating material, involved in carrying or transporting the therapeutic compound for administration to the subject, bulking agent, salt, surfactant and / or a preservative. Some examples of materials which can serve as pharmaceutically-acceptable excipients include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as ethylene glycol and propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents; water; isotonic saline; pH buffered solutions; and other non-toxic compatible substances employed in pharmaceutical formulations.
[0197] A bulking agent is a compound which adds mass to a pharmaceutical formulation and contributes to the physical structure of the formulation in lyophilized form. Suitable bulking agents include mannitol, glycine, polyethylene glycol and sorbitol.
[0198] The use of a surfactant can reduce aggregation of the reconstituted protein and / or reduce the formation of particulates in the reconstituted formulation. The amount of surfactant added is such that it reduces aggregation of the reconstituted protein and minimizes the formation of particulates after reconstitution. Suitable surfactants include polysorbates (e.g. polysorbates 20 or 80); poloxamers (e.g. poloxamer 188); Triton; sodium dodecyl sulfate (SDS); sodium laurel sulfate; sodium octyl glycoside; laury l-, myristyl-, linoleyl-, or stearyl- sulfobetaine; lauryl-, myristyl-, linoleyl-or stearyl-sarcosine; linoleyl-. myristyl-, or cetylbetaine; lauroamidopropyl-, cocamidopropyl-, linoleamidopropyl-, myristamidopropyl-,palmidopropyl-, or isostearamidopropyl-betaine (e.g. lauroamidopropyl): myristamidopropyl- , palmidopropyl-, or isostearamidopropyl-dimethylamine; sodium methyl cocoyl-, or disodium methyl oleyl-taurate; and polyethyl glycol, polypropyl glycol, and copolymers of ethylene and propylene glycol (e.g. Pluronics, PF68, etc.).
[0199] Preservatives may be used in formulations disclosed herein. Suitable preservatives include octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride (a mixture of alkylbenzyl-dimethylammonium chlorides in which the alkyl groups are long-chain compounds), and benzethonium chloride. Other types of preservatives include aromatic alcohols such as phenol, butyl and benzyd alcohol, alkyd parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol. Other suitable excipients can be found in standard pharmaceutical texts, e.g. in “Remington's Pharmaceutical Sciences". The Science and Practice of Pharmacy, 19th Ed. Mack Publishing Company, Easton, Pa., (1995).
[0200] The compositions comprising an antibody or antigen-binding fragment thereof and a pharmaceutically acceptable carrier may comprise the anti-HCMV antibodies or antigenbinding portions thereof set forth herein at various concentrations. For example, the compositions may comprise an antibody or antigen-binding fragment thereof at 10 mg / ml to 200 mg / ml, 25 mg / ml to 130 mg / ml, 50 mg / ml to 125 mg / ml, 75 mg / ml to 110 mg / ml, or 80 mg / ml to 100 mg / ml. The compositions also may comprise an antibody or antigen-binding fragment thereof at about 10 mg / ml. 20 mg / ml, 30 mg / ml, 40 mg / ml. 50 mg / ml, 60 mg / ml, 70 mg / ml, 80 mg / ml, 90 mg / ml, 100 mg / ml, 1 10 mg / ml, 120 mg / ml, 130 mg / ml, 140 mg / ml, or 150 mg / ml.
[0201] In some embodiments, the compositions comprising the antibody or antigen-binding fragment thereof and the pharmaceutically acceptable carrier are lyophilized and provided in a composition for reconstitution prior to administration.
[0202] Methods of Administration
[0203] Therapeutic compositions comprising the contemplated antibody or antigen-binding fragment thereof may be administered in any convenient manner, including by injection, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, intracranially, by intravenous or intralymphatic injection, or intraperitoneally. In one embodiment, the cell compositions disclosed herein are preferably administered by intravenous injection.
[0204] In some embodiments, the amount of antibody administered is in the range of about 0.001 mg / kg to about 1000 mg / kg of patient body weight, and any range in between. Depending on the type and severity of the infection, about 0. 1 mg / kg to about 50 mg / kg body weight (for example, about 0. 1-15 mg / kg / dose) of antibody is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion. The anti-HCMV antibodies or antigen-binding fragments thereof can be delivered relatively low volume rates, for example but not necessarily from about 0.001 ml / day to 10 ml / day so as to minimize tissue disturbance or trauma near the site where the formulation is released. The formulation may be released at a rate of, depending on the specific biological agent(s), at a low dose, e.g., from about 0.01 pg / hr or 0.1 pg / hr, 0.25 pg / hr, 1 pg / hr, generally up to about 200 pg / hr, or the formulation is delivered at a low volume rate e.g., a volume rate of from about 0.001 ml / day to about 1 ml / day, for example, 0.01 micrograms per day up to about 20 milligrams per day. Dosage depends on a number of factors such as potency, bioavailability, and toxicity of the active ingredient used (e.g. the anti-HCMV antibodies or antigen-binding portions thereof) and the requirements of the subject. The progress of this therapy is readily monitored by conventional methods and assays and based on cnteria known to the physician or other persons of skill in the art. The above parameters for assessing successful treatment and improvement in the disease are readily measurable by routine procedures familiar to a physician.
[0205] In certain embodiments, the antibody or antigen-binding fragment thereof is administered to the mammal by intravenous infusion, z'.e., introduction of the antibody or antigen-binding fragment thereof into the vein of a mammal over a certain period of time. In certain embodiments, the period of time is about 5 minutes, about 10 minutes, about 30 minutes, about 1 hour, about 2 hours, about 4 hours, or about 8 hours.
[0206] In certain embodiments, a dose of a compound or a composition is administered to a subject every day, every other day, every couple of days, every third day, once a week, twice a week, three times a week, once every two weeks, or once a month. In other embodiments, two, three or four doses of a compound or a composition is administered to a subject every’ day, every couple of days, every third day, once a week, once every two weeks or once a month. In some embodiments, a dose(s) of a compound or a composition is administered for 2 days, 3 days, 5 days, 7 days, 14 days, 21 days or 28 days. In certain embodiments, a dose of a compound or a composition is administered for 1 month, 1.5 months, 2 months, 2.5 months, 3 months, 4 months, 5 months, 6 months or more.
[0207] It is to be understood that this disclosure is not limited to the particular molecules, compositions, methodologies, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments disclosed herein. It is further to be understood that the disclosure includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention, or a particular claim, that feature can also be used, to the extent possible, in combination with and / or in the context of other particular aspects and embodiments of the invention, and in the invention generally.
[0208] Where reference is made herein to a method comprising two or more defined steps, the defined steps can be carried out in any order or simultaneously (except where the context excludes that possibility), and the method can include one or more other steps which are carried out before any of the defined steps, between two of the defined steps, or after all the defined steps (except where the context excludes those possibilities).
[0209] All other referenced patents and applications are incorporated herein by reference in their entirety. Furthermore, where a definition or use of a term in a reference, which is incorporated by reference herein is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.
[0210] To facilitate a better understanding of the present invention, the following examples of specific embodiments are given. The following examples should not be read to limit or define the entire scope of the invention.EXAMPLES
[0211] Example 1: Materials and Methods for Examples 2-13
[0212] Cell lines, antibodies, and viruses
[0213] Normal human neonatal dermal fibroblast (NHDF. Lonza, CC-2509) and U373 astrocytoma cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Coming, 10-013-CV). ARPE-19 human retinal epithelial cells (ATCC, CRL-2302) were cultured in a 1: 1 mixture of DMEM and F-12 medium (Gibco, 11765-054). HTR-8 / SVneo human trophoblast cells (ATCC, CRL-3271) were cultured in RPMI-1640 medium (Coming, 10-041-CV). The DMEM, DMEM / F-12, and RPMI mediums were all supplemented with 10% heat-inactivated fetal bovine serum (FBS), IrnM HEPES (Coming, 25-060-CI), 100 U / mL penicillin, and 100 g / mL streptomycin (100X Pen / Strep, Coming, 30-002 -CI). U373 astrocytoma cells that constitutively express HCMV glycoproteins gH / gL were generated as previously described (18). All cell lines were kept at 37°C with 5% CO2.
[0214] HCMV hyperimmune globulin (CytoGam®) was purchased from CSL Behring LLC, NDC-44206-532-90. Monoclonal antibody W6 / 32 (anti-MHC class I) and mAb 5C3 (anti-gH) were previously described (18). The polyclonal anti-gL antibody was generated in rabbits against the HCMV TB40 / E gL peptide (aa. 265-278, PAHSRYGPQAVDAR). The polyclonal rabbit anti-IEl / 2 antibody was generated against the peptide sequence N’- KRKMDPDNPDEGPS-C’. The mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EMD Millipore, MAB374); donkey anti-rabbit IgG conjugated to horseradish peroxidase (HRP) (Invitrogen, A16035); and donkey anti-mouse IgG conjugated to HRP (Invitrogen, A16017) were purchased from commercial vendors.
[0215] HCMV viruses TB40 / E, AD169R (derived from HCMV-AD169 (BADrUL131- C4)), TR, and AD169-IE2-YFP were propagated in NHDF fibroblast cells as previously described (18). Briefly, virus was isolated from ~30 million infected cells (in a roller bottle) following a freeze / thaw and Bonification, then further isolated via ultracentrifugation (20,000 rpm, 1.5 hours, 4°C) over a 20% sorbitol cushion (Fisher Scientific, S459-500) using a SW-28 rotor (Beckman Coulter). The resulting virus was resuspended in 3% bovine serum albumin (BSA) in PBS and stored at -80°C. Viruses were titered in NHDF and ARPE-19 cells to determine the infectious units per milliliter (lU / mL).
[0216] Mouse vaccination and hvbridoma fusion
[0217] Five twelve-week-old Veloclmmune® female mice were immunized with 50pg HCMV-TB40 / E and 50pg HCMV-VHL / E formulated with PolylC, as described in Parsons etal., Development of broadly neutralizing antibodies targeting the cytomegalovirus subdominant antigen gH, Commun Biol. 2022 Apr 25;5(1):387. Briefly, mice received a prime immunization with virus, followed by a boosting immunization 14 days post-priming. Mice received a total of four boosts, and blood was collected from the submandibular vein at 50 and 150 days post-priming for sera neutralization analysis. Following this, one mouse was selected for hybridoma fusion, and received two final boosts of 50 pg of HCMV-TB40 / E and VHL / E virus at -5 and -2 days before euthanization by CO2 asphyxiation. The mouse’s spleen was processed to a single-cell suspension before hybridoma generation. Splenocytes from this mouse were fused using polyethylene glycol (PEG) with hypoxanthine-aminopterin- thymidine-sensitive F23.1 cells using the ClonalCell-HY system and protocol, as described previously (StemCell Technologies. 03800) (Parsons et al, 2022). Briefly, individual B-cell clones were grown on soft agar and selected for screening using a robotic ClonaCell Easy Pick instrument (Hamilton / StemCell Technologies). Individual clones were expanded, and the supernatant was used to screen for virus neutralization. All animal studies were approved by the Icahn School of Medicine at Mount Sinai’s Institutional Animal Care and Use Committee(IACUC); animal studies adhere to ARRIVE guidelines.
[0218] Antibody sequence analysis of heavy chain variable region and junctional diversity
[0219] Sequencing of variable heavy and kappa chains was obtained using SMARTer 5’ RACE technology (Takara Bio USA) adapted for immunoglobulins to amplify the variable genes from the heavy and kappa chains. Briefly. RNA was extracted from each hybridoma using a RNeasy Mini Kit (Qiagen, 74004), followed by first-strand cDNA synthesis using constant gene-specific 3’ primers (GSP1) based on the specific mouse isotype of the hybridoma and incubation with the SMARTer II A Oligonucleotide and SMARTscribe reverse transcriptase (Takara, 634858). [GSP1 Primers (5’-3’): mGl-AGAGGTCAGACTGCAGGACA (SEQ ID NO:32), mG2a- CTTGTCCACTTTGGTGCTGC(SEQ ID NO:33), mG2b-GACAGTCACTGAGCTGCTCA (SEQ ID NO:34), mG2b-GACAGTCACTGAGCTGCTCA (SEQ ID NO:35), mcK- CCAACTGTTCAGGACGCCAT(SEQ ID NO: 36)]. PCR amplification of the first-strand cDNA product was then performed using SeqAmp DNA Polymerase (Takara, 638504) with a nested 3’ primer (GSP2 Primer) to the constant genes and a 5’ universal primer (kit provided) based on universal primer sites added to the 5’ end during cDNA generation. [GSP2 Primers (5’-3’): mGl-CCCAGGGTCACCATGGAGTT (SEQ ID NO:37), mG2a-GGTCACTGGCTCAGGGAAAT (SEQ ID NO: 38), mG2b-CTTGACCAGGCATCCCAGAG (SEQ ID NO:39), mG3-GACAGGGCTCCATAGTTCCATT (SEQ ID NO:40), mCk- CTGAGGCACCTCCAGATGTTAAC (SEQ ID N0:41)]. Purified PCR products were submitted for Sanger sequencing using 3’ constant gene primers (GeneWiz, South Plainfield, NJ). Sequence results were BLASTed against the IMGT human databank of germline genes using V-Quest (http: / / imgt.org / ).
[0220] Neutralization screening assay of hybridoma clones
[0221] Hybridoma supernatant (1:5) was preincubated with TB40 / E or ADI69R virus (total volume = 50 pL; MOI=0.2) for Ihr at 4°C prior to infecting NHDF and ARPE-19 cells (IxlO4cells / well) for 2hrs at 37°C. The inoculum was then replaced with 100 pL complete DMEM or DMEM / F-12 media. Cells were fixed with 4% paraformaldehyde (PF A) and stained with Hoechst reagent (0.01 pg / mL, Molecular Probes, H3570) at 18 hours post-infection (hpi). Cells were fixed (4% PFA-PBS) and permeabilized (0.3% Triton X-100 (ThermoFisher, HFH10 in PBS) before staining with polyclonal rabbit anti-IE-1 / 2 antibody (0.7 ng / mL) followed by an anti-rabbit IgG-AF647 (1: 1000) antibody. To quantify total cells. Hoechst reagent (0.01 pg / mL-PBS) was added to cells. Virus neutralization was quantified using an imaging Celigo cytometer (Nexelcom Bioscience). Relative percent infection was calculated using the number of IE-1 + counts detected by the Celigo instrument and normalizing to the average number of IE-1+ counts detected in cells which received no antibody.
[0222] Isotvping and monoclonal antibody purification
[0223] Isotyping for the constant gene of the antibodies was performed with the Mouse Immunoglobulin Isotyping Kit (BD, 550026) as per the manufacturer’s protocol. Monoclonal antibodies were purified by FPLC on an AKTA pure FPLC systems on protein G affinity columns (HiTrap-lmL, GE / Cytiva, #17-0404-01). They were dialyzed against PBS and quantitated by both BCA and OD at 280 nm.
