In-vitro preparation method for midbrain dopaminergic progenitor cell population

The stem cell differentiation method optimized by three-dimensional suspension culture and single-cell tracking technology solves the problems of high heterogeneity and low differentiation efficiency of progenitor cell populations in existing technologies, and realizes efficient, robust large-scale production and safe preparation of midbrain dopaminergic progenitor cells, thereby improving therapeutic efficacy and safety.

WO2025252180A1PCT designated stage Publication Date: 2025-12-11CENT FOR EXCELLENCE IN BRAIN SCI & INTELLIGENCE TECH CHINESE ACAD OF SCI +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/099438
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-05
Filing Date
2025-06-05
Publication Date
2025-12-11

AI Technical Summary

Technical Problem

Existing in vitro induction methods result in progenitor cell populations with high heterogeneity and low differentiation efficiency, making it difficult to meet the requirements of large-scale production and robustness for clinical applications. Furthermore, the proportion of neurons after transplantation is low, indicating the potential for non-target cell differentiation, leading to unsatisfactory therapeutic effects and potential safety risks.

Method used

A three-dimensional culture strategy without feeder cells or matrix was adopted, combined with a cross-transplantation single-cell splitting barcode method. Pluripotent stem cells were cultured in stages under different combinations of differentiation-promoting factors through suspension culture. The Wnt activation protocol was optimized to increase the content of midbrain dopaminergic progenitor cells, and lineage consistency was ensured through single-cell tracking technology.

Benefits of technology

This method enables efficient and robust large-scale preparation of midbrain dopaminergic progenitor cell populations with low non-target cell counts, ensuring a high proportion of neurons after transplantation, restoring normal physiological function, reducing treatment risks and costs, and improving the predictability of treatment outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025099438_11122025_PF_FP_ABST
    Figure CN2025099438_11122025_PF_FP_ABST
Patent Text Reader

Abstract

Provided is a method for differentiating pluripotent stem cells in vitro to prepare a cell population mainly composed of midbrain floor plate dopaminergic progenitor cells, wherein the progenitor cells can efficiently and directionally differentiate into midbrain dopaminergic neuron precursors and midbrain dopaminergic neurons after being transplanted into a subject. Further provided is a cell population prepared by the method, a pharmaceutical composition containing the cell population, and a method for using the cell population or the pharmaceutical composition to treat or ameliorate a neurological disorder caused by a reduction in the number of midbrain dopaminergic neurons and / or impairment of function thereof.
Need to check novelty before this filing date? Find Prior Art

Description

In vitro method of preparing midbrain dopaminergic progenitor cell populations TECHNICAL FIELD

[0001] The present invention relates to methods of differentiating stem cells in vitro into midbrain floor plate dopaminergic progenitor cells, and progenitor cell populations, compositions, kits, methods of treatment and uses made therefrom. BACKGROUND

[0002] Parkinson's disease (PD) is a prevalent neurodegenerative disease affecting millions of people, primarily caused by the progressive loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc) of the midbrain. It is manifested mainly in two categories of symptoms, motor and non-motor. Motor symptoms include resting tremor, muscle rigidity, bradykinesia, and postural instability. Non-motor symptoms mainly include constipation, olfactory dysfunction, sleep disturbances, autonomic dysfunction, and mental and cognitive impairment. Cell therapy, which aims to supplement the lost midbrain dopaminergic neurons in the subject, is considered a promising method for treating PD.

[0003] Currently, several PD cell replacement therapies based on human pluripotent stem cell (hPSC)-derived dopaminergic progenitor cells are in clinical trials worldwide. Reported cell therapies include the use of human pluripotent stem cells to obtain a mixed cell population containing midbrain dopaminergic (mDA) precursor cells through in vitro differentiation, so that they can continue to differentiate into mDA neuron-containing grafts after transplantation into the body. For example, PCT International Application Publication No. WO2022216911 discloses a method for inducing mDA neurons or FOXA2 + / LMX1A + cells using a single SMAD inhibitor. US Patent Application No. US20210123018A1 reports a method for inducing mDA neurons and their precursor cells by dual inhibition of SMAD signaling and activation of Sonic Hedgehog (SHH) signaling, in combination with an activator of wingless (Wnt) signaling at an increased concentration, under adherent culture conditions. US Patent Application No. US20220177835 reports a further improvement to the method, by using FGF18 instead of FGF8, which can reduce the production of non-mDA cells and non-mDA precursor cells.

[0004] However, the progenitor cell populations obtained by the currently known in vitro induction methods are actually highly heterogeneous, which requires additional sorting purification and / or selective killing to improve the proportion of target cells, or when directly used in complex in vivo environment, the proportion of neurons formed in the grafts is low and the robustness is poor. It should be noted that these in vitro induction methods in the past are based on, for example, detection of a small number of molecular markers (such as flow cytometry) or transcriptomics of mixed cell populations to evaluate the composition of the cell population, but this can only analyze the data set of the population from very limited dimensions, and the results ultimately reflected are the average levels of markers of the entire mixed population, which cannot accurately characterize the marker expression and differentiation state of each cell in the population, resulting in the so-called homogeneous population actually containing a variety of heterogeneous cells. However, even based on such population detection results, the in vitro differentiation methods in the past still generally have the problems of low differentiation efficiency, low yield of target cells and instability. For example, according to the flow cytometry or immunohistochemistry results of common mDA lineage cell markers (such as EN1, LMX1A, FOXA2, etc.), the proportion of DA progenitor cells or DA neuronal cells under in vitro differentiation conditions is usually far less than about 20% of the total cells, and if transplanted into the body, the proportion of mDA neurons is further reduced, usually less than 5% of the total donor cells, and rarely reported to reach about 10% (see Schweitzer, J. S et al., (2020). New England Journal of Medicine (Vol. 382, Issue 20, pp. 1926-1932); Piao, J. et al., (2021). Cell Stem Cell (Vol. 28, Issue 2, pp. 217-229.e7)). Heterogeneity and low differentiation efficiency will inevitably lead to a series of problems, including increased dosage, increased cost, complicated surgery, uncontrollable and unsatisfactory treatment effect, and even potential safety risks such as tumorigenesis due to proliferation of a large number of non-target cells.

[0005] In addition to high differentiation efficiency, robustness of differentiation protocols is of great importance for the industrialization of cell therapy, which can ensure consistency when using different hPSC cell lines and minimize process adjustments between batches. From an immunological perspective, immunologically matched iPSCs are superior to allogeneic ESC lines, so it is particularly important to be able to use patient autologous iPSC lines or human leukocyte antigen (HLA)-matched donor iPSC lines to prepare transplanted cell populations in routine clinical practice (Wang, S. et al., Cell Discov. 1, 1-11 (2015) and Morizane, A. et al., Nat. Commun. 8, 1-12 (2017)). However, the robustness of the protocols reported so far is weak between different cell lines (especially between iPSCs with different genetic backgrounds) and different production batches (see Kirkeby, A. et al., (2017). Predictive Markers Guide Differentiation to Improve Graft Outcome in Clinical Translation of hESC-Based Therapy for Parkinson’s Disease. In Cell Stem Cell, Vol. 20, Issue 1, pp. 135-148), making it difficult to meet the needs of large-scale production and customized development required for clinical applications.

[0006] Furthermore, the existing studies’ explanations of the correlation between progenitor cells and differentiation outcomes are usually based on developmental common sense and / or transcriptome similarity, which have been proven to be insufficient for accurate determination of cell types and neuronal subtypes. When tracking the grafts produced after administering existing in vitro induced-differentiated progenitor cell populations into the body, significant differences in the composition of the grafts were observed. scRNA-seq detection of different grafts has been reported, showing that not only the proportion of dopaminergic neurons formed in grafts from different hPSC-derived progenitor cells is significantly different (usually from about 0.3% to about 20%), but also the other non-target cell types formed are different, including but not limited to glutamatergic neurons, serotonergic neurons, GABAergic neurons, vascular and leptomeningeal cells (VLMC), and various glial cells (such as astrocytes, oligodendrocytes, etc.) (see Tiklová, K. et al., (2020). Single cell transcriptomics identifies stem cell-derived graft composition in a model of Parkinson’s disease. In Nature Communications, Vol. 11, Issue 1; Xu, P. et al., (2022). Human midbrain dopaminergic neuronal differentiation markers predict cell therapy outcomes in a Parkinson’s disease model. In Journal of Clinical Investigation, Vol. 132, Issue 14; Kim, T. W. et al., (2025). Enhanced yield and subtype identity of hPSC-derived midbrain dopamine neuron by modulation of WNT and FGF18 signaling. In bioRxiv [Preprint]. 2025 Jan 6: 2025.01.06.631400.). The presence of these cells indicates that the transplanted progenitor cells are not exclusively differentiated into the target dopaminergic neurons or their precursors, but still undesirably retain the potential to differentiate into various non-target cells.

[0007] Therefore, it is also necessary to explore the key lineage information between progenitor cells and final different neuronal subtypes to decode the potential of transplanted cells, and on this basis, to provide a method capable of efficiently, robustly and stably producing cell populations for transplantation on a large scale to ensure the safety of cell therapy and promote the development of more refined cell therapy products. SUMMARY

[0008] The inventors of the present application have for the first time successfully developed a three-dimensional culture strategy that does not require the use of any feeder layer cells or coating with a substrate, which can be applied to a large-scale three-dimensional suspension manufacturing process to meet the GMP production specification requirements in the field of cell therapy. The inventors of the present application have also found that even without performing additional enrichment steps or adjusting the culture scheme according to the characteristics of individual cell lines, the cultures obtained using the culture method of the present application have similar progenitor cell compositions when various pluripotent stem cell lines (including hESC, hiPSC) are cultured, and can successfully generate transplants mainly composed of mDA neurons after being transplanted in vivo, and completely restore the dopamine release level of the model animal to restore normal physiological function. Therefore, the present application provides in a first aspect an in vitro culture method capable of producing a population of mDA progenitor cells (mDAP) with significantly reduced non-target cells such as glutamatergic neurons in a highly robust, efficient, stable and reproducible manner.

[0009] The inventors of the present application have also developed a cross-transplantation single-cell split barcoding method (hereinafter referred to as TX-SISBAR method), which can perform clonal tracking of individual progenitor cells after transplantation. Compared with traditional methods of lineage analysis at the population level, this method can perform cross-stage lineage tracking and evaluate the differentiation potential of each progenitor cell at the level of individual clones, thereby for the first time reconstructing the clonal lineage between different subtypes of floor plate progenitor cells and their respective differentiation fate in the transplant, and finding that midbrain progenitor cells are the subtype lineage that produces the required DA neurons after transplantation, and diencephalic progenitor cells are the main subtype lineage that differentiates into non-target Glut neurons. Using the discovered subtype lineage, the inventors of the present application further optimize the in vitro culture method and provide an optimized scheme for additional Wnt activation at a later time point before the above-mentioned subtype lineage separation, which can further increase the content of midbrain dopaminergic progenitor cells in the progenitor cell population.

[0010] Using the method of the present application, a large number of low non-target cell, highly predictable and lineage consistent progenitor cell populations can be produced for clinical application without the need for additional enrichment operations such as marker sorting.

[0011] Accordingly, it is a first object of the present application to provide a method for in vitro differentiation of pluripotent stem cells, which ultimately yields a differentiated cell population expressing at least one marker indicative of midbrain floor plate progenitor cells, by culturing pluripotent stem cells in suspension in stages under conditions containing different combinations of differentiation-promoting factors.

[0012] It is a second object of the present application to provide a differentiated cell population prepared by the in vitro differentiation method of pluripotent stem cells disclosed herein. In some embodiments, the present application provides a differentiated cell population obtained at an intermediate stage of the differentiation method disclosed herein.

[0013] It is a third object of the present application to provide a composition (e.g., a pharmaceutical composition) or a kit comprising the differentiated cell population disclosed herein. In some embodiments, the cell population disclosed herein is present in the composition or kit in the form of single cells. In some embodiments, the cell population disclosed herein is present in the composition or kit in the form of oligocellular clusters. In some embodiments, the cell population disclosed herein is present in the composition or kit in the form of spheroid cell aggregates re-aggregated from single cells and / or oligocellular clusters.

[0014] It is a fourth object of the present application to provide another kit comprising (a) at least one inhibitor of BMP signaling, (b) at least one inhibitor of TGF-β1 signaling, (c) at least one activator of Wnt signaling, (d) at least one activator of Sonic hedgehog (SHH) signaling, and (e) at least one activator of FGF signaling. In some embodiments, the kit disclosed herein further comprises (f) instructions for inducing differentiation of stem cells into the differentiated cell population disclosed herein.

[0015] It is a fifth object of the present application to provide use of the cell population disclosed herein in the manufacture of a medicament for preventing, ameliorating, and / or treating a nervous system disorder.

[0016] It is a sixth object of the present application to provide a method for preventing, ameliorating, or treating a nervous system disorder, which comprises administering to a subject in need thereof an effective amount of the cell population disclosed herein, or administering an effective amount of the pharmaceutical composition disclosed herein.

[0017] It is a seventh object of the present application to provide a method for establishing an in vitro model using the cell population disclosed herein, which model is used for identifying, screening, and / or validating a drug candidate having preventive, ameliorative, or therapeutic activity against a nervous system disorder.

[0018] It is an eighth object of the present application to provide a medium for the differentiation of pluripotent stem cells. In some embodiments, the medium disclosed herein comprises about 0.5 to about 10.0 mM DMH-1, about 1.0 to about 10.0 mM SB431542, about 0.2 to about 1.0 mM CHIR99021, and about 0.1 to about 2.0 mM SAG. In some embodiments, the medium disclosed herein comprises about 0.5 to about 10.0 mM DMH-1, about 1.0 to about 10.0 mM SB431542, about 1.0 to about 15.0 mM CHIR99021, and about 0.1 to about 2.0 mM SAG. In some embodiments, the medium disclosed herein comprises about 0.2 to about 15.0 mM CHIR99021, and about 0.1 to about 2.0 mM SAG. In some embodiments, the medium disclosed herein comprises about 0.1 to about 2.0 mM SAG, and about 10 to about 500 ng / ml FGF8b. In some embodiments, the medium disclosed herein comprises about 0.1 to about 1.0 mM SAG, and about 10 to about 200 ng / ml FGF8b. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1A (top) is a schematic showing the conversion from monolayer to three-dimensional culture; (bottom) is a brightfield image showing the morphology of day 3 (D3) cultures;

[0020] Figure 1B (top) is a schematic showing the expression of LMX1A and EN1 during early development; (bottom) is a schematic showing the LMX1A-p2A-tdTomato / EN1-p2A-mNeonGreen dual reporter cell line;

[0021] Figure 1C is a schematic showing the time-course flow cytometry of Wnt / SHH signaling titration for mDAP generation;

[0022] Figure 1D is a box plot showing the proportion of LMX1A + EN1 + cells over Ho

[0023] Figure 1E is an immunostaining of hESC-derived cultures at day 45 of in vitro maturation showing mDA markers TH and EN1; Ho indicates Hoechst, scale bar is 20 pm;

[0024] Figure 1F shows the quantification of TH + cells over Ho + cells; data shown as mean ± standard error (SEM) of three independent experiments.

[0025] Figure 1G shows TH in Figure 1E + Cells relative to TH + Quantification of cells; data shown as mean ± SEM of three independent experiments;

[0026] Figure 1H is an immunostaining of in vivo matured hESC-derived cultures at 6 months post transplantation (MPT) showing mDA markers TH and HN; HN indicates human nuclei, scale bar 200 pm;

[0027] Figure 1I is an immunostaining of in vivo matured hESC-derived cultures at 6 months post transplantation (MPT) showing mDA markers TH and EN1; HN indicates human nuclei, scale bar 20 pm;

[0028] Figure 1J shows TH in Figure 1H + Cells relative to HN + Quantification of cells; data shown as mean ± SEM;

[0029] Figure 1K shows EN1 in Figure 1H + Cells relative to TH + Quantification of cells; data shown as mean ± SEM;

[0030] Figure 1L is an immunostaining of in vitro matured day 45 hPSC-derived cultures showing mDA markers TH and EN1; Ho indicates Hoechst, scale bar 20 pm;

[0031] Figure 1M shows TH in Figure 1L + Cells relative to Ho + Quantification of cells; data shown as mean ± SEM of three independent experiments;

[0032] Figure 1N shows EN1 in Figure 1L + Cells relative to TH + Quantification of cells; data shown as mean ± SEM of three independent experiments;

[0033] Figure 1O is an immunostaining of in vivo matured 6MPT-cultures of hiPSC-derived showing mDA markers TH and HN, scale bar 200 pm;

[0034] Figure 1P shows TH in Figure 1O + Cells relative to HN + Quantification of cells; data shown as mean ± SEM;

[0035] Figure 1Q shows HPLC analysis of dopamine and dopamine metabolites (DOPAC and HVA) in vivo. mDAP D28 and mDAP D21 groups tested hiPSC#C derived 6MPT- grafts. Data shown as mean ± SEM. Dunnett’s multiple comparison test to the mean of the 6-OHDA group after one-way ANOVA; *p<0.05, **p<0.01, ***p<0.001.

[0036] Figure 1R shows changes in amphetamine-induced rotational behaviour in PD mice six months after transplantation of hESC-derived mDAPs (6MPT); n=4 (aCSF), 4 (SAG 0.25 CHIR 0.6), 5 (SAG 0.25 CHIR 0.8), 3 (SAG 0.5 CHIR 0.6), 6 (SAG 0.5 CHIR 0.8); data shown as mean ± SEM, Dunnett’s multiple comparison test after two-way ANOVA, ***p<0.001, ****p<0.0001;

[0037] Figure 1S shows changes in amphetamine-induced rotational behaviour in PD mice six months after transplantation of hiPSC-derived mDAPs (6MPT); n=6 (hiPSC#A), 5 (hiPSC#B), 10 (hiPSC#C D28), 7 (hiPSC#C D21); data shown as mean ± SEM;

[0038] Figure 2A (left) is a schematic showing the timeline of mDAP differentiation scRNA-seq. (right) is the result of visualizing the clustering results at each time point using UMAP; cell types prefixed with “P” are progenitors, FP denotes floor plate, Proli denotes proliferative, hFP denotes hindbrain floor plate, mFP denotes midbrain floor plate, dFP denotes diencephalic floor plate, FPL denotes lateral floor plate, N&Nb denotes neurons and neuroblasts;

[0039] Figure 2B (left) shows expression of typical markers of midbrain DA progenitors at day 28 (EN1 + / LMX1A + / FOXA2 + / OTX2 + ) visualized using UMAP; (right) shows expression of cluster marker genes in cell clusters at day 28, with SIM2 being a marker of P_dFP cluster visible;

[0040] FIG. 2C is a heatmap depicting the transcriptomic similarity of cultured clusters at day 28 to clusters in the human ventral midbrain data set in development (La Manno, G. L. et al., (2016). Cell, Vol. 167, Issue 2, pp. 566-580.e19);

[0041] FIG. 2D (top) shows gene set enrichment analysis (GSEA) of the“Dopaminergic neuron differentiation” pathway in the P_mFP cluster, (bottom) shows GSEA of the“Response to unfolded proteins” pathway in the P_GDF15 cluster;

[0042] FIG. 2E is a heatmap showing the expression of the top 100 highly expressed genes of the P_mFP cluster in D28 cultures; surface proteins, transcription factors, and co-factors are labeled as annotations;

[0043] FIG. 2F shows the integrated cluster results of D21 cultures derived from hESC (hESC#H9) and hiPSC (hiPSC#A-C) visualized using UMAP;

[0044] FIG. 2G shows the distribution results of each cell line at day 21 visualized using UMAP, n denotes the number of cells;

[0045] FIG. 2H shows the proportion of clusters of day 21 cultures of each cell line (hESC#H9, hiPSC#A, hiPSC#B, hiPSC#C);

[0046] FIG. 2I shows the integrated cluster results of D28 cultures derived from hESC (hESC#H9) and hiPSC (hiPSC#A-C) visualized using UMAP;

[0047] FIG. 2J shows the distribution results of each cell line at day 28 visualized using UMAP;

[0048] FIG. 2K shows the proportion of clusters of day 28 cultures of each cell line (hESC#H9, hiPSC#A, hiPSC#B, hiPSC#C);

[0049] FIG. 2L is a correlation plot showing the correlation of clusters derived from hESC (hESC#H9) to clusters derived from different hiPSC cell lines (hiPSC#A, hiPSC#B, hiPSC#C) transcriptomes;

[0050] FIG. 2M shows the PCA projection of clusters cultured at day 21 and day 28;

[0051] Figure 3A shows UMAP visualization of the major cell types of the grafts at 4 months post transplantation (4MPT), grafts derived from hESC#H9 and hiPSC#C were integrated for analysis; VLMC stands for vascular leptomeningeal cells, Astro stands for astrocytes, OPC&OL stands for oligodendrocyte progenitor cells and oligodendrocytes;

[0052] Figure 3B is a map of the major cell types in Figure 3A by expression of classical markers for neurons (STMN2), astrocytes (AQP4), VLMC (COL1A1 / PDGFRA), and OPC&OL (PDGFRA);

[0053] Figure 3C is a dot plot showing markers of the major cell types in the grafts;

[0054] Figure 3D is a representative image of a 6MPT graft, immunostained with NEUN (neurons), SOX9 (astrocyte predominant), OLIG2 (oligodendrocyte progenitor cells and oligodendrocytes), COL1A1 / hCOL1A1 (vascular leptomeningeal cells), and HN; scale bar is 50 pm;

[0055] Figure 3E shows the quantification results of the NEUN / HN, SOX9 / HN, OLIG2 / HN, hCOL1A1 / HN ratios in Figure 3D;

[0056] Figure 3F is a representative image of a 6MPT graft, immunostained with NEUN (neurons), TH (dopaminergic neurons), and HN; scale bar is 50 pm; arrows indicate TH - / NEUN + human cells, arrowheads indicate TH + / NEUN + human cells;

[0057] Figure 3G shows the quantification results of the TH + / NEUN + HN + ratios in Figure 3F;

[0058] Figure 3H shows UMAP visualization of the neurons of the 4MPT grafts, neuron clusters, grafts derived from hESC#H9 and hiPSC#C were integrated for analysis; DA stands for dopaminergic neurons, Glut stands for glutamatergic neurons, Unk stands for unknown;

[0059] FIG. 3I is a heatmap depicting pairwise transcriptional correlations of 4MPT neuron clusters with clusters in a developmental human ventral midbrain data set (La Manno, G. L. et al., (2016). Cell, Vol. 167, Issue 2, pp. 566-580.e19);

[0060] FIG. 3J is a violin plot of representative markers of neuron clusters of 4MPT grafts;

[0061] FIG. 3K is a box plot showing pseudo-time fractions of 4MPT midbrain DA neuron clusters (DA1, DA2, DA3) and adult DA neurons (Siletti, K. et al., (2023). Science, Vol. 382, Issue 6667);

[0062] FIG. 3L is a representative image of 6MPT grafts, immunostained with hSLC17A6 (RNAscope), TH, and HN; white arrows, white arrowheads, and red arrows indicate TH + hSLC17A + neurons, TH + hSLC17A6 - neurons and TH - hSLC17A6 + neurons, scale bars for the overview and the magnification are 100 pm and 20 pm, respectively;

[0063] FIG. 3M is a representative image of 6MPT grafts, immunostained with hGAD2 (RNAscope), TH, and HN; white arrows, white arrowheads, and red arrows indicate TH + hGAD2 + neurons, TH + hGAD2 - neurons and TH - hGAD2 + neurons, scale bars for the overview and the magnification are 100 pm and 20 pm, respectively;

[0064] FIG. 3N shows visualization of DA neuron clusters in 4MPT grafts using UMAP;

[0065] FIG. 3O (left) shows visualization of expression of classic A9 and A10 markers (KCNJ6 and CALB1) of DA neurons in 4MPT grafts using UMAP; (right) is an Upset plot showing expression of TH, KCNJ6, and CALB1 in all TH-positive cells;

[0066] FIG. 3P shows representative images of hiPSC-derived 6MPT grafts immunostained for TH (DA neurons), GIRK2 (DA A9), and CALB1 (DA A10);

[0067] FIG. 3Q shows quantification of the proportion of cells annotated in FIG. 3P as TH + HN + cells;

[0068] FIG. 4A shows serial coronal sections of hESC (hESC#H9)-derived grafts immunostained with the human-specific cytoplasmic marker STEM121 (gray), scale bar 500 pm;

[0069] FIG. 4B shows serial coronal sections of hiPSC (hiPSC#A, hiPSC#B)-derived grafts immunostained with the human-specific cytoplasmic marker STEM121 (gray), scale bar 500 pm;

[0070] FIG. 4C is a schematic showing the use of hESC (hESC#H9 TH-tdTomato)-derived grafts for electrophysiological characterization of TH-expressing neurons;

[0071] FIG. 4D shows representative traces of whole-cell patch-clamp recordings of spontaneous action potentials (sAPs);

[0072] FIG. 4E is a schematic showing representative traces of hyperpolarizing current injection of voltage Sag;

[0073] FIG. 4F shows the measured values of voltage Sag;

[0074] FIG. 4G shows representative traces of sIPSCs (top) and sEPSCs (bottom) in human DA neurons 6 months post-transplantation;

[0075] FIG. 4H plots the amplitude and frequency of sEPSCs; data represented as mean ± SEM; number of mice, n = 3; number of cells recorded for sEPSCs, n = 12;

[0076] FIG. 4I plots the amplitude and frequency of sIPSCs; data represented as mean ± SEM; number of mice, n = 3; number of cells recorded for sIPSCs, n = 12;

[0077] FIG. 4J is a schematic showing the use of UMAP to visualize the expression of D1, D2 receptor genes (DRD1, DRD2) in DA neurons within the graft 4 months post-transplantation;

[0078] FIG. 4K is a schematic showing that D2 autoreceptors on DA neurons can modulate dopamine release;

[0079] Figure 4L shows representative traces of pacemaker-like firing and the effect of quinpirole on firing frequency;

[0080] Figure 4M shows the effect of quinpirole on (left) neuronal firing frequency (Hz) and (right) resting membrane potential (RMP) and statistical analysis thereof; number of mice = 3, number of neurons recorded = 8, data represented as mean ± SEM, Dunnett’s multiple comparison test with mean of baseline group after one-way ANOVA, *p<0.05, **p<0.01, ****p<0.0001;

[0081] Figure 5A is a schematic showing the cross-grafted TX-SISBAR approach;

[0082] Figure 5B shows the visualization of clusters of D28 grafts using UMAP, integrating grafts derived from hESC#H9 and hiPSC#C for analysis;

[0083] Figure 5C shows the visualization of clusters of 1MPT grafts using UMAP, integrating grafts derived from hESC#H9 and hiPSC#C for analysis;

[0084] Figure 5D left is a heatmap showing TX-SISBAR barcode-based lineage correlations between cell clusters in the D28 culture data set; right is a heatmap showing TX-SISBAR barcode-based lineage correlations between cell clusters in the 1MPT graft data set;

[0085] Figure 5E shows clustering of pairwise transcriptomic correlations (left) and TX-SISBAR barcode-based lineage correlations (right) between cell clusters in the integrated data set;

[0086] Figure 5F is a heatmap depicting pairwise transcriptomic similarity of 1MPT neuronal clusters with neuronal clusters in the 4MPT graft data set;

[0087] Figure 5G is a dot plot showing lineage coupling scores (p-value and Tversky score) between pairwise cell clusters across grafts, analyzed by origin perspective (blue dots) and potential perspective (orange dots). Shown are dots with p<0.05, the number within each dot indicates the number of clones in each pair of clusters; clones less than 3 are not shown;

[0088] Figure 5H is a Sankey plot showing significant progenitor cell outcome associations between D28 cultures and 1MPT grafts;

[0089] Figure 5I is a schematic showing the BrdU labeling experiment;

[0090] Figure 5J shows representative images observed in 2MPT grafts of D28 cultures from hESC#H9 cells transplanted in vivo after labeling with BrdU for 24h, immunostained with TH, BrdU and HN, scale bar 100pm and 20pm for the original and magnification, respectively;

[0091] Figure 5K shows TH + cells relative to HN + cells, and BrdU + cells relative to TH + Quantification results of cells;

[0092] Figure 6A is a schematic showing the lineage correlation between P_dFP and P_mFP clusters at day 14 of differentiation, where further Wnt activation promotes P_mFP fate shift;

[0093] Figure 6B shows the clustering results at each time point under conditions with additional Wnt activation visualized using UMAP; cell types prefixed with “P” are progenitors, FP stands for floor plate, MHB stands for mid- hindbrain boundary, hFP stands for hindbrain floor plate, mFP stands for midbrain floor plate, FPL stands for lateral floor plate, N&Nb stands for neurons and neuroblasts;

[0094] Figure 6C shows the expression of classical markers of midbrain DA progenitors (EN1 + / LMX1A + / FOXA2 + / OTX2 + ) at day 28 after Wnt gradient activation; the lower panel shows the expression of cluster marker genes in the cell clusters at day 28 after additional Wnt activation;

[0095] Figure 6D shows the cluster ratio of day 28 cultures under constant or gradient Wnt activation;

[0096] Figure 6E shows the expression of P_dFP markers (SIM2 and BARHL2) at day 28 under constant or gradient Wnt activation using UMAP;

[0097] Figure 6F is a schematic showing the fate shift in culture (upper panel) and graft results (lower panel) after gradient Wnt activation;

[0098] Figure 6G is a schematic showing the SIM2-p2A-tTdTomato / PITX2-p2A-mNeonGreen dual reporter cell line;

[0099] Figure 6H shows the change in proportion of SIM2 expressing cells over the course of differentiation under conditions of constant or graded Wnt activation; data represented as mean ± standard deviation (SD) representation, two-way ANOVA followed by uncorrected Fisher's test, *p<0.05, **p<0.01, ***p<0.001; the lower panel shows the change in proportion of PITX2 expressing cells over the course of differentiation under conditions of constant or graded Wnt activation; data represented as mean ± standard deviation (SD) representation, two-way ANOVA followed by uncorrected Fisher's test, *p<0.05, **p<0.01, ***p<0.001;

[0100] Figure 6I is an immunostaining of hPSC-derived cultures at day 45 of in vitro maturation under conditions of graded Wnt activation, showing mDA markers TH and EN1; Ho represents Hoechst, scale bar is 20 pm;

[0101] Figure 6J shows TH in Figure 6J + Cells relative to Ho + Quantification results of cells; data represented as mean ± SEM of three independent experiments;

[0102] Figure 6K shows EN1 in Figure 6J + Cells relative to TH + Quantification results of cells; data represented as mean ± SEM of three independent experiments;

[0103] Figure 6L shows TH + Cells relative to Ho + Quantification results of cells (Figure 1M and Figure 6J); data represented as mean ± SEM of eight cell lines (hESC#H9, hiPSC#A-D, hiPSC#E-1-E-3), unpaired t-test, ***p<0.001, ****p<0.0001;

[0104] Figure 6M shows EN1 + Cells relative to TH + Quantification results of cells (Figure 1N and Figure 6K); data represented as mean ± SEM of eight cell lines (hESC#H9, hiPSC#A-D, hiPSC#E-1-E-3), unpaired t-test, ***p<0.001, ****p<0.0001;

[0105] Figure 6N shows representative images of 6MPT grafts derived from cultures under conditions of constant or graded Wnt activation; immunostained with TH and HN; scale bar is 200 pm;

[0106] Figure 6O shows TH in Figure 6N + Cells relative to Ho + Quantification results of cells; data represented as mean ± SEM

[0107] Figure 6P shows TH in different cell lines in Figures IP and 6N + Cells relative to HN + Changes in quantification results of cells

[0108] Figure 6Q shows representative images of 6MPT grafts derived from cultures under conditions of graded Wnt activation; immunostaining with hSLC17A6 (RNAscope), TH and HN; white arrows, white arrowheads and red arrows indicate TH + hSLC17A6 + Neurons, TH + hSLC17A6 - Neurons and TH - hSLC17A6 + Neurons, scale bars for original and magnified images are 100 pm and 20 pm, respectively

[0109] Figure 6R is a bar graph showing TH in Figures 3L and 6Q - hSLC17A6 + Cells relative to HN + Quantification results of cells; data represented as mean ± SEM

[0110] Figure 6S shows differences in visualization of 4MPT grafts neuronal clusters using UMAP under conditions of constant or graded Wnt activation

[0111] Figure 6T shows changes in the proportion of 4MPT neuronal clusters in grafts under conditions of constant or graded Wnt activation

[0112] Figure 6U is a violin plot showing expression of TH, EN1 (midbrain DA neurons) and PITX2 (Glut neurons) in all neurons in grafts under conditions of constant or graded Wnt activation

[0113] Figure 7A is a schematic showing Stereo-seq performed on 3MPT and 7MPT grafts, with hESC#H9 TH-tdTomato cell line used for graft localization

[0114] Figure 7B shows spatial visualization of detected ssDNA and segmented nuclei in the same section; scale bars are 750 pm, 200 pm, 50 pm (from left to right)

[0115] FIG. 7C shows gene expression in the graft associated with mouse striatum (Ppp1r1b) and human neurons (STMN2);

[0116] FIG. 7D shows 7MPT graft regions magnified for visualization, displayed with adjusted cell bins showing log2 fraction of human gene reads;

[0117] FIG. 7E shows 7MPT graft regions annotated with reference to the graft single cell transcriptome data, displayed with adjusted cell bins, colored with major cluster annotations;

[0118] FIG. 7F shows annotated major cluster ratios;

[0119] FIG. 7G shows 7MPT graft regions annotated with reference to the graft single cell transcriptome data, displayed with adjusted cell bins, colored with neuron cluster annotations;

[0120] FIG. 7H shows annotated neuron cluster ratios;

[0121] FIG. 7I is a heatmap showing representative marker expression for major clusters of the 7MPT graft in Stereo-seq;

[0122] FIG. 7J shows spatial distribution of “Neuron” and “Astro” major clusters in the 7MPT graft, displayed in adjusted cell bins;

[0123] FIG. 7K shows spatial distribution of “Neuron” and “Astro” major clusters in the 7MPT graft, displayed in contour plots;

[0124] FIG. 7L is a heatmap showing representative marker expression for neuron clusters of the 7MPT graft in Stereo-seq;

[0125] FIG. 7M shows spatial distribution of “DA1” and “DA3” neuron clusters in the 7MPT graft, displayed in adjusted cell bins;

[0126] FIG. 7N shows spatial distribution of “DA1” and “DA3” neuron clusters in the 7MPT graft, displayed in contour plots;

[0127] FIG. 8A is a schematic showing the 3D culture mDAP differentiation protocol.

[0128] FIG. 8B is a graph showing TH + / HO ratio and EN1+ TH + / TH + Box plots of the proportion, related to Figure ID;

[0129] Figure 8C is a box plot showing the proportion of differentiated cells at one, two, three and four weeks of differentiation with different SAG and CHIR concentrations;

[0130] Figure 8D is a box plot showing the proportion of differentiated cells at one, two, three and four weeks of differentiation with different SAG and CHIR concentrations;

[0131] Figure 8E is an immunostaining of hESC-derived cultures at day 45 of in vitro maturation showing the serotonergic neuronal marker TPH2; Ho represents Hoechst, scale bar is 50 μm;

[0132] Figure 8F shows the correlation between the proportion of LMX1A + EN1 + , LMX1A + EN1 - in cultures at day 21 and the TH + / Ho ratio (left) or EN1 + TH + / TH + ratio (right) after in vitro maturation.

[0133] Figure 9A is an immunostaining of hESC-derived 6MPT grafts after in vivo maturation showing the ventral marker LMX1A; HN represents human nuclei, scale bar is 20 μm;

[0134] Figure 9B shows the quantification of LMX1A + cells relative to HN + cells in Figure 9A; data are expressed as mean ± SEM;

[0135] Figure 9C is an immunostaining of hESC-derived 6MPT grafts after in vivo maturation showing the DA neuronal markers TH and DAT, scale bar is 20 μm;

[0136] Figure 9D shows the quantification of DAT + cells relative to TH + cells in Figure 9C; data are expressed as mean ± SEM;

[0137] Figure 9E shows the changes in amphetamine-induced rotational behavior in PD mice six months after transplantation of hESC-derived mDAP (6MPT); n = 3 (SAG 0.25CHIR 0.6), 5 (SAG 0.25CHIR 0.8), 3 (SAG 0.5CHIR 0.6), 7 (SAG 0.5CHIR 0.8); data are presented as mean ± SEM.

[0138] Figures 10A to 10D show the estimation of graft volume (Figure 10A), total donor cell number (Figure 10B), and donor cell number / mm² by HN staining at 6 months, respectively. 2 (Figure 10C) and donor cell count / mm 3 (Figure 10D); n = 3(hiPSC#A), 3(hiPSC#B), 7(hiPSC#C D28), 4(hiPSC#C D21), Tukey multiple comparison test after one-sided ANOVA; related to Figure 10;

[0139] Figures 10E to 10G show the estimation of total TH number (Figure 10E) and TH / mm by TH staining at 6 months, respectively. 2 (Figure 10F) and TH / mm 3 (Figure 10G); n = 3(hiPSC#A), 3(hiPSC#B), 7(hiPSC#C D28), 4(hiPSC#C D21); Tukey multiple comparison test after one-sided ANOVA; related to Figure 1O;

[0140] Figure 10H shows the immunostaining of mature hiPSC-derived 6MPT grafts in vivo, revealing the proliferation marker Ki67. Scale bar: 100 μm.

[0141] Figures 10I to 10L show the estimation of the total Ki67 number (Figure 10I), Ki67 / HN (Figure 10J), and Ki67 / mm by Ki67 staining of Figure 10H at six months, respectively. 2 (Figure 10K) and Ki67 / mm 3 (Figure 10L); n = 3(hiPSC#A), 3(hiPSC#B), 7(hiPSC#C D28), 4(hiPSC#C D21); Tukey multiple comparison test was performed after one-sided ANOVA;

[0142] Figure 10M shows the immunostaining of mature hiPSC-derived 6MPT grafts in vivo, revealing the ventral marker FOXA2 (Figure 10M), scale bar 100 μm;

[0143] Figure 10N shows the FOXA2 in Figure 10M. +Cells relative to HN + Quantification of cells; data shown as mean ± standard error (SEM);

[0144] Figure 10O is an immunostaining of in vivo matured hiPSC-derived 6MPT grafts showing the serotonergic marker 5-HT (Figure 10O), scale bar 100 pm;

[0145] Figure 10P shows the quantification of 5-HT in Figure 10O + Cells relative to HN + Quantification of cells; data shown as mean ± standard error (SEM);

[0146] Figure 11A shows the change in the proportion of LMX1A and EN1 double positive cells between the first, second and third week of in vitro differentiation under 2D starting conditions, with constant or gradient Wnt activation;

[0147] Figure 11B is an immunostaining of in vitro matured day 45 hESC-derived cultures under 2D starting conditions, with constant or gradient Wnt activation, showing the mDA marker TH; Ho indicates Hoechst, scale bar 50 pm;

[0148] Figure 11C shows the quantification of TH in Figure 11B + Cells relative to Ho + Quantification of cells; data shown as mean ± standard error (SEM);

[0149] Figure 11D is an immunostaining of in vivo matured hESC-derived 6MPT grafts under 2D starting conditions, with constant or gradient Wnt activation, showing the mDA marker TH, scale bar 100 pm;

[0150] Figure 11E shows the quantification of TH in Figure 11D + Quantification of cells relative to HN cells; data shown as mean ± standard error (SEM);

[0151] Figure 12A is a violin plot showing representative markers in cell clusters at day 7, day 14, day 21;

[0152] Figure 12B shows the expression of typical markers of ventral midbrain (EN1, LMX1A, FOXA2, OTX2, CORIN) and neurons (STMN2) during the time course differentiation using UMAP; the expression of non-aimed cluster markers (SIM2, NTRK2) in day 28 cultures using UMAP;

[0153] FIG. 12C shows expression of previously discovered midbrain DA progenitor cell surface markers in day 21 and day 28 cultures using UMAP;

[0154] FIG. 12D shows expression of identified midbrain DA progenitor cell surface markers and transcription factors in day 21 and day 28 cultures using UMAP;

[0155] FIG. 13A is a schematic showing the GDF15-p2A-tdTomato / EN1-p2A-EGFP dual reporter cell line used to indicate P_GDF15 clusters during differentiation;

[0156] FIG. 13B shows representative images of day 28 cultures derived from the GDF15 reporter cell line in FIG. 12A, immunostained with EN1, tdTomato, and Ho, scale bar 100 pm;

[0157] FIG. 13C shows the most enriched biological processes (BPs) in P_GDF15 clusters of day 28 cultures compared to other clusters in the culture; adjusted p-values are shown;

[0158] FIGS. 13D and 13E show expression of canonical markers of midbrain DA progenitors (EN1, LMX1A, FOXA2, OTX2, CORIN), P_dFP (SIM2), P_GDF15 (GDF15), P_CD36 (CD36), and neurons (STMN2) on day 21 cultures (FIG. 13D) and day 28 cultures (FIG. 13E) using UMAP;

[0159] FIG. 14A shows visualization of integrated clusters of day 28 cultures and 1MPT grafts using UMAP;

[0160] FIG. 14B shows visualization of cell line distribution of integrated data set using UMAP;

[0161] FIG. 14C shows visualization of time point distribution of integrated data set using UMAP;

[0162] FIG. 14D shows proportion of clusters of day 28 cultures (left panel) and 1MPT grafts (right panel) by cell line (hiPSC#C and hESC#H9) using UMAP;

[0163] FIG. 14E shows identification of cell clusters in FIG. 5C by expression of canonical markers of DA (TH, EN1), Glut (SLC17A6), VLMC (COL1A1), and Astro (SOX9, AQP4);

[0164] FIG. 14F is a violin plot showing 4MPT neuron cluster representative markers of neuronal cluster expression for 1MPT grafts;

[0165] FIG. 15A is a schematic showing the structure of the barcoded lentivirus used for TX-SISBAR;

[0166] FIG. 15B shows the diversity of the barcoded lentivirus library, estimated by high-throughput sequencing of ~50 million reads of the plasmid library;

[0167] FIG. 15C shows the distribution of minimal barcode distance (distance of a given barcode to its most similar barcode in the entire library pool) in the barcoded lentivirus library;

[0168] FIG. 15D shows the distribution of viral barcodes visualized using UMAP for the integrated data set;

[0169] FIG. 15E shows the viral barcode recovery rate between different clusters (left) and samples (right)

[0170] FIG. 15F shows the quantitative analysis of sister cells based on gene expression correlation and graphical distance on UMAP plot;

[0171] FIG. 15G is an integrated UMAP result showing examples of biased clonality;

[0172] FIG. 15H shows the reconstruction and visualization of cells in cross-stage clonality using force-directed network, points are individual cells colored by stage and connected together by clonal relationship;

[0173] FIG. 15I is a dot plot showing lineage coupling scores (p-value and Tversky score) between pairs of cell clusters across transplants by origin perspective analysis (blue dots) and potential perspective analysis (orange dots), data split by cell line. Points with p<0.05 are shown, numbers within each point represent the number of clones in each pair of clusters; clones less than 3 are not shown;

[0174] FIG. 16A is a pie chart showing the distribution of potential of precursor cell clusters;

[0175] FIG. 16B is a pie chart showing the distribution of origin of terminal cell clusters;

[0176] FIG. 17A is a schematic showing the SISBAR experiment for in vitro maturation;

[0177] FIG. 17B shows the distribution of time points (left) and cell cluster distribution (right) visualized using UMAP for the integrated data set;

[0178] FIG. 17C shows the cell clusters in FIG. 17B identified by expression of canonical markers for DA (TH, EN1), Glut (SLC17A6), VLMC (COL1A1), P_dFP (SIM2), and Nb (NEUROD1);

[0179] FIG. 17D is a violin plot showing representative markers in neuroblast and neuron cell clusters;

[0180] FIG. 17E shows the cell cluster distribution of in vitro and in vivo maturation integrated data sets visualized using UMAP;

[0181] FIG. 17F is a violin plot showing expression of representative markers of in vivo mature neurons in in vitro mature neuroblast and neuron cell clusters;

[0182] FIG. 17G is a dot plot showing lineage coupling scores (p-value and Tversky score) between pairs of cell clusters across transplants by origin perspective analysis (blue dots) and potential perspective analysis (orange dots). Points with p<0.05 are shown, numbers within each point indicate the number of clones in each pair of clusters; clones less than 3 are not shown;

[0183] FIG. 17H is a Sankey plot showing significant progenitor outcome associations between D28 cultures and in vitro maturation;

[0184] FIG. 18A is a schematic showing viral barcoding at day 7 and day 14 of the differentiation process;

[0185] FIGS. 18B and 18C show the clusters of day 14 cultures (FIG. 18B) and day 21 cultures (FIG. 18C) visualized using UMAP after viral barcoding, respectively;

[0186] FIG. 18D is a heatmap showing viral barcode-based lineage correlations between cell clusters in the day 14 cultures (FIG. 18B) and day 21 cultures (FIG. 18C) data sets;

[0187] FIG. 18E shows GO analysis between P_mFP and P_dFP clusters in day 14 cultures;

[0188] FIG. 19A is a schematic showing constant or gradient Wnt activation steps in the differentiation process;

[0189] FIG. 19B is a violin plot showing representative markers in day 7, day 14, day 21 cell clusters after gradient Wnt activation;

[0190] FIG. 19C shows expression of ventral midbrain (EN1, LMX1A, FOXA2, OTX2, CORIN) and neuronal (STMN2) canonical markers over time using UMAP; expression of non-canonical cluster markers (SIM2, NTRK2) in day 28 cultures using UMAP and additional Wnt activation;

[0191] FIG. 20A shows integrated cluster results for day 21 cultures derived from hiPSCs (hiPSCs #A-C) using UMAP visualization after gradient Wnt activation;

[0192] FIG. 20B shows distribution results for each cell line at day 21 using UMAP visualization after gradient Wnt activation;

[0193] FIG. 20C shows cluster proportions for day 21 cultures for each cell line in FIGS. 20A and 20B;

[0194] FIG. 20D shows integrated cluster results for day 28 cultures derived from hiPSCs (hiPSCs #A-C) using UMAP visualization after gradient Wnt activation;

[0195] FIG. 20E shows distribution results for each cell line at day 28 using UMAP visualization after gradient Wnt activation;

[0196] FIG. 20F shows cluster proportions for day 28 cultures for each cell line in FIGS. 20A and 20E;

[0197] FIG. 20G shows cluster ratio differences for day 21 cultures under conditions of constant or gradient Wnt activation;

[0198] FIG. 20H shows expression of P_dFP markers (SIM2 and BARHL2) at day 21 using UMAP under conditions of constant or gradient Wnt activation;

[0199] FIG. 21 shows SIM2 expression in day 21 and day 28 cultures derived from three hiPSC lines (hiPSC #A, hiPSC #B, hiPSC #C) as a function of gradient Wnt activation;

[0200] Figure 20J shows changes in amphetamine-induced rotarod behavior in PD mice six months after transplantation of hiPSC-derived gradient-Wnt-activated mDAPs (6MPT); n = 6 (hiPSC#A D21), 5 (hiPSC#B D21), 5 (hiPSC#C D21), 4 (hiPSC#A D28), 6 (hiPSC#B D28), 4 (hiPSC#C D28), data represented as mean ± SEM;

[0201] Figure 21A shows unsupervised clustering of host brains with 3MPT and 7MPT grafts shown as cell bins of size 50, cell bins colored according to their annotation; STR represents striatum, PAL represents pallidum, CTX represents cortex, HYPO represents hypothalamus, CC represents corpus callosum, ACO represents anterior commissure, LSX represents lateral septal complex, VS represents ventricular system, Astro represents astrocytes, Micro represents microglia, CIN represents cholinergic interneurons, RBC represents red blood cells, OPC represents oligodendrocyte precursor cells;

[0202] Figure 21B shows violin plot of number of genes per cluster for cell bin size 50;

[0203] Figure 21C shows spatial distribution of all subclusters in 7MPT grafts shown in adjusted cell bins;

[0204] Figure 22A shows representative images of first day cultures for different Feret diameter distribution groups and bar graph of Feret diameter distribution for each group of cultures, scale bar is 100 pm;

[0205] Figure 22B shows EN1 + cell proportion dot plot for first, second, and fourth groups of cultures at day 13 in Figure 22A;

[0206] Figure 22C shows correlation dot plot of mean Feret diameter and EN1 + cell proportion for day 13 cultures. DETAILED DESCRIPTION

[0207] The application will be further described in conjunction with the specific embodiments, the examples given are only to help clarify the application or as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any way to limit the application.

[0208] The experimental methods in the following examples, unless otherwise specified, are routine methods, performed according to techniques or conditions described in the literature in the art or according to the instructions of the products. See, for example, Sambrook et al. Molecular Cloning: a Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, 2012; Ausubel et al., Current Protocols in Molecular Biology, Wiley Online Library, updated periodically; and other general tools in the field of biology. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0209] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. Unless defined otherwise, all scientific and technical terms used in connection with this disclosure will have the meanings that are commonly understood by those of ordinary skill in the art. The meanings and ranges of the terms should be clear from the context in which they are used, however, in the event of any latent ambiguity, the definitions provided herein take precedent.

[0210] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, reference to "a cell" includes a combination of two or more cells, or an entire culture of cells.

[0211] As used herein, the term "comprising" or "including," means including the recited components or steps but not excluding others. "Consisting essentially of, when used in the definition of a product or method, shall mean excluding other components or steps essential to the technical effect of the claimed product or method. "Consisting of shall mean excluding other components or steps not mentioned.

[0212] As used herein, the term "about," unless otherwise expressly specified, is understood to mean within normal tolerances of the art, for example, within 2 standard deviations of the mean. "About" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term "about."

[0213] As used herein, the terms "first," "second," are used for purposes of description only and are not intended to indicate or imply relative importance or a limitation on the scope of the indicated technical features, unless otherwise expressly indicated from the context. Unless otherwise expressly noted, features described with "first," "second" can include at least one of the features.

[0214] As used herein, the term "isolated" or "in isolation" refers to the identification, separation, and recovery of a biological component (such as a cell or a graft) from its surroundings (such as an in vitro medium or an in vivo environment) in which the component is produced. In preferred embodiments, "isolated" means that the biological component will be substantially separated from all other biological components in the environment in which it is produced, to the extent that it is substantially free of the influence of other biological components on its composition and / or functional activity. In some embodiments, isolation can mean achieved by at least one purification step.

[0215] The term "engineered" refers to a method of modifying the genome of a cell, including but not limited to deletion of a coding or non-coding region or a portion thereof, or insertion of a coding or non-coding region or a portion thereof.

[0216] As used herein, the terms "treatment" and "amelioration" are used interchangeably herein to refer to an approach for obtaining beneficial or desired results, including but not limited to therapeutic benefit and / or prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated. A therapeutic benefit can be either subjective, as determined by a patient, or objective as determined by a clinician. For the purposes of this application, therapeutic benefit includes, but is not limited to, reduction of symptoms, diminishing extent of disease, stabilizing the disease state, and remission (whether partial or total), whether detectable or undetectable. For prophylactic benefit, the pharmaceutical compositions disclosed herein can also be administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis can not have been made. As used herein, the term "prevention" refers to reducing the frequency of occurrence of a disorder or condition in a statistical sample of treated samples relative to a control sample that is not treated, or delaying the time of onset and / or lessening the severity of one or more symptoms of a disorder or condition relative to a control sample that is not treated.

[0217] In some aspects, the term "treatment" encompasses both prophylactic and / or therapeutic treatment. In general, treatment is prophylactic if it is administered prior to the clinical manifestation of an unwanted condition (e.g., a hallmark behavior such as tremor, or the observation of a typical pathological molecular marker, etc.); whereas treatment is therapeutic if it is administered after the manifestation of the unwanted condition (i.e., intended to reduce, improve or stabilize an existing unwanted condition or side effects thereof).

[0218] As used herein, the term "excipient" refers to various compounds used in preparing a pharmaceutical composition, which are generally safe and non-toxic, and do not have biological or other properties that would significantly interfere with the effectiveness of the treatment.

[0219] As used herein, the term "therapeutically effective amount" refers to an amount of the / cells of the present application that can: (i) treat or prevent a disease or disorder described herein (Parkinson's and other neurological disorders), (ii) ameliorate or eliminate one or more of the diseases or disorders described herein, or (iii) prevent or delay the onset of one or more symptoms of the diseases or disorders described herein.

[0220] I. In vitro differentiation method of stem cells

[0221] The present application provides a method for in vitro induction of pluripotent stem cells to differentiate into mesencephalic dopaminergic progenitor cells.

[0222] In some embodiments, the in vitro differentiation method of pluripotent stem cells disclosed herein comprises: (A) culturing pluripotent stem cells in suspension in the presence of a combination of at least one inhibitor of BMP signaling, at least one inhibitor of TGF-β1 signaling, at least one activator of Wnt signaling, and at least one activator of Sonic hedgehog (SHH) signaling, to obtain a differentiated cell population A expressing at least one marker indicative of floor plate progenitor cells; (B) culturing the differentiated cell population A in suspension first in the presence of a combination of at least one activator of Wnt signaling and at least one activator of Sonic hedgehog (SHH) signaling, and then in the presence of a combination of at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of FGF signaling, to obtain a differentiated cell population B expressing at least one marker indicative of floor plate progenitor cells; and (C) culturing the differentiated cell population B in suspension in the presence of a combination of at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of FGF signaling, to obtain a differentiated cell population C expressing at least one marker indicative of mesencephalic floor plate progenitor cells.

[0223] In some embodiments, the in vitro differentiation method of the pluripotent stem cells disclosed herein comprises: (A) culturing pluripotent stem cells in suspension in the presence of a combination of at least one inhibitor of BMP signaling, at least one inhibitor of TGF-β1 signaling, at least one activator of Wnt signaling, and at least one activator of Sonic hedgehog (SHH) signaling, to obtain a differentiated cell population A expressing at least one marker indicative of floor plate progenitor cells; (B) culturing the differentiated cell population A in suspension first in the presence of a combination of at least one activator of Wnt signaling and at least one activator of Sonic hedgehog (SHH) signaling, and then in the presence of a combination of at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of FGF signaling, to obtain a differentiated cell population B expressing at least one marker indicative of floor plate progenitor cells; (C) culturing the differentiated cell population B in suspension in the presence of a combination of at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of FGF signaling, to obtain a differentiated cell population C expressing at least one marker indicative of midbrain floor plate progenitor cells; and (D) culturing the differentiated cell population C in suspension in the presence of a combination of at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of FGF signaling, to obtain a differentiated cell population D expressing at least one marker indicative of midbrain floor plate progenitor cells.

[0224] In some embodiments, the in vitro differentiation method disclosed herein does not comprise a step of culturing cells using a feeder layer or using a coating reagent to coat the culture vessel. In some embodiments, each of the culturing steps (including steps A to D) in the in vitro differentiation method disclosed herein is a static suspension culturing step. In some embodiments, each of the culturing steps (including steps A to D) in the in vitro differentiation method disclosed herein is a dynamic suspension culturing step. In some embodiments, some of the culturing steps (including steps A to D) in the in vitro differentiation method disclosed herein are static suspension culturing steps, and some are dynamic suspension culturing steps.

[0225] In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is substantially maintained constant during the course of step A relative to the initial concentration at the time of initiation of contact with the pluripotent stem cells. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased during the course of step A relative to the initial concentration at the time of initiation of contact with the pluripotent stem cells. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased after day 4 of initiation of contact with the pluripotent stem cells relative to the initial concentration at the time of initiation of contact with the pluripotent stem cells. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by at least about 300% during the course of step (A) relative to the initial concentration at the time of initiation of contact with the pluripotent stem cells. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, at least about 1000%, at least about 1100%, at least about 1200%, at least about 1300%, at least about 1400%, at least about 1500%, at least about 1600%, at least about 1700%, at least about 1800%, at least about 1900%, at least about 2000% during the course of step (A) relative to the initial concentration at the time of initiation of contact with the pluripotent stem cells. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by about 300% to about 2000%, about 350% to about 2000%, about 300% to about 1500%, about 300% to about 1000%, about 350% to about 1500%, about 400% to about 2000%, about 400% to about 1500%, or about 1000% to about 2000% during the course of step (A) relative to the initial concentration at the time of initiation of contact with the pluripotent stem cells. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by about 350% to about 2000% during the course of step (A) relative to the initial concentration at the time of initiation of contact with the pluripotent stem cells. In preferred embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by about 400% to about 1500% during the course of step (A) relative to the initial concentration at the time of initiation of contact with the pluripotent stem cells. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the initial concentration of the at least one Wnt signaling activator is about 0.2 to about 1.0 μΜ.In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the initial concentration of the at least one Wnt signaling activator is about 0.2 to about 0.8 μΜ. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the initial concentration of the at least one Wnt signaling activator is about 0.2 to about 0.6 μΜ. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the initial concentration of the at least one Wnt signaling activator is about 0.20, about 0.21, about 0.22, about 0.23, about 0.24, about 0.25, about 0.26, about 0.27, about 0.28, about 0.29, about 0.30, about 0.31, about 0.32, about 0.33, about 0.34, about 0.35, about 0.36, about 0.37, about 0.38, about 0.39, about 0.40, about 0.41, about 0.42, about 0.43, about 0.44, about 0.45, about 0.46, about 0.47, about 0.48, about 0.49, about 0.50, about 0.51, about 0.52, about 0.53, about 0.54, about 0.55, about 0.56, about 0.57, about 0.58, about 0.59, about 0.60, about 0.61, about 0.62, about 0.63, about 0.64, about 0.65, about 0.66, about 0.67, about 0.68, about 0.69, about 0.70, about 0.71, about 0.72, about 0.73, about 0.74, about 0.75, about 0.76, about 0.77, about 0.78, about 0.79, about 0.80, about 0.81, about 0.82, about 0.83, about 0.84, about 0.85, about 0.86, about 0.87, about 0.88, about 0.89, about 0.90, about 0.91, about 0.92, about 0.93, about 0.94, about 0.95, about 0.96, about 0.97, about 0.98, about 0.99, or about 1.00 μΜ. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by at least about 1.0 μΜ.In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, about 4.0, about 4.1, about 4.2, about 4.3, about 4.4, about 4.5, about 4.6, about 4.7, about 4.8, about 4.9, about 5.0, about 5.1, about 5.2, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, about 8.0, about 8.1, about 8.2, about 8.3, about 8.4, about 8.5, about 8.6, about 8.7, about 8.8, about 8.9, about 9.0, about 9.1, about 9.2, about 9.3, about 9.4, about 9.5, about 9.6, about 9.7, about 9.8, about 9.9, about 10.0, about 11.0, about 12.0, about 13.0, about 14.0, or about 15.0 μΜ. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by about 1.0 to about 15.0 μΜ, about 2.0 to about 15.0 μΜ, about 3.0 to about 15.0 μΜ, about 4.0 to about 15.0 μΜ, about 1.0 to about 10.0 μΜ, about 2.0 to about 10.0 μΜ, about 3.0 to about 10.0 μΜ, about 4.0 to about 10.0 μΜ, about 1.0 to about 5.0 μΜ, about 2.0 to about 5.0 μΜ, about 3.0 to about 5.0 μΜ, about 4.0 to about 5.0 μΜ, about 1.0 to about 3.0 μΜ, about 2.0 to about 3.0 μΜ, about 1.0 to about 4.0 μΜ, or about 2.0 to about 4.0 μΜ. In some embodiments, in step (A) of the in vitro differentiation methods disclosed herein, the concentration of the at least one Wnt signaling activator is increased by about 3.0 to about 10.0 μΜ.

[0226] In some embodiments, step (A) in the in vitro differentiation methods disclosed herein lasts for at least 5 days (or at least about 120 hours). In some embodiments, step (A) in the in vitro differentiation methods disclosed herein lasts for 5 to 8 days (or about 120 to about 192 hours). In some embodiments, step (A) in the in vitro differentiation methods disclosed herein lasts for 6 to 7 days (or about 144 to about 168 hours).

[0227] In some embodiments, the concentration of the at least one BMP signaling inhibitor in step (A) in the in vitro differentiation methods disclosed herein is about 0.5 to about 10.0 μΜ. In some embodiments, the concentration of the at least one BMP signaling inhibitor in step (A) in the in vitro differentiation methods disclosed herein is about 0.5 to about 5.0 μΜ, about 0.5 to about 2.5 μΜ, about 2.5 to about 7.5 μΜ, or about 5.0 to about 10.0 μΜ. In some embodiments, the concentration of the at least one BMP signaling inhibitor in step (A) in the in vitro differentiation methods disclosed herein is about 0.5 μΜ, about 0.6 μΜ, about 0.7 μΜ, about 0.8 μΜ, about 0.9 μΜ, about 1.0 μΜ, about 2.0 μΜ, about 3.0 μΜ, about 4.0 μΜ, about 5.0 μΜ, about 6.0 μΜ, about 7.0 μΜ, about 8.0 μΜ, about 9.0 μΜ, or about 10.0 μΜ.

[0228] In some embodiments, the concentration of the at least one TGF-β1 signaling inhibitor in step (A) in the in vitro differentiation methods disclosed herein is about 1.0 to about 10.0 μΜ. In some embodiments, the concentration of the at least one TGF-β1 signaling inhibitor in step (A) in the in vitro differentiation methods disclosed herein is about 2.0 to about 10.0 μΜ, about 1.0 to about 2.0 μΜ, about 1.0 to about 5.0 μΜ, or about 5.0 to about 10.0 μΜ. In some embodiments, the concentration of the at least one TGF-β1 signaling inhibitor in step (A) in the in vitro differentiation methods disclosed herein is about 1.0 μΜ, about 2.0 μΜ, about 3.0 μΜ, about 4.0 μΜ, about 5.0 μΜ, about 6.0 μΜ, about 7.0 μΜ, about 8.0 μΜ, about 9.0 μΜ, or about 10.0 μΜ.

[0229] In some embodiments, the concentration of the at least one Sonic hedgehog (SHH) signaling activator in step (A) of the in vitro differentiation methods disclosed herein is about 0.1 to about 2.0 μΜ. In some embodiments, the concentration of the at least one SHH signaling activator in step (A) of the in vitro differentiation methods disclosed herein is about 0.2 to about 1.0 μΜ. In some embodiments, the concentration of the at least one SHH signaling activator in step (A) of the in vitro differentiation methods disclosed herein is about 0.1 μΜ, about 0.2 μΜ, about 0.3 μΜ, about 0.4 μΜ, about 0.5 μΜ, about 0.6 μΜ, about 0.7 μΜ, about 0.8 μΜ, about 0.9 μΜ, about 1.0 μΜ, about 1.1 μΜ, about 1.2 μΜ, about 1.3 μΜ, about 1.4 μΜ, about 1.5 μΜ, about 1.6 μΜ, about 1.7 μΜ, about 1.8 μΜ, about 1.9 μΜ, or about 2.0 μΜ.

[0230] In some embodiments, step (B) of the in vitro differentiation methods disclosed herein lasts for at least 5 days (or at least about 120 hours). In some embodiments, step (B) of the in vitro differentiation methods disclosed herein lasts for 5 to 8 days (or about 120 to about 192 hours). In some embodiments, step (B) of the in vitro differentiation methods disclosed herein lasts for 6 to 7 days (or about 144 to about 168 hours).

[0231] In some embodiments, the concentration of the at least one Wnt signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 0.2 to about 15.0 μΜ. In some embodiments, the concentration of the at least one Wnt signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 0.2 to about 10.0 μΜ. In some embodiments, the concentration of the at least one Wnt signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 0.2 μΜ, about 0.3 μΜ, about 0.4 μΜ, about 0.5 μΜ, about 0.6 μΜ, about 0.7 μΜ, about 0.8 μΜ, about 0.9 μΜ, about 1.0 μΜ, about 2.0 μΜ, about 3.0 μΜ, about 4.0 μΜ, about 5.0 μΜ, about 6.0 μΜ, about 7.0 μΜ, about 8.0 μΜ, about 9.0 μΜ, about 10.0 μΜ, about 11.0 μΜ, about 12.0 μΜ, about 13.0 μΜ, about 14.0 μΜ, or about 15.0 μΜ.

[0232] In some embodiments, the concentration of the at least one SHH signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 0.1 to about 2.0 μΜ. In some embodiments, the concentration of the at least one SHH signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 0.2 to about 1.0 μΜ. In some embodiments, the concentration of the at least one SHH signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 0.1, about 0.2 μΜ, about 0.3 μΜ, about 0.4 μΜ, about 0.5 μΜ, about 0.6 μΜ, about 0.7 μΜ, about 0.8 μΜ, about 0.9 μΜ, about 1.0 μΜ, about 1.1 μΜ, about 1.2 μΜ, about 1.3 μΜ, about 1.4 μΜ, about 1.5 μΜ, about 1.6 μΜ, about 1.7 μΜ, about 1.8 μΜ, about 1.9 μΜ, or about 2.0 μΜ.

[0233] In some embodiments, the concentration of the at least one FGF signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 10 to about 500 ng / ml. In some embodiments, the concentration of the at least one FGF signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 20 to about 200 ng / ml. In some embodiments, the concentration of the at least one FGF signaling activator in step (B) of the in vitro differentiation methods disclosed herein is about 10 ng / ml, about 20 ng / ml, about 30 ng / ml, about 40 ng / ml, about 50 ng / ml, about 60 ng / ml, about 70 ng / ml, about 80 ng / ml, about 90 ng / ml, about 100 ng / ml, about 110 ng / ml, about 120 ng / ml, about 130 ng / ml, about 140 ng / ml, about 150 ng / ml, about 160 ng / ml, about 170 ng / ml, about 180 ng / ml, about 190 ng / ml, about 200 ng / ml, about 250 ng / ml, about 300 ng / ml, about 350 ng / ml, about 400 ng / ml, about 450 ng / ml, or about 500 ng / ml.

[0234] In some embodiments, step (C) of the in vitro differentiation methods disclosed herein lasts for at least 5 days (or at least about 120 hours). In some embodiments, step (C) of the in vitro differentiation methods disclosed herein lasts for 5 to 8 days (or about 120 to about 192 hours). In some embodiments, step (C) of the in vitro differentiation methods disclosed herein lasts for 6 to 7 days (or about 144 to about 168 hours).

[0235] In some embodiments, in step (C) of the in vitro differentiation methods disclosed herein, the concentration of the at least one SHH signaling activator is substantially maintained relative to its concentration at the end of said step (B).

[0236] In some embodiments, in step (C) of the in vitro differentiation methods disclosed herein, the concentration of the at least one FGF signaling activator is substantially maintained relative to its concentration at the end of said step (B).

[0237] In some embodiments, in step (C) of the in vitro differentiation methods disclosed herein, the concentration of the at least one SHH signaling activator and the at least one FGF signaling activator is substantially maintained relative to their concentrations at the end of said step (B).

[0238] In some embodiments, step (D) of the in vitro differentiation methods disclosed herein lasts for at least 5 days (or at least about 120 hours). In some embodiments, step (D) of the in vitro differentiation methods disclosed herein lasts for 5 to 8 days (or about 120 to about 192 hours). In some embodiments, step (D) of the in vitro differentiation methods disclosed herein lasts for 6 to 7 days (or about 144 to about 168 hours).

[0239] In some embodiments, in step (D) of the in vitro differentiation methods disclosed herein, the concentration of the at least one SHH signaling activator is reduced below its concentration at the end of said step (C).

[0240] In some embodiments, in step (D) of the in vitro differentiation methods disclosed herein, the concentration of the at least one FGF signaling activator is reduced below its concentration at the end of said step (C).

[0241] In some embodiments, in step (D) of the in vitro differentiation methods disclosed herein, the concentration of the at least one SHH signaling activator and the at least one FGF signaling activator is reduced below their concentrations at the end of said step (C).

[0242] In some embodiments, the concentration of the at least one SHH signaling activator is reduced to about 0.1 to about 1.0 μΜ in step (D) of the in vitro differentiation methods disclosed herein. In some embodiments, the concentration of the at least one SHH signaling activator is reduced to about 0.1 to about 0.5 μΜ in step (D) of the in vitro differentiation methods disclosed herein. In some embodiments, the concentration of the at least one SHH signaling activator is reduced to about 0.1 μΜ, about 0.2 μΜ, about 0.3 μΜ, about 0.4 μΜ, about 0.5 μΜ, about 0.6 μΜ, about 0.7 μΜ, about 0.8 μΜ, about 0.9 μΜ, or about 1.0 μΜ in step (D) of the in vitro differentiation methods disclosed herein.

[0243] In some embodiments, the concentration of the at least one FGF signaling activator in step (D) of the in vitro differentiation methods of pluripotent stem cells disclosed herein is reduced to about 10 to about 200 ng / ml. In some embodiments, the concentration of the at least one FGF signaling activator in step (D) of the in vitro differentiation methods of pluripotent stem cells disclosed herein is reduced to about 10 to about 100 ng / ml. In some embodiments, the concentration of the at least one FGF signaling activator in step (D) of the in vitro differentiation methods of pluripotent stem cells disclosed herein is reduced to about 10 ng / ml, about 20 ng / ml, about 30 ng / ml, about 40 ng / ml, about 50 ng / ml, about 60 ng / ml, about 70 ng / ml, about 80 ng / ml, about 90 ng / ml, about 100 ng / ml, about 110 ng / ml, about 120 ng / ml, about 130 ng / ml, about 140 ng / ml, about 150 ng / ml, about 160 ng / ml, about 170 ng / ml, about 180 ng / ml, about 190 ng / ml, or about 200 ng / ml.

[0244] In some embodiments, the "for at least 5 days" in each step of the in vitro differentiation methods disclosed herein comprises for 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days.

[0245] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population A comprises a subpopulation Al expressing at least one marker indicative of floor plate progenitor cells and a subpopulation A2 expressing at least one marker indicative of neurons and neuroblasts. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population A comprises a subpopulation Al expressing at least one marker indicative of floor plate progenitor cells, a subpopulation A2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation A3 expressing at least one marker indicative of mid-hindbrain isthmic progenitor cells. In some embodiments, the marker indicative of floor plate progenitor cells of subpopulation Al is selected from any one or any combination of FOXA2, OTX2, SOX2. In some embodiments, the marker indicative of neurons and neuroblasts of subpopulation A2 is selected from any one or any combination of NEUROD1, NEUROD4, NEUROG2. In some embodiments, the marker indicative of mid-hindbrain isthmic progenitor cells of subpopulation A3 is selected from any one or any combination of FGF17, FGF8, S100A11, FOXH1, GBX2.

[0246] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells and a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and any one or any combination of a subpopulation B3 positive for GDF15, a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation B3 positive for GDF15. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation B3 positive for GDF15, and a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation B3 positive for GDF15, and a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation B3 positive for GDF15, a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.

[0247] In some embodiments, the marker indicative of floor plate progenitor cells of subgroup B1 is selected from any one of or any combination of FOXA2, OTX2, SOX2, CORIN. In some embodiments, the marker indicative of neurons and neuroblasts of subgroup B2 is selected from any one of or any combination of NEUROD1, NEUROD4, NEUROG2, GAP43, or STMN2. In some embodiments, the marker indicative of hindbrain floor plate progenitor cells of subgroup B4 is selected from PLSCR5 and / or PDE1A. In some embodiments, the marker indicative of mid-hindbrain isthmus progenitor cells of subgroup B5 is selected from any one of or any combination of FGF17, FGF8, or WIF1.

[0248] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subgroup C1 expressing at least one marker indicative of midbrain floor plate progenitor cells and a subgroup C2 expressing at least one marker indicative of neurons and neuroblasts, and any one of or any combination of subgroup C3 positive for GDF15, subgroup C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, subgroup C5 positive for CD36, subgroup C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or subgroup C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subgroup C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subgroup C2 expressing at least one marker indicative of neurons and neuroblasts, and a subgroup C3 positive for GDF15. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subgroup C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subgroup C2 expressing at least one marker indicative of neurons and neuroblasts, and a subgroup C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subgroup C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subgroup C2 expressing at least one marker indicative of neurons and neuroblasts, and a subgroup C5 positive for CD36. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subgroup C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subgroup C2 expressing at least one marker indicative of neurons and neuroblasts, and a subgroup C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subgroup C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subgroup C2 expressing at least one marker indicative of neurons and neuroblasts, and a subgroup C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.

[0249] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, and a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, and a subpopulation C5 positive for CD36. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C5 positive for CD36. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C5 positive for CD36, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells.In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C5 positive for CD36, and a subpopulation C7 expressing at least one marker indicative of mid- / hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid- / hindbrain isthmus progenitor cells.

[0250] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C5 positive for CD36. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C5 positive for CD36, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C5 positive for CD36, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells.In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C5 positive for CD36, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.

[0251] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C5 positive for CD36, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0252] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.

[0253] In some embodiments, the marker indicative of midbrain floor plate progenitor cells of subpopulation C1 is selected from any one of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, WNT5A, ARX, ALCAM, CMTM8, RGS2, TFF3, SERPINF1, CMTM7, or any combination thereof. In some embodiments, the marker indicative of neurons and neuroblasts of subpopulation C2 is selected from any one of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2, or any combination thereof. In some embodiments, the marker indicative of diencephalic floor plate progenitor cells of subpopulation C4 is selected from any one of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609, or any combination thereof. In some embodiments, the marker indicative of hindbrain floor plate progenitor cells of subpopulation C6 is selected from any one of HOXB3, HOXB6, HOXB8, or HOXB9, or any combination thereof. In some embodiments, the marker indicative of mid-hindbrain isthmus progenitor cells of subpopulation C7 is selected from any one of FGF17, FGF8, WIF1, KRT7, or any combination thereof.

[0254] In the present application, the term "ADAMTS1" generally refers to disintegrin and metalloproteinase with thrombospondin motifs 1, which can also be called METH1, KIAA1346, ADAM-TS1 or C3-C5. The ADAMTS1 protein is a member of a family of disintegrin and metalloproteinases, and also belongs to the metzincin superfamily of proteases. The "ADAMTS1" can include full-length ADAMTS1, as well as truncations, functional fragments, different transcripts, splice variants and isoforms of ADAMTS1, naturally occurring ADAMTS1, artificially modified or mutated ADAMTS1 proteins. For the gene information of "ADAMTS1", the Ensembl database accession number ENSG00000154734 can be referred to, and for the protein information of "ADAMTS1", the UniProt database accession number Q9UHI8 can be referred to. In the present application, the "ADAMTS1" can serve as a molecular marker of dopaminergic progenitor cells.

[0255] In the present application, the term "ABCA5" generally refers to ATP binding cassette subfamily A member 5, which can also be called EST90625. The ABCA5 protein is a member of the superfamily of ATP binding cassette (ABC) transporters, which transport various molecules across intracellular and extracellular membranes. The "ABCA5" can include full-length ABCA5, as well as truncations, functional fragments, different transcripts, splice variants and isoforms of ABCA5, naturally occurring ABCA5, artificially modified or mutated ABCA5 proteins. For the gene information of "ABCA5", the Ensembl database accession number ENSG00000154265 can be referred to, and for the protein information of "ABCA5", the UniProt database accession number Q8WWZ7 can be referred to. In the present application, the "ABCA5" can serve as a molecular marker of dopaminergic progenitor cells.

[0256] In the present application, the term "WNT5A" generally refers to wingless-type MMTV integration site family, member 5A, which can also be referred to as HWNT5A or epididymal secretory sperm binding protein. WNT5A protein is a ligand for seven-transmembrane receptor frizzled-5 and receptor tyrosine kinase-like orphan receptor 2, and plays an important role in developmental pathways that regulate embryogenesis. The "WNT5A" can include full-length WNT5A, as well as truncations, functional fragments, different transcripts, splice variants and isoforms of WNT5A, naturally occurring WNT5A, artificially modified or mutated WNT5A protein. The gene information of "WNT5A" can be referred to Ensembl database accession number ENSG00000114251, and the protein information of "WNT5A" can be referred to UniProt database accession number P41221. In the present application, the "WNT5A" can be used as a molecular marker of dopaminergic progenitor cells.

[0257] In the present application, the term "TWIST1" generally refers to Twist family basic helix-loop-helix transcription factor 1, which can also be referred to as H-Twist, BHLHa38, BPES2, TWIST, CRS1, SCS, BPES3 or ACS3. TWIST1 protein is a basic helix-loop-helix (bHLH) transcription factor that binds to DNA E-box sequences and plays an important role in embryonic development. The "TWIST1" can include full-length TWIST1, as well as truncations, functional fragments, different transcripts, splice variants and isoforms of TWIST1, naturally occurring TWIST1, artificially modified or mutated TWIST1 protein. The gene information of "TWIST1" can be referred to Ensembl database accession number ENSG00000122691, and the protein information of "TWIST1" can be referred to UniProt database accession number Q15672. In the present application, the "TWIST1" can be used as a molecular marker of dopaminergic progenitor cells.

[0258] In the present application, the term "ADAMTS9" generally refers to disintegrin and metalloproteinase with thrombospondin motifs 9, which can also be referred to as KIAA1312 or EC 3.4.24.14. The ADAMTS9 protein is a member of a family of disintegrin and metalloproteinases, and also belongs to the metzincin superfamily of proteases. The "ADAMTS9" can include full-length ADAMTS9, as well as truncations, functional fragments, different transcripts, splice variants and isoforms of ADAMTS9, naturally occurring, artificially modified or mutated ADAMTS9 proteins. For gene information of "ADAMTS9", reference can be made to Ensembl database accession number ENSG00000163638, and for protein information of "ADAMTS9", reference can be made to UniProt database accession number Q9P2N4. In the present application, the "ADAMTS9" can serve as a molecular marker of dopaminergic progenitor cells.

[0259] In some embodiments, in the in vitro differentiation method disclosed herein, the differentiated cell population D comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells and a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and any one or any combination of a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, or a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0260] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D3 positive for GDF15. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D5 positive for CD36. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0261] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 that expresses at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 that expresses at least one marker indicative of neurons and neuroblasts, a subpopulation D3 that is GDF15 positive, and a subpopulation D4 that expresses at least one marker indicative of diencephalic floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 that expresses at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 that expresses at least one marker indicative of neurons and neuroblasts, a subpopulation D3 that is GDF15 positive, and a subpopulation D5 that is CD36 positive. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 that expresses at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 that expresses at least one marker indicative of neurons and neuroblasts, a subpopulation D3 that is GDF15 positive, and a subpopulation D6 that expresses at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 that expresses at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 that expresses at least one marker indicative of neurons and neuroblasts, a subpopulation D3 that is GDF15 positive, and a subpopulation D7 that expresses at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 that expresses at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 that expresses at least one marker indicative of neurons and neuroblasts, a subpopulation D4 that expresses at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D5 that is CD36 positive. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 that expresses at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 that expresses at least one marker indicative of neurons and neuroblasts, a subpopulation D4 that expresses at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D6 that expresses at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 that expresses at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 that expresses at least one marker indicative of neurons and neuroblasts, a subpopulation D4 that expresses at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D7 that expresses at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 that expresses at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 that expresses at least one marker indicative of neurons and neuroblasts, a subpopulation D5 that is CD36 positive, and a subpopulation D6 that expresses at least one marker indicative of floor plate lateral progenitor cells.In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D5 positive for CD36, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0262] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D5 positive for CD36. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D5 positive for CD36, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D5 positive for CD36, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells.In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0263] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation Dl expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells.

[0264] In some embodiments, in the in vitro differentiation methods disclosed herein, the differentiated cell population D comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0265] In some embodiments, the marker indicative of midbrain floor plate progenitor cells of subpopulation D1 is selected from any one of or any combination of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, or WNT5A. In some embodiments, the marker indicative of neurons and neuroblasts of subpopulation D2 is selected from any one of or any combination of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2. In some embodiments, the marker indicative of diencephalic floor plate progenitor cells of subpopulation D4 is selected from any one of or any combination of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609. In some embodiments, the marker indicative of floor plate lateral progenitor cells of subpopulation D6 is selected from any one of or any combination of SHISA3, NTRK2, PLP1, SOX3, or LIX1. In some embodiments, the marker indicative of hindbrain floor plate progenitor cells of subpopulation D7 is selected from any one of or any combination of HOXB3, HOXB6, HOXB8, or HOXB9.

[0266] In some embodiments of the in vitro differentiation methods disclosed herein, both differentiated cell populations C and D are in the form of a neurosphere having a core comprising GDF15 positive cells. In some embodiments, the GDF15 positive cells comprise at most about 10% of the total number of cells of the neurosphere. In some embodiments, the GDF15 positive cells comprise at most about 0.1%, at most about 0.2%, at most about 0.3%, at most about 0.4%, at most about 0.5%, at most about 0.6%, at most about 0.7%, at most about 0.8%, at most about 0.9%, at most about 1.0%, at most about 2.0%, at most about 3.0%, at most about 4.0%, at most about 5.0%, at most about 6.0%, at most about 7.0%, at most about 8.0%, at most about 9.0%, or at most about 10.0% of the total number of cells of the neurosphere.

[0267] In some embodiments, the neural spheroids have an average Feret diameter of about 50 microns to about 5 millimeters. In some embodiments, the neural spheroids have an average Feret diameter of about 50 microns to about 5 millimeters, about 50 microns to about 4 millimeters, about 50 microns to about 3 millimeters, about 50 microns to about 2 millimeters, about 0.1 millimeter to about 5 millimeters, about 0.1 millimeter to about 4 millimeters, about 0.1 millimeter to about 3 millimeters, about 0.1 millimeter to about 2 millimeters, about 0.05 to about 0.1 millimeter, about 0.05 to about 0.5 millimeter, about 0.5 to about 5 millimeter, about 1 to about 5 millimeter, or about 2 to about 5 millimeter. In preferred embodiments, the neural spheroids have an average Feret diameter of about 0.1 to about 2 millimeter. In some embodiments, the neural spheroids have an average Feret diameter of at most about 0.05 millimeter, at most about 0.06 millimeter, at most about 0.07 millimeter, at most about 0.08 millimeter, at most about 0.09 millimeter, at most about 0.1 millimeter, at most about 0.2 millimeter, at most about 0.3 millimeter, at most about 0.4 millimeter, at most about 0.5 millimeter, at most about 0.6 millimeter, at most about 0.7 millimeter, at most about 0.8 millimeter, at most about 0.9 millimeter, at most about 1.0 millimeter, at most about 1.1 millimeter, at most about 1.2 millimeter, at most about 1.3 millimeter, at most about 1.4 millimeter, at most about 1.5 millimeter, at most about 1.6 millimeter, at most about 1.7 millimeter, at most about 1.8 millimeter, at most about 1.9 millimeter, at most about 2.0 millimeter, at most about 3.0 millimeter, at most about 4.0 millimeter, or at most about 5.0 millimeter.

[0268] In some embodiments, the neural spheroids exist primarily in a form independent of one another. In some embodiments, the neural spheroids exist primarily in a form adhered to one another to form aggregates comprising a plurality of the neural spheroids. In some embodiments, the neural spheroids exist in a mixed form, i.e., comprising both individual neural spheroids independent of one another and aggregates comprising a plurality of the neural spheroids adhered to one another.

[0269] In some embodiments, the pluripotent stem cells used in the in vitro differentiation methods disclosed herein are selected from the group consisting of embryonic stem cells, induced pluripotent stem cells (iPSCs), parthenogenetic stem cells. In some embodiments, the pluripotent stem cells used in the in vitro differentiation methods disclosed herein can also be a mixture of embryonic stem cells, induced pluripotent stem cells (iPSCs), or parthenogenetic stem cells. In some embodiments, the induced pluripotent stem cells (iPSCs) used can be transcriptionally induced reprogrammed cells induced by the introduction of exogenous reprogramming factors, or can be chemically induced reprogrammed cells induced by the addition of chemical factors to the culture environment. In some embodiments, the pluripotent stem cells used are derived from a human, a non-human primate, a rodent, or a companion animal. In some embodiments, the stem cells are human stem cells. Non-limiting examples of human stem cells include human embryonic stem cells (hESCs), human pluripotent stem cells (hPSCs), human induced pluripotent stem cells (hiPSCs), human parthenogenetic stem cells, primordial germ cell-like pluripotent stem cells, ectodermal stem cells, F-class pluripotent stem cells, somatic stem cells, cancer stem cells, or any other cell capable of lineage-specific differentiation. In some embodiments, the stem cells are human embryonic stem cells (hESCs). In some embodiments, the stem cells are human induced pluripotent stem cells (hiPSCs).

[0270] In some embodiments, the in vitro differentiation method disclosed herein further comprises using the pluripotent stem cells in a spheroid aggregate for said step A. In some embodiments, the spheroid aggregate used has an average Feret diameter of about 300 pm or less. In some embodiments, the spheroid aggregate used has an average Feret diameter of about 200 pm or less. In some embodiments, the spheroid aggregate used has an average Feret diameter of about 100 pm or less. In preferred embodiments, the spheroid aggregate used has an average Feret diameter of about 1 to about 300 pm, about 5 to about 250 pm, about 10 to about 250 pm, about 20 to about 200 pm, about 20 to about 150 pm, about 20 to about 100 pm, or about 25 to about 100 pm. In some embodiments, the spheroid aggregate used has an average Feret diameter of about 1 pm, about 2 pm, about 3 pm, about 4 pm, about 5 pm, about 6 pm, about 7 pm, about 8 pm, about 9 pm, about 10 pm, about 11 pm, about 12 pm, about 13 pm, about 14 pm, about 15 pm, about 16 pm, about 17 pm, about 18 pm, about 19 pm, about 20 pm, about 21 pm, about 22 pm, about 23 pm, about 24 pm, about 25 pm, about 26 pm, about 27 pm, about 28 pm, about 29 pm, about 30 pm, about 31 pm, about 32 pm, about 33 pm, about 34 pm, about 35 pm, about 36 pm, about 37 pm, about 38 pm, about 39 pm, about 40 pm, about 41 pm, about 42 pm, about 43 pm, about 44 pm, about 45 pm, about 46 pm, about 47 pm, about 48 pm, about 49 pm, about 50 pm, about 51 pm, about 52 pm, about 53 pm, about 54 pm, about 55 pm, about 56 pm, about 57 pm, about 58 pm, about 59 pm, about 60 pm, about 61 pm, about 62 pm, about 63 pm, about 64 pm, about 65 pm, about 66 pm, about 67 pm, about 68 pm, about 69 pm, about 70 pm, about 71 pm, about 72 pm, about 73 pm, about 74 pm, about 75 pm, about 76 pm, about 77 pm, about 78 pm, about 79 pm, about 80 pm, about 81 pm, about 82 pm, about 83 pm, about 84 pm, about 85 pm, about 86 pm, about 87 pm, about 88 pm, about 89 pm, about 90 pm, about 91 pm, about 92 pm, about 93 pm, about 94 pm, about 95 pm, about 96 pm, about 97 pm, about 98 pm, about 99 pm, about 100 pm, about 150 pm, about 200 pm, about 250 pm, or about 300 pm.

[0271] In some embodiments, the spheroid aggregates used each comprise an average of about 5 to about 1000 pluripotent stem cells. In preferred embodiments, the spheroid aggregates used each comprise an average of about 10 to about 800 pluripotent stem cells. In more preferred embodiments, the spheroid aggregates used each comprise an average of about 20 to about 600 pluripotent stem cells. In some embodiments, the spheroid aggregates used each comprise an average of about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, or about 1000 pluripotent stem cells.

[0272] In some embodiments, the spheroid aggregates are used as starting material for the in vitro differentiation methods disclosed herein.

[0273] In some embodiments of the in vitro differentiation methods disclosed herein, the differentiated cell population C or the differentiated cell population D, upon transplantation into the brain of a host, forms a graft in which astrocytes are aggregated in a central portion and dopaminergic neurons are distributed throughout the area.

[0274] In some embodiments, the graft comprises at least about 20% of dopaminergic neurons in total cells of the graft. In some embodiments, the graft comprises about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, or about 66% of dopaminergic neurons in total cells of the graft. In some embodiments, the graft comprises about 20% to about 66%, about 20% to about 60%, about 20% to about 55%, about 25% to about 66%, about 25% to about 60%, about 25% to about 55%, about 30% to about 66%, about 30% to about 60%, about 30% to about 55%, about 40% to about 66%, about 40% to about 60%, about 40% to about 55%, about 45% to about 66%, about 45% to about 60%, about 45% to about 55% of dopaminergic neurons in total cells of the graft. In some embodiments, the central portion of the graft comprises about 10% or less, about 15% or less, about 20% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, about 45% or less, about 50% or less, about 55% or less, about 60% or less, or about 65% or less of astrocytes in cells of the central portion of the graft. In some embodiments, the central portion of the graft comprises about 10% to about 65%, about 15% to about 65%, about 20% to about 65%, about 20% to about 60%, about 25% to about 65%, about 25% to about 60%, about 20% to about 55%, about 25% to about 55%, about 30% to about 60%, about 20% to about 40%, about 40% to about 65% or less, about 40% to about 60% of astrocytes in cells of the central portion of the graft.

[0275] In some embodiments, the total cells of the transplant comprise less than about 50% glutamatergic neurons. In some embodiments, the total cells of the transplant comprise less than about 50%, less than about 49%, less than about 48%, less than about 47%, less than about 46%, less than about 45%, less than about 44%, less than about 43%, less than about 42%, less than about 41%, less than about 40%, less than about 39%, less than about 38%, less than about 37%, less than about 36%, less than about 35%, less than about 34%, less than about 33%, less than about 32%, less than about 31%, less than about 30%, less than about 29%, less than about 28%, less than about 27%, less than about 26%, less than about 25%, less than about 24%, less than about 23%, less than about 22%, less than about 21%, less than about 20%, or less than about 10% glutamatergic neurons.

[0276] In some embodiments, the in vitro differentiation methods disclosed herein further comprise a step of digesting the differentiated cell population C or the differentiated cell population D into single cell or oligocell clumps. In some embodiments, the in vitro differentiation methods disclosed herein further comprise a step of re-aggregating the single cell or oligocell clumps obtained from the digestion of the differentiated cell population C or the differentiated cell population D into spheroid cell aggregates. In some embodiments, the digestion is an enzymatic digestion using a digestion enzyme. In preferred embodiments, the digestion is performed using any one selected from GCDR (STEMCELL), ReLeSR (STEMCELL), Accutase (STEMCELL or Gibco), TrypLE Express (Gibco), TrypLE Select (Gibco), or Papain. In some embodiments, the in vitro differentiation methods disclosed herein further comprise a step of enzymatically digesting the differentiated cell population C or the differentiated cell population D, and then pipetting the digested cell population into single cell or oligocell clumps. In some embodiments, the re-aggregation is a suspension culture of the single cell or the oligocell clumps for at least 24 hours, preferably 24 to 72 hours to form spheroid cell aggregates. In some embodiments, the spheroid aggregates used have an average Feret diameter of about 300 pm or less. In some embodiments, the spheroid aggregates used have an average Feret diameter of about 200 pm or less. In some embodiments, the spheroid aggregates formed by the re-aggregation have an average Feret diameter of about 100 pm or less. In preferred embodiments, the spheroid aggregates formed by the re-aggregation have an average Feret diameter of about 1 to about 300 pm, about 5 to about 250 pm, about 10 to about 250 pm, about 20 to about 200 pm, about 20 to about 150 pm, or about 25 to about 100 pm.In some embodiments, the average Feret diameter of the spheroid agglomerates used is about 1 pm, about 2 pm, about 3 pm, about 4 pm, about 5 pm, about 6 pm, about 7 pm, about 8 pm, about 9 pm, about 10 pm, about 11 pm, about 12 pm, about 13 pm, about 14 pm, about 15 pm, about 16 pm, about 17 pm, about 18 pm, about 19 pm, about 20 pm, about 21 pm, about 22 pm, about 23 pm, about 24 pm, about 25 pm, about 26 pm, about 27 pm, about 28 pm, about 29 pm, about 30 pm, about 31 pm, about 32 pm, about 33 pm, about 34 pm, about 35 pm, about 36 pm, about 37 pm, about 38 pm, about 39 pm, about 40 pm, about 41 pm, about 42 pm, about 43 pm, about 44 pm, about 45 pm, about 46 pm, about 47 pm, about 48 pm, about 49 pm, about 50 pm, about 51 pm, about 52 pm, about 53 pm, about 54 pm, about 55 pm, about 56 pm, about 57 pm, about 58 pm, about 59 pm, about 60 pm, about 61 pm, about 62 pm, about 63 pm, about 64 pm, about 65 pm, about 66 pm, about 67 pm, about 68 pm, about 69 pm, about 70 pm, about 71 pm, about 72 pm, about 73 pm, about 74 pm, about 75 pm, about 76 pm, about 77 pm, about 78 pm, about 79 pm, about 80 pm, about 81 pm, about 82 pm, about 83 pm, about 84 pm, about 85 pm, about 86 pm, about 87 pm, about 88 pm, about 89 pm, about 90 pm, about 91 pm, about 92 pm, about 93 pm, about 94 pm, about 95 pm, about 96 pm, about 97 pm, about 98 pm, about 99 pm, or about 100 pm, about 150 pm, about 200 pm, about 250 pm, or about 300 pm.

[0277] In some embodiments, the differentiated cell population A, the differentiated cell population B, the differentiated cell population C, and the differentiated cell population D in the in vitro differentiation methods disclosed herein all express substantially no or very low levels of TH. As used herein, the phrase "express substantially no" means that the level of the protein of interest on the surface of the differentiated cell population is not appreciably different from a cell that theoretically or practically has no expression of the protein of interest. "Very low levels" means that less than about 5%, about 4%, about 3%, about 2%, about 1% of the total cell population expresses the protein of interest. In other words, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% of the cells in a cell population that "express substantially no or very low levels of TH" test negative for TH.

[0278] In some embodiments, the in vitro differentiation method disclosed herein further comprises (E) culturing the differentiated cell population D obtained in step (D) in suspension under conditions that promote differentiation of dopaminergic precursor cells or dopaminergic neurons, to obtain a mature cell population E. In some embodiments, at least about 10% of the cells in the mature cell population E express at least one or more dopaminergic neuronal markers selected from the group consisting of TH, EN1, PITX3, SLC18A2, or TMCC3. In some embodiments, the mature cell population E is free of TPH2-positive serotonergic neurons. In some embodiments, the conditions that promote differentiation of dopaminergic precursor cells or dopaminergic neurons are adherent culturing of the differentiated cell population D or the spheroid cell aggregates in a neuronal maturation medium for at least 10 days, preferably 10-14 days.

[0279] II. Differentiation medium

[0280] 1. BMP signaling inhibitor

[0281] A BMP signaling inhibitor is a class of SMAD inhibitors, which can also be referred to herein simply as "BMP inhibitors". Non-limiting examples of BMP inhibitors include those disclosed in WO2011 / 149762, Chambers et al., Nat Biotechnol. 2009 Mar, 27(3):275-80, Kriks et al.,, Nature. 2011 Nov 6, 480(7378):547-51, and Chambers et al., Nat Biotechnol. 2012 Jul 1, 30(7):715-20, the entire contents of which are incorporated herein by reference. In some embodiments, the BMP inhibitor can be selected from DMH-1, LDN193189, or Noggin, or active derivatives thereof, or any mixture thereof. Derivatives of these small molecule inhibitors can be readily obtained by a person skilled in the art by substituting, replacing, or adding substituents to the core skeleton of the inhibitors.

[0282] “DMH-1” refers to a molecule with CAS number 1206711-16-1-41-9, name 4-[6-[4-(1- methoxy)phenyl]pyrazolo[1,5-a]pyrimidin-3-yl]-quinoline. DMH-1 can selectively inhibit bone morphogenetic protein (BMP) type I receptor activin receptor-like kinase 2 (ALK2) receptors in in vitro kinase assays. It is 6-fold selective for ALK-2 over ALK-1 and 19-fold selective over ALK-3, with no significant inhibition of AMPK, ALK5, KDR (VEGFR-2), or PDGFRbeta receptors. DMH-1 has been reported to block BMP4-induced phosphorylation of Smads 1, 5, 8 in HEK293 cells (Neely et al., ACS Chem. Neurosci., 2012; 3:482).

[0283] “LDN193189” refers to a small molecule with CAS number 1062368-24-4, IUPAC name 4-(6-(4-(piperazin-1-yl)phenyl)pyrazolo[1,5-a]pyrimidin-3-yl)quinoline, chemical formula C25H22N6, also known as DM-3189. LDN193189 can function as an inhibitor of BMP signaling, and is a potent inhibitor of ALK2, ALK3, and ALK6 protein tyrosine kinases. LDN193189 has been reported to inhibit signaling by the above receptors, thereby inhibiting BMP2, BMP4, BMP6, BMP7, and Activin cytokine signaling, and subsequent SMAD phosphorylation of Smad1, Smad5, and Smad8 (Yu et al., (2008) Nat Med 14: 1363-1369; Cuny et al.,. (2008) Bioorg. Med. Chem. Lett. 18:4388-4392).

[0284] In some embodiments of the in vitro differentiation methods disclosed herein, the BMP signaling inhibitor used is DMH-1. In other embodiments, the BMP signaling inhibitor used is LDN193189. In other embodiments, the BMP signaling inhibitor used is Noggin.

[0285] In some embodiments, the concentration of DMH-1 used in the in vitro differentiation methods disclosed herein is about 0.5 to about 10.0 μΜ. In some embodiments, the concentration of DMH-1 used is about 0.5 to about 5.0 μΜ. In some embodiments, the concentration of DMH-1 used is about 0.5 μΜ, about 0.6 μΜ, about 0.7 μΜ, about 0.8 μΜ, about 0.9 μΜ, about 1.0 μΜ, about 2.0 μΜ, about 3.0 μΜ, about 4.0 μΜ, about 5.0 μΜ, about 6.0 μΜ, about 7.0 μΜ, about 8.0 μΜ, about 9.0 μΜ, or about 10.0 μΜ.

[0286] 2. Inhibitors of TGF-β1 signaling

[0287] TGF-β1 signaling inhibitors are another class of SMAD inhibitors, which can also be referred to herein simply as "TGF-β1 inhibitors" or "TGFβ / Activin-Nodal inhibitors." Thus, differentiation steps that use both a BMP inhibitor and a TGF-β1 inhibitor can also be referred to as "dual SMAD inhibition." In some embodiments, the TGF-β1 inhibitor can inactivate receptors including TGFβ, Nodal, and / or Activin, and / or block the signaling pathway by blocking the above-mentioned receptors and their downstream effectors.

[0288] Non-limiting examples of TGF-β1 inhibitors include those disclosed in WO / 2010 / 096496, WO / 2011 / 149762, WO / 2013 / 067362, WO / 2014 / 176606, WO / 2015 / 077648, Chambers et al., Nat Biotechnol. 2009 Mar, 27(3):275-80, Kriks et al.,, Nature. 2011 Nov 6, 480(7378):547-51, and Chambers et al., Nat Biotechnol. 2012 Jul 1, 30(7):715-20, the entire contents of which are incorporated herein by reference. In some embodiments, the at least one TGF-β1 signaling inhibitor is selected from the group consisting of an ALK5 inhibitor, an ALK4 inhibitor, an ALK7 inhibitor, and combinations thereof. In some embodiments, the TGF-β1 inhibitor comprises an ALK5 inhibitor. In some embodiments, the TGF-β1 inhibitor is selected from the group consisting of at least one of SB431542 or its derivative A83-01, SB505124, SB525334, LY2157299, GW788388, LY364947, SD-208, EW-7197, A77-01, RepSox, BIBF-0775, TP0427736, TGFBR1-in-1, SM-16, TEW-7197, LY3200882, LY2109761, KRCA 0008, GSK 1838705, Crizotinib, Ceritinib, ASP 3026, TAE684, AZD3463, or any combination thereof. In preferred embodiments of the in vitro differentiation methods disclosed herein, the TGF-β1 inhibitor used is SB431542. In other embodiments, the TGF-β1 inhibitor used is derivative A83-01.

[0289] “SB431542” refers to a small molecule compound with the number CAS 301836-41-9, the name 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl]-benzamide, and the molecular formula C22H18N4O3.

[0290] In some embodiments, the concentration of SB431542 used in the in vitro differentiation methods disclosed herein is about 1.0 to about 10.0 μΜ. In some embodiments, the concentration of SB431542 used is about 2.0 to about 10.0 μΜ. In some embodiments, the concentration of SB431542 used is about 1.0 μΜ, about 2.0 μΜ, about 3.0 μΜ, about 4.0 μΜ, about 5.0 μΜ, about 6.0 μΜ, about 7.0 μΜ, about 8.0 μΜ, about 9.0 μΜ, or about 10.0 μΜ.

[0291] As used herein, the concentration of the inhibitor or activator used refers to the concentration of the inhibitor or activator that is in contact with or exposed to the cells. In some embodiments, an appropriate amount of the inhibitor or activator is added to the culture medium containing the cells every day or every other day that the cells are in contact with or exposed to the inhibitor or activator to maintain the concentration specified herein. In some embodiments, the stem cells are in contact with or exposed to both a BMP inhibitor and a TGFβ1 inhibitor simultaneously. In some embodiments, the stem cells are in contact with or exposed to a BMP inhibitor and a TGFβ1 inhibitor sequentially at time intervals close enough to each other. In some embodiments, the stem cells are in contact with or exposed to both a BMP inhibitor and a TGFβ1 inhibitor simultaneously for a total of at least 5 days, at least 6 days, at least 7 days, and at least 8 days. In some embodiments, the stem cells are in contact with or exposed to both a BMP inhibitor and a TGFβ1 inhibitor simultaneously for a total of up to 5 days, up to 6 days, up to 7 days, and up to 8 days.

[0292] 3. Wnt signaling activators

[0293] It has been reported that Wnt signaling activators can activate Wnt signaling by reducing the activity of glycogen synthase kinase 3 beta enzyme (GSK3β). Thus, in some embodiments, the "Wnt signaling activators" can be used interchangeably with "GSK3β inhibitors", hereinafter also referred to simply as Wnt activators (see, e.g., Cadigan et al., J Cell Sci 2006, 119:395-402; Kikuchi et al., Cell Signaling. 2007, 19:659-671; Doble et al., J Cell Sci. 2003, 116: 1175-1186).

[0294] Non-limiting examples of Wnt activators include CHIR99021, WNT1, WNT5A, WNT3A, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, or SB-216763, as well as those described in WO2011 / 149762, W013 / 067362, Chambers et al., Nat Biotechnol. 2012 Jul 1, 30(7):715-20, Kriks et al., Nature. 2011 Nov 6, 480(7378):547-51, and Calder et al., J Neurosci. 2015 Aug 19, 35(33):11462-81, the entire contents of each of which are incorporated herein by reference.

[0295] In some embodiments of the in vitro differentiation methods disclosed herein, the Wnt signaling activator used comprises CHIR99021 or a derivative thereof. In some embodiments, the at least one Wnt activator used is CHIR99021. “CHIR99021” refers to the small molecule inhibitor of the IUPAC name 6-(2-(4-(2,4-dichlorophenyl)-5-(4-methyl-lH-imidazol-2-yl)pyrimidin-2-ylamino)ethylamino)nicotinonitrile, also known as “aminopyrimidine” or “3-[3-(2-carboxyethyl)-4-methylpyrrol-2- ylmethylidenyl]-2-indolinone.” CHIR99021 is highly selective, exhibiting nearly thousand-fold selectivity over a panel of related and unrelated kinases, with an IC50 of 6.7 nM for human GSK3beta and nanomolar IC50 for rodent GSK3beta homologs.

[0296] In some embodiments, the concentration of the Wnt activator used in the in vitro differentiation methods disclosed herein remains substantially constant during use (i.e., during contact or exposure to the cells). In some embodiments, the concentration of the Wnt activator used in the in vitro differentiation methods disclosed herein is increased during use (this use is referred to as a“Wnt boost” in CN115768875A, which is incorporated herein by reference in its entirety). Using CHIR99021 as an example, in some embodiments, the initial concentration of CHIR99021 used in the in vitro differentiation methods disclosed herein is about 0.2 to about 1.0 mM. In preferred embodiments, the initial concentration of CHIR99021 used in the in vitro differentiation methods disclosed herein is about 0.2 to about 0.8 mM. In some embodiments, the in vitro differentiation methods disclosed herein contact or expose the stem cells to the initial concentration of CHIR99021 for at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, or at least about 15 days. In some embodiments, the in vitro differentiation methods disclosed herein contact or expose the stem cells to the initial concentration of CHIR99021 for up to about 4 days, up to about 5 days, up to about 6 days, up to about 7 days, up to about 8 days, up to about 9 days, up to about 10 days, up to about 11 days, up to about 12 days, up to about 13 days, up to about 14 days, or up to about 15 days.

[0297] In some embodiments, the in vitro differentiation methods disclosed herein increase the concentration of CHIR99021 after about 4 days of culturing the stem cells at the initial concentration of CHIR99021 (i.e., starting on day 5). In some embodiments of the in vitro differentiation methods disclosed herein, the cells are cultured at the increased concentration of CHIR99021 for at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, or at least about 11 days.

[0298] In some embodiments, the stem cells are contacted or exposed to a Wnt inhibitor at the same time as the dual SMAD inhibition (BMP inhibitor and TGFpi inhibitor). In some embodiments, the stem cells are contacted or exposed to the dual SMAD inhibition and the Wnt inhibitor sequentially, in close enough temporal proximity. In the in vitro differentiation methods disclosed herein, the stem cells are contacted or exposed to the Wnt inhibitor for a total time that is longer than the total time of contact or exposure to the dual SMAD inhibition. Thus, in some embodiments, the stem cells are contacted or exposed to the dual SMAD inhibition and the Wnt inhibitor simultaneously for a total time of up to 5 days, up to 6 days, up to 7 days, and up to 8 days.

[0299] 4. Sonic hedgehog (SHH) signaling activators

[0300] As used herein, the term "Sonic hedgehog" or "SHH" refers to a protein of one of at least three proteins in the mammalian signaling pathway family known as hedgehog factors, the other being desert hedgehog (DHH) and the third being Indian hedgehog (IHH). SHH interacts with at least two transmembrane proteins through interaction with the transmembrane molecule Patched (PTC) and Smoothened (SMO). SHH normally binds to PTC, which allows SMO to function as a signal sensor to activate. In the absence of SHH, PTC normally inhibits SMO, which in turn activates transcriptional repressors, so certain genes are not transcribed. When SHH is present and binds to PTC, PTC cannot interfere with the function of SMO. With SMO uninhibited, certain proteins are able to enter the nucleus and act as transcription factors, thereby activating certain genes (see Gilbert, 2000 Developmental Biology (Sunderland, Mass., Sinauer Associates, Inc., Publishers). In some embodiments, the SHH activator refers to any molecule or compound that is capable of activating the SHH signaling pathway, including molecules or compounds that are capable of binding to PTC or SMO. In some embodiments, the SHH activator is selected from the group consisting of a molecule that binds PCT, a molecule that binds SMO, and combinations thereof. Non-limiting examples of SHH activators include those described in WO 10 / 096496, WO 13 / 067362, Chambers et al., Nat Biotechnol. 2009 Mar, 27(3):275-80, and Kriks et al., Nature. 2011 Nov 6, 480(7378):547-51. In some embodiments, the SHH activator comprises SAG (N-methyl-N'-(3-pyridinylphenyl)-N'-(3-chlorobenzo[b]thiophene-2-carbonyl)-1,4-diaminocyclohexane), SHH protein, SMO agonist, or combinations thereof. In some embodiments, the SHH protein comprises recombinant SHH, purified SHH, Purmorphamine, or combinations thereof. In some embodiments, the recombinant SHH comprises a recombinant protein that is at least about 80%, about 85%, about 90%, about 95%, or about 99% identical to a mouse SHH N-terminal fragment. In preferred embodiments, the SHH activator is SAG. As used herein, the term "SAG" refers to the compound molecule with CAS numbers 912545-86-9 and 364590-63-6 (hydrochloride salt), name 3-chloro-N-[(1r,4r)-4-(methylamino)cyclohexyl]-N-[3-(pyridin-4-yl)benzyl]benzo[b]thiophene-2-carboxamide.

[0301] In some embodiments of the in vitro differentiation methods disclosed herein, the cells are contacted or exposed to at least one SHH signaling activator (also referred to simply as an SHH activator) for at least about 15 days. In some embodiments, the cells are contacted or exposed to at least one SHH activator for at least about 20 days. In some embodiments, the cells are contacted or exposed to at least one SHH activator for up to about 32 days. In some embodiments, the cells are contacted or exposed to at least one SHH activator for up to about 24 days. In some embodiments, the cells are contacted or exposed to at least one SHH activator for between about 15 days and about 32 days, between about 15 days and about 20 days, between about 24 and about 32 days. In some embodiments, the cells are contacted or exposed to at least one SHH activator for about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, about 21 days, about 22 days, about 23 days, about 24 days, about 25 days, about 26 days, about 27 days, about 28 days, about 29 days, about 30 days, about 31 days, or about 32 days.

[0302] In some embodiments, the concentration of the SHH activator used in the in vitro differentiation methods disclosed herein is reduced during the period of use (during which it is contacted or exposed to the cells). In some embodiments of the in vitro differentiation methods disclosed herein, the cells are contacted with the SHH agonist at a reduced concentration for at least about 5 days, at least about 6 days, at least about 7 days, or at least about 8 days. In some embodiments, the cells are contacted with the SHH agonist at a reduced concentration for between about 5 and about 8 days. In some embodiments, the cells are contacted with the SHH agonist at a reduced concentration for about 5 days, about 6 days, about 7 days, or about 8 days.

[0303] In some embodiments, the initial concentration of the at least one SHH activator to which the cells are contacted or exposed is between about 0.1 and about 2.0 μΜ, between about 0.1 and about 1.5 μΜ, between about 0.2 and about 2.0 μΜ, between about 0.2 and about 1.0 μΜ, between about 0.2 and about 0.8 μΜ, between about 0.1 and about 1.0 μΜ, between about 0.2 and about 0.6 μΜ, between about 0.4 and about 0.8 μΜ, between about 0.5 and about 2.0 μΜ, or between about 0.5 and about 1.0 μΜ. In some embodiments, the initial concentration of the at least one SHH activator is about 0.1 μΜ, about 0.2 μΜ, about 0.3 μΜ, about 0.4 μΜ, about 0.5 μΜ, about 0.6 μΜ, about 0.7 μΜ, about 0.8 μΜ, about 0.9 μΜ, about 1.0 μΜ, about 1.1 μΜ, about 1.2 μΜ, about 1.3 μΜ, about 1.4 μΜ, about 1.5 μΜ, about 1.6 μΜ, about 1.7 μΜ, about 1.8 μΜ, about 1.9 μΜ, or about 2.0 μΜ.

[0304] In some embodiments, the concentration of the at least one SHH signaling activator is reduced to about 0.1 to about 1.0 μΜ, about 0.1 to about 0.5 μΜ, about 0.2 to about 0.5 μΜ, about 0.1 to about 0.3 μΜ, or about 0.1 to about 0.2 μΜ. In some embodiments, the concentration of the at least one SHH signaling activator is reduced to about 0.1 μΜ, about 0.2 μΜ, about 0.3 μΜ, about 0.4 μΜ, about 0.5 μΜ, about 0.6 μΜ, about 0.7 μΜ, about 0.8 μΜ, about 0.9 μΜ, or about 1.0 μΜ in step (D) of the in vitro differentiation methods disclosed herein. In some embodiments, the concentration of the at least one SHH signaling activator is reduced to at most about 90%, at most about 80%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, at most about 20%, at most about 10% of the initial concentration.

[0305] 5. FGF signaling activator

[0306] The FGF family includes secreted signaling proteins (secreted FGFs) that signal to receptor tyrosine kinases. Phylogenetic analysis indicates that the 22 Fgf genes can be divided into seven subfamilies, each containing two to four members. Branch lengths are proportional to evolutionary distance between each gene.

[0307] In some embodiments, the FGF activator is selected from the group consisting of FGF8, FGF8a, FGF17, FGF18, FGF8b, FGF2, FGF4, and derivatives thereof. In some embodiments, the FGF activator is selected from the group consisting of FGF8b.

[0308] The FGF8 subfamily consists of FGF8a, FGF8b, FGF17, and FGF18. Early patterning of the midbrain and cerebellum in vertebrates is regulated by mid- / hindbrain tissue organizers that produce FGF8a, FGF8b, FGF17, and FGF18. Among these, FGF8b is the only protein that can induce the rl gene Gbx2 and strongly activate the pathway inhibitor Spry 1 / 2, as well as repress the midbrain gene Otx2 (Liu 2003). In addition, FGF8b extends the organizer along the junction between the induced Gbx2 domain and the remaining Otx2 region in the midbrain, which is associated with cerebellum development (Liu 2003). FGF8a, FGF17, and FGF18 cause midbrain expansion and upregulate midbrain gene expression (Liu 2003).

[0309] In some embodiments, the initial concentration of the at least one FGF signaling activator used is about 10 to about 500 ng / ml, about 10 to about 400 ng / ml, about 10 to about 200 ng / ml, about 20 to about 500 ng / ml, about 20 to about 400 ng / ml, about 20 to about 200 ng / ml, about 50 to about 500 ng / ml, about 50 to about 200 ng / ml, about 100 to about 500 ng / ml, about 100 to about 400 ng / ml, or about 50 to about 300 ng / ml. In some embodiments, the initial concentration of the FGF signaling activator used is about 10 ng / ml, about 20 ng / ml, about 30 ng / ml, about 40 ng / ml, about 50 ng / ml, about 60 ng / ml, about 70 ng / ml, about 80 ng / ml, about 90 ng / ml, about 100 ng / ml, about 110 ng / ml, about 120 ng / ml, about 130 ng / ml, about 140 ng / ml, about 150 ng / ml, about 160 ng / ml, about 170 ng / ml, about 180 ng / ml, about 190 ng / ml, about 200 ng / ml, about 250 ng / ml, about 300 ng / ml, about 350 ng / ml, about 400 ng / ml, about 450 ng / ml, or about 500 ng / ml.

[0310] In some embodiments, the concentration of the at least one FGF signaling activator used in the in vitro differentiation methods disclosed herein is reduced during use, which is during contact or exposure to the cells. In some embodiments of the in vitro differentiation methods disclosed herein, the cells are contacted with the reduced concentration of the at least one FGF agonist for at least about 5 days, at least about 6 days, at least about 7 days, or at least about 8 days. In some embodiments, the cells are contacted with the reduced concentration of the at least one FGF agonist for about 5 to about 8 days. In some embodiments, the cells are contacted with the reduced concentration of the at least one FGF agonist for about 5 days, about 6 days, about 7 days, or about 8 days.

[0311] In some non-limiting embodiments, the in vitro method disclosed herein comprises: (A) culturing pluripotent stem cells in suspension in the presence of a combination of about 0.5 to about 10.0 μΜ DMH-1, about 1.0 to about 10.0 μΜ SB431542, about 0.2 to about 1.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG for at least 5 days to obtain a differentiated cell population A, wherein the concentration of CHIR99021 is substantially maintained; (B) culturing the differentiated cell population A in suspension first in the presence of a combination of about 0.2 to about 15.0 μΜ CHIR99021 and about 0.1 to about 2.0 μΜ SAG, and then in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b to obtain a differentiated cell population B; and (C) culturing the differentiated cell population B in suspension in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b for at least 5 days to obtain a differentiated cell population C. In some embodiments, the concentration of SAG and FGF8b in step (C) of the method is substantially maintained from step (B).

[0312] In some non-limiting embodiments, the in vitro method disclosed herein comprises: (A) culturing pluripotent stem cells in suspension in the presence of a combination of about 0.5 to about 10.0 μΜ DMH-1, about 1.0 to about 10.0 μΜ SB431542, about 0.2 to about 1.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG for at least 5 days to obtain a differentiated cell population A, wherein the concentration of CHIR99021 is substantially maintained; (B) culturing the differentiated cell population A in suspension first in the presence of a combination of about 0.2 to about 15.0 μΜ CHIR99021 and about 0.1 to about 2.0 μΜ SAG, and then in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b to obtain a differentiated cell population B; (C) culturing the differentiated cell population B in suspension in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b for at least 5 days to obtain a differentiated cell population C; and (D) culturing the differentiated cell population C in suspension in the presence of a combination of about 0.1 to about 1.0 μΜ SAG and about 10 to about 200 ng / ml FGF8b for at least 5 days to obtain a differentiated cell population D. In some embodiments, the concentration of SAG and FGF8b in step (D) of the method is lower than their concentration at the end of step (C), respectively.

[0313] In some non-limiting embodiments, the in vitro method disclosed herein comprises: (A) culturing pluripotent stem cells in suspension in the presence of a combination of about 0.5 to about 10.0 μΜ DMH-1, about 1.0 to about 10.0 μΜ SB431542, about 0.2 to about 1.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG for at least 5 days to obtain a differentiated cell population A, wherein the concentration of CHIR99021 is increased after day 4 of step A; (B) culturing the differentiated cell population A in suspension first in the presence of a combination of about 0.2 to about 15.0 μΜ CHIR99021 and about 0.1 to about 2.0 μΜ SAG, and then in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b to obtain a differentiated cell population B; and (C) culturing the differentiated cell population B in suspension in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b for at least 5 days to obtain a differentiated cell population C. In some embodiments, the concentration of SAG and FGF8b in step (C) of the method remains substantially unchanged from that in step (B).

[0314] In some non-limiting embodiments, the in vitro method disclosed herein comprises: (A) culturing pluripotent stem cells in suspension in the presence of a combination of about 0.5 to about 10.0 μΜ DMH-1, about 1.0 to about 10.0 μΜ SB431542, about 0.2 to about 1.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG for at least 5 days to obtain a differentiated cell population A, wherein the concentration of CHIR99021 is increased after day 4 of step A; (B) culturing the differentiated cell population A in suspension first in the presence of a combination of about 0.2 to about 15.0 μΜ CHIR99021 and about 0.1 to about 2.0 μΜ SAG, and then in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b to obtain a differentiated cell population B; (C) culturing the differentiated cell population B in suspension in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b for at least 5 days to obtain a differentiated cell population C; and (D) culturing the differentiated cell population C in suspension in the presence of a combination of about 0.1 to about 1.0 μΜ SAG and about 10 to about 200 ng / ml FGF8b for at least 5 days to obtain a differentiated cell population D. In some embodiments, the concentration of SAG and FGF8b in step (D) of the method is lower than their concentration at the end of step (C), respectively.

[0315] III、Cell populations

[0316] In some embodiments, the present application provides a population of cells prepared by the methods described above in Section III.

[0317] In some embodiments, the present application also provides a population of cells at an intermediate stage of the above methods.

[0318] In some embodiments, the differentiated population of cells disclosed herein comprises a subpopulation Al that expresses at least one marker indicative of floor plate progenitor cells and a subpopulation A2 that expresses at least one marker indicative of neurons and neuroblasts. In some embodiments, the differentiated population of cells disclosed herein comprises a subpopulation Al that expresses at least one marker indicative of floor plate progenitor cells, a subpopulation A2 that expresses at least one marker indicative of neurons and neuroblasts, and a subpopulation A3 that expresses at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the marker indicative of subpopulation Al floor plate progenitor cells is selected from any one or any combination of FOXA2, OTX2, SOX2. In some embodiments, the marker indicative of subpopulation A2 neurons and neuroblasts is selected from any one or any combination of NEUROD1, NEUROD4, NEUROG2. In some embodiments, the marker indicative of subpopulation A3 mid-hindbrain isthmus progenitor cells is selected from any one or any combination of FGF17, FGF8, S100A11, FOXH1, GBX2.

[0319] In some embodiments, the differentiated cell population disclosed herein comprises about 50.0 to about 99.9% of subpopulation Al, about 0.1% to about 10.0% of subpopulation A2, about 0% to about 10.0% of subpopulation A3, based on total number of cells. In some embodiments, subpopulation Al comprises about 50.0 to about 99.9%, about 51.0 to about 99.9%, about 52.0 to about 99.9%, about 53.0 to about 99.9%, about 54.0 to about 99.9%, about 55.0 to about 99.9%, about 56.0 to about 99.9%, about 57.0 to about 99.9%, about 58.0 to about 99.9%, about 59.0 to about 99.9%, about 60.0 to about 99.9%, about 61.0 to about 99.9%, about 62.0 to about 99.9%, about 63.0 to about 99.9%, about 64.0 to about 99.9%, about 65.0 to about 99.9%, about 66.0 to about 99.9%, about 67.0 to about 99.9%, about 68.0 to about 99.9%, about 69.0 to about 99.9%, about 70.0 to about 99.9%, about 71.0 to about 99.9%, about 72.0 to about 99.9%, about 73.0 to about 99.9%, about 74.0 to about 99.9%, about 75.0 to about 99.9%, about 76.0 to about 99.9%, about 77.0 to about 99.9%, about 78.0 to about 99.9%, about 79.0 to about 99.9%, about 80.0 to about 99.9% of the differentiated cell population disclosed herein, based on total number of cells. In some embodiments, subpopulation A2 comprises about 0.1% to about 10.0%, about 0.1% to about 9.0%, about 0.1% to about 8.0%, about 0.1% to about 7.0%, about 0.1% to about 6.0%, about 0.1% to about 5.0%, about 0.1% to about 4.0%, about 0.1% to about 3.0%, about 0.1% to about 2.0%, about 0.1% to about 1.0% of the differentiated cell population disclosed herein, based on total number of cells. In some embodiments, subpopulation A3 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0%, about 0% to about 5.0%, about 0% to about 4.0%, about 0% to about 3.0%, about 0% to about 2.0%, about 0% to about 1.0% of the differentiated cell population disclosed herein, based on total number of cells.

[0320] In some embodiments, the subpopulation A1 can be further divided into a subpopulation A1-1 expressing at least one proliferation marker and a subpopulation A1-2 not expressing the proliferation marker. In some embodiments, the proliferation marker is selected from any one of CENPU, TOP2A, or MKI67, or any combination thereof. In some embodiments, the subpopulation A1-1 comprises about 50.0 to about 80.0%, about 51.0 to about 80.0%, about 52.0 to about 80.0%, about 53.0 to about 80.0%, about 54.0 to about 80.0%, about 55.0 to about 80.0%, about 56.0 to about 80.0%, about 57.0 to about 80.0%, about 58.0 to about 80.0%, about 59.0 to about 80.0%, about 60.0 to about 80.0%, about 61.0 to about 80.0%, about 62.0 to about 80.0%, about 63.0 to about 80.0%, about 64.0 to about 80.0%, about 65.0 to about 80.0%, about 66.0 to about 80.0%, about 67.0 to about 80.0%, about 68.0 to about 80.0%, about 69.0 to about 80.0%, about 70.0 to about 80.0%, about 71.0 to about 80.0%, about 72.0 to about 80.0%, about 73.0 to about 80.0%, about 74.0 to about 80.0%, about 75.0 to about 80.0%, about 76.0 to about 80.0%, about 77.0 to about 80.0%, about 78.0 to about 80.0%, about 79.0 to about 80.0%, about 80.0 to about 80.0% of the total number of cells in the population of differentiated cells disclosed herein.

[0321] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells and a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and any one or any combination of a subpopulation B3 positive for GDF15, a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation B3 positive for GDF15. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation B3 positive for GDF15, and a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation B3 positive for GDF15, and a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells, a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation B3 positive for GDF15, a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.

[0322] In some embodiments, the marker indicative of floor progenitor cells of subpopulation B1 is selected from any one of FOXA2, OTX2, SOX2, CORIN, or any combination thereof. In some embodiments, the marker indicative of neurons and neuroblasts of subpopulation B2 is selected from any one of NEUROD1, NEUROD4, NEUROG2, GAP43, or STMN2, or any combination thereof. In some embodiments, the marker indicative of hindbrain floor progenitor cells of subpopulation B4 is selected from PLSCR5 and / or PDE1A. In some embodiments, the marker indicative of mid-hindbrain isthmus progenitor cells of subpopulation B5 is selected from any one of FGF17, FGF8, or WIF1, or any combination thereof.

[0323] In some embodiments, the differentiated cell population disclosed herein comprises about 50.0 to about 99.9% of subpopulation B1, about 0.1% to about 30.0% of subpopulation B2, about 0% to about 10.0% of subpopulation B3, about 0% to about 10.0% of subpopulation B4, about 0% to about 10.0% of subpopulation B5, based on total number of cells. In some embodiments, subpopulation B1 comprises about 50.0 to about 99.9%, about 51.0 to about 99.9%, about 52.0 to about 99.9%, about 53.0 to about 99.9%, about 54.0 to about 99.9%, about 55.0 to about 99.9%, about 56.0 to about 99.9%, about 57.0 to about 99.9%, about 58.0 to about 99.9%, about 59.0 to about 99.9%, about 60.0 to about 99.9%, about 61.0 to about 99.9%, about 62.0 to about 99.9%, about 63.0 to about 99.9%, about 64.0 to about 99.9%, about 65.0 to about 99.9%, about 66.0 to about 99.9%, about 67.0 to about 99.9%, about 68.0 to about 99.9%, about 69.0 to about 99.9%, about 70.0 to about 99.9%, about 71.0 to about 99.9%, about 72.0 to about 99.9%, about 73.0 to about 99.9%, about 74.0 to about 99.9%, about 75.0 to about 99.9%, about 76.0 to about 99.9%, about 77.0 to about 99.9%, about 78.0 to about 99.9%, about 79.0 to about 99.9%, about 80.0 to about 99.9% of the differentiated cell population disclosed herein, based on total number of cells. In some embodiments, subpopulation B2 comprises about 0.1% to about 30.0%, about 0.1% to about 29.0%, about 0.1% to about 28.0%, about 0.1% to about 27.0%, about 0.1% to about 26.0%, about 0.1% to about 25.0%, about 0.1% to about 24.0%, about 0.1% to about 23.0%, about 0.1% to about 22.0%, about 0.1% to about 21.0%, about 0.1% to about 20.0%, about 0.1% to about 19.0%, about 0.1% to about 18.0%, about 0.1% to about 17.0%, about 0.1% to about 16.0%, about 0.1% to about 15.0%, about 0.1% to about 14.0%, about 0.1% to about 13.0%, about 0.1% to about 12.0%, about 0.1% to about 11.0%, about 0.1% to about 10.0%, about 0.1% to about 9.0%, about 0.1% to about 8.0%, about 0.1% to about 7.0%, about 0.1% to about 6.0%, about 0.1% to about 5.0%, about 0.1% to about 4.0%, about 0.1% to about 3.0%, about 0.1% to about 2.0%, about 0.1% to about 1.0% of the differentiated cell population disclosed herein, based on total number of cells.In some embodiments, the subpopulation B3 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0%, about 0% to about 5.0%, about 0% to about 4.0%, about 0% to about 3.0%, about 0% to about 2.0%, about 0% to about 1.0% of the total number of cells in the population of differentiated cells disclosed herein.

[0324] In some embodiments, the subpopulation B1 can be further divided into a subpopulation B1-1 expressing at least one proliferation marker and a subpopulation B1-2 not expressing the proliferation marker. In some embodiments, the proliferation marker is selected from any one of CENPU, TOP2A, or MKI67, or any combination thereof. In some embodiments, the subpopulation B1-1 comprises about 30.0 to about 90.0%, about 31.0 to about 90.0%, about 32.0 to about 90.0%, about 33.0 to about 90.0%, about 34.0 to about 90.0%, about 35.0 to about 90.0%, about 36.0 to about 90.0%, about 37.0 to about 90.0%, about 38.0 to about 90.0%, about 39.0 to about 90.0%, about 40.0 to about 90.0%, about 41.0 to about 90.0%, about 42.0 to about 90.0%, about 43.0 to about 90.0%, about 44.0 to about 90.0%, about 45.0 to about 90.0%, about 46.0 to about 90.0%, or about 47.0 to about 90.0% of the total number of cells in the population of differentiated cells disclosed herein.

[0325] In some embodiments, the differentiated cell population disclosed herein comprises subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells and subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and any one or any combination of subpopulation C3 positive for GDF15, subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, subpopulation C5 positive for CD36, subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and subpopulation C3 positive for GDF15. In some embodiments, the differentiated cell population disclosed herein comprises subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and subpopulation C5 positive for CD36. In some embodiments, the differentiated cell population disclosed herein comprises subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.

[0326] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, and a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, and a subpopulation C5 positive for CD36. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C5 positive for CD36. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C5 positive for CD36, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C5 positive for CD36, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid- hindbrain isthmus progenitor cells.

[0327] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C5 positive for CD36. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmic progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C5 positive for CD36, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C5 positive for CD36, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmic progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmic progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells.In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C5 positive for CD36, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.

[0328] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C5 positive for CD36, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, and a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0329] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation C3 positive for GDF15, a subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation C5 positive for CD36, a subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, and a subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells.

[0330] In some embodiments, the marker indicative of midbrain floor plate progenitor cells of subpopulation C1 is selected from any one of or any combination of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, WNT5A, ARX, ALCAM, CMTM8, RGS2, TFF3, SERPINF1, CMTM7. In some embodiments, the marker indicative of neurons and neuroblasts of subpopulation C2 is selected from any one of or any combination of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2. In some embodiments, the marker indicative of diencephalic floor plate progenitor cells of subpopulation C4 is selected from any one of or any combination of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609. In some embodiments, the marker indicative of hindbrain floor plate progenitor cells of subpopulation C6 is selected from any one of or any combination of HOXB3, HOXB6, HOXB8, or HOXB9. In some embodiments, the marker indicative of mid-hindbrain isthmus progenitor cells of subpopulation C7 is selected from any one of or any combination of FGF17, FGF8, WIF1, KRT7.

[0331] In some embodiments, the differentiated cell population disclosed herein comprises about 40.0 to about 99.0% of subpopulation C1, about 0.1% to about 10.0% of subpopulation C2, about 0% to about 20.0% of subpopulation C3, about 0% to about 20.0% of subpopulation C4, about 0% to about 10.0% of subpopulation C5, about 0% to about 10.0% of subpopulation C6, and about 0% to about 10.0% of subpopulation C7, based on the total number of cells. In some embodiments, subpopulation C1 comprises about 40.0 to about 99.9%, about 41.0 to about 99.9%, about 42.0 to about 99.9%, about 43.0 to about 99.9%, about 44.0 to about 99.9%, about 45.0 to about 99.9%, about 46.0 to about 99.9%, about 47.0 to about 99.9%, about 48.0 to about 99.9%, about 49.0 to about 99.9%, about 50.0 to about 99.9%, about 51.0 to about 99.9%, about 52.0 to about 99.9%, about 53.0 to about 99.9%, about 54.0 to about 99.9%, about 55.0 to about 99.9%, about 56.0 to about 99.9%, about 57.0 to about 99.9%, about 58.0 to about 99.9%, about 59.0 to about 99.9%, about 60.0 to about 99.9%, about 61.0 to about 99.9%, about 62.0 to about 99.9%, about 63.0 to about 99.9%, about 64.0 to about 99.9%, or about 65.0 to about 99.9% of the differentiated cell population disclosed herein, based on the total number of cells. In some embodiments, subpopulation C2 comprises about 0.1% to about 10.0%, about 0.1% to about 9.0%, about 0.1% to about 8.0%, or about 0.1% to about 7.0% of the differentiated cell population disclosed herein, based on the total number of cells. In some embodiments, subpopulation C3 comprises about 0% to about 20.0%, about 0% to about 19.0%, about 0% to about 18.0%, about 0% to about 17.0%, about 0% to about 16.0%, about 0% to about 15.0%, about 0% to about 14.0%, about 0% to about 13.0%, about 0% to about 12.0%, about 0% to about 11.0%, or about 0% to about 10.0% of the differentiated cell population disclosed herein, based on the total number of cells. In some embodiments, subpopulation C4 comprises about 0% to about 20.0%, about 0% to about 19.0%, about 0% to about 18.0%, about 0% to about 17.0%, about 0% to about 16.0%, about 0% to about 15.0%, about 0% to about 14.0%, about 0% to about 13.0%, about 0% to about 12.0%, about 0% to about 11.0%, or about 0% to about 10.0% of the differentiated cell population disclosed herein, based on the total number of cells.In some embodiments, the subpopulation C4 comprises about 0% to about 20.0%, about 0% to about 19.0%, about 0% to about 18.0%, about 0% to about 17.0%, or about 0% to about 16.0% of the total number of cells in a population of differentiated cells disclosed herein. In some embodiments, the subpopulation C5 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0%, about 0% to about 5.0%, or about 0% to about 4.0% of the total number of cells in a population of differentiated cells disclosed herein. In some embodiments, the subpopulation C6 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0%, about 0% to about 5.0%, about 0% to about 4.0%, about 0% to about 3.0%, about 0% to about 2.0%, or about 0% to about 1.0% of the total number of cells in a population of differentiated cells disclosed herein. In some embodiments, the subpopulation C7 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0%, about 0% to about 5.0%, about 0% to about 4.0%, about 0% to about 3.0%, or about 0% to about 2.0% of the total number of cells in a population of differentiated cells disclosed herein. In some embodiments, a population of differentiated cells disclosed herein comprises subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells and subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and any one of or any combination of subpopulation D3 positive for GDF15, subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, subpopulation D5 positive for CD36, subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, or subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0332] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D3 positive for GDF15. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D5 positive for CD36. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0333] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, and a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, and a subpopulation D5 positive for CD36. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D5 positive for CD36. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D5 positive for CD36, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D5 positive for CD36, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0334] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D5 positive for CD36. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D5 positive for CD36, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D5 positive for CD36, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells.In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0335] In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells. In some embodiments, the differentiated cell population disclosed herein comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, and a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells.

[0336] In some embodiments, the in vitro differentiation method disclosed herein, the differentiated cell population D comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells, a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, and a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells.

[0337] In some embodiments, the marker indicative of midbrain floor plate progenitor cells of Subpopulation D1 is selected from any one of or any combination of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, or WNT5A. In some embodiments, the marker indicative of neurons and neuroblasts of Subpopulation D2 is selected from any one of or any combination of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2. In some embodiments, the marker indicative of diencephalic floor plate progenitor cells of Subpopulation D4 is selected from any one of or any combination of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609. In some embodiments, the marker indicative of floor plate lateral progenitor cells of Subpopulation D6 is selected from any one of or any combination of SHISA3, NTRK2, PLP1, SOX3, or LIX1. In some embodiments, the marker indicative of hindbrain floor plate progenitor cells of Subpopulation D7 is selected from any one of or any combination of HOXB3, HOXB6, HOXB8, or HOXB9.

[0338] In some embodiments, the differentiated cell population disclosed herein comprises about 40.0 to about 99.0% of subpopulation D1, about 0.1% to about 40.0% of subpopulation D2, about 0% to about 30.0% of subpopulation D3, about 0% to about 10.0% of subpopulation D4, about 0% to about 10.0% of subpopulation D5, about 0% to about 10.0% of subpopulation D6, about 0% to about 10.0% of subpopulation D7, based on total number of cells. In some embodiments, subpopulation D1 comprises about 40.0 to about 99.9%, about 41.0 to about 99.9%, about 42.0 to about 99.9%, about 43.0 to about 99.9%, about 44.0 to about 99.9%, about 45.0 to about 99.9%, about 46.0 to about 99.9%, about 47.0 to about 99.9%, about 48.0 to about 99.9%, about 49.0 to about 99.9%, about 50.0 to about 99.9%, about 51.0 to about 99.9%, or about 52.0 to about 99.9%, about 53.0 to about 99.9%, about 54.0 to about 99.9%, about 55.0 to about 99.9%, about 56.0 to about 99.9%, about 57.0 to about 99.9%, about 58.0 to about 99.9%, about 59.0 to about 99.9%, of the differentiated cell population disclosed herein, based on total number of cells. In some embodiments, subpopulation D2 comprises about 0.1% to about 40.0%, about 0.1% to about 39.0%, about 0.1% to about 38.0%, about 0.1% to about 37.0%, about 0.1% to about 36.0%, about 0.1% to about 35.0%, about 0.1% to about 34.0%, about 0.1% to about 33.0%, about 0.1% to about 32.0%, about 0.1% to about 31.0%, about 0.1% to about 30.0%, about 0.1% to about 29.0%, about 0.1% to about 28.0%, about 0.1% to about 27.0%, about 0.1% to about 26.0%, about 0.1% to about 25.0%, about 0.1% to about 24.0%, about 0.1% to about 23.0%, about 0.1% to about 22.0%, about 0.1% to about 21.0%, about 0.1% to about 20.0%, about 0.1% to about 19.0%, about 0.1% to about 18.0%, about 0.1% to about 17.0%, about 0.1% to about 16.0%, about 0.1% to about 15.0%, or about 0.1% to about 14.0% of the differentiated cell population disclosed herein, based on total number of cells.In some embodiments, subpopulation D3 comprises about 0% to about 30.0%, about 0% to about 29.0%, about 0% to about 28.0%, about 0% to about 27.0%, about 0% to about 26.0%, about 0% to about 25.0%, about 0% to about 24.0%, about 0% to about 23.0%, about 0% to about 22.0%, about 0% to about 21.0%, about 0% to about 20.0%, about 0% to about 19.0%, about 0% to about 18.0%, about 0% to about 17.0%, about 0% to about 16.0%, about 0% to about 15.0%, about 0% to about 14.0%, about 0% to about 13.0%, about 0% to about 12.0%, about 0% to about 11.0%, or about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0%, about 0% to about 5.0%, or about 0% to about 4.0% of the total number of cells in a population of differentiated cells disclosed herein. In some embodiments, subpopulation D4 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0% of the total number of cells in a population of differentiated cells disclosed herein. In some embodiments, subpopulation D5 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, or about 0% to about 6.0% of the total number of cells in a population of differentiated cells disclosed herein. In some embodiments, subpopulation D6 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0%, about 0% to about 5.0%, about 0% to about 4.0%, about 0% to about 3.0%, or about 0% to about 2.0% of the total number of cells in a population of differentiated cells disclosed herein. In some embodiments, subpopulation D7 comprises about 0% to about 10.0%, about 0% to about 9.0%, about 0% to about 8.0%, about 0% to about 7.0%, about 0% to about 6.0%, about 0% to about 5.0%, about 0% to about 4.0%, about 0% to about 3.0%, about 0% to about 2.0%, or about 0% to about 1.0% of the total number of cells in a population of differentiated cells disclosed herein.

[0339] In some embodiments of the in vitro differentiation methods disclosed herein, both cell populations C and D are in the form of neurospheres having a core comprising GDF15-positive cells. In some embodiments, the GDF15-positive cells comprise up to about 10% of the total number of cells in the neurospheres. In some embodiments, the GDF15-positive cells comprise up to about 0.1%, up to about 0.2%, up to about 0.3%, up to about 0.4%, up to about 0.5%, up to about 0.6%, up to about 0.7%, up to about 0.8%, up to about 0.9%, up to about 1.0%, up to about 2.0%, up to about 3.0%, up to about 4.0%, up to about 5.0%, up to about 6.0%, up to about 7.0%, up to about 8.0%, up to about 9.0%, or up to about 10.0% of the total number of cells in the neurospheres.

[0340] In some embodiments, each subpopulation and / or the ratio of each subpopulation to the total number of cells in the cell populations disclosed herein is determined by a single-cell transcriptome sequencing method. In the present application, each subpopulation and / or the ratio of each subpopulation to the total number of cells is determined by a single-cell sequencing method. As used herein, the term “single-cell transcriptome sequencing”, which can also be referred to as “single-cell transcriptomics”, is a high-throughput technology for quantifying gene expression profiles of a specific cell population at the single-cell level. Single-cell transcriptome sequencing generally includes steps of single-cell isolation, nucleic acid library construction, and high-throughput sequencing analysis, which can be performed according to the methods reported in the literature (see Tang, F. et al., (2009). mRNA-Seq whole-transcriptome analysis of a single cell. In Nature Methods (Vol. 6, Issue 5, pp. 377-382), or obtained by, for example, purchasing CRO services. Compared with traditional bulk transcriptomics, single-cell transcriptome sequencing can identify the heterogeneity of gene expression of each cell in a biological sample, and is particularly suitable for analyzing, identifying, and characterizing complex heterogeneous systems, such as early developmental tissues or brain tissues. Known tools capable of performing single-cell transcriptome determination include the 10x Genomics Chromium system, the Fluidigm C1 system, and the BD Rhapsody system.

[0341] In some embodiments, each of the cell populations disclosed herein does not substantially express or expresses very low levels of TH.

[0342] IV. Pharmaceutical Compositions and Kits

[0343] The present application also provides a composition (e.g., a pharmaceutical composition) or a kit comprising the cell populations disclosed herein.

[0344] In some embodiments, in addition to the cell population disclosed herein, the pharmaceutical composition disclosed herein further comprises various pharmaceutically acceptable excipients. By way of non-limiting example, the excipients include injection fluid carriers. In some embodiments, the injection fluid carrier is selected from any one of DMEM / F-12 medium, NeuraoBasal medium, artificial cerebrospinal fluid (ACSF), normal saline, phosphate buffered saline (PBS or DPBS), Hank’s balanced salt solution (HBSS), lactated Ringer’s injection, or sodium acetate Ringer’s injection. In some embodiments, the injection fluid carrier is of pharmaceutical grade or GMP production grade. In some embodiments, the excipients further comprise a supplemental agent selected from any one of human serum albumin (HSA), B-27 supplement, glial-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), a ROCK inhibitor, a nuclease, or L-ascorbic acid, or any combination thereof. In some embodiments, the excipients include a cytokine for promoting maturation of the implanted / transplanted cells into midbrain DA cells. In some embodiments, the ROCK inhibitor is selected from any one of Y27632, H-1152, fasudil, ripasudil, netarsudil, or bexarotene, or any combination thereof. In some embodiments, the nuclease is selected from any one of Pulmozyme, DNase I, or Benzonuclease, or any combination thereof. In some embodiments, the excipients further comprise a biocompatible scaffold or matrix, for example, a biocompatible three-dimensional scaffold that promotes tissue regeneration when the cells are implanted or transplanted into a subject. In some embodiments, the biocompatible scaffold comprises an extracellular matrix material, a synthetic polymer, a cytokine, a collagen, a polypeptide or protein, a polysaccharide, including fibronectin, laminin, keratin, fibrin, fibrinogen, hyaluronic acid, heparin sulfate, chondroitin sulfate, agarose, or gelatin, and / or a hydrogel (see, e.g., U.S. Publication Nos. 2015 / 0159135, 2011 / 0296542, 2009 / 0123433, and 2008 / 0268019, each incorporated by reference herein in its entirety).

[0345] In some embodiments, the pharmaceutical composition comprises about 1 x 105 4 to about 1 x 105 10 cells of the cell population disclosed herein. In some embodiments, the pharmaceutical composition comprises about 1 x 105 4 to about 1 x 105 5 , about 1 x 105 5 to about 1 x 105 9 , about 1 x 105 5 to about 1 x 105 6 , about 1 x 105 5about 1 x 10 7 about 1 x 10 6 about 1 x 10 7 about 1 x 10 6 about 1 x 10 8 about 1 x 10 7 about 1 x 10 8 about 1 x 10 8 about 1 x 10 9 about 1 x 10 8 about 1 x 10 10 about 1 x 10 9 about 1 x 10 10 cells in a population of cells disclosed herein.

[0346] In some embodiments, the composition needs to be maintained in a frozen state. In some embodiments, the composition further comprises at least one cryoprotectant, such as, but not limited to, dimethyl sulfoxide (DMSO), glycerol, polyethylene glycol, sucrose, trehalose, dextrose, or a combination thereof.

[0347] In some aspects, the present disclosure also provides a device comprising differentiated cells. Non-limiting examples of devices include a syringe, a glass capillary tube, a stereotactic needle, and a cannula.

[0348] In some embodiments, the kits disclosed herein comprise (a) at least one inhibitor of BMP signaling, (b) at least one inhibitor of TGF-β1 signaling, (c) at least one activator of Wnt signaling, (d) at least one activator of Sonic hedgehog (SHH) signaling, and (e) at least one activator of FGF signaling. In some embodiments, the kits disclosed herein further comprise (f) instructions for inducing differentiation of stem cells into the differentiated cell populations disclosed herein. In some embodiments, the kits disclosed herein comprise: (a) selected from any one of, or any combination of, DMH-1, Noggin, LDN193189, or derivatives thereof; (b) selected from any one of, or any combination of, SB431542 or A83-01, or derivatives thereof; (c) selected from any one of, or a combination of, CHIR99021, WNT1, WNT5A, WNT3A, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, SB-216763; (d) selected from any one of, or a combination of, SAG (N-methyl-N'-(3-pyridinylphenyl)-N'-(3-chlorobenzo[b]thiophene-2-carbonyl)-1,4-diaminocyclohexane), SHH protein or active fragment thereof, or Purmorphamine; (e) selected from any one of, or a combination of, FGF8, FGF8a, FGF17, FGF18, FGF8b, FGF2, FGF4.

[0349] V. Methods of preventing, ameliorating, or treating a neurological disorder

[0350] The cell populations provided herein, particularly the differentiated cell population C and the differentiated cell population D, can be used to prevent, ameliorate, or treat a neurological disorder, or to prepare a medicament capable of preventing, ameliorating, or treating a neurological disorder. In some embodiments, the neurological disorder is caused by a decrease in the number of mesencephalic dopaminergic neurons. In some embodiments, the neurological disorder is caused by a decrease in the function of mesencephalic dopaminergic neurons. In some embodiments, the neurological disorder is caused by a decrease in the number and function of mesencephalic dopaminergic neurons. In some embodiments, the neurological disorder is a disorder associated with increasing age or aging. In some embodiments, the neurological disorder is selected from any one of, or any combination of, Parkinson's disease, Parkinson-plus syndrome, Huntington's disease, Alzheimer's disease, or multiple sclerosis. In some embodiments, the neurological disorder is selected from any one of, or any combination of, tremor, bradykinesia, postural reflexia, postural instability, rigidity, dysphagia, or dementia.

[0351] In some embodiments, the nervous system disorder is Parkinson’s disease. Major motor symptoms of Parkinson’s disease include, but are not limited to, tremor of the hands, arms, legs, jaw, and face, slowness of movement or bradykinesia, stiffness or soreness of the limbs and trunk, postural instability or impaired balance and coordination. In some embodiments, Parkinson’s disease refers to a disease associated with dopamine deficiency in the basal ganglia, a part of the brain that controls movement, symptoms include tremor, bradykinesia (extreme slowness of movement), curved posture, postural instability, and rigidity. Non-limiting examples of Parkinson’s disease include corticobasal degeneration, Lewy body dementia, multiple system atrophy, and progressive supranuclear palsy.

[0352] In some embodiments, the cells or compositions disclosed herein can be administered or provided to a subject systemically or directly to prevent, ameliorate, or treat a nervous system disorder. In some embodiments, the cells or compositions disclosed herein are injected directly into a target organ (e.g., the central nervous system (CNS) or the peripheral nervous system (PNS)). In some embodiments, the cells or compositions disclosed herein are injected directly into the striatum.

[0353] The cells or compositions disclosed herein can be administered by local injection, orthotopic (OT) injection, systemic injection, intravenous injection, or parenteral administration. In some embodiments, the cells or compositions are administered to a subject having a nervous system disorder by orthotopic (OT) injection.

[0354] The cells or compositions disclosed herein can conveniently be provided as sterile liquid preparations, such as isotonic aqueous solutions, suspensions, emulsions, dispersions or viscous compositions, which can be buffered to a selected pH. Liquid preparations are generally easier to prepare than gels, other viscous compositions and solid compositions. In addition, liquid compositions are more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within an appropriate viscosity range to provide longer contact time with a particular tissue. Liquid or viscous compositions can include a carrier, which can be a solvent or dispersion medium containing, for example, water, saline, phosphate buffered saline, polyhydric alcohol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof. If desired, a sterile injectable solution of the subject compositions (e.g., a composition comprising stem cell-derived precursors of the disclosure) can be prepared by incorporating the subject compositions in the required amount in the appropriate solvent with the other ingredients as desired. Such compositions can be mixed with suitable carriers, diluents or excipients (e.g., sterile water, physiological saline, dextrose, dextrose in water, etc.). The compositions can also be lyophilized. The compositions can include auxiliary substances such as wetting or dispersing agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, coloring agents and the like, depending upon the dosage form desired and the particular site being targeted for administration. Reference can be made to standard texts for formulating appropriate dosage formulations, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17thEdition, 1985, incorporated herein by reference, without undue experimentation.

[0355] Various additives can be added to enhance the stability and sterility of the composition, including antibacterial preservatives, antioxidants, chelating agents, and buffers. Prevention of the growth of microorganisms can be ensured through the use of various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, sorbic acid, etc.). Prolonged absorption of injectable pharmaceutical forms can be brought about by the use of agents delaying absorption (e.g., single-stearate alum and gelatin).

[0356] If desired, the viscosity of the composition can be maintained at a selected level using a pharmaceutically acceptable thickening agent. Methylcellulose can be used because it is readily available and economical, and easy to use. Other suitable thickening agents include, for example, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, carbomer, etc. The concentration of the thickening agent will depend on the agent selected. It is important that the amount used be such as to achieve the selected viscosity. The selection of suitable carriers and other additives will depend on the particular route of administration and the nature of the particular dosage form, e.g., liquid dosage forms (e.g., whether the composition is to be formulated as a solution, suspension, gel or other liquid form, e.g., a time release form or a liquid filled form).

[0357] The skilled person will recognize that the components of the composition should be chosen to be chemically inert and not to affect the activity or efficacy of the stem cell-derived precursors of the present disclosure. This presents no problem to the chemist and pharmacist of ordinary skill, or can be easily avoided from the present disclosure and documents cited herein by reference to standard texts or by simple experimentation not involving undue experimentation.

[0358] One consideration for the cell therapy use is the number of cells required to achieve optimal effect. Optimal effect includes, but is not limited to, re-population of a CNS and / or PNS region of a subject having a neurodegenerative disease, and / or improvement of CNS and / or PNS function of a subject.

[0359] The present application is further described in the following examples, which do not limit the scope of the application. Various modifications and adjustments can be made by those skilled in the art based on the teachings of the present application without departing from the spirit and scope of the application.

[0360] Examples

[0361] The experimental methods in the following examples are routine methods, and are performed according to the techniques or conditions described in the literature in the art or according to the instructions of the products, unless otherwise specified. The materials, reagents, instruments, etc. used in the following examples are commercially available, unless otherwise specified. The quantitative tests in the following examples are the average of three repeated experiments, unless otherwise specified. In the following examples, the nucleotide sequences in the sequence listing are written from left to right as 5' to 3' end, and the amino acid sequences are written from left to right as amino terminal to carboxyl terminal, unless otherwise specified.

[0362] Reagents, instruments and cell lines used

[0363] The reagents, instruments and cell lines used in the present application are commercially available, unless otherwise specified. Important reagents are listed as follows.

[0364] Table 1

[0365] Cell lines

[0366] hESC reporter line was obtained according to the method described in You, Z. et al. (2023). Mapping of clonal lineages across developmental stages in human neural differentiation. Cell Stem Cell 30, 473-487. hESCs #H9, less than 50 passages, and their derived reporter line were cultured with mTeSR TM Plus (STEMCELL) medium, and the culture dishes were coated with Vitronectin (VTN-N, Thermo Fisher). The cells were passaged every 4-5 days using TrypLE Express (Gibco).

[0367] The related research of human induced pluripotent stem cells (hiPSCs) was approved by the Ethics Committee of the Institute of Neuroscience, CAS Center for Excellence in Brain Science and Intelligence Technology. After obtaining the informed consent of the volunteer donors, the hiPSC line was established according to the method described in Xu, P. et al., (2022). J Clin Invest 132. The hiPSCs on the feeder layer were further transferred to the feeder-free system for culture.

[0368] Experimental animals

[0369] SCID Beige mice were purchased from Vital River Laboratory. All animals used in the study were group-housed under a 12:12 hour light / dark cycle and were provided with water and food as needed. All animal experiments were performed according to the protocols approved by the Animal Care and Use Committee of the Institute of Neuroscience, CAS Center for Excellence in Brain Science and Intelligence Technology.

[0370] Recombinant genes and recombinant plasmids

[0371] Wild-type Cas9 (Cas9-2A-GFP) and Cas9 nickase (Cas9D10A-2A-GFP) of human codon-optimized Streptococcus pyogenes were obtained from Addgene (plasmid #44719, plasmid #44720). See Ding, Q. et al., (2013). Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Cell Stem Cell 12, 393-394.

[0372] The starting vectors for generating donor plasmids are PL452-hGH-polyA-PGK-neoR (plasmid #191681) reported in Xu, P. et al., (2022) and PL552-hGH-polyA-PGK-puroR (plasmid #68407) generated from PL552 reported in Chen, Y. et al., (2015). Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR / Cas9. Cell Stem Cell 17, 233-244.

[0373] To generate SIM2-P2A-tdTomato, GDF15-P2A-tdTomato donor plasmids, DNA fragments with left or right homology arms (with certain mutations on the right homology arm to avoid sgRNA self-targeting to the donor plasmid) were amplified by PCR from H9 hESCs genomic DNA upstream or downstream of the stop codon of these genes. The DNA fragment of P2A-tdTomato was amplified by PCR from TH-P2A-tdTomato plasmid reported in Xiong, M. et al., (2021). Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Cell Stem Cell 28, 112-126. Then, the DNA fragments carrying left and right homology arms of the above genes were cloned with P2A-tdTomato into the multiple cloning site of the plasmid PL552-hGH-polyA-PGK-puroR to obtain the donor plasmids.

[0374] To generate PITX2-P2A-EGFP donor plasmid, the DNA fragment of P2A-EGFP was amplified by PCR from PL452-PTPRO-LA-P2A-EGFP-hGHpA-PGK-neoR-PTPRO-RA (plasmid #191689) and assembled with homology arms into the PL552-hGH-polyA-PGK-puroR plasmid.

[0375] To generate EN1-P2A-EGFP donor plasmid, the P2A-EGFP fragment and homology arms of EN1 gene were cloned into the plasmid PL452-hGH-polyA-PGK-neoR.

[0376] sgRNAs targeting the top 100 bp of the right homology arm were designed through the website https: / / benchling.com / . Genotyping primers for detecting transgene integration were designed through the website https: / / www.bioinformatics.nl / cgi-bin / primer3plus / primer3plus.cgi.

[0377] Flow cytometry (FACS)

[0378] Titration experiment of LMX1A-p2A-tdTomato / EN1-p2A-mNeonGreen hESC lines: According to the stage, the neurospheres were dissociated into single cells by Accutase (Innovative Cell Technologies) at 37°C for 10-20 min and resuspended in neural induction medium (NIM). Cells were filtered with a 40 mm cell strainer before flow cytometry. Analysis was performed by MA900 Multi-Application cell sorter (Sony, Japan) and data were further analyzed with cell sorter software or Flowjo.

[0379] Cell sorting experiment: 1x penicillin-streptomycin was added to the resuspension medium. Using 488 nm and 568 nm lasers for excitation, tdTomato + and EGFP + Components. Sorted and unsorted (control) cells were seeded at a density of 5000 cells / well onto Lipidure-CM5206 (NFC CORPORATION) coated 96-well conical (V) bottom plates (Thermo Scientific). B-27 supplement without vitamin A (Life Technologies) and Rho kinase (ROCK) inhibitor (Tocris, 0.5 mM) were added to the medium to improve cell survival rate during reseeding.

[0380] Immunohistochemistry

[0381] Immunohistochemistry was performed according to the methods described in Xu, P. et al., (2022) and You, Z. et al. (2023). DNA was stained with DAPI solution (Roche). Detailed information of antibodies is shown in Table 1.

[0382] RNA in situ hybridization

[0383] RNA in situ hybridization was performed essentially following the manufacturer’s instructions using the RNAscope Multiplex Fluorescent Detection Kit v2 (Advanced Cell Diagnostics) according to the methods described in Xu, P. et al., (2022) and You, Z. et al. (2023). Details of the probes are found in Table 1.

[0384] Cell transplantation

[0385] Neural stem cell transplantation was performed according to the methods described in Chen, Y. et al., (2016). Chemical Control of Grafted Human PSC-Derived Neurons in a Mouse Model of Parkinson’s Disease. Cell Stem Cell 18, 817-826. Briefly, PD model SCID mice (11-12 weeks old, including both male and female) were randomly grouped and progenitor cells, either marker sorted or unsorted, were transplanted into the following coordinates relative to bregma: AP +0.6 mM, ML -1.8 mM, DV -3.2 mM, resuspended in 1 mL ACSF containing ROCK inhibitor (0.5 mM), B27, 20 ng / mL BDNF.

[0386] Amphetamine-induced rotation test

[0387] Amphetamine-induced rotation test and analysis were performed according to the methods described in Xu, P. et al., (2022). Briefly, animals that exhibited behavioral deficits (>300 rotations in 60 minutes) were defined as successful PD models and used for cell transplantation. Behavioral tests were performed at 4 and 6 months post-transplantation.

[0388] Imaging and cell counting

[0389] Imaging and quantification were performed according to the methods described in Xu, P. et al., (2022). Briefly, all brightfield images were taken using an Olympus VS120 microscope at 20x magnification. Fluorescent images were taken on a Nikon TIE inverted microscope at 60x magnification, on an Olympus VS120 microscope at 20x magnification, or on an Olympus FV3000 microscope at 20x magnification. For quantification of in vitro mature neurons, Ho + , TH + , EN1 + , and TPH2+ The total number of cells is used to quantify TH. + EN1 + and TPH2 + Cell ratio. For graft quantification, manually count the total number of human cell nuclei, or first use StarDist to count the cell nuclei and then manually check to add or remove counts. All other positive cells were manually counted or analyzed using FIJI (ImageJ).

[0390] scRNA-seq expression and in vivo comparative analysis

[0391] First, scRNA-seq data were preprocessed using CellRanger (V7.0.1) with GRCh38 as the reference genome. Downstream analysis was performed using the digital gene expression (DGE) matrix generated by CellRanger. The Seurat (V4.3.0) object created from the CellRanger output was normalized with a scaling factor of 40,000 and then subjected to quality control procedures.

[0392] First, genes present in fewer than three cells are filtered out, and the remaining genes are used for quality control. Second, doublet cells are removed using DoubletFinder (V2.0.3), and cells with a median absolute deviation greater than 5 times the median are also removed. Third, cells with a UMI count less than 1000, fewer than 500 genes, and a mitochondrial gene percentage greater than 0.08 are removed as low-quality cells. The filtered Seurat objects are then used in the subsequent integration process.

[0393] The processed samples were then used for integration. Integration anchors were selected and calculations were performed at dimension 40, with the reduction method chosen as "rpca" to preserve inter-sample differences. After integration, "Find Variable Features" was used to identify highly variable genes, excluding genes associated with TOP2A expression and showing a Pearson correlation greater than 0.15. The integrated data was then scaled and "RunPCA" was performed. "Elbow Plot" was used to determine the dimensions used for "Find Neighbors." Cells were then clustered using "Find Clusters" and visualized using UMAP. Clusters with significantly low average gene counts were also filtered out as low-quality cells.

[0394] Correlation comparison between precursor cells derived from hESC and hiPSC lines

[0395] To compare the relationship of different clusters originating from hiPSC lines and from hESC H9 lines, Spearman and Pearson correlation analysis was performed on the single cell data. Correlation analysis was performed using high variable genes for integration. Spearman analysis was used to compare the average expression similarity of specific cell types between the H9 cell line and different hiPSC lines. Pearson analysis was used to compare the expression relationship between different samples of one cell type and between different cell types of one sample at the single cell level. 500 cells were randomly selected from each of the two groups and the Pearson correlation score was compared within each group.

[0396] In vivo microdialysis and HPLC-ECD analysis

[0397] At coordinates [AP] = 0.6 mm, [ML] = -1.7 mm, [DV] = -1.7 mm, a mock probe cannula (CMA / 7) was surgically implanted into the dorsal striatum of the study animals. Samples were collected from the mice 7 days post-surgery. Probes with high recovery were selected for the mice. The microdialysis probes were perfused overnight with ACSF (artificial cerebrospinal fluid) at a rate of 0.3 μL / min while the animals were placed in a head-fixed manner on a rack for a 5-hour training session. The next day, the flow rate was increased to 1 μL / min and samples were collected every 40 minutes into vials containing 10 μL of a protective solution containing 0.1 μM ascorbic acid and 100 mM hydrochloric acid. The 2ndto 5thcollection vials were used for high-performance liquid electrochemical detection to calculate the sample concentration.

[0398] TX-SISBAR library construction

[0399] According to You, Z. et al. (2023), the method for constructing the SISBAR library used in this paper was improved. For the barcoded lentivirus library, a single-stranded template of 84 bp in length was synthesized, which contained a semi-random 32 bp barcode sequence (AATCCAAAGACGCCGTCGCAAACCGGTWSWSWSWSWSWSWSWSWSWSWSWSWSWSWSWSGGATCCAGCCTTACATGCCTTCAACAT) and a primer pair flanking the barcode for amplification (forward: CGACGCATTGAAGGCACAGACTTTGTTGGCTGCAATCCAAAGACGCCGTCGCAAACCGGT; reverse: TATTCGGAGGACGACCCTATTTGTGTCCGGCACATGTTGAAGGCATGTAAGGCTGGATCC). After digestion of the viral vector with Age I / BamHI, it was recovered with a gel extraction kit. Other reported procedures were used to generate randomly barcoded plasmid DNA. The barcoded lentivirus was produced by Shanghai Taitool Bioscience Co., Ltd. on a contract basis.

[0400] Transplant scRNA-seq

[0401] The culture at day 21 (D21) was dissociated into single cells, then infected with TX-SISBAR, with the infection rate carefully controlled at around 10%. Subsequently, the progenitor cells were allowed to spontaneously reaggregate in T25 flasks and were allowed to continue differentiating. By day 28, several spheroids were harvested and digested into single cells. A quarter of these cells were sampled for scRNA-seq. The remaining cells were reaggregated for one day, then transplanted into a PD mouse model following the protocol described previously (see Xiong, M. et al., (2021). Cell Stem Cell (Vol. 28, Issue 1, pp. 112-126. e6) for the mouse model). After one month of maturation in the PD model mice, the mice were sacrificed and the grafts were isolated from brain sections and digested into single cells. Then, the cells were sorted by FACS, with EGFP-positive donor cell-specific sorting and collection for subsequent scRNA-seq analysis.

[0402] Clone extraction and lineage analysis

[0403] Single-cell lineage tracing data were constructed, pre-processed, and blacklisted according to the methods described in You, Z. et al. (2023). Tversky index was used to measure the clonal correlation between two cell types. If there are two cell types (A and B), and clone A and clone B represent the viral clonal types in A and B, respectively, the Tversky index is calculated as follows:

[0404] When calculating the Tversky index at a certain time point, to eliminate the number imbalance between the number of clones in two cell types, the values of a and b are calculated as follows:

[0405] If the Tversky index is calculated across two time points, origin-spective and potential-spective Tversky index are used. If A represents the earlier cell type (D28) and B represents the later cell type (1MPT), a = 0, b = 1 when calculating the origin Tversky index; a = 1, b = 0 when calculating the potential Tversky index. Based on this, the significance of clonal correlation between cell types was further analyzed. To compare cell types A and B, first, 500 random selections were made from each group, each time selecting (|clone A|) / 2 and (|clone B|) / 2 clonal types, and calculating the Tversky index (T-INDEX exp ) of these 500 selections. Subsequently, all clonal types in the analysis data were considered as a group, 500 random selections were made from them, each time selecting (|clone A|) / 2 and (|clone B|) / 2 clonal types, and the Tversky index (T-INDEX ctrl ) of these data was also calculated. The mean values of T-INDEX exp and T-INDEX ctrl were tested with T test to calculate the p value.

[0406] To study the lineage relationship within a certain stage, the absolute Pearson distance (d) between clusters was calculated, and the value cscore = 1 - d was used to represent the cluster-cluster correlation at a time point. The lineage relationship across stages was calculated and presented with the origin and potential Jaccard similarity coefficient scores, with the random distribution of cells in a certain clone among all clusters as the null hypothesis to calculate the P value.

[0407] BrdU incorporation assay

[0408] BrdU solution was added to the culture medium at a concentration of 10 mM for 24 hours during the process of re-aggregation into spheroids before transplantation. Spheroids were collected before transplantation, removed BrdU labeling solution, and washed spheroids twice in DPBS for about 2 minutes each. Subsequently, spheroids were suspended in transplantation medium.

[0409] Stereo-seq

[0410] All steps were performed using R platform (version 4.3.1) or Python platform (version 3.8). First, h5ad files were converted to SeuratObject datasets using SeuratDisk (version 0.0.09020). Subsequently, data were re-analyzed using Seurat (version 5.0.1). Normalization was performed using the “NormalizedData” function with a scale factor of 40000. Next, “FindVariableFeatures” was executed to select 4000 features. Then, data were scaled, and functions RunPCA, RunUMAP, FindNeighbors, and FindClusters were applied sequentially.

[0411] After clustering, human cells and mouse cells were separated into different clusters, and their annotations were determined according to the expression patterns of human genes or mouse genes. Statistical analysis was then performed on human cells and mouse cells, respectively.

[0412] Human cell subpopulations were isolated from Seurat objects, and all mouse genes were removed. The “TransferData” function in Seurat was used to annotate cell types. At the beginning, the human data and reference data (single-cell transcriptome data of the graft sample) were converted to SCT format using the “SCTransform” function. Subsequently, the “FindTransferAnchors” and “TransferData” functions with default parameters were used to annotate the spatial transcriptome data of humans (spatial human cells) at single-cell resolution. After annotation, the percentage of cell types and their expression patterns were calculated and visualized.

[0413] To elucidate the distribution of human cells and genes, the expression percentage of human genes and mouse genes in each cell was calculated. First, the original expression count data were extracted from Seurat objects. Subsequently, mouse gene counts and human gene counts were separated, and the sum of each component in the cell was calculated. The summary count information was then used to calculate the percentage.

[0414] Statistical analysis

[0415] The number of biological replicates and methods of statistical testing are described in the figure legends. Statistical analyses were performed using GraphPad Prism 10. Data are presented as mean ± SEM, unless otherwise indicated. P values were calculated using a two-tailed unpaired t test, unless otherwise indicated, and are shown in the relevant figure legends. P values < 0.05 were considered significant.

[0416] Example 1:

[0417] This example describes an exemplary culture method of the present application.

[0418] In previously disclosed in vitro culture methods based on late Wnt potentiated activation (the “Differentiation of midbrain ventral neural cells” protocol disclosed in Chinese Patent Application Publication CN117202914A, incorporated by reference in its entirety), stem cells are induced to differentiate in vitro to produce a cell population co-expressing typical midbrain ventral floor plate neural precursor cell markers (LMX1A + , EN1 + , OTX2 + , and FOXA2 + ). However, this method requires the use of a feeder layer or a coated culture vessel to prevent the death or undesirable differentiation of pluripotent stem cells. But the feeder layer or coating process introduces a lot of disturbances caused by manual operations, increases the heterogeneity of cell products, increases costs, is not conducive to the stable and uniform production of cell products, and the animal-derived components derived from feeder cells can cause potential safety problems. In addition, the cell population produced by the above method of differentiation contains a variety of non-target cells, and without flow sorting enrichment of mDA precursor cells using mDA markers, the resulting cell population is further differentiated into mature cells under in vitro conditions, and only about 8% to about 18% of mDA neurons can be obtained. If sorted by markers of midbrain dopaminergic (mDA) neural precursor cells, although the proportion of LMX1A + EN1 + double positive cells can be increased, LMX1A and EN1 themselves as nuclear transcription factors cannot be labeled on non-engineered living cells, and have no practical application significance; using other cell surface markers for sorting can easily damage the cells and even change the function of the cells, reducing the survival rate of the cells and the therapeutic effect. And using the sorting process for industrial level cell preparation still has challenges. Therefore, in order to provide a method that can more safely and effectively produce high-purity midbrain progenitor cell populations that can be directly used for in vivo transplantation, the original two-dimensional culture method was optimized in this example (Figure 1A).

[0419] To quantitatively observe the optimization effect, according to the method described in Xu, P. et al., In Journal of Clinical Investigation (2022) Vol. 132, Issue 14, a LMX1A and EN1 dual reporter hESC line was constructed as shown in FIG. IB, which has fluorescent proteins tdTomato and mNeonGreen inserted into the LMX1A and EN1 loci, respectively. Both LMX1A and EN1 exhibit restricted expression patterns during the development of the brain, the former is expressed in progenitor cells located in the ventral midbrain region and the ventral midbrain region, and the latter is activated in the midbrain and the anterior part of the hindbrain at the early developmental stage (Andersson E, et al., Cell. 2006 Jan 27; 124(2): 393-405; Nouri, N. et al., (2017). https: / / doi.org / 10.1242 / dev.144949). Therefore, cells that simultaneously express LMX1A and EN1 are likely to belong to ventral midbrain progenitor cells with mDA generation potential (FIG. IB).

[0420] As a preferred example of the present application, the following method was used to induce a culture dual-reporter hESC line. Specifically, on day 0 (D0), the desired cells were resuspended in neural induction medium (NIM) containing DMEM / F-12 medium (Gibco), lx N2 Supplement-A (STEMCELL), lx MEM NEAA (Gibco), further supplemented with 500 nM H-1152 (Rho kinase inhibitor, Sigma-Aldrich) in a culture flask without a feeder layer and without coating, and resuspended culture. On day 1 (D1), the medium was changed to NIM supplemented with SB431542 (Stemgent, 2 mM), DMH-1 (Tocris, 2 mM), CHIR99021 (Tocris, 0.6 mM), and SAG HC1 (Selleck, 0.5 mM), and the medium was changed every other day for the next 7 days (D1 to D7). On day 7 and day 9, the medium was changed without SB431542 and DMH-1. From day 11 (D11), the medium was changed to NIM supplemented with SAG (Selleck, 0.5 mM) and FGF-8b (Novoprotein, 100 ng / ml), and the medium was changed every other day for the next 10 days (D11 to D20). From day 21 (D21), the neural spheres were allowed to continue differentiation and proliferation in NIM medium supplemented with SAG (Selleck, 0.1 mM) and FGF-8b (Novoprotein, 20 ng / ml) to day 28 (D28) (Figure 8A). The expression changes of LMX1A and EN1 were observed throughout the differentiation process using flow cytometry as shown in Figure 1C. Since the concentration of the Wnt signaling activator used in this method remained essentially unchanged, this method is also referred to as the 3D CHIR constant culture method hereinafter.

[0421] The effect of using different concentrations of CHIR99021 (also referred to as CHIR herein) in combination with SAG in the basic induction method was also tested to determine the optimized Wnt and SHH signaling suitable for three-dimensional culture conditions (Figure 1C). The CHIR concentration was tested in the range from 0 to 1.2 mM, and the SAG concentration was 0.25 to 1.0 mM. Samples were collected every week for the first four weeks of culture, and the expression of the cell markers LMX1A and EN1 was determined, and the proportion of each type of cell in the total cells was calculated, and the results are shown in Figure 1D and Figures 8C, 8D. As can be seen from Figure 1D, the proportion of LMX1A + and EN1 + cells both increased significantly when CHIR was used at a concentration of 0.4 mM to 1.0 mM, suggesting that Wnt signaling plays a key role in the determination of the ventral midbrain fate, and CHIR increases the proportion of LMX1A +and EN1 + The increase in cell proportion mainly occurs after D14 and continues until D28. As seen in Figure 8D, SAG at concentrations of 0.25 μΜ to 1 μΜ does not significantly change the proportion of LMX1A + and EN1 + proportion of double positive cells, but the expression of EN1 shows greater sensitivity to CHIR concentration, and high concentration of CHIR inhibits and delays the increase in LMX1A expression. Overall, three-dimensional culture with CHIR concentration of 0.6-0.8 μΜ and SAG concentration of 0.25-0.5 μΜ can produce a higher proportion of LMX1A + and EN1 + double positive cells. Unless otherwise specified, the "3D CHIR constant culture" or "constant culture" mentioned hereinafter means the use of any two- two concentration combination thereof within the above-mentioned range.

[0422] Example 2:

[0423] The differentiated cell population produced by the culture method of the present application can be matured into dopaminergic neurons under suitable conditions known in the art for differentiating dopaminergic precursor cells into dopaminergic neurons. This example describes the maturation effect in vitro under exemplary maturation conditions.

[0424] The cell population prepared by the method described in Example 1 was further differentiated and matured in vitro. Specifically, the cell population was further cultured in NIM medium supplemented with SAG (Selleck, 0.1 μΜ) and FGF-8b (Novoprotein, 20 ng / ml) until day 35, and the neurospheres were dissociated with Accutase (Gibco) at 37 °C for 20 minutes, and then re-aggregated in the same NIM medium supplemented with SM1 w / o Vitamin A (STEMCELL) at 37 °C for 24 hours. TM Accutase TM (Gibco) at 37 °C for 20 minutes, and then re-aggregated in the same NIM medium supplemented with SM1 w / o Vitamin A (STEMCELL) at 37 °C for 24 hours. TM SM1 w / o Vitamin A (STEMCELL) at 37 °C for 24 hours. At day 36 (D36), the neurospheres were plated on Matrigel (BD Biosciences)-coated 24-well plates. From day 36 to day 45, Neurobasic TM medium (Gibco), 1x N-2 Supplement (Gibco), 1x B-27 TMNeural differentiation medium (NDM) containing fetal bovine serum (FBS, Gibco), brain-derived neurotrophic factor (BDNF, Peprotech, 10 ng / ml), glia-derived neurotrophic factor (GDNF, Pepro tech, 10 ng / ml), transforming growth factor b3 (TGF-b3, R&D Systems, 1 ng / ml), L-ascorbic acid (AA, Sigma-Aldrich, 200 mM), cAMP (Sigma-Altrich, 1 mM) and Compound E (Sigma Aldrich, 0.1 mM) was used to culture the differentiated cells (Fig. 8A).

[0425] The TH / HO and EN1 / TH ratios of the cell population at day 45 of in vitro maturation were determined to assess their ability to generate DA neurons, the results of which are shown in Figs. 1E, 1F, 1G, 8B. As can be seen from the figures, after 10 days of continued culture under in vitro maturation conditions, about 25% of the cells in the culture expressed the DA neuron marker TH (Figs. 1E, 1F, 8C), and most of the TH + cells also presented as midbrain marker EN1 positive (Figs. 1E, 1G, 8C), indicating that the prepared cell population was able to effectively generate mDA neurons in vitro. Meanwhile, LMX1A + EN1 + double positive cells in total cells had a good positive correlation with the TH + / HO and EN1 + TH + / TH + ratios of the cell population after in vitro maturation (Figs. 8F). This indicates that the proportion of mDAP in the final product can be effectively predicted by determining the proportion of early double positive cells (LMX1A + and EN1 + cells in total cells at an early stage (no earlier than D7). This suggests that the midbrain progenitor cells differentiated by the method of the present application can better maintain the midbrain lineage identity and differentiate into target mDA neurons with high specificity, and have the potential to simplify the in vitro maturation step. For industrial production, this means that production costs can be reduced and human disturbance factors can be reduced. In addition, this also suggests that the quality control step of the method of the present application can be set at an early stage of culture, and the composition of the final product and the therapeutic effect can be predicted by detecting the proportion of early LMX1A + and EN1 + double positive cells.

[0426] In addition, through immunofluorescence staining of the cell population at D45, it was not detected that there were any TPH2 +Serotoninergic neurons, a non-target cell component that has been reported to cause adverse side effects (dyskinesia) after transplantation, were not observed, indicating that the cell cultures produced by the method of the application have good safety for transplantation (Fig. 8E).

[0427] Example 3:

[0428] Different stem cells can have different responses to the induction protocol, therefore, the inventors evaluated the robustness of the three-dimensional culture strategy described herein across different cell lines by performing in vitro induction cultures for the unedited hESC #H9 cell line and seven iPSC lines from five different donors (A, B, C, D, E) including three different clones from the same donor (E1, E2, E3), using the same basic induction method as described in Example 1, and the results are shown in Figs. 1L, 1M and 1N.

[0429] The results show that the induction method of the application can effectively induce embryonic stem cells and induced pluripotent stem cells to produce mDA neurons in vitro, and the induction effect has high consistency among different individual and different clone-derived cell lines, indicating that the three-dimensional culture method of the application has good robustness and has the potential to provide customized cell therapy for patients.

[0430] Example 4:

[0431] This example evaluates the therapeutic effect and potential of the cell population prepared by the method of the application in vivo by performing transplantation experiments in PD model mice.

[0432] The cell population was prepared from the hESC line by the method described in Example 1 (any one of the cultures from day 21 to day 28), and the cell population was prepared from the iPSC lines derived from three different donors (hiPSC #A, hiPSC #B, hiPSC #C) by the method described in Example 3 (any one of the cultures from day 21 to day 28), and the above-mentioned cell population was used for transplantation into the striatum of PD model mice, and the mice were sacrificed at the designated time point, and the brain sections and the grafts produced in vivo were subjected to immunohistochemical staining, and representative results were selected as the accompanying drawings. Among them, the typical results based on hESC are shown in Figs. 1H to 1K, 9A to 9D, and the typical results based on hiPSC are shown in 1O and 1P, 10E-10G.

[0433] All cultures used for transplantation were able to efficiently generate mDA neurons in the host striatum. Specifically, in the 6-month post-transplantation (6MPT) grafts, the proportion of TH-positive cells generated from the hESC line-induced cell population was 30.42% to 55.00% of the total transplanted cells; and in all combinations, the vast majority of TH-positive cells (74.95% to 90.69%) were EN1-positive, suggesting their identity as target mDA neurons, (Figures 1H-1K).

[0434] To further demonstrate the identity of these in vivo differentiated cells, their expression of key genes associated with mDA neuron development, such as LMX1A and DAT, was also examined, with the results shown in Figures 9A-9D. In each condition group, the majority of donor cells expressed LMX1A, demonstrating their floor plate identity (Figures 9A and 9B); and the vast majority of DA neurons expressed DAT, suggesting their ability to transport dopamine (Figures 9D and 9D).

[0435] Similar results were also reproducibly obtained in the grafts of cell populations obtained from different hiPSC lines (Figures 10O and 1P, Figures 10A-10P). The measurements of 6MPT grafts showed that the hiPSC-derived cell populations were able to form about 1 mm3grafts in vivo, with the proportion of TH-positive cells to the total cells in the grafts being higher than that in the in vitro maturation, ranging from 23.71% to 54.12% among different cells, and showing robustness among grafts from three different donors. And, essentially all donor cells remained FOXA2-positive, suggesting their ventral identity (Figures 10M and 10N). Figures 10H-10L showed that only a very small number of donor cells (0.4% or less) were Ki67-positive, having the ability to continue to proliferate, indicating that the cell populations of the present application had a low potential safety risk of excessive cell proliferation after being transplanted into the body. The results of 5-HT staining indicated the low safety risk of the cell populations of the present application when used for in vivo transplantation from another aspect, with Figures 10O and 10P showing that the proportion of 5-hydroxytryptaminergic neurons in all grafts was very low (0.2% or less), thus being difficult to induce or eliminate side effects (such as dyskinesia) associated with such non-target neurons.

[0436] Comparative Example 1:

[0437] The hESC line was induced using the in vitro culture method based on late Wnt-enhanced activation described in Chinese Patent Application Publication CN117202914A (hereinafter also referred to as the 2D initial differentiation method), and the obtained culture (hereinafter also referred to as the 2D culture) was compared with the culture obtained by the method described in Example 1 using the same medium conditions.

[0438] Figure 11A shows the change of the proportion of LMX1A and EN1 double positive cells in the two types of cultures during differentiation. Compared with the 2D starting differentiation method, the differentiation culture method disclosed herein significantly increased the proportion of double positive cells contained in the cultures, suggesting that it more effectively induced the pluripotent stem cells to differentiate into midbrain dopaminergic progenitor cells, obtaining a differentiated cell population containing significantly more midbrain dopaminergic progenitor cells.

[0439] Figures 11B-11E show the results of in vitro maturation of the two types of cultures according to the method described in Example 2 and in vivo transplantation and maturation of the cultures according to the method described in Example 4. As can be seen from the figures, the cell population obtained by the differentiation culture method disclosed herein was able to produce a significantly higher proportion of TH positive cells, both under the condition of in vitro culture maturation and in the environment of in vivo transplantation, than the 2D starting differentiation method. Again, it was verified that the method disclosed herein has extremely excellent effects in promoting the directed differentiation of pluripotent stem cells into dopaminergic neuronal precursor cells and then into dopaminergic neurons.

[0440] Example 5:

[0441] This example verified that the cell population prepared by the method of the present application can restore the dopamine neurotransmitter level of the striatal cell gap of the PD model mice and restore the motor function of the animals to normal.

[0442] The levels of neurotransmitters and their metabolites in the striatal cell gap of wild type mice, PD model mice, D21 culture transplantation group and D28 culture transplantation group mice were measured by high performance liquid chromatography (HPLC) method, and the results are shown in Figure 1Q. Compared with the PD control group, both culture transplantation groups showed an increase in dopamine and its metabolites DOPAC and HVA, and both transplantation groups reached a release level comparable to that of healthy mice, indicating that the newly born mDA neurons in the grafts were able to perform normal functions and completely restored the dopamine deficiency of the PD model mice.

[0443] On this basis, the recovery of motor function of the mice after transplantation was further evaluated by amphetamine-induced rotation test, and the results are shown in Figures 1R, 9E (for hESC) and 1S (for hiPSC). As can be seen from the figures, compared with the control group injected with ACSF, all the transplanted mice showed statistically significant functional recovery. Among the mice transplanted with cultures derived from different hiPSC lines, all the transplanted groups showed complete functional recovery 4 months after transplantation (Figure 1S).

[0444] Therefore, the cell population prepared by the method of the present application has high efficiency of regeneration in vivo and strong long-term survival ability, can completely solve the dopamine deficiency of the host striatum, and reverse the motor defects caused thereby, and thus the cell population of the present application has the potential as a cell therapy for treating nervous system disorders (such as Parkinson's disease) caused by a decrease in the number or function of midbrain dopaminergic neurons.

[0445] Example 6:

[0446] This example aims to characterize the cultures during differentiation to more accurately assess the differentiation effect of the method of the present application.

[0447] For the H9 hESC line, the method described in Example 1 was used for culture, and the neurospheres cultured to day 7 (D7), day 14 (D14), day 21 (D21) and day 28 (D28) were collected and digested into single cells for time-course scRNA-seq analysis, the results of which are shown in Figures 2A-2B, 12A-12B and Table 2.

[0448] Table 2

[0449] *: N.D. means not detected.

[0450] It can be seen that the cultures of D7 and D14 are dominated by FOXA2 + P_FPs and their TOP2A + Proliferative counterparts (P_FP_proli) are the main cell clusters, in addition to early STMN2 + Neurons and NEUROD1 + The presence of neuroblasts, collectively referred to as N and Nb clusters. As the differentiation process deepens, the cell composition of the cultures of D21 and D28 changes to EN1 + Midbrain floor plate progenitors (P_mFP) become the most dominant cluster, and the proportion of N&Nb clusters increases. As the main non-target cell clusters, the cultures of D21 and D28 also contain the diencephalic floor plate progenitor cluster P_dFP (BARHL2+ / SIM2+) expressing diencephalic markers BARHL2 and SIM2, as well as a small amount of P_GDF15 (GDF15+) cluster and P_CD36 (CD36+) cluster. In addition, the D28 culture can also contain a small amount of P_FPL (NTRK2+ / PLP1+) cluster of floor plate lateral progenitors expressing markers PLP1 and NTRK2.

[0451] The expression levels of surface proteins, transcription factors, and cofactors in the top 100 enriched genes in the P_mFP cluster were analyzed, and the results are shown in Figure 2E. Single-cell gene expression analysis of the D21 and D28 cultures revealed that the P_mFP cluster expressed known mDA neural progenitor cell surface marker genes APCDD1, TPBG, PTPRO, and KITLG (see, for example, You, Z. et al., Mapping of clonal lineages across developmental stages in human neural differentiation. In Cell Stem Cell. (2023); Xu, P. et al., Journal of Clinical Investigation (2022) Vol. 132, Issue 14), consistent with expectations. Furthermore, genes ADAMTS1, ABCA5, WNT5A, TWIST1, and ADAMTS9 were characteristically expressed in the P_mFP cluster and could serve as novel markers for mDAP detection and culture enrichment (Figures 12C and 12D).

[0452] For the few non-target cell clusters P_CD36 and P_GDF15 repeatedly observed in multiple batches of experiments, the transcriptional correlations of each cluster in the D28 culture obtained using the H9 ESC line with the dataset of developing human embryonic ventral midbrain (see, for example, La Manno, G Let al., Molecular Diversity of Midbrain Development in Mouse, Human, and Stem Cells. Cell (2016) Vol. 167, Issue 2, pp. 566-580.e19) were compared. Notable similarities were found between the P_CD36 cluster and the hRgl3 cluster (Fig. 2C). The hRgl3 cluster is thought to play a role in glial cell formation located in the ventral midbrain floor plate (La Manno, G Let al. Cell (2016) Vol. 167, Issue 2, pp. 566-580.e19).

[0453] The P_GDF15 cluster appears to exist only in the in vitro culture system (Figure 2C). In gene set enrichment analysis (GSEA) against all clusters, the P_mFP cluster is enriched in various dopaminergic neuron differentiation related terms (e.g. dopaminergic neuron differentiation pathway, neuron production pathway, neuron projection pathway, neuron development pathway), while the P_GDF15 cluster shows clear enrichment in terms responding to unfolded proteins (Figure 2D). The P_GDF15 cluster is enriched in terms such as endoplasmic reticulum stress-mediated intrinsic apoptosis signaling pathway in GO analysis (Figure 13C). Since the enrichment of expression terms is focused on stress related pathways, it is speculated that the cause of this cluster may lie in the environmental restrictions and stress in the in vitro culture system. As further verification, the EN1-EGFP / GDF15-tdTomato cell line as shown in Figure 13A was constructed, and D28 culture in the form of neurospheres was obtained by the 3D CHIR constant method described in Example 1, and immunostaining was performed on neurosphere sections to detect the expression pattern of GDF15. Although suspension culture makes cell contact with medium more uniform than adherent culture, forming spheres will cause the local microenvironment of the internal cells to have greater environmental restrictions and stress than the outer layer of cells, such as low oxygen or lower concentration of nutritional factors. The staining results show that tdTomato positive cells are concentrated in the internal core area of all spheres (Figures 13A and 13B). It is emphasized that after the culture is transplanted into the host body to continue differentiation and maturation, this cluster will no longer be detected in the graft, suggesting that this cluster can serve as a good quality control indicator for in vitro suspension culture process, and will not affect the efficacy and safety after transplantation.

[0454] Using the method of the present application, pluripotent stem cells can obtain a cell population mainly composed of midbrain floor plate progenitor cells and containing only a few non-target components after passing through the floor plate progenitor cell stage, around day 21. Midbrain floor plate progenitor cells are known precursors of dopaminergic neurons, suggesting that the culture after D21 of the present application has the potential to be used as a treatment for neurological disorders caused by mDA neuron functional impairment, such as Parkinson's disease. On the other hand, the culture after D21 contains only a limited number of non-target cells, mainly P_dFP, P_CD36, P_FPL and P_GDF15. It should be noted that the measurement and analysis of cell population composition in the present application are mostly carried out at the single cell transcriptome sequencing level, with much higher accuracy and resolution than bulk data analysis.

[0455] Example 7:

[0456] This example verifies that the method of the present application has robust differentiation effects when used for different stem cells.

[0457] The D21 and D28 cultures were obtained from hESC lines and three hiPSC lines from three different donors (A, B, C) respectively using the 3D CHIR constant method described in Example 1 for scRNA-seq analysis. The integration and joint analysis results of the obtained data set are shown in FIGS. 2F-2K and 13D-13E.

[0458] The results show that the method of the present application can obtain substantially the same culture with high stability and repeatability at the resolution of single cell level when different starting cell lines are used, which is not achieved by the known induction methods. Specifically, FIGS. 2F and 2I show the UMAP results of comprehensive clustering of cells from D21 or D28 cultures of four different cell lines, respectively; FIGS. 2G and 2J show the embedding distribution of culture cells from each cell line in comprehensive clustering, and it can be seen that each cell line shows similar uniform distribution. Statistics of the results of the above single cell transcriptome sequencing more directly shows that between the cases of using different pluripotent stem cell lines as starting cells, the culture of the present application only has slight differences in the clustering proportion at different stages, but is highly consistent in cell composition (including dominant cell clusters and non-target cell clusters) (FIGS. 2H and 2K). The analysis results of spearman coefficient of RNA expression (FIG. 2L) also show that between H9 and different iPSC lines, most cell clusters have a correlation coefficient of 0.9 or more, which proves from the single cell transcriptome level that the different cultures of the present application are highly similar. In other words, the method of the present application can differentiate the same clusters from different cell lines. The same conclusion can also be obtained by principal component analysis PCA embedding method, and FIG. 2M shows that the clusters from different time periods and different cell lines are similar and tend to be divided into the same group. Therefore, the method of the present application has high cell line robustness.

[0459] Example 8:

[0460] This example further verifies that the culture of the present application has stable differentiated cell properties after being transplanted into the body.

[0461] For hESC (H9 EGFP-nls) cell line (see, e.g., Xu, P. et al., Human midbrain dopaminergic neuronal differentiation markers predict cell therapy outcomes in a Parkinson’s disease model. In Journal of Clinical Investigation (2022), Vol. 132, Issue 14) and hiPSC (hiPSC#C) cell line, D28 cultures were obtained using the method as described in Example 1, respectively, and transplanted into PD model mice. The 4MPT grafts were analyzed by scRNA-seq, and the results are shown in FIG. 3A. According to the expression of typical marker genes, the grafts mainly produced four cell types in the in vivo environment, including STMN2 + neuron cluster (hereinafter referred to as “Neuron”), AQP4 + astrocyte cluster (hereinafter referred to as “Astro”), PDGFRA + COL1A1 - oligodendrocyte lineage cluster (hereinafter referred to as “OPC & OL”), and COL1A1 + fibroblast cluster (hereinafter referred to as “VLMC”) (FIGS. 3A-3C).

[0462] To accurately determine the proportion of each cell type, immunohistochemistry was further verified for the above grafts, and the results are shown in FIGS. 3D-3E. As can be seen from the figures, neurons constitute the main cell type in the grafts after 4MPT, accounting for about 67.81% of the total number of human cells (as shown by NEUN / HN); astrocytes are another major cell type, accounting for about 31.19% of the total number of human cells (as shown by SOX9 / HN, which contains a small amount of SOX9 weakly positive VLMC and OPC / OL cells), followed by VLMC, accounting for about 3.928% of the total number of human cells, and in addition, there are a small amount of OLIG2 positive oligodendrocyte lineage cells (OPC and OL), accounting for about 1.811% of the total number of human cells. The proportion of neurons in the above grafts was further verified using immunohistochemistry, and it can be seen that among the NEUN positive human neurons, TH positive dopaminergic neurons accounted for 77.49% (FIGS. 3F-3G), indicating that dopaminergic neurons are the main neuron type in the grafts.

[0463] Further sub-classification of the neuronal subtypes within the grafts revealed that the dopaminergic neurons formed after transplantation could be identified into 6 clusters of dopaminergic subtypes and 3 clusters of glutamatergic subtypes according to the differences in gene expression (Fig. 3H and 3J). The 3 glutamatergic subtypes all expressed high levels of SLC17A6 and low levels of TH; among them, Glutl subtype was double positive for BARHL1 and BARHL2, Glut2 subtype was double positive for LMO1 and DKK1, and Glut3 subtype was double positive for CCK and SPP1. The 6 dopaminergic subtypes all expressed significantly higher levels of TH. Among them, DA1, DA2, DA3 were positive for EN1 and expressed low levels of SLC17A6, and their positive markers were SCGN, SLC32A1 and ALDH1A1, respectively; DA4, DA5, DA6 were both positive for TH and SLC17A6, and their positive markers were NPW, CBLN4 and LMO2, respectively (Fig. 3J). Comparing these neuronal subtypes with the transcriptomic data of fetal brain tissues (see, e.g., La Manno, G. L. et al., Molecular Diversity of Midbrain Development in Mouse, Human, and Stem Cells. Cell (2016) Vol. 167, Issue 2, pp. 566-580.e19), it could be determined that DA1 and DA6 were similar to the midbrain hNbM clusters, suggesting that they were less mature than the other subtypes (Fig. 31). DA2 and DA3 were well correlated with the hDA0, hDA1 and hDA2 clusters, indicating that these DA neuronal subtypes were similar to the embryonic DA neurons. DA4 and DA5 were transcriptomically closer to the 3 Glut subtypes and the GLUT cluster hRN reported by La Manno et al., suggesting that DA4 and DA5 had similarities with glutamatergic neurons (Fig. 31). Further comparison of the EN1 + DA subtypes (DA1, DA2, DA3) and the mDA neurons from adult human brain tissues revealed that the DA1 to DA3 subtypes were all less mature than the mature mDA neurons, and DA1 was significantly less mature than DA2 and DA3 (Fig. 3K). The above results indicated that the neurons formed by the cultures of the present application after transplantation into the body were mostly dopaminergic neurons, and were similar to the endogenous fetal brain dopaminergic neurons in the molecular expression profile, and were still not fully mature at 4 months after transplantation.

[0464] Fig. 3J shows that SLC32A1 + DA neurons (DA2) and SLC17A6 +DA neurons (mainly DA4, DA5, DA6), which can co-release other neurotransmitters such as GABA or glutamate along with dopamine. Therefore, it was verified by RNAscope probes that the dopaminergic neurons within the grafts 6 months after transplantation can indeed co-express RNA of SLC17A6 or GAD2, as shown in FIGS. 3L-3M.

[0465] The six DA subtypes in the 4MPT grafts of this example were identified using the primary markers of A9 and A10 (such as KCNJ6 and CALB1), and it was found that most of the TH-positive neurons in the grafts at this time can express KCNJ6 and CALB1 at the same time, and a large number of TH-positive neurons express KCNJ6 alone (FIGS. 3N-3O), which suggests that the neurons have not yet fully differentiated into A9 or A10 phenotypes at 4MPT, which is consistent with the results of the previous results on the maturity of neurons (FIG. 3O). The results of immunostaining of the grafts 6 months after transplantation showed that TH + The correlation of the cells with GIRK2 (KCNJ6 protein name) expression is significantly greater than that with CALB1, indicating that most of the transplanted progenitor cells eventually differentiate into A9 neurons as expected (FIGS. 3P-3Q).

[0466] This example shows that the cell population of the present application can form a stable graft after being transplanted into the host striatum, and this stability in composition is reproducible in grafts obtained using different starting cell lines and / or culturing for different days. Compared with various known induction methods of dopaminergic lineage cells, the grafts obtained by the present application not only achieve neurons as the most main constituent cell type, but also achieve dopaminergic neurons (especially A9 neurons) as the dominant neuron subtype at the single cell level resolution, and astrocytes as another main cell type. The neurons themselves exert therapeutic activity, while the glial cells can also play a beneficial auxiliary therapeutic effect of common nutrition, support and signal transduction, etc., thus having great potential for use in treating dopaminergic neuron deficiency or dysfunction.

[0467] Example 9:

[0468] This example explores the fiber innervation of the regenerated neurons formed by the culture of the present application after transplantation into the body.

[0469] The D28 culture obtained by the method described in Example 1 was transplanted into a PD model mouse, and the nerve fiber projection of the 6MPT graft in vivo was observed, and the results are shown in FIGS. 4A and 4B. As shown in FIG. 4A, a large number of STEM121 +Human fibers, CPu is a specific brain region targeted by endogenous dopaminergic neurons in the substantia nigra. Figure 4B shows that grafts derived from two different hPSC lines (hiPSC#A and hiPSC#B) also presented complete innervation of the host striatum.

[0470] The electrophysiological properties of transplanted DA neurons were investigated using the TH-tdTomato hESC#H9 cell line following the protocol outlined in Figure 4C. Whole-cell patch clamp methods as described by Xu, P. et al., Human midbrain dopaminergic neuronal differentiation markers predict cell therapy outcomes in a Parkinson’s disease model. In Journal of Clinical Investigation (2022), Vol. 132, Issue 14) revealed that human DA neurons (tdTomato + ) within the 6MPT grafts exhibited spontaneous APs (sAPs) (Figure 4D), with a substantial fraction of DA neurons exhibiting a sagging potential (Sag) upon response to hyperpolarizing current, a characteristic hallmark of A9 mDA neurons (Figures 4E and 4F). The above results indicate that DA neurons in the 6MPT grafts reached functional maturity and exhibited electrophysiological properties consistent with A9 mDA neurons.

[0471] The inventors previously reported that functional input to the regenerated DA neurons can be established within 3-6 months post-transplantation (Xiong, M. et al., (2021). Cell Stem Cell, Vol. 28, Issue 1, pp. 112-126.e6). Consistent with this, further electrophysiological analysis showed that DA neurons in the 6MPT grafts of the present application also exhibited spontaneous excitatory and inhibitory postsynaptic currents (referred to as sEPSCs and sIPSCs, respectively) (Figure 4G). The amplitude and frequency of sIPSCs and sEPSCs indicated that DA neurons had integrated into neural circuits and were able to successfully receive functional input (Figures 4H-4I).

[0472] Dopamine D2 autoreceptors are receptors that play a key role in regulating the activity of DA neurons and controlling dopamine synthesis, release, and uptake (Figure 4K). From scRNA-seq data, it was known that most DA neurons in 4MPT grafts, especially mature subtypes, expressed DRD2, rather than DRD1 genes (Figure 4J). Administration of the D2 / D3 receptor-specific agonist quinpirole (1 mM) significantly suppressed the firing of recorded neurons, and the firing frequency recovered after washout (Figures 4L and 4M). Changes in resting membrane potential also showed that quinpirole hyperpolarized recorded neurons (Figure 4M). Thus, it was verified that the function of regenerated DA neurons was also regulated by D2 autoreceptors.

[0473] Example 10:

[0474] This example describes a modification of the single-cell split barcode (SISBAR) technology (You, Z. et al., (2023). Mapping of clonal lineages across developmental stages in human neural differentiation. In Cell Stem Cell.) to enable cross-transplant lineage tracing, hereafter referred to as TX-SISBAR.

[0475] Lentiviral vectors were modified as shown in Figure 15A, i.e., 32 bp semi-random barcodes were inserted into the 3’ untranslated region (UTR) of the EGFP coding sequence, the coding efficiency of which was driven by a shortened CAG promoter. The TX-SISBAR barcode lentiviral plasmid library contains over 200,000 unique barcodes with a relatively uniform count distribution, sufficient to label over 20,000 cells with a barcode collision rate of less than 1% (Figure 15B). These barcodes are distinguishable from each other (Figure 15C). Thus, TX-SISBAR can be used to describe various clusters of clonal lineages before and after transplantation. Cells in the former time point are sister-origin cells of cells with the same barcode in the latter time point (Figures 15F and 15H). D21 cultures were infected with lentivirus at MOI < 0.1 (lentivirus infection used the method described in You, Z. et al., Mapping of clonal lineages across developmental stages in human neural differentiation. In Cell Stem Cell, (2003)) as shown in Figure 5A. At D28, EGFP +Cells were split into two samples. One quarter of the sample cells were immediately subjected to transcriptome and barcode analysis, while the remaining three quarters of the sample cells were transplanted into a PD mouse model for in vivo maturation, and the transplants were subjected to transcriptome and barcode analysis one month later.

[0476] According to the above method, two sets of TX-SISBAR experiments were performed for D28 cultures of H9 ESC line and IPS-C line obtained using the method shown in Example 1 (Figures 14A to 14C). Integrated analysis was performed on the same stage of data sets (Figures 5B, 5C and 14D). From the barcode-labeled D28 cultures, five different progenitor cell types were identified, P_dFP, P_mFP, P_mPFP_proli, P_GDF15 and P_CD36, and an early N&Nb cluster (Figures 5B and 2A); for 1MPT transplant data, nine neuronal clusters were identified, DA1, DA2, DA3, DA4, DA5, Glut1, Glut2, Glut3, Glut4, a late Nb cluster, an astrocyte cluster (Astro) and a vascular leptomeningeal cell cluster (VLMC) (Figures 5C and 14E). Notably, the identification results of 1MPT were highly correlated with the neuronal cluster data of 4MPT (Figures 5F and 14F), suggesting that the identity of most neuronal subtypes was basically established at one month of transplantation / maturation.

[0477] Viral barcodes were retrieved from cDNA libraries of each scRNA-seq experiment, followed by blacklist filtering and assignment to individual cells. Viral barcodes were recovered relatively evenly across different clusters and different batches, indicating that the TX-SISBAR method of the present application can uniformly track all lineages without artificial results caused by preferentially labeling a certain type of cells (FIGS. 15D and 15E). The lineage relationships within each time point were initially determined by calculating the Pearson correlation between time points (FIG. 5D). Strong clonal correlations were observed between P_mFP and P_mFP_proli, and between P_dFP and early N&Nb at D28, suggesting the continued proliferation of P_mFP and the appearance of neurons from P_dFP. In addition, lineage relationships were also observed between P_dFP and P_mFP_proli (FIG. 5D), suggesting that the midbrain floor plate progenitor and the hypothalamic floor plate progenitor might share a common progenitor before D28 (e.g., at D21) and differentiate from this common progenitor, while P_GDF15 appeared to be more isolated. As seen in FIG. 5D, at 1MPT, Glut1 and Glut2 showed strong correlation; EN1 -positive DA neurons clusters DA1, DA2, and DA3 showed close correlation between each other and with Astro cluster; and EN1 -negative DA4 and DA5 showed close correlation between each other. In addition, strong correlation was observed between VLMC and late neuroblasts.

[0478] The TX-SISBAR method can also calculate transplanted lineage relationships based on the same viral barcodes between two time points. It should be noted that the lineage hierarchy obtained by the TX-SISBAR method is significantly different from the lineage hierarchy based on transcriptome similarity (FIG. 5E). For example, the hierarchy based on transcriptome similarity failed to reveal the cross-stage, non-purpose lineage relationships between P_dFP and Glut subtypes, and failed to reveal the lineage correlation between P_mFP, DA subtypes, and astrocytes (FIG. 5E). Such transplanted lineage relationships are crucial for stem cell therapy, as they provide insights into the therapeutic mechanisms and improvement directions of donor cells for precision medicine.

[0479] Example 11:

[0480] This example provides a more detailed cross-stage examination of each cluster through potentiality and provenance prospective analyses (You, Z. et al., (2023). Mapping of clonal lineages across developmental stages in human neural differentiation. In Cell Stem Cell. Elsevier BV. https: / / doi.org / 10.1016 / j.stem.2023.02.007) (Figures 5G and 151).

[0481] Specifically, the differentiation potential of a given progenitor cell type at an earlier stage was examined by calculating the clonal cell distribution of that cell type at a later stage and comparing it to a random distribution, which is referred to as potentiality prospective analysis. The provenance of a given cell type at an earlier stage was examined by calculating the clonal cell distribution of that cell type at a later stage and comparing it to a random distribution, which is referred to as provenance prospective analysis. The potentiality prospective analysis results showed that P_dFP clusters generated all four glutamatergic clusters (Glut1-Glut4) in the grafts (all P values < 0.05), P_mFP_proli clusters generated various DA subtypes (DA1-DA5), astrocytes (Astro), and vascular leptomeningeal cells (VLMC) (all P values < 0.05), and P_mFP clusters generated partial DA subtypes (DA1 and DA2) and astrocytes (Astro) (Figures 5G, 15G, and 16A). The provenance prospective analysis also observed consistent results that Glut1-Glut4 mainly originated from P_dFP, while DA1-DA5 and Astro originated from P_mFP and P_mFP_proli clusters (Figures 5G and 16B). Thus, the in vivo grafting results were consistent with the pathway enrichment results of cultured cells in vitro in Example 6 (Figure 2D), and P_mFP and P_mFP_proli clusters were the main contributors to generate DA neurons in the host striatum; the graft lineage results further revealed the lineage connection of P_mFP and P_mFP_proli with early astrocytes, and P_dFP clusters were the main factors to generate non-targeted GLUT subtypes (Figures 5G-5I). Notably, the proportion of DA neurons in the in vivo grafts was much higher than that in the in vitro maturation culture (Figures 1F, 1J, 1M, 1P), which suggested that the current in vitro maturation conditions had potential for optimization to further improve the generation efficiency of neurons compared to the in vivo environment.

[0482] It is also suggested by Figure 5G that even if neurons or neuroblasts are included in the culture prior to transplantation, the main source of neurons within the graft is still the progenitors generated prior to transplantation. This is also confirmed by BrdU labeling experