Conferring resistance to cyanide toxicity
Administering PHD or FIH inhibitors enhances cyanide resistance by promoting glycolysis and altering mitochondrial architecture, effectively mitigating the toxic effects of cyanide exposure.
Patent Information
- Application Number
- PCT/US2025/031672
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-31
- Filing Date
- 2025-05-30
- Publication Date
- 2025-12-04
AI Technical Summary
Cyanide is highly lethal and poses a significant risk to human health through various exposure routes, with existing treatments lacking effective methods to confer resistance or mitigate its toxic effects.
Administering pharmacological inhibitors of Prolyl Hydroxylase Domain enzymes (PHDs) or Factor Inhibiting HIF (FIH) to enhance cyanide resistance by diverting metabolism towards glycolysis and altering mitochondrial architecture, thereby reducing the toxicity of cyanide.
The approach significantly increases cyanide resistance in living organisms, reducing the risk of systemic, neurological, and other adverse health effects associated with cyanide poisoning.
Smart Images

Figure IMGF000006_0001 
Figure IMGF000007_0001 
Figure IMGF000016_0001
Abstract
Description
[0001] CONFERRING RESISTANCE TO CYANIDE TOXICITY
[0002] CLAIM OF PRIORITY
[0003] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 654,356, filed on May 31, 2024. The entire contents of the foregoing are incorporated herein by reference.
[0004] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0005] This invention was made with Government support under Grant No.
[0006] NS 112107 awarded by the National Institutes of Health. The Government has certain rights in the invention.
[0007] TECHNICAL FIELD
[0008] Provided herein are methods and compositions comprising pharmacological inhibitors of HIF hydroxylases (e.g., or more inhibitors of Prolyl Hydroxylase Domain enzymes (PHDs) or Factor Inhibiting HIF (FIH)) for enhancing cyanide resistance in living organisms.
[0009] BACKGROUND
[0010] The term cyanide refers to the cyanide anion- CN' producing compounds that release CN' into aqueous solutions including the colorless gas of hydrogen cyanide (HCN) or salts of CN'1like sodium cyanide (NaCN) or potassium cyanide (KCN). Cyanide is highly lethal whether inhaled as a gas, ingested in solid form, or absorbed through tropical exposure.
[0011] SUMMARY
[0012] Provided herein are methods of reducing risk of cyanide poisoning in a subject, the methods comprising administering to the subject a therapeutically effective amount of one or more inhibitors of Prolyl Hydroxylase Domain enzymes (PHDs) or Factor Inhibiting HIF (FIH). Also provided are compositions comprising one or more inhibitors of Prolyl Hydroxylase Domain enzymes (PHDs) or Factor Inhibiting HIF (FIH), for use in a method of reducing risk of cyanide poisoning in a subject. In some embodiments, the one or more inhibitors of PHD or FIH are selected from daprodustat, roxadustat, enarodustat, molidustat, vadadustat, IOX5, desidustat, BNS, N-hydroxythiazole-based analogs of BNS; or analogs of desidustat.
[0013] In some embodiments, the one or more inhibitors of PHD or FIH are broadspectrum 20G oxygenase inhibitors.
[0014] In some embodiments, the broad-spectrum 20G oxygenase inhibitor is pyridine-2,4-dicarboxylic acid (2,4-PDCA) or N-oxalylglycine (NOG).
[0015] In some embodiments, the one or more inhibitors of PHD or FIH is N-oxalyl- D-phenylalanine (NOFD) or dimethyl N-oxalyl-D-phenylalanine (DM-NOFD).
[0016] In some embodiments, the subjects are likely to be exposed to cyanide within 12-48, or 12-24, or 12-18 hours.
[0017] In some embodiments, the subject is a fire fighter, soldier, healthcare, law enforcement, or military personnel.
[0018] In some embodiments, the subject is living in an area with high levels of cyanide in the environment, or regularly consumes foods that are high in cyanide.
[0019] In some embodiments, the subject is employed in an industry that uses cyanide.
[0020] In some embodiments, the inhibitor is daprodustat. In some embodiments, the daprodustat is administered, or is formulated to be administered, orally, e.g., once or twice a day, optionally in a dose of 2-8 mg.
[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0022] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. DESCRIPTION OF DRAWINGS
[0023] FIGs. 1 A-C. Whole embryo RNA sequencing to identify differentiating cyanide targets. a. Schematic representation of methodology for whole embryo RNA sequencing. b. Principal component analysis of the four groups. c. Volcano plot depicting the log fold change and the log P value of differential expression analysis between the control verses cyanide treated embryos during development. Genes that are regulated by hypoxia pathway are shown in bold and their biological pathway are highlighted in red.
[0024] FIGs. 2A-D. Cyanide resistance is conferred by inhibiting HIF-la feedback loop. a. qRT-PCR mRNA analysis of hif-la, hifan, eglnl, egln2, egln3, and vhl in whole embryos (N=4). Circles represent untreated and squares represent cyanide treated. b. Representative western blot depicting changes in hif-la and hifan / FIH upon cyanide treatment between 2 dpf and 7 dpf embryos. c. Quantification of fold change of hif-la and hifan / FIH upon cyanide treatment between 2 dpf and 7 dpf embryos (N=4). Circles represent untreated and squares represent cyanide treated. d. Representative immunofluorescence staining of hif-la, FIH, Phalloidin and DAPI of H9C2 cells treated with cyanide or cobalt chloride as a chemical hypoxia mimetic agent.
[0025] FIGs. 3A-E. Cyanide enhances glycolysis via HIF-la. a. Expression of pyruvate dehydrogenase kinase isoforms at the transcript level from whole embryo RNA sequencing. b. Extracellular acidification rate (ECAR) of embryos with hif-la acute CRIPSR at 2 dpf with or without cyanide treatment. Embryos with hypoxia treatment is used as a control (N=4). c. Survival of embryos at 2 dpf in cyanide with pretreatment of AZ-67 or 2- DG. LD50DMSO / 2dpf is 27590 pM (95% Cl-22500 pM-34090 pM), LD50AZ-67 10 pM / 2dpf is 2863 pM (95% Cl-2229 pM-3681 pM), LD50AZ-67 20 pM / 2dpf is 392.2 pM (95% Cl-335.5 pM-457.2 pM) and 2DG / 2dpf is 3391 pM (95% Cl-2713 pM- 4249 pM) (N=4). d. ECAR changes during glycolysis stress test of H9C2 cells pretreated with DMSO or ECM (100 nM), with or without cyanide. Cobalt chloride treated cells serve as hypoxia controls (N=4). e. Quantification of basal glycolysis and glycolytic capacity during glycolysis stress test of H9C2 cells pretreated with DMSO or ECM (100 nM), with or without cyanide (N=4). Circles represent untreated and squares represent cyanide treated.
[0026] FIGs. 4A-F. Altered mitochondrial architecture confers cyanide resistance. a. Representative confocal images of live H9C2 cells labeled with Mitotracker and DAPI pretreated with DMSO or ECM (100 nM), with or without cyanide. b. Representative immunofluorescence staining of TOMM20, Tubulin and DAPI of H9C2 cells pretreated with DMSO or ECM (100 nM), with or without cyanide. Pink box represents zoomed mitochondrial structure. c. Quantification of mito aspect ratio and mito form factor of H9C2 cells pretreated with DMSO or ECM (100 nM), with or without cyanide. Circles represent untreated and squares represent cyanide treated. d. Expression of mitochondrial fission factor and dynamin related protein at the transcript level from whole embryo RNA sequencing. e. Oxygen consumption rate changes during mitochondrial stress test and f. Mitochondrial function test parameters of embryos with hif-la acute CRIPSR at 2 dpf with or without cyanide treatment (N=4).
[0027] FIGs. 5A-F. Alteration of HIF-la. pathway changes cyanide resistance a. Survival of embryos with hif-la or FIH acute CRIPSR at 2 dpf in cyanide. LD50control gRNA / 2dpf is 28970 pM (95% Cl-23950 pM-35250 pM), LD50HIF-la gRNA / 2dpf is 68.7pM (95% Cl-52.1 pM-90.5 pM) and LD50FIH gRNA / 2dpf is 105400 pM (95% Cl-82630 pM-139000 pM). b. Representative western blot depicting changes in hif-la and hifan / FIH upon cyanide treatment in 7 dpf embryos with FIH acute CRISPR. c. Survival of embryos with FIH acute CRIPSR at 7 dpf in cyanide. LD50 control gRNA / 7dpf is 18.2 pM (95% Cl-14.95 pM-22.0 pM) and LD50FIH gRNA / 7dpf is 45.9 pM (95% Cl-35.7 pM-58.9 pM). d. Survival of embryos pretreated with HIF hydroxylase inhibitors at 7 dpf in cyanide. LD50DMSO / 7dpf is 17.8 pM (95% Cl-14.8 pM-21.2 pM), LD50Daprodustat (100 pM) / 7dpf is 116.1 pM (95% Cl-93.1 pM-146.2 pM), LD50DM- NOFD (50 pm) / 7dpf is 79.1 pM (95% Cl-62.7 pM-100.2 pM) and LD50Daprodustat (100 pM) and DM-NOFD (50 pM) / 7dpf is 116.1 pM (95% Cl-93.1 pM-146.2 pM). e. Oxygen consumption rate changes during mitochondrial stress test and f. Mitochondrial function test parameters of H9C2 cells pretreated with DMSO or Daprodustat (10 pM) with or without cyanide (N=4).
[0028] FIGs. 6A-C. Acute CRISPR of HIF-la. a. Acute CRISPR target sequence with gene location and mosaic gene edits identified by DNA sequencing. Shown are SEQ ID NOs. 1-7. b. qRT-PCR mRNA analysis of hif-la, hifan, in whole embryos with hif-la acute CRIPSR(N=4). Circles represent untreated and squares represent cyanide treated. c. Representative western blot depicting changes in hif-la and hifan / FIH upon cyanide treatment in 2 dpf embryos with hif-la acute CRISPR.
[0029] FIGs. 7A-B. Mitochondrial architecture changes with mitochondrial depolarization and hypoxia. a. Ratio of JC-10 red to green fluorescence as percentage of DMSO treated H9C2 cells, FCCP and cyanide treated cells. b. Representative immunofluorescence staining of TOMM20 and DAPI of H9C2 cells treated with FCCP or cobalt chloride as a chemical hypoxia mimetic agent. Pink box represents zoomed mitochondrial structure.
[0030] FIG. 8. Acute CRISPR of FIH Acute CRISPR target sequence with gene location and mosaic gene edits identified by DNA sequencing. Shown are SEQ ID NOs. 8-15.
[0031] DETAILED DESCRIPTION
[0032] Cyanide is a metabolic poison, and its toxicity is associated with metabolic impairment. It poses as a risk to human health as an agent in chemical warfare, occupational exposure, and smoke inhalation during fire. It has multiple targets, but the best understood is that of Complex IV also known as the cytochrome c oxidase of the electron transport chain in the mitochondria. Cyanide inhibits Complex IV by binding to heme a3 moiety of Complex IV, preventing transfer of electrons to oxygen thereby blocking electron transfer across the electron transport chain in the mitochondria. This blocks a crucial part of metabolism- oxidative phosphorylation and results in rapid depletion of ATP and bioenergetic failure. Inhibition of Complex IV also prevents mitochondrial utilization of molecular oxygen, reducing cellular consumption of oxygen leading to histotoxic hypoxia in which oxygen delivery to tissues is normal but there is reduced utilization of oxygen via oxidative phosphorylation. There are other known biochemical targets of cyanide including several metalloenzymes, antioxidant enzymes, sulfhydryl compounds. Cyanide also increases intracellular calcium levels, direct redox modulation, and activation of N- methyl-D-aspartate (NMD A) receptor function along with nitric oxide and reactive oxygen species generation (ROS) production1 7. Molecular mechanisms focusing on intracellular cascades that are activated to produce apoptosis or necrosis in neuronal cells have highlighted other cellular targets of cyanide8 l 0. Mitochondrial Uncoupling Protein-2 (UCP-2) has been identified as a molecular switch that controls the mode of cell death from apoptosis to necrosis by potentiating mitochondrial dysfunction11.
[0033] In Zebrafish (Dariio rerio), sensitivity to cyanide depends on developmental stage; during early stages of development embryos are extremely resistant to cyanide and their sensitivity increases with development.12'14Other studies have made similar observations where survival of embryos to anoxia (acute hypoxia) and chemical inhibition of oxidative phosphorylation is inversely proportional to its developmental stage. Prolonged treatment of zebrafish embryos to anoxia or cyanide leads to a reversible suspended animation at earlier developmental stage of the embryos12 l 4. In the present study, a comparative approach has been taken to understand the different biological responses to cyanide between the resistant embryos at 1 day post fertilization (dpf) and sensitive embryos at 6 dpf.
[0034] Our comparative analysis of the whole embryo RNA sequencing between the resistant and sensitive embryos highlighted upregulation of the hypoxia signaling pathway. Changes in oxygen utilization or availability serves as a critical physiological stimulus which activates the adaptive hypoxia signaling pathway. Hypoxia inducible factor (HIF) is a heterodimeric transcriptional factor composed of an oxygen sensitive a subunit (HIF- la or HIF-2a) and a constitutively expressed 0 subunit (HIF- 10) and serves as a key regulator of the transcriptional responses to shift in oxygenation. Under physiological oxygen concentration the abundance and transactivation of the HIF -a subunit is regulated by hydroxylation of two prolyl residues (Pro402 and Pro564 in human HIF-la in the oxygen dependent degradation domain (ODDD)) by prolyl hydroxylases (PHD 1-3) enzyme and hydroxylation of an asparagine reside (Asn803 in the C-terminal transactivation domain (CTAD)) by the hydroxylase domain protein factor inhibiting HIF (FIH) respectively. Hydroxylated HIF -a is recognized by the 0-domain of von Hippel-Lindau tumor suppressor protein (pVHL) and is subsequently ubiquitylated by the Elongin BC / Cul2 / pVHL ubiquitinligase complex targeting it for degradation by the 26S proteasome. Both PHD and FIH hydroxylase enzyme’s function using molecular oxygen and 2-oxoglutarate (2- OG) as co-substrates and Fe (II) and a reductive agent like ascorbate as co-factors, serving as cellular oxygen sensors. Under low oxygen concentration or hypoxia, HIF- escapes hydroxylation and dimerizes with HIF-0 allowing transactivation at the hypoxia-response elements (HREs) promoting subset of genes which regulate cellular adaptions to hypoxia. These responses include metabolic adaptions, angiogenesis, cell cycle control, extracellular matrix (ECM) remodeling15 21
[0035] The present data revealed that the hypoxia signaling pathway is differentially regulated between resistant and sensitive embryos. In developing embryos, the regulatory hydroxylase enzymes (PHD’s and FIH) are inhibited allowing sustained hypoxia signaling. This allows metabolic adaptations to sustain the embryos by diverting metabolism towards glycolysis away from the cyanide inhibited oxidative phosphorylation. Knockdown of hypoxia pathway reverses cyanide resistance in developing embryos.
[0036] Thus, pharmacological inhibition of HIF hydroxylases enhances cyanide resistance in living organisms.
[0037] Methods of Improving Cyanide Resistance
[0038] Provided herein are methods for improving or increasing cyanide resistance, e.g., resistance to negative health effects of cyanide poisoning including systemic (e.g., cardiovascular or respiratory effects), immunological, neurological, reproductive, developmental, genotoxic, and carcinogenic effects, including death. The methods can decrease the risk of systemic acidosis, seizures, cardiac arrhythmias, and cardiac or respiratory arrest. See also Toxicological Profile for Cyanide. Atlanta (GA): Agency for Toxic Substances and Disease Registry (US); 2006 Jul. 3, HEALTH EFFECTS. Available from: ncbi.nlm.nih.gov / books / NBK600901 / .
[0039] The methods can be used for treating subjects who are likely to be, or who have been, exposed to cyanide, either acutely or chronically. Smoke inhalation is the most common cause of cyanide poisoning in western countries (Alcorta, R. (2004). “Smoke inhalation & acute cyanide poisoning. Hydrogen cyanide poisoning proves increasingly common in smoke-inhalation victims.” JEMS 29, suppl 6-15; quiz suppl 16-17; Barillo, D.J., Goode, R., and Esch, V. (1994). “Cyanide poisoning in victims of fire: analysis of 364 cases and review of the literature.” J Burn Care Rehabil 15, 46-57). Thus the methods can be used, e.g., in subjects who are likely to be exposed to cyanide, including fire fighters, soldiers, and other healthcare, law enforcement, or military personnel, as well as people living in an area with high levels of cyanide in the environment, who regularly consume foods that are high in thiocyanates or cyanogenic glucosides including cassava, lima beans and others, or who are employed in an industry that uses cyanide, e.g., manufacturing of paper, textiles and plastics; developing photographs; metallurgy, including electroplating, metal cleaning, and removing gold from its ore; and extermination of pests and vermin.
[0040] The present methods can include the administration of inhibitors of Prolyl Hydroxylase Domain enzymes (PHDs) or inhibitors of Factor Inhibiting HIF (FIH). PHD and FIH inhibitors can include PHD selective inhibitors roxadustat, daprodustat, enarodustat, molidustat, vadadustat, IOX5 (68, example 46 of WO2024157019A1 and Lawson et al., Nat Cancer. 2024 Jun;5(6):916-937), desidustat, BNS, N- hydroxythi azole-based analogs of BNS, e.g., compounds 4, 15-23, 26, 38, 39, 42, 42b, described in Comer et al., Chem Sci. 2023 Oct 27; 14(43): 12098-12120; and analogs of desidustat (e.g., compounds 32, 40, 41, and 50 as described in Comer et al., J Med Chem. 2025 May 8;68(9):9777 -9798; broad-spectrum 2OG oxygenase inhibitors (e.g., pyridine-2,4-dicarboxylic acid (2,4-PDCA) and N-oxalylglycine (NOG)); and more FIH-selective inhibitors such as N-oxalyl-D-phenylalanine (NOFD) and its dimethyl ester prodrug form dimethyl N-oxalyl-D-phenylalanine (DM-NOFD). Other inhibitors are described in WO2024157019A1; Comer et al., Chem Sci. 2023 Oct
[0041] 27; 14(43): 12098-12120; Comer et al., J Med Chem. 2025 May 8;68(9):9777 -9798; US 2020 / 0017492; US 2007 / 0299086; W02004035812; US8691866; and
[0042] US11643397. See also Liu et al., Expert Opin Ther Pat. 2024 Aug;34(8):651-664.
[0043] The methods can include administration of a pharmaceutical composition comprising or consisting of an inhibitor as described herein as an active agent.
[0044] Pharmaceutical compositions typically include a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions, e.g., chelation agents (e.g., cobalt-containing compounds like hydroxocobalamin (Cyanokit) and dicobalt edetate (Kelocyanor), or Sodium nitrite and sodium thiosulfate) or with glyoxylate cyanide antidotes.
[0045] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral, nasal (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
[0046] Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY). For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0047] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0048] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0049] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. Tablets comprising daprodustat, for example, are known in the art, and can be used orally, e.g., once or twice a day, optionally in a dose of 2-8 mg, or an equivalent dose of another agent.
[0050] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressured container or dispenser that contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Patent No. 6,468,798.
[0051] Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
[0052] The pharmaceutical compositions can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery. In some embodiments, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques, or obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to selected cells with monoclonal antibodies to cellular antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
[0053] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
[0054] EXAMPLES
[0055] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0056] Methods
[0057] The following materials and methods were used in the Examples below.
[0058] Zebrafish husbandry and use
[0059] Zebrafish use and maintenance were performed according to the animal protocols approved by the Institutional Animal care and Use Committee (IACUC) of Brigham and Women’s Hospital and Harvard Medical School. Experiments were performed on embryos or larvae ages between 1 and 7 dpf and were maintained in E3 embryo medium (containing 5 mM NaCl, 0.17 mM KC1, 0.33 mM CaCh, 0.33 mM MgSO4and 10 mM HEPES pH 7.1) at 28°C.
[0060] For hif-lan" ' (sa38947) was purchased from ZIRC, hif-lan+Awere incrossed and the resulting embryos were raised to adulthood, followed by fin cliiping to determine their respective genotype. Briefly, individual adult fish was anesthetized with tricaine methanesulfonate (220-226; Syndel) and a small section of their tail fin was cut to extract gDNA using 50 mM NaOH (heated at 95°C for 10 minutes). Following that, IM Tris ph8 was added and centrifuged at 12000 rpm for 5 minutes. PCR was performed using Quick-Load Taq 2X master mix (M0271L; NEB). Cell culture
[0061] H9c2 embryonic rat heart-derived ventricular cells (myoblast) were purchased from ATCC (CRL-1446; ATCC) and were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (11965118; ThermoFisher Scientific) with 10% fetal bovine serum (F2442; Sigma) and 1% Penicillin-Streptomycin solution (15140122; Life Technologies) at 37°C and 5% CO2.
[0062] Cyanide, drug or chemical administration and survival studies
[0063] In zebrafish embryos, KCN treatment and survival studies were done according to our previous work14Briefly, KCN and other drugs were dissolved in E3 medium and added to either 6 well plate (for collecting samples for qPCR or western blot) or 96 well plate (for KCN survival assay). Following the addition of KCN, plates were sealed with PCR plate foil (MSB 1001; BIO-RAD) having both control and KCN treated embryos. Treatment times are indicated in Figure legends in hpf (hours post fertilization) and dfp (days post fertilization). For drugs dissolved in DMSO, control wells were treated with DMSO and did not exceed 1% volume / volume. The following drugs were used in this study: AZ-67 ((2S)-N-[4-[[3-Cyano-l-[(3,5-dimethyl-4- isoxazolyl)methyl]-lH-indol-5-yl]oxy]phenyl]-2-pyrrolidinecarboxamide; 5742; TOCRIS), echinomycin (ECM) (SML0477; Sigma), daprodustat (S8171; SelleckChem), DM-NOFD (SML1874; Sigma).
[0064] The following chemicals were used in this study: cobalt chloride (C8661; Sigma), 2-Deoxy-D-glucose (2DG) (D6134; Sigma), FLT1 / KDR tyrosine kinase inhibitor 676475 (HY-13785; MedChem Express), Oligomycin A (75351; Sigma), rotenone (R8875;Sigma), antimycin (A8674; Sigma), Carbonyl cyanide 4- (trifluoromethoxy)phenylhydrazone (FCCP) (C2920; Sigma) and potassium cyanide (KCN) (60178; Sigma).
[0065] Cyanide survival studies were carried out for treating with the indicated doses of KCN for 3 hours followed by recording survival. The dose that caused 50% lethality was reported as LD50. Lethality was defined as the absence of a heartbeat.
[0066] In H9c2 cells, KCN and other drugs or chemicals are treated in DMEM with 10%FBS in 6-well plates (for collecting samples for qPCR or western blot) or in 96 well plates (for Seahorse assay and JC10 assay). Following the addition of KCN, plates were sealed with PCR plate foil (MSB 1001; BIO-RAD) having both control and KCN treated cells. Primary and secondary antibodies
[0067] The following monoclonal or polyclonal primary antibodies were used in immunofluorescence or immunoblotting experiments: Anti-HIF-la (NB100-134; Novus Biologicals), Anti-FIH (MA5-37749; Invitrogen), Anti-GAPDH (60004-1-Ig; Proteintech), Anti-TOMM20 (PA5-52843; Thermo Fisher Scientific), Anti-Tubulin (T6199; Sigma).
[0068] The following secondary antibodies were used in Western blots: Anti-rabbit IgG, HRP-linked antibody (7074S; Cell signalling) and Anti-Mouse HRP (7076S; Cell signalling).
[0069] The following secondary antibodies were used in immunofluorescence: Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ Plus 488 (A32790; Fisher Scientific), Goat anti-Mouse IgG (H+L) Highly Cross- Adsorbed Secondary Antibody, Alexa Fluor™ Plus 546 (A- 11030; Invitrogen) and Alexa Alexa Fluor™ Plus 647 Phalloidin (A30107; Fisher Scientific)
[0070] Analysis of RNA sequencing data
[0071] Total RNA was isolated from 2 days post fertilization (dpf) and 7 dpf embryos with or without KCN treatment at indicated doses and duration followed by RNA extraction with TRIzol™ Reagent (15596026; Thermo Fisher Scientific). Each group had four biological replicates with 30 embryos per group. cDNA was generated using the SMART-seq v4 kit (Takara bio) and the concentration was checked by Qubit. The libraries were sequenced on the Illumina HiSeq 2500 (2x150 bp reads). Reads were mapped to zebrafish genome version GRCzl 1 and quantified STAR v2.5.b. Reads were mapped to zebrafish genome version GRCzl 1 and quantified STAR v2.5.b. Using DESeq2, a comparison of gene expression between groups was performed. The Wald test was used to generate p-values and log2 fold changes.
[0072] Acute CRISPR-mediated knockdown
[0073] Guide RNA targeting a gene of interest were designed using CHOPCHOP22. cRNA’s were synthesized (Integrated DNA Technology) and annealed with tracrRNA and mixed with Alt-R S.p HiFi Cas9 Nuclease V3 (Integrated DNA Technology) to form ribonucleoprotein complex. The combined complex (1 nl) was injected into onecell stage of zebrafish embryos. The table below indicates the target sequence, chromosome location and primers used for sequencing the edits.
[0074] Live cell imaging
[0075] For imaging in cells, H9c2 cells were seeded in m-sLIDE 8 WELL GLASS BOTTOM IBDI chamber (80827; IBIDI) and allowed to attach overnight followed by indicated treatments. Media was replaced with FluoroBrite DMEM (Al 896701; Thermo Fisher Scientific) and incubated with 100 nM of MitoTracker™ Green (M7514; Invitrogen) at 37°C for 30 minutes. After 30 minutes, the cells were washed twice with PBS (10010-023; Fisher Scientific) and incubated with fresh FluoroBrite DMEM with Hoescht (H3569; Invitrogen) at 37°C for 5 minutes. The cells were washed twice and imaged in FluoroBrite DMEM. Confocal images were acquired at 100X magnification in an upright Olympus F VI 200 microscope.
[0076] Evaluation of mitochondrial membrane potential
[0077] Mitochondrial membrane potential was measured in H9c2 cells following indicated treatments by JC10 dye (Abeam; abl 12134) following the manufacturer’s protocol.
[0078] Glycolysis Stress test in cells and ECAR recording in embryos.
[0079] Glycolysis stress test was done in H9c2 cells by using Seahorse XF Glycolysis Stress Test Kit (103020-100; Agilent) following the manufacturer’s protocol. The following final concentrations were used- Glucose at 10 mM, Oligomycin at ImM and 2-DG at 50 mM. Extracellular acidification rate (ECAR) was recorded in Seahorse XF96 Extracellular Flux Analyzer (Seahorse Bioscience, North Billerica, MA, USA). The data is normalized to total protein quantified with BCA kit (23227; ThermoFisher Scientific). For measurement of ECAR in zebrafish embryos, Seahorse XF24 Islet Capture FlucPak (101122-100; Agilent) was used and recorded in Seahorse XF24 Extracellular Flux Analyzer (Seahorse Bioscience, North Billerica, MA, USA) in E3 media supplemented with 20 mM HEPES pH 7.2.
[0080] Mito Stress test in cells and in embryos.
[0081] Mitochondrial stress test was done in H9c2 cells by using Seahorse XF Mito Stress Test Kit (103015-100; Agilent) following manufacturer’s protocol. The following final concentrations were used- Oligomycin at 1.5 mM, FCCP at ImM and Rotenone / Antimycin A at 0.5mM. Oxygen consumption rate (OCR) was detected using was recorded in Seahorse XF96 Extracellular Flux Analyzer (Seahorse Bioscience, North Billerica, MA, USA). The data is normalized to total protein quantified with BCA kit.
[0082] For zebrafish embryos, mitochondrial stress test was performed as previously reported23. Breifly, individual embryos after treatment or injections are placed within individual wells of Seahorse XF24 Islet Capture FlucPak (101122-100; Agilent) in E3 media supplemented with 20 mM HEPES pH 7.2.
[0083] The following final concentrations were used- Oligomycin at 12 mM, FCCP at 2.5 mM and Rotenone / Antimycin A at 1 mM. Oxygen consumption rate (OCR) was detected using was recorded in Seahorse XF24 Extracellular Flux Analyzer (Seahorse Bioscience, North Billerica, MA, USA).
[0084] RT-qPCR in cells and in embryos.
[0085] Total RNA was extracted from pooled embryos or H9c2 cells using TRIzol™ Reagent (15596026; Thermo Fisher Scientific). cDNA was synthesized from 1 mg of RNA using iScript SuperMix (1708841; BIORAD). Real time PCR was performed using iTaq Universal SYBR Green Supermix (1725124; BIORAD). Relative expression levels were calculated using the cycle number method and was normalized to eel fa for embryos.
[0086] The following primers were used for zebrafish embryo samples- eglnlb Forward: TGGAGATGGGAGATGTGTCA (SEQ ID NO:22) eglnlb Reverse: ACTGAGCTGTTCCCTCTGGA (SEQ ID NO:23) egln2 Forward: ACGCTCCTGAAGGACTCAAA (SEQ ID NO:24) egln2 Reverse: TGTAAACGCTTGCTCTGTGC (SEQ ID NO:25) egln3 Forward: AAGTTCAGCCGTCGTATGCT (SEQ ID NO:26) egln3 Reverse: CCTGTGAGATGGCTGTGAGA (SEQ ID NO:27) vhl Forward: AGCGGGTGGAACAGAAGTTA (SEQ ID NO:28) vhl Reverse: TTGTTGGTTGATGCACAGGT (SEQ ID NO:29) hif-la Forward: ACTTCCAGCTGCGGACTGTT (SEQ ID NO:30) hif- la Reverse: TGTGGTCCTGCACTGTGGTT (SEQ ID N0:31) hif-lan Forward: CCCTTTCAGACCATCGGCCT (SEQ ID NO:32) hif-lan Reverse: CGCGGTATTTGTCGGGTTGG (SEQ ID NO:33) eelfa Forward: CCTTTGGAACGGTGTGATTGA (SEQ ID NO:34) eelfa Reverse: CCCTCCTCTTGGTCGCTTT (SEQ ID NO:35)
[0087] Immunofluroscence in H9c2 cells
[0088] Cells were cultured in 22 mm square cover slips (102222; Epredia) and following indicated treatment, cells were washed twice with PBS and fixed with 4% PFA (128800; Life Tech) followed by permeabilization with 0.1% Triton™ X-100 (T8787; Sigma) in PBS (PBST). The cells were blocked in 3% bovine serum albumin (A3294; Sigma) in PBST for one hour followed by overnight incubation at 4°C with the primary antibodies (1 : 100 dilution in 3% bovine serum albumin containing PBST). The cover slips were washed three times in PBST and incubated with the secondary antibodies (1 :200 dilution in 3% bovine serum albumin containing PBST) for one hour at room temperature. Following three washes with PBST, the cover slips were mounted on glass slide (1255015; Fisher Scientific) using Prolong™ Gold antifade reagent with DAPI (P36935; Invitrogen). Confocal images were acquired at 100X magnification in an upright Olympus F VI 200 microscope.
[0089] Immunoblotting with embryos and H9c2 cells
[0090] Embryos or cells were lysed in RIPA buffer (R0278; Sigma) supplemented with cOmplete™ EDTA free protease tablets (469159001; Sigma) and PhosSTOP™ phosphatase inhibitor tablet (4906845001; Sigma). Lysates were cleared by centrifugation at 13200 rpm at 4°C for 15 minutes. Total protein is quantified by Pierce™ BCA protein assay and 20-30 mg (for cells) or 50-60 mg (for embryos) was separated using SDS-polyacrylamide gel electrophoresis using precast gel (4561083; BIORAD). The separated proteins were transferred to PVDF membrane (1620174; BIORAD). The membrane was blocked using 5% non-fat milk (9999S; Cell signalling) in Tris buffered Saline with 0.1% Tween 20 (P7949; Sigma) (TBST) for one hour at room temperature followed by incubation with respective primary antibodies (1 :1000 dilution in 5% bovine serum albumin containing TBST) at 4°C overnight. The following day, the membrane was washed thrice in TBST followed by incubation with the secondary antibodies (1 : 1000 dilution in 5% bovine serum albumin containing TBST) at room temperature for one hour. The membrane was washed thrice and developed in iBright™ FL1000 (ThermoFisher Scientific) using Prosignal Femto ECL reagent (20-302; Genesee Scientific).
[0091] Quantification and Statistical Anlaysis
[0092] For quantification of mitochondrial architectural parameters: Mitochondria analyzer plugin was used from ImageJ. For quantification of tubulin intensity: Region of interest (ROI) was cropped, background fluorescence was subtracted, thresholded and quantified. For quantification of Western blot protein bands: iBright™ Analyzer was used. Biological replicates in experiments involving zebrafish embryo or larvae refers to independent groups obtained from different clutches of embryos obtained from different spawning pairs. Biological replicates in experiments involving cells refers to independent experiments done with different cell passage numbers. All experiments were done within passage 3-8. Data analysis was done using GraphPad Prism 10 (version 10.4.1) and figures were assembled using Adobe Illustrator (29.3.1).
[0093] Example 1. Whole embryo RNA sequencing identifies a differentially regulated hypoxia pathway.
[0094] To investigate the biological mechanisms that support cyanide resistance, whole embryo RNA sequencing was performed for resistant embryos at 1 dpf with 100 pM of KCN for 16 hours (inducing non -lethal suspended animation) and sensitive embryos at 6 dpf with 10 pM of KCN for 16 hours (maximum non -lethal dose tolerated at this stage) (Fig. la).
[0095] The PCA plot (FIG. IB) depicts the four data points 2 dpf / untreated, 2 dpf / CN treated, 7 dpf / untreated and dpf / CN treated and its variation within the data. Volcano plot depicting the log fold change and the log P value of differential expression analysis between the control verses cyanide treated embryos during development. FIG. 1C is a volcano plot of differential gene expression in zebrafish embryos following cyanide exposure. Each point represents a gene, plotted by log2 fold change (x-axis) and -logw adjusted p-value (y-axis). Genes significantly upregulated in response to cyanide (red: Padj < 0.05, |log2FC| > 1). Genes that are regulated by hypoxia pathway are shown in bold, full name mentioned in blue and their biological pathway are highlighted in bold. Non-significant (NS) genes are shown in grey; genes significant only by fold change or p-value are in in bold.
[0096] Among the genes significantly altered, some of them had a common regulatory pathway.
[0097] Phosphoserine aminotransferase 1 (psatl) and Phosphoglycerate dehydrogenase (phgdh), both part of the L-Serine biosynthetic pathway, are upregulated in U87MG cells during hypoxia24A study has also shown that hypoxia activates serine / l-C metabolism to coordinate metabolic shift from oxidative phosphorylation to glycolysis conferring protection against oxygen induced retinopathy25. Kriippel-like factor 1 (KLF1), an erythroid cell -specific zinc finger protein, is a key player in activating mammalian P-globin gene transcription, along with Gatal, Tall was identified as a key transcriptional factor regulating stress erythropoiesis in the spleen under hypoxia26. Early growth response-4 (egr4) is a zinc finger transcription factor in a multigene family that includes egr2, egr3 and Wilm’s tumor-suppressor gene (WT1) and is activated by stress signals such as hypoxia and UV radiation exposure. EGR1 loss-of-function studies in mice has identified its role as a positive regulator of extracellular matrix remodeling27. Differential expression of egr4 has been linked to the ability of retinal cells to survive long tern hypoxia28. Angiopoietin-like 4 (angptl4), a member of the angiopoietin-like protein is also known to be regulated by HIF-la29(Fig. 1c).
[0098] Example 2. Developing embryos inhibit the HIF-la feedback loop.
[0099] To understand the differential molecular mechanism controlling the hypoxia signaling between resistant and sensitive embryos, characterization of the HIF-la pathway was performed by RT-qPCR analysis. Cyanide treatment in both 2 dpf embryos and 7 dpf embryos elevated HIF-la mRNA levels however, interestingly, the regulatory mediators in the hypoxia pathway, namely FIH (hif-lan in zebrafish) and PHD1-3 [egg laying defective nine-1-3 (eglnl-3) in zebrafish] were specifically inhibited in 2 dpf resistant embryos verses the 7 dpf sensitive embryos. This would imply that cyanide exposure activates HIF-la expression in zebrafish embryos, but the regulatory components of the pathway would remain active and shut down the hypoxia signaling in developed embryos as oxygen which is a required cofactor for functioning of the pathway is present. In resistant embryos the hydroxylase enzymes were inhibited which allows the HIF-la pathway to be activated. The hypoxia pathway has a feedback loop where eglnl and egln3 (PHD2 and PHD3 respectively) are hypoxia inducible at their mRNA level30,31. This was also observed in our data; in developed embryos at 7 dpf, a HIF-l mRNA 2-fold increase matched with eglnl and egln3 mRNA fold increase verses a decrease in mRNA levels for eglnl -3 and hif-lan (FIH). VHL levels remained unchanged between the two groups indicating that the degradation machinery controlling HIF-la remains unchanged but the regulatory hydroxylation is inhibited in resistant embryos allowing the HIF-la pathway to be activated even the presence of oxygen (Fig. 2a). The changes in the mRNA levels were reflected at the protein level, as Western blot analysis of HIFl-a and FIH revealed that while the HIF-la expression was seen upon cyanide treatment in both 2 dpf and 7 dpf embryos, FIH only decreased at 2 dpf (Fig. 2b-c). Using H9C2 cells, we confirmed that cyanide activates the HIF-la pathway; immunofluorescence data confirmed that treatment with KCN, translocate HIF-la to the nucleus where it can act as a transcription factor. As a positive control, hypoxia was induced in the cells by treatment with cobalt chloride32. We observed that HIF-la activation and translocation to the nucleus was also accompanied by FIH upregulation and translocation to the nucleus in case of hypoxia as observed previously33,34. KCN treatment induced HIF-la expression and its translocation to the nucleus without affecting the FIH translocation (Fig. 2d). We also observed that both hypoxia and KCN treatment affected phalloidin labelling in the cells, indicating significant changes in the cytoskeletal density.
[0100] Example 3. Glycolytic adaptation by HIF-la pathway compensates for cyanide mediated metabolic inhibition.
[0101] To understand the metabolic adaptations that would compensate cyanide mediated inhibition of oxidative phosphorylation, we searched for metabolic switches within our whole embryo RNA sequencing data. We focused on changes that were seen only in resistant embryos and observed that pyruvate dehydrogenase kinase 2a / 2b and 4 (PDK 2a / 2b / 4) was upregulated only in the resistant embryos at 2 dpf verses sensitive embryos at 7 dpf (Fig. 3a). HIF-la pathway is known to decrease tricarboxylic acid metabolism (TCA) and shifting it towards glycolysis by upregulating PDK1 and PDK3 which inactivates pyruvate dehydrogenase (PDH) preventing conversion of pyruvate to acetyl-Co-A. This bioenergetic shift has been shown in various tumor models to be a mode of survival, and to maintain ATP production and prevent toxic reactive oxygen species (ROS) production35 38. To demonstrate a shift towards glycolysis being mediated by cyanide in resistant embryos via HIF-la pathway, we knocked down HIF-la by acute CRISPR in embryos (Fig. 6a-c) and looked at the extracellular acidification rate (ECAR) as a measure of glycolysis. Cyanide treatment enhances ECAR in embryos, comparable to hypoxia treated embryos and this increase is reversed when HIF-la is knocked down (Fig. 3b). To independently verify the importance of the observed glycolytic shift, we used a potent and specific inhibitor of 6-phospho fructo-2-kinase / fructose-2,6- bisphosphatase isoform 3 (PFKFB3) inhibitor, AZ-67 to inhibit glycolysis39and with the glucose analog 2-deoxyglucose (2DG)40to observe the survival of resistant embryos in cyanide. Inhibition of glycolysis by AZ-67 in a dose dependent manner or with 2DG reduced the survival of resistant embryos in cyanide. This indicates the importance of the shift towards glycolysis is crucial for developing embryos in being resistant to cyanide (Fig. 3c). We tested if the glycolytic shift in metabolism was preserved in H9C2 cells on cyanide treatment. We used a specific inhibitor for HIF- la DNA binding activity, echinomycin (ECM) to test the contribution of HIF-la in shifting the metabolism towards glycolysis4I‘42. There was a significant increase in both glycolysis and glycolytic capacity upon cyanide treatment that was abolished with co-treatment with ECM (Fig. 3d-e).
[0102] Example 4. Altered mitochondrial architecture confers cyanide resistance.
[0103] Given that cyanide acts as a metabolic poison targeting the mitochondrial function, it was important to see if the resistance to cyanide was due to any compensatory changes within the mitochondria to confer protection. We first observed the mitochondrial architecture in presence of cyanide and if this was altered when we inhibited the HIF-la pathway by ECM. Alterations to the mitochondrial dynamics was investigated by staining the mitochondria in live H9C2 cells using MITOTRACKER green and with immunofluorescence staining using Translocase of Outer Mitochondrial Membrane 20 (TOMM20). In untreated cells, the mitochondria exist both in form of long filamentous state and as punctate-like structure. Treatment with cyanide caused architectural changes resulting in long filamentous form which is reversed by blocking HIF-la activation by ECM (Fig. 4a-b). We quantified the mitochondrial aspect ratio that serves as a proxy for measuring the degree of networked mitochondria; a higher aspect ratio equates to a hyperfused mitochondria, and a lower aspect ratio indicates a fragmented mitochondrion. Cyanide caused an increase in the aspect ratio whereas inhibiting HIF-la decreased the aspect ratio. The mitochondria form factor reflects the complexity and branching aspect of the mitochondria; the higher the form factor, the higher the branching of the mitochondria and the more hyperfused is the mitochondria. Cyanide caused an increase in the form factor whereas inhibiting HIF-l by ECM decreased the form factor (Fig. 4c). This indicates that cyanide treatment caused the mitochondria to undergo architectural changes and produce more hyperfused mitochondria via a HIF-la mediated pathway. Changes in the mitochondrial architecture could also be due to changes in mitochondrial depolarization state or due to a traditional hypoxia response. We looked at the mitochondrial depolarization state of the mitochondria by JC-10 dye. The mitochondria were depolarized by cyanide as with treatment of FCCP (Fig. 7a). Depolarized mitochondria as well as hypoxia treatment results in enhanced mitochondrial fission and fragmented mitochondria42,43, which is also seen in our data (Fig. 7b). This would indicate that cyanide resistance via HIF-la pathway has a different biological effect on the mitochondrial structure and hence its function.
[0104] We mined through the whole embryo RNA sequencing data to determine if there were changes that could affect the mitochondrial architecture that additionally could confer resistance. There was a significant decrease in zgc: 110130 (orthologous to the human mitochondrial fission factor), dynamin lb, and dynamin 3a in resistant 2 dpf embryos verses no significant changes in sensitive 7 dpf embryos (Fig. 4d). Mitochondrial fission factor is essential for recruitment of dynamin related protein (Drpl) and together contribute to mitochondrial fission44,45. Loss of Drpl has been shown to produce more elongated mitochondria and improve mitochondrial function45.We investigated mitochondrial function in resistant embryos and the contribution of the HIF-la pathway by using acute CRISPR to knockdown HIF-la (Fig. 6A-C). As expected, cyanide treatment reduced mitochondrial function but knockdown of HIF- la resulted in complete loss of mitochondrial function including basal respiration, ATP -lined respiration, proton leak and the spare capacity (Fig. 4e-f).
[0105] Example 5. Remodeling of HIF-la pathway can alter cyanide resistance and offer new cyanide countermeasures.
[0106] Given that our data suggest that HIF-la pathway confers resistance in developing embryos against cyanide toxicity, we used genetic and pharmacological tools to alter this pathway to determine its effect on cyanide toxicity. We used acute CRISPR to knockdown HIF-la (FIGs. 6A-C) and FIH (FIG. 8) in embryos and monitored their survival at the resistant state at 2 dpf. Knocking down HIF-la reversed their resistance and they were more susceptible to cyanide toxicity. Knocking down FIH, which would allow a higher HIF-l activity conferred more resistance to the embryos indicating that this pathway could be targeted to provide resistance (Fig. 5a). We used acute CRISPR to knockdown FIH and tested the resistance in sensitive embryos at 7 dpf. When challenged with KCN, FIH knockout embryos were able to activate more HIF-la and had increased survival with cyanide (Fig. 5b-c). We also pharmacologically targeted HIF-la pathway using a PHD inhibitor and a FIH inhibitor, Daprodustat and DM-NOFD, respectively46. Pretreatment with Daprodustat and DM-NOFD alone or in combination significantly enhanced survival of cyanide sensitive embryos at 7 dpf (Fig. 5d). Using Daprodustat in H9C2 cells, mitochondrial function could also be rescued in cyanide treated cells (Fig. 5e-f). Pharmacological inhibition of HIF hydroxylase enhance cyanide resistance thereby can serve as new biological target for development of a new cyanide countermeasure.
[0107] References
[0108] 1. Bhattacharya, R. & Flora, S. J. S. Cyanide Toxicity and its Treatment, in Handbook of Toxicology of Chemical Warfare Agents: Second Edition 301-314 (Elsevier Inc., 2015). doi: 10.1016 / B978-0-12-800159-2.00023-3.
[0109] 2. Hall, A. H., Isom, G. E. & Rockwood, G. A. Toxicology of Cyanides and Cyanogens Experimental, Applied and Clinical Aspects . (2015). 3. Jones, D. C., Gunasekar, P. G., Borowitz, J. L. & Isom, G. E.
[0110] Dopamine-Induced Apoptosis Is Mediated by Oxidative Stress and Is Enhanced by Cyanide in Differentiated PC 12 Cells. J. Neurochem vol. 74 (2000).
[0111] 4. Kanthasamy, A. G. et al. Toxicology Letters Reactive Oxygen Species Generated by Cyanide Mediate Toxicity in Rat Pheochromocytoma Cells. Toxicology Letters vol. 93 (1997).
[0112] 5. Patel, M. N., Peoples, R. W., Yim, G. K. W. & Isom, G. E. Enhancement of NMD A-Mediated Responses by Cyanide. Neurochemical Research vol. 19 (1994).
[0113] 6. Sun, P., Rane, S. G., Gunasekar, P. G., Borowitz, J. L. & Isom, G. E. Modulation of the NMD A Receptor by Cyanide: Enhancement of Receptor-Mediated Responses 1. THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS vo\. 280 (1997).
[0114] 7. Zuhra, K. & Szabo, C. The two faces of cyanide: an environmental toxin and a potential novel mammalian gasotransmitter. FEBS Journal vol. 289 2481- 2515 Preprint at doi.org / 10. l l l l / febs.16135 (2022).
[0115] 8. Shou, Y., Li, L., Prabhakaran, K., Borowitz, J. L. & Isom, G. E. p38 mitogen-activated protein kinase regulates bax translocation in cyanide-induced apoptosis. Toxicological Sciences 75, 99-107 (2003).
[0116] 9. Shou, Y., Li, L., Prabhakaran, K., Borowitz, J. L. & Isom, G. E. Calcineurin-Mediated Bad Translocation Regulates Cyanide-Induced Neuronal Apoptosis. Biochem. . / vol. 379 (2004).
[0117] 10. Prabhakaran, K., Li, L., Borowitz, J. L. & Isom, G. E. Caspase inhibition switches the mode of cell death induced by cyanide by enhancing reactive oxygen species generation and PARP-1 activation. Toxicol Appl Pharmacol 195, 194- 202 (2004).
[0118] 11. Li, L., Prabhakaran, K., Mills, E. M., Borowitz, J. L. & Isom, G. E. Enhancement of cyanide-induced mitochondrial dysfunction and cortical cell cecrosis by uncoupling protein-2. Toxicological Sciences 86, 116-124 (2005).
[0119] 12. Padilla, P. A. & Roth, M. B. Oxygen Deprivation Causes Suspended Animation in the Zebrafish Embryo . pnas.orgcgidoi!0.1073pnas.131213198 (2001). 13. Mendelsohn, B. A., Kassebaum, B. L. & Gitlin, J. D. The zebrafish embryo as a dynamic model of anoxia tolerance. Developmental Dynamics 237, 1780-1788 (2008).
[0120] 14. Sips, P. Y. et al. Identification of specific metabolic pathways as druggable targets regulating the sensitivity to cyanide poisoning. PLoS One 13, (2018).
[0121] 15. Weidemann, A. & Johnson, R. S. Biology of HIF-la. Cell Death and Differentiation vol. 15 621-627 Preprint at doi.org / 10.1038 / cdd.2008.12 (2008).
[0122] 16. Peter Ratcliffe, P. & Bishop, T. Signaling hypoxia by hypoxiainducible factor protein hydroxylases: a historical overview and future perspectives. Hypoxia 197 (2014) doi: 10.2147 / hp.s47598.
[0123] 17. Greer, S. N., Metcalf, J. L., Wang, Y. & Ohh, M. The updated biology of hypoxia-inducible factor. EMBO Journal vol. 31 2448-2460 Preprint at doi.org / 10.1038 / emboj .2012.125 (2012).
[0124] 18. Scholz, C. C. & Taylor, C. T. Hydroxylase-dependent regulation of the NF -Kb pathway. Biological Chemistry vol. 394 479-493 Preprint at doi.org / 10.1515 / hsz-2012-0338 (2013).
[0125] 19. Simon, M. C. The Hypoxia Response Pathways — Hats Off! New England Journal of Medicine 375, 1687-1689 (2016).
[0126] 20. Lee, P., Chandel, N. S. & Simon, M. C. Cellular adaptation to hypoxia through hypoxia inducible factors and beyond. Nature Reviews Molecular Cell Biology vol. 21 268-283 Preprint at doi.org / 10.1038 / s41580-020-0227-y (2020).
[0127] 21. Lando, D. et al. FIH-1 is an asparaginyl hydroxylase enzyme that regulates the transcriptional activity of hypoxia-inducible factor. Genes Dev 16, 1466-1471 (2002).
[0128] OTHER EMBODIMENTS
[0129] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
WHAT IS CLAIMED IS:
1. A method of reducing risk of cyanide poisoning in a subject, the methods comprising administering to the subject a therapeutically effective amount of one or more inhibitors of Prolyl Hydroxylase Domain enzymes (PHDs) or Factor Inhibiting HIF (FIH).
2. The method of claim 1, wherein the one or more inhibitors of PHD or FIH are selected from daprodustat, roxadustat, enarodustat, molidustat, vadadustat, IOX5, desidustat, BNS, N-hydroxythiazole-based analogs of BNS; or analogs of desidustat.
3. The method of claim 1, wherein the one or more inhibitors of PHD or FIH are broad-spectrum 20G oxygenase inhibitors.
4. The method of claim 3, wherein the broad- spectrum 20G oxygenase inhibitor is pyridine-2,4-dicarboxylic acid (2,4-PDCA) or N-oxalylglycine (NOG).
5. The method of claim 1, wherein the one or more inhibitors of PHD or FIH is N- oxalyl-D-phenylalanine (NOFD) or dimethyl N-oxalyl-D-phenylalanine (DM- NOFD).
6. The method of claim 1, wherein the subjects are likely to be exposed to cyanide within 12-48, or 12-24, or 12-18 hours.
7. The method of claim 1, wherein the subject is a fire fighter, soldier, healthcare, law enforcement, or military personnel.
8. The method of claim 1, wherein the subject is living in an area with high levels of cyanide in the environment, or regularly consumes foods that are high in cyanide.
9. The method of claim 1, wherein the subject is employed in an industry that uses cyanide.
10. The method of claim 1, wherein the inhibitor is daprodustat.
11. The method of claim 10, wherein the daprodustat is administered orally.
12. The method of claim 11, wherein the daprodustat is administered orally once a day.
13. A composition comprising one or more inhibitors of Prolyl Hydroxylase Domain enzymes (PHDs) or Factor Inhibiting HIF (FIH), for use in a method of reducing risk of cyanide poisoning in a subject.
14. The composition for the use of claim 13, wherein the one or more inhibitors of PHD or FIH are selected from daprodustat, roxadustat, enarodustat, molidustat, vadadustat, IOX5, desidustat, BNS, N-hydroxythiazole-based analogs of BNS; or analogs of desidustat.
15. The composition for the use of claim 13, wherein the one or more inhibitors of PHD or FIH are broad-spectrum 20G oxygenase inhibitors.
16. The composition for the use of claim 15, wherein the broad-spectrum 20G oxygenase inhibitor is pyridine-2,4-dicarboxylic acid (2,4-PDCA) or N- oxalylglycine (NOG).
17. The composition for the use of claim 13, wherein the one or more inhibitors of PHD or FIH is N-oxalyl-D-phenylalanine (NOFD) or dimethyl N-oxalyl-D- phenylalanine (DM-NOFD).
18. The composition for the use of claim 13, wherein the subjects are likely to be exposed to cyanide within 12-48, or 12-24, or 12-18 hours.
19. The composition for the use of claim 131, wherein the subject is a fire fighter, soldier, healthcare, law enforcement, or military personnel.
20. The composition for the use of claim 13, wherein the subject is living in an area with high levels of cyanide in the environment, or regularly consumes foods that are high in cyanide.
21. The composition for the use of claim 13, wherein the subject is employed in an industry that uses cyanide.
22. The composition for the use of claim 13, wherein the inhibitor is daprodustat.
23. The composition for the use of claim 22, wherein the daprodustat is formulated to be administered orally.
24. The composition for the use of claim 23, wherein the daprodustat is formulated to be administered orally once a day.
Citation Information
Patent Citations
Prolyl hydroxylase domain inhibitor treatment to improve survivability of hemorrhagic shock
US20240122987A1
Platinum complexes, related compositions, and uses thereof in cyanide countermeasures
WO2024026123A2