[0224] Immunoprecipitation (IP) assay
[0225] U373-gH / gL cells lysed with 0.5% NP-40 buffer (0.5% NP-40, 50 mM Tris pH 7.5, 150 mMNaCl, 5 mM MgCh, 2 pM leupeptin, 2 pg / mL aprotinin, 20 pM phenylmethylsulfonyl fluoride / PMSF) were clarified via centrifugation (13,000 * g for 5 min). Cell lysates (~1 x io6cells per mL of NP-40 lysis buffer) were incubated with 5 pg of an antibody for Ihr at 4°C on anutator, followed by addition of protein A-agarose beads (IPA3005, Repligen, Walthma, MA) for Ihr at 4°C on a nutator. Agarose beads were recovered by centrifugation (13,000 * g for 2 min), and washed 3x with NET buffer (50 mM Tris pH 7.5, 0.5% NP-40, 150 mM NaCl, 5 Mm EDTA) before being resuspended in 50 pL SDS-sample buffer (1.5% SDS, 1 M Tris pH 6.8, 50% glycerol, 600 mM DL-Dithiothreitol / DTT, bromophenol blue) and heated at 95°C for 2min. Proteins from the supernatant of pelleted protein A-agarose beads were resolved on a 10% SDS-polyacrylamide gel, then transferred to a PVDF membrane. The membrane was incubated with PBS+3% BSA, followed by incubation with anti-gL polyclonal antibody (Ihr at 25°C) and secondary anti-rabbit Ig conjugated to HRP (Ihr at 25°C). Chemiluminescent HRP substrate (Millipore, WBKLS 0500) was added to the membrane for visualization on autoradiography film.
[0226] Virus neutralization assays
[0227] TB40 / E, AD169R, TR, or AD169-IE2-YFP vims (MOI=0.2) w as preincubated with diluted mAbs using three-fold serial dilutions (final concentration: 0.21, 0.63, 1.85, 5.56, 16.67, 50 pg / mL in 50 pL / well) for Ihr at 4°C prior to inoculum addition to ARPE-19, HTR-svNeo, or NHDF cells (10,000 cells / well). Cells were incubated with mAb / virus inoculum at 37°C with 5% CO2, and infection was assessed 18-24 hpi using a plate-based imaging Celigo cytometer (Nexelcom, Version 4. 1.3.0). Virus infection was quantitated as described above. All conditions were performed in technical triplicate over at minimum n=2 independent experiments.
[0228] Kp determination
[0229] Biolayer interferometry assays were performed using the Octet RED 96 instrument (Sartori usAG) to determine the association rates (kon), dissociation rates (kOff), and affinity' (KD) for each antibody. Purified monoclonal antibody (10 pg / mL) was loaded onto anti-mouse Fc IgG capture (AMC) sensors for 10 min at 20°C. To determine the kon. sensors were exposed to recombinant HCMV pentamer (strain VR1814) consisting of the glycoproteins gH, gL, ULI 28, UL130, and UL131A (Native Antigen, CMV -PENT-100) at two-fold diluted concentrations (6.25-100 pg / mL in PBS) for 3 min. The koff values w ere measured over the course of 3 minutes after sensors were transferred to PBS buffer. KD values were then calculated based on the obtained sensogram data as a ratio of k0n / k0n. A binding model of 1 : 1 resulted in the best fit for each antibody.
[0230] Pre / post-attachment neutralization assay.
[0231] NHDF and ARPE-19 cells (10,000 cells / well) were incubated at 4°C for 10 min prior to addition of HCMV-TB40 / E (MOI=0.2) chilled to 4°C and then exposed to cells for 1 hr. followed by addition of pre-chilled mAbs (final concentration: 5 pg / mL) and transfer of cells to 37°C. For pre-incubation with mAbs, virus was pre-incubated with mAbs for 1 hr at 4°C prior to addition to cells and subsequent transfer of cells to 37°C. Infection was assessed at 18 hpi after fixing cells in 4% PFA and immunostaining for IE-1+ cells as well as total cell count, w ith the number of IE- 1+ cells and total cell count measured via imaging Celigo cytometer.
[0232] Time-of-addition neutralization assay.
[0233] NHDF and ARPE-19 cells (10,000 cells / well) were incubated at 4°C for 10 min prior to addition of HCMV-TB40 / E (MOI=0.2) chilled to 4°C and exposed to cells for 1 hr. Cells were then transferred to 37°C, and pre-chilled mAbs (final concentration: 5 pg / rnL) were added at different timepoints (0, 30, 60, 90, and 180 min) following the transfer to 37°C. mAbs were also preincubated with virus for 60 minutes at 4°C prior to addition of the inoculum to chilled cells and subsequent transfer to 4°C.
[0234] Virus dissemination / plaque reduction assays.
[0235] NHDF or ARPE-19 cells (25,000 cells / well in a 24-well plate) were infected with HCMV-TB40 / E (MOI=0.01) preincubated for Ihr at 4°C with either 10 (for NHDFs) or 5 (for ARPE-19s) pg / mL of antibody. Following a 1 hr incubation, inoculum was removed, and cells were overlaid with a 1% low melt temperature sea agarose overlay for 30 min at 20°C. After the agarose solidified, 500 pL of complete media containing the indicated concentration of antibody was added to cells and placed at 37°C with 5% CO2. At 3 days and 6 days postinfection (dpi), media containing antibody was replaced. At 9 days post-infection, cells were fixed in 4% PFA for 20 min prior to removal of agar overlays and subsequent immunostaining for IE-1 and for total cell count. An imaging Celigo cytometer was used to detect and quantify the number of IE-1+ cells and the total number of cells, as well as the number of plaques greater than 5,000 pm2in area, which was determined based on localized intensity of IE-1+ fluorescent signal.
[0236] Quantitative PCR
[0237] For quantitative PCR, DNA was first isolated and purified from NHDF or ARPE-19 cells using an E.Z.N.A.® Tissue DNA Kit (Omega Bio-Tek, D3396-00S) and following manufacturer's instructions. Once isolated. DNA purity and concentration was determined through 260 / 280 nm absorbance measures using a NanoDrop 2000 spectrophotometer (ThermoScientific). DNA was then amplified via qPCR to measure relative HCMV genome levels, with each qPCR reaction mix consisting of 5 pL 2x iQ SYBR Green Master Mix (BioRad, #1708880), 1.25 pL forward primer (150 nM), 1.25 pL reverse primer (150 nM), and 2.5 pL sample DNA diluted with ultrapure RNAse / DNAse-free water (0.2 ng / pL). qPCR primer stocks (100 pM) were prepared with ultrapure RNAse / DNAse-free water, and were designed to amplify either HCMV gene UL83, encoding the pp65 tegument protein (36), or RPS11, a housekeeping gene used as an internal control. Primer sequences were as follows: pp65 Forward. 5’-GTCAGCGTTCGTGTTTCCCA-3’ (SEQ ID NO:42); pp65 Reverse, 5’- GGGACACAACACCTGAAAGC-3’ (SEQ ID NO:43); RPS11 Forward. 5’-ATCGTCACAGTGGGCGAGTG-3’ (SEQ ID NO:44); RPSI 1 Reverse, 5’- GCCGATGTCCAGCCTCAGA-3' (SEQ ID NO:45).
[0238] A Bio-Rad CFX96 qPCR Real-Time PCR Thermo Cycler (Boston Industries) was used to perform and analyze qPCR-based amplification of DNA according to the following program: denaturation at 95°C for 30 seconds; 40 cycles of alternating between 94°C for 15 seconds and 60°C for 60 seconds; and a dissociation curve at 65-95°C in 0.5°C increments for 5 seconds per increment. Cycle threshold (Ct) values were determined by automated threshold analysis using the CFX Maestro So Pt ware (Bio-Rad, #12013758). Relative HCMV genome levels were assessed using the 2"ddCtmethod (37) by calculating the fold change in copies of the UL83 gene relative to mock (uninfected) cells after normalizing to RPS11 gene expression.
[0239] Synergy score calculation
[0240] All synergy scores were calculated using SynergyFinder 3.0 (38) based on the Loewe additivity' reference model. Relative percent infection data was first transformed to relative percent inhibition of infection, using the formula relative percent inhibition) = 100 - (relative percent infection). Deviations between observed and expected responses with positive and negative values denote synergy and antagonism, respectively.
[0241] Statistics and reproducibility
[0242] All statistical tests w ere performed using GraphPad Prism 9 softw are (La Jolla, C A). Asterisks identify statistical significance, which is denoted as: *, p<0.05 **, / ?<0.01; ***, p<0.001; **** JPO.OOOL The half-maximal inhibitory concentration (ICso) values for each antibody were calculated using three-parameter non-linear regression analysis, after antibody concentrations (x-axis) w ere transformed to log scale. Error bars represent standard deviation from the mean for all figures. Sample size and replicates for each experiment are listed in the respective figure legends. Technical replicates were performed in triplicate within one experiment; experimental replicates were performed on separate days.
[0243] Example 2: Generation of anti-HCMV mAbs in Veloclmmune® mice
[0244] Sera of Veloclmmune® mice immunized with HCMV TB40 / E and VHL / E were found to limit infection of the HCMV AD169R variant strain in both fibroblast and epithelial cells. The AD169R variant was derived from HCMV-AD169 (BADrUL131-C4). in which the genome region of HCMV-TR corresponding to the UL131a-128 ORFs was cloned into the homologous region of AD 169 to allow the expression of a functional pentamer complex. In addition, AD169R constitutively expresses GFP upon infection, providing a robust method forquantifying virus infection. Based on the neutralizing capacity of the sera of immunized Veloclmmune®’ mice, the spleen from mouse 38 was used to produce 1440 hybridoma clones. Hybridoma supernatants were then screened using a neutralization assay in ARPE- 19 epithelial cells (FIG. 1A), where virus infection was assessed at 18 hours post-infection (hpi) by immunostaining for the HCMV protein immediate-early-1 (IE-1). The percent infection was determined relative to untreated virus (set as 100% infection), with results illustrated as a heat map (FIG. 1A).
[0245] Seven ‘hit’ clones (1C10, 1H1, 2D4, 4F9, 7G7, 8A5, and 9H1) were identified that reduced infection > 25% and were selected for further characterization.
[0246] Example 3: Ability of selected anti-HCMV mAbs to neutralize HCMV infection
[0247] The seven ‘hit’ clones were evaluated for their ability to neutralize HCMV infection within the contexts of disparate cell types.
[0248] To that end, the supernatants of clones 1C10, 1H1, 2D4, 4F9, 7G7, 8A5, and 9H1 were examined for neutralization of AD169R in NHDF and ARPE-19 cells. The FDA- approved hyperimmune globulin CytoGam® and the anti-gH mAb 5C3 (Gardner et al.. Functional screening for anti-CMV biologies identifies a broadly neutralizing epitope of an essential envelope protein, Nat Commun. 2016 Dec 14;7: 13627) w ere used as positive controls, while the influenza-specific antibody M2E10 and non-neutralizing clone 7H6 acted as negative controls.
[0249] Clones 1 C 10, 2D4, 4F9, 7G7 , and 8A5 reduced infection by > 25% in both cell types (FIG. IB). However, clones 1H1 and 9H1 lost neutralization activity for at least one strain and were excluded from further studies. Clone 1C10 was extremely effective across both cell types.
[0250] Example 4: Isotyping of selected anti-HCMV mAbs
[0251] The neutralizing clones 1C10, 2D4, 4F9, 7G7, and 8A5 were each purified and isotyped.
[0252] Clones 1C10, 2D4, 4F9, and 8A5 were identified as IgG2a isotype. Clone 7G7 was characterized as IgG3 isotype and excluded due to the nonspecific binding of IgG3 immunoglobulins.
[0253] The heavy chains of the four IgG2a-isotype clones w ere sequenced (Table 9) and found to be genetically distinct with diverse CDR3 lengths (10-15 aa).
[0254] To summarize, immunization using intact HCMV virions elicited a broad and robust immune response from Veloclmmune® mice, producing genetically diverse antibody clones.Table 9. Antibody diversity and VDJ gene usage of Veloclniiiiiinc -elicited mAbsTable 9 (continued)
[0255] Example 5: Anti-HCMV neutralizing mAbs target the gH / gL complex
[0256] The anti-HCMV neutralizing mAbs’ capacity to limit infection in both fibroblast and epithelial cells is consistent with previous findings that these mAbs target gH / gL- complexes on the viral envelope. Thus, immunoprecipitation (IP) studies were performed with the anti-HCMV mAbs from lysates of U373 astrocytoma cells expressing gH and gL (designated U373-gH / gL) followed by an anti-gL immunoblot.
[0257] As expected, the complex recovered with the anti-gH mAb 5C3 migrated at a position corresponding to the gH / gL complex found in the total cell lysate fraction (FIG. 1C, lanes 1 and 5). Importantly, clones 1C10, 2D4, 4F9, and 8A5 also recovered the gH / gL dimer (FIG. 1C, lanes 6-9). demonstrating their specificity for the gH / gL complex. The negative controls of beads alone, the anti-MHC class I mAb W6 / 32, and non-neutralizing isotype mAb 7H6 did not recover the gH / gL complex (FIG. 1C, lanes 3, 4, and 10, respectively). Further, the neutralizing mAbs were able to recover both gH / gL-containing trimer and pentamer complexes from HCMV -TB40 / E virions (FIG. ID), indicating that the mAbs recognize both complexes on the surface of the vinon.
[0258] Example 6: The anti-gH / gL mAbs effectively inhibit HCMV infection
[0259] Next, to quantify the capacity of the anti-gH / gL mAbs to neutralize diverse HCMV strains, the mAbs’ ability to limit infection of HCMV strains TB40 / E, AD169R. and TR in epithelial cells and fibroblasts was examined. These viruses represent diverse HCMV strains isolated from Europe and North America between 1956 and 1999; however, they share a gH / gLsequence identity of > 96.6%. TB40 / E, AD169R, and TR (MOI = 0.2) were each preincubated with mAbs (0-50 pg / mL) prior to infection of ARPE-19 cells.
[0260] mAbs 1C10, 2D4, 4F9, and 8A5 reduced infection of diverse HCMV strains with IC50 of 0.10-0.30 pg / mL against TB40 / E and AD169R and 0.35-0.41 pg / mL for TR (FIG. 2A, FIG. 2B, FIG. 2C, and FIG. 2D, Table 10). By comparison, CytoGam® was markedly less effective against all strains (FIG. 2E, Table 10).To further assess and profile the ability of mAb 1 CIO to neutralize HCMV, the antibody’s capacity for neutralization of two additional strains, Towne and Davis was tested. These are laboratory strains that lack a functional pentamer complex and thus infect exclusively fibroblasts.
[0261] The viruses (MOI = 0.2) were preincubated with either mAb 1C10 or CytoGam® (0- 50 pg / mL) for assessment of infection of NHDF cells using the neutralization assay.
[0262] As with the other strains tested, mAb 1C10 potently and effectively neutralized both Towne and Davis with IC50 values of <0.1 and 7.5 pg / mL, respectively (FIG. 2F). CytoGam® neutralized both strains (FIG. 2G) to a lesser degree with IC50 values of 2.93 and >100 pg / mL against Towne and Davis, respectively.Table 10. Half-maximal inhibitory concentrations (IC50) for Veloclmmune '-elicited mAbs.Table 10 (continued)
[0263] Example 7: Ability of anti-gH / gL mAbs to reduce HCMV infection
[0264] Next, the ability of anti-gH / gL mAbs to reduce infection of fibroblasts by HCMV TB40 / E, AD169R, TR, and lab-adapted strain AD169-IE2-YFP, which lacks functioningpentamer complex, was evaluated. Viruses (MOI = 0.2) preincubated with mAbs (0-50 pg / mL) were assessed by the neutralization assay.
[0265] Clones 1C10, 2D4, 4F9, and 8A5 neutralized TB40 / E with IC50 values of 0.30-1.78 pg / mL (Table 10). Strikingly, mAb 1C10 was able to reduce infection of AD169R, TR, and AD169-IE2-YFP with IC50 values of 0.57, 5.32, and 0.51 pg / mL, respectively (FIG. 3A). The mAbs 2D4 and 8A5 (FIG. 3B and FIG. 3D) demonstrated modest neutralization with >50% inhibition of infection of AD169R, TR, and AD169-IE2-YFP only at the highest mAb concentration tested (50 pg / mL). mAb 4F9 displayed reduced efficacy in neutralizing AD 169R (IC50: -5.56 pg / mL) and was unable to inhibit TR or AD169-IE2-YFP (FIG. 3C). CytoGam®’s efficacy in fibroblast cells was also reduced as compared to epithelial cell infection (FIG. 3E).
[0266] The difference in mAbs 2D4, 4F9. and 8A5’s ability to neutralize diverse HCMV strains in epithelial cells compared to fibroblasts may be due to differences in binding affinity for gH / gL within the pentamer complex, which mediates entry into epithelial cells, compared to affinity for gH / gL within the trimer, which is important for entry into fibroblasts. Another possible explanation is that the mAbs recognize distinct epitopes on gH / gL-complexes which are exposed within the pentamer, but may be masked in the gH / gL-tnmer due to the gO protein (43). Polymorphic forms of gO can mediate protection of gH / gL epitopes targeted by anti- HCMV mAbs in neutralization studies in fibroblasts. However, such polymorphisms did not affect mAb-mediated neutralization of epithelial cell infection. Thus, profiling an mAbs’ ability to neutralize diverse HCMV strains across distinct cell types is important for characterization of anti-HCMV mAbs as effective therapeutics.
[0267] Example 8: Anti-gH mAb 1C10 limits HCMV infection of trophoblasts and monocytes
[0268] To assess the capacity of 1C 10 to impact infection of relevant cell types, clone 1C10 was evaluated for its ability to limit infection of TB40 / E and AD169R in placental tissue- derived HTR-8 / SVneo trophoblast cells and monocyte-derived THP-1 cells. HCMV can cross the maternal-fetal placental barrier to infect gestating fetuses during pregnancy; in addition, the virus can infect CD14+blood monocytes and establish latency, implicating these cells as potential sites of a latent reservoir.
[0269] TB40 / E and AD169R (MOI = 0.2) preincubated with 1C10 or CytoGam® (0-50 pg / mL) were evaluated in HTR-8 / SvNeo and THP-1 cells using the neutralization assay.
[0270] In the placental-derived cells, clone 1C10 inhibited infection of HCMV with IC50 values <0.1 and 0.4 pg / mL for TB40 / E and AD169R, respectively (FIG. 4A); while CytoGam®neutralized infection with IC50 values of 0.3 and 0.7 pg / mL respectively (FIG. 4B). 1C10 was also able to significantly neutralize these viruses in THP-1 monocytic cells (FIG. 4C), yielding IC50 values of <0. 1 pg / mL against both strains. By comparison, CytoGam* IC50 values were 1.16 and 1.0 pg / mL against TB40 / E and AD19R, respectively (FIG. 4D).
[0271] The ability of 1 CIO to inhibit HCMV in placental and monocytic cells demonstrates the therapeutic ability of anti-HCMV mAbs disclosed herein.
[0272] Example 9: Neutralizing mAbs demonstrate similar binding affinities for gH / gL complexes
[0273] Next, the mAbs' binding affinity for the recombinant HCMV gH / gL / UL128 / UL130 / UL131a pentamer complex was examined. Biolayer interferometry assays were performed to determine the association rate (kon), dissociation rate (koir), and overall affinity (KD, calculated as a ratio of k0ff / k0n) of each mAb for the soluble recombinant pentamer complex. To that end, serial twofold dilutions of recombinant pentamer complex were incubated with capture sensors pre-incubated with 10 pg of indicated mAb. Interactions between immobilized mouse Fc antibodies and recombinant pentamer were detected. Following attachment, dissociation was performed in PBS.
[0274] The mAbs displayed similar binding affinities for HCMV pentamer, with KD values ranging from 12.0-36.0 nM. 1C10: KD = 17 nM (R2= 0.996); 2D4: KD = 12 nM (R2= 0.800); 4F9: KD = 36 nM (R2= 0.886); 8A5: KD = 26 nM (R2= 0.745).
[0275] This data shows that the high affinity’ mAbs disclosed herein effectively neutralize HCMV.
[0276] Example 10: Competition assays reveal that 1C10 binds to a distinct region of gH
[0277] To further characterize the binding profile of 1C10 in comparison to other neutralizing anti-gH antibodies, antibody competition assays were performed. A fixed amount of AlexaFluor647 (AF647) labeled 1C10 (2 pg / mL) was mixed with increasing concentrations (0.4, 2. 4, 20 pg / mL) of unlabeled anti-gH mAbs 2D4. 15G11 (Parsons et al. 2022) 10F8 (Parsons et al, 2022), and 5C3 (Gardner et al., 2016) prior to addition to U373-gH / gL cells.
[0278] 15G11, 10F8, and 5C3 were selected for the competition assay, as it has shown that they are representative examples of distinct anti-gH antibody classes which bind to two separate regions of gH. Specifically, 10F8 belongs to the same antibody class as 5C3, which binds to a highly conserved epitope within domain 2 of gH, while 15G11 exhibited a distinctbinding profile as measured by antibody competition assay and binding to gH double alanine substitution constructs. AF647-labeled 1C10 was also mixed with a lOfold excess of irrelevant influenza antibody PY102 as a positive control, and with U373-gB cells as a negative control. The geometric mean fluorescent intensity (MFI) of AF 647-positive cells was measured on a flow cytometer and normalized relative to cells incubated with AF 47-labeled 1C10 and PY102.
[0279] Of the antibodies tested, only 15G11 was able to significantly compete with the labeled 1C 10 for binding to U373-gH / gL cells, reducing the relative MFI by almost 50 % at the highest concentration (FIG. 5).
[0280] This indicates that 1 C 10 and 15G11 share an antibody -binding region on gH, distinct from that of 5C3. Further, unlabeled 2D4 did not compete with AF647-labeled 1C10. which, combined with the data from the neutralization assays indicates that the mAbs in our panel recognize different epitopes of gH / gL-complexes.
[0281] Example 11: The anti-gH / gL mAbs inhibit virus infection in a post-attachment step
[0282] Anti-HCMV mAbs targeting gH / gL complexes inhibit infection by blocking viral attachment or by functioning at a post-attachment step to prevent viral penetration and / or fusion into cells. To examine whether the anti-gH / gL mAbs block infection at a post-attachment step, the mAbs’ ability to limit HCMV infection following virion attachment to cells was examined.
[0283] HCMV-TB40 / E (MOI=0.2) was incubated for 1 hr at 4 °C with NHDF and ARPE- 19 cells, permitting virus binding but not subsequent penetration. Clones 1C10, 2D4, 4F9, and 8A5, as well as CytoGam® and isotype control 7H6 (5 pg / rnL) were added and the cells transferred to 37 °C to allow for infection. As an inhibition control, TB40 / E (MOI = 0.2) was pre-incubated with the respective immunoglobulins (5 pg / mL).
[0284] HCMV preincubated with clones 1C10, 2D4, 4F9, and 8A5 reduced infection by -50-90% in fibroblasts and >90% in epithelial cells (FIG. 6A and FIG. 6B). The CytoGam® and 7H6 controls acted as expected. Strikingly, similar levels of inhibition were observed upon the addition of mAbs post-attachment (FIG. 6A and FIG. 6B).
[0285] This data supports the underlying model that anti-gH / gL HCMV mAbs prevent virus infection at a post-attachment step.
[0286] To assess at what time during HCMV infection the mAbs abrogate infection, a “time-of-addition” neutralization assay was performed (FIG. 6C).
[0287] Briefly, mAbs were added at 0, 30-, 60-, 90-, and 180-minutes relative to infection of HCMV-TB40 / E (MOI=0.2). respectively, following a Ihr incubation at 4 °C. Virus preincubated with mAbs was used as a control for neutralization.
[0288] HCMV infection was reduced in a time-dependent manner in fibroblasts, with mAb- mediated neutralization largely abrogated at 180 minutes post-attachment (FIG. 6D). Of note, mAbs 1C10 and 2D4 limited infection of TB40 / E by > 50 % when added up to 60 minutes post-viral attachment. In the case of ARPE-19 epithelial cells. 1C 10, 2D4, 4F9, and 8A5 reduced infection by 50% or more up to 90 minutes post-attachment, with abrogation of inhibition at 180 minutes post-attachment (FIG. 6E). The cell type-specific distinction in mAbs’ ability to inhibit infection over time is likely due to HCMV’s use of multiple distinct mechanisms of entry, as HCMV enters fibroblasts from the cell surface and epithelial cells through pH-dependent endocytosis.
[0289] These results highlight the value of mechanistic studies that define the therapeutic window of mAb delivery' and cell-specific kinetics of virus entry.
[0290] Example 12: The anti-gH / gL mAbs limit viral dissemination and spread
[0291] Next, the anti-gH / gL mAbs were examined for ability' to inhibit virus dissemination, replication, and spread.
[0292] ARPE-19 epithelial cells were infected with TB40 / E (MOI = 0.01) preincubated with mAbs 1C10, 2D4, 4F9. and 8A5 (5 pg / mL), followed by the addition of a 1% SeaPlaque agarose overlay. Antibody treatments were added to infected cells and replaced at days 3 and 6 post-infection. At day 9, cells were fixed, and infection was quantified using an anti-IEl immunostain to determine the number of infected cells and viral foci. Relative percent infection was determined using virus alone as 100 %; viral foci were measured based on anti-IEl immunofluorescence intensity in areas of > 5,000 pm2. CytoGam® and the HCMV antiviral ganciclovir (10 pM) were used as controls.
[0293] Assessment of the number of infected cells indicated that all neutralizing mAbs, CytoGam®, and ganciclovir treatment significantly reduced levels of infection (FIG. 7A) and number of viral foci (FIG. 7B), with 1C10 being one of the most effective mAbs. The number of IE1+cells did not significantly differ when media was left on cells for 9 days as compared to media replaced at 3 and 6 days in TB40 / E-infected fibroblasts analyzed at 9 dpi (FIG. 7E), confirming that the reduction in virus infection was not a consequence of the periodic replacement of media. Furthermore, when NHDF cells were infected with TB40 / E at varying MOIs (0.001, 0.005, 0.01, and 0.05), subsequent addition of 1C10 (10 pg / mL) 1-day post-infection significantly reduced the overall levels of infection at all MOIs (FIG. 7G and FIG. 7H).
[0294] This data shows that the neutralizing anti-gH / gL mAbs limit viral dissemination and spread.
[0295] To assess whether the anti-gH / gL mAbs’ ability to inhibit virus foci also limits virus replication. ARPE-19 and NHDF cells were infected with TB40 / E (MOI = 0.01) preincubated with mAbs 1C10, 2D4, 4F9, and 8A5 and isotype control 7H6 (5 pg / mL in ARPE-19s; 10 pg / mL in NHDFs). Virus proliferation was allowed to proceed for 9 days, with mAb treatments replaced at days 3 and 6 post-infection. CytoGam® and ganciclovir were used as controls. Total DNA from untreated and treated cells was harvested at 9 days-post infection and subjected to qPCR to amplify the HCMV UL83 gene (tegument protein pp65) and the cellular housekeeping gene RPS11.
[0296] Quantification of relative HCMV genome levels after normalization to uninfected cells demonstrated that mAb treatment significantly reduced levels of HCMV genomes in both epithelial and fibroblast cells (FIG. 7C and FIG. 7D). In TB40 / E-infected ARPE-19 cells, all antibody treatment, excluding the control 7H6. reduced HCMV genome levels by ~100-fold compared to untreated infected cells. Interestingly, mAb 4F9 reduced relative HCMV genome levels by ~ 10-fold, while 2D4 and ICO decreased the relative HCMV genome levels -1000- fold and - 10,000-fold, respectively, in TB40 / E-infected fibroblasts. Intriguingly, in fibroblasts, mAbs 1 C 10 and 2D4 were more effective in reducing HCMV genome levels than ganciclovir and CytoGam®.
[0297] This data further highlights the efficacy of anti-HCMV mAbs to limit viral dissemination and spread in vitro.
[0298] To further assess the potential utility of 1 CIO and other mAb-based treatments for clinical strains, the ability of 1C10 and anti-gH mAb 15G11 to limit replication of a clinical HCMV isolate was examined. Clinical isolates of HCMV demonstrate notable distinctions in both genoty pe and phenoty pe compared with both lab-adapted and clinical-like strains, most notably less prolific viral titers and exclusively cell-to-cell dissemination.
[0299] ARPE-19 cells infected with HCMV strain “CH7”, a ganciclovir-resistant clinical isolate from a solid-organ transplant with active HCMV infection, were treated with 5 or 20 pg / mL of mAbs 1C10, 15G11, or isotype control antibody 7H6; as a control, cells were treated with the HCMV viral terminase inhibitor 20 nM letermovir. Treatments were replaced at 4 and 7 days following plating of clinically infected cells, and total DNA was isolated from treatedand untreated cells at day 10 for quantification and assessment of relative HCMV genome levels.
[0300] Treatment with both anti-gH mAbs significantly reduced viral load in a dosedependent manner, underscoring the potential for anti-gH mAb-based therapeutics as a viable and effective treatment for HCMV -infected patients (Fig. 7F).
[0301] Example 13: Anti-gH-based combination therapy effectively limits HCMV proliferation
[0302] Combination therapies targeting disparate viral entry proteins or distinct steps of the viral life cycle are an effective therapeutic approach, since they limit virus dissemination as well as ameliorating toxicity, limiting diverse viral variants, and preventing elicitation of antiviral-resistant strains.
[0303] First, a combination treatment of anti-gH mAb 1C10 and the neutralizing anti-gB mAb 8F9, which targets a conserved linear epitope of gB located in antigenic domain, was examined. ARPE-19 epithelial cells were infected with HCMV-TB40 / E (MOI=0.05) in the presence of 1C10 and / or 8F9 (0-1 pg / mL) in a checkerboard matrix.
[0304] When quantified at 9 days post-infection, 1C10 / 8F9 combinations were found to significantly reduce infection as compared to treatment with 8F9 alone (FIG. 8A). The relative percent infection values were then used to calculate synergy- scores based on the Loewe additivity model (FIG. 8B). the greatest of which (score: 5.48) was obtained using a combination of 0.25 pg / mL 1C10 and 0.25 pg / mL 8F9, indicating that the tw-o mAbs function together additively (38). Importantly, the two antibodies administered together did not display antagonistic effects, despite targeting a similar pathway.
[0305] To assess whether anti-HCMV treatments that act at disparate stages of the viral life cycle work synergistically, combinations of 1C10 and the antiviral ganciclovir were administered to evaluate the synergy of drug-mAb combination treatments.
[0306] ARPE-19 and NHDF cells were infected with TB40 / E (MOI=0.05) in the presence of 1 CIO (0-1 pg / mL in ARPE-19 cells; 0-2.5 pg / mL in NHDF cells) and / or ganciclovir (0-5 pM) in a checkerboard matrix.
[0307] 1C10 combined with ganciclovir significantly reduced the number of infected cells in both ARPE-19 and NHDF cells (FIG. 9A and FIG. 9B) and demonstrated synergy based on a Loewe additivity model in both cell types (FIG. 9C and FIG. 9D). The most synergistic combinations were found at 0.25 pg / mL 1C10 / 5 pM ganciclovir in epithelial cells (synergy score: 19.60) and 2.5 pg / mL 1 C 10 / 1.25 pM ganciclovir in fibroblasts (synergy score: 19.60).Importantly, in epithelial cells, the use of 0.25 pg / mL 1C10 produced synergy scores >10 when combined with all three concentrations of ganciclovir tested, and in fibroblasts, every combination of 1C10 and ganciclovir produced a synergy score >10, indicating an extremely strong likelihood that the two treatments function synergistically to limit HCMV spread.
[0308] To further examine the potential for synergy between anti-gH mAbs and ganciclovir to reduce HCMV dissemination, combination treatments of the anti-gH mAb 15G11 (0-1 pg / mL) and / or ganciclovir (0-5 pM) were administered to ARPE-19 cells infected with TB40 / E (MOI = 0.05).
[0309] These combinations significantly reduced infection as compared to 15G11 or ganciclovir alone (FIG. 10A). Further, the synergy scores (FIG. 10B) indicated that 15G11 and ganciclovir also functioned synergistically, with the highest synergy score of 12.53 at 0.25 pg / mL 15G11 / 2.5 pM ganciclovir. Interestingly, the magnitude of synergy obtained with 15G11 / ganciclovir is less than that seen in the IClO / ganciclovir combinations, despite the two mAbs targeting the same viral glycoprotein.
[0310] These findings indicate that mAbs targeting specific regions of gH may be more effective at functioning synergistically with ganciclovir, highlighting this approach as a novel therapeutic strategy.
Claims
We claim:
1. An antibody or antigen-binding fragment thereof that binds to human cytomegalovirus (HCMV), the antibody or antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region, wherein each of the heavy chain and the light chain variable regions comprises a CDR1, CDR2, and CDR3, and wherein:(a) the sequence of CDR1H comprises GGSISSYY (SEQ ID NO: 15); the sequence of CDR2H comprises IYYSGNT (SEQ ID NO: 16); the sequence of CDR3H comprises VRFGYYGLDV (SEQ ID NO: 17); the sequence of CDR1L comprises QGIRSD (SEQ ID NO: 18); the sequence of CDR2L comprises AAS; and the sequence of CDR3L comprises LQHNSYPFT (SEQ ID NO: 19);(b) the sequence of CDR1H comprises GFTFSDYT (SEQ ID NO:20); the sequence of CDR2H comprises ISRNSNYI (SEQ ID NO:21); the sequence of CDR3H comprises ARDLAAAGAYGYFDY (SEQ ID NO:22); the sequence of CDR1L comprises QGISSW (SEQ ID NO:23); the sequence of CDR2L comprises AAS; and the sequence of CDR3L comprises CQQANSFPYT (SEQ ID NO:24); or(c) the sequence of CDR1H comprises GYSFASYW (SEQ ID NO:28); the sequence of CDR2H comprises IYPGDSDT (SEQ ID NO:26); the sequence of CDR3H comprises TRLRGTMAGFDF (SEQ ID NO:29); the sequence of CDR1L comprises QSLVESDGNTY (SEQ ID NO:30); the sequence of CDR2L comprises KIS; and the sequence of CDR3L comprises MKATQYT (SEQ ID NO: 31).
2. The antibody or antigen-binding fragment thereof of claim 1, wherein:(a) the sequence of the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO: 1 and the sequence of the light chain variable region comprises a sequence that is least at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:5;(b) the sequence of the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:2 and the sequence of the light chain variable regioncomprises a sequence that is least at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:6; or(c) the sequence of the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:4 and the sequence of the light chain variable region comprises a sequence that is least at least 80%, at least 85%. at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to SEQ ID NO:7.
3. The antibody or antigen-binding fragment thereof according claim 2, wherein:(a) the sequence of the heavy chain variable region comprises SEQ ID NO: 1 and the sequence of the light chain variable region comprises SEQ ID NO:5;(b) the sequence of the heavy chain variable region comprises SEQ ID NO:2 and the sequence of the light chain variable region comprises SEQ ID NO:6; or(c) the sequence of the heavy chain variable region comprises SEQ ID NO:4 and the sequence of the light chain variable region comprises SEQ ID NO: 7.
4. The antibody or antigen-binding fragment thereof of any one of claims 1-3, wherein the antibody or antigen-binding fragment thereof is a chimeric antibody, a CDR-grafted antibody, or a humanized antibody or antigen-binding fragment thereof.
5. The antibody or antigen-binding fragment thereof of any one of claims 1 -4, wherein the antibody or antigen-binding fragment thereof is a monoclonal antibody or antigen-binding fragment thereof.
6. The antibody or antigen-binding fragment thereof of any one of claims 1-5, wherein the antibody or antigen-binding fragment thereof is a multispecific or a bispecific antibody or antigen-binding fragment thereof.
7. The antibody or antigen-binding fragment thereof any one of claims 1-5. wherein the antibody or antigen-binding fragment thereof is an scFv, Fv, Fab’, Fab, F(ab’)2, or diabody.
8. The antibody or antigen-binding fragment thereof any one of claims 1-5, wherein the antibody or antigen-binding fragment thereof has isotype IgG2.
9. The antibody or antigen-binding fragment thereof of any one of claims 1-8, wherein the antibody or antigen -binding portion thereof is capable of broadly neutralizing an HCMV infection.
10. An isolated nucleic acid encoding the antibody or antigen-binding fragment thereof of any one of claims 1-9.
11. A vector comprising the nucleic acid of claim 10.
12. A vector or set of vectors encoding an antibody or antigen-binding fragment thereof that binds to HCMV, the antibody or antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region, wherein:(a) the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to any one of SEQ ID NOs:8, 9, or 11; and(b) the sequence encoding the light chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to any one of SEQ ID NOs: 12, 13, or 14.
13. The vector or set of vectors of claim 12. wherein:(a) the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 8 and the sequence encoding the light chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 12;(b) the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%. or at least 99% to identical to SEQ ID NO: 9 and the sequence encoding the light chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 13; or(c) the sequence encoding the heavy chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least98%, or at least 99% to identical to SEQ ID NO: 11 and the sequence encoding the light chain variable region comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to identical to SEQ ID NO: 14.
14. The vector or set of vectors of claim 12, wherein:(a) the sequence encoding the heavy chain variable region comprises SEQ ID NO: 8 and the sequence encoding the light chain variable region comprises SEQ ID NO: 12;(b) the sequence encoding the heavy chain variable region comprises SEQ ID NO: 9 and the sequence encoding the light chain variable region comprises SEQ ID NO: 13; or(c) the sequence encoding the heavy chain variable region comprises SEQ ID NO: 11 and the sequence encoding the light chain variable region comprises SEQ ID NO: 14.
15. A cell comprising the vector of claim 11 or the vector or set of vectors of any one of claims 12-14.1 . The cell of claim 15, wherein the cell is a bacterial cell, a yeast cell, or an isolated mammalian cell.
17. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of any one of claims 1 -9 and a pharmaceutically acceptable carrier or excipient.
18. A T-cell comprising a chimeric antigen receptor comprising the CDRs of the antibody or antigen-binding fragment thereof of any one of claims 1-9.
19. The antibody or antigen-binding fragment thereof of any one of claims 1-9, wherein the antibody or antigen-binding fragment thereof is conjugated to one or more of a cy tot oxin, a fluorescent label, and an imaging agent.
20. A kit for detecting the presence of HCMV, or an antigenic fragment of HCMV thereof, in a sample comprising: (i) the antibody or antigen-binding portion thereof of any one of claims 1-9, and (ii) a buffer.
21. The kit of claim 20, wherein the antibody or antigen-binding portion thereof is bound to a substrate.
22. The kit of any one of claims 20-21, wherein the antibody or antigen-binding portion thereof is detectably labeled.
23. The kit of any one of claims 20-22. the kit further comprising a secondary antibody that specifically binds to the antibody or antigen-binding portion thereof.
24. The kit of claim 23, wherein the secondary antibody is an anti-IgG antibody.
25. The kit of any one of claims 23-24, wherein the secondary antibody is detectably labeled.
26. A method of making an antibody or antigen-binding fragment thereof that binds to HCMV, the method comprising:(i) providing a cell comprising one or more nucleic acid molecules encoding the antibody or antigen-binding fragment thereof of any one of claims 1-9;(ii) expressing in the cell the antibody or antigen-binding fragment thereof; and(iii) collecting the antibody or antigen-binding fragment thereof.
27. A method of detecting the presence of HCMV, or an antigenic fragment thereof, in a sample comprising:(i) obtaining a sample containing, or suspecting of containing, HCMV, or an antigenic fragment thereof;(ii) contacting the sample with the antibody or antigen-binding fragment thereof of any one of claims 1-9; and(iii) detecting the presence of specific binding of the antibody or antigen-binding fragment thereof to HCMV, or an antigenic fragment thereof.
28. The method of claim 27, further comprising quantifying the amount of HCMV, or antigenic fragments thereof, present in the sample.
29. The method of any one of claims 27-28. wherein the sample is an environmental sample.
30. The method of any one of claims 27-28, wherein the sample is a biological sample.
31. A method of treating an HCMV infection in a subject in need thereof, the method comprising administering to the subject the antibody or antigen-binding fragment thereof of any one of claims 1-9 or the pharmaceutical_composition of claim 17.
32. The method of claim 31, the method further comprising administering to the subject at least one additional anti-HCMV antibody or antigen-binding portion thereof.
33. The method of claim 32, wherein the at least one additional anti-HCMV antibody, or antigen-binding portion thereof, is an antibody or antigen-binding fragment thereof of any one of claims 1-9.
34. The method of any one of claims 31-33, the method further comprising administering to the subject at least one additional antiviral composition.
35. The method of claim 34, wherein the at least one additional antiviral composition is selected from the group consisting of ganciclovir, valganciclovir, foscamet, cidofovir, and combinations thereof.
36. A method of preventing an HCMV infection in a subject comprising administering to the subject the antibody or antigen-binding fragment thereof of any one of claims 1-9 or the pharmaceiitical composition of claim 17.
37. A method of diagnosing a subject as having an HCMV infection comprising:(i) identifying a subject;(ii) obtaining from the subject a biological sample containing HCMV or an antigenic fragment thereof;(iii) contacting the sample with the antibody or antigen-binding fragment thereof of any one of claims 1 -9;(iv) detecting the presence of specific binding of the antibody or antigen-binding fragment thereof to HCMV, or an antigenic fragment thereof; and(v) diagnosing the subject as having an HCMV infection.
38. A method of inhibiting binding of HCMV glycoprotein gH and / or glycoprotein gL to a cellular surface protein, the method comprising contacting gH and / or gL with the antibody or antigen-binding fragment thereof of any one of claims 1-9 or the pharmaceutical_composition of claim 17.
39. The method of claim 38, wherein the cellular surface protein is selected from the group consisting of Nectin 1. EphA2, Nrp2, PDGFRalpha.
40. The antibody or antigen-binding fragment thereof of any one of claims 1-9 for use in medicine.
41. The antibody or antigen-binding fragment thereof of any one of claims 1-9 for use in treating or preventing an HCMV infection.
42. Use of the antibody or antigen-binding fragment thereof of any one of claims 1-9 in the manufacture of a medicament for use in treating or preventing an HCMV infection.
43. A method of reducing the infection of a cell with HCMV, the method comprising contacting the cell with the antibody or antigen-binding fragment thereof of any one of claims 1-9 or the pharmaceutical composition of claim 17.
44. The method of claim 43, wherein the cell is a fibroblast, an epithelial cell, or a trophoblast.
45. A method of inhibiting HCMV dissemination, replication, and spread in a subject in need thereof, the method comprising administering to the subject the antibody or antigen-binding fragment thereof of any one of claims 1-9 or the pharmaceutical composition of claim 17.
46. A method of treating an HCMV infection in a subject in need thereof, the method comprising administering to the subject two anti-viral agents that target HCMV at different stages of the viral life cycle, wherein one of the anti-viral agents comprises the antibody or antigen-binding fragment thereof of any one of claims 1-9.
47. The method of any one of claims 31-37, 45, or 46, wherein the subject is a human.
Citation Information
Patent Citations
Broadly neutralizing Anti-human cytomegalovirus (HCMV) antibodies and methods of use thereof
WO2017196819A2
BTLA-binding (CD272) antibodies for modulating immune response and treating disease
WO2020205849A1
Anti-SIRP-alpha antibodies and methods of use thereof
WO2023010076A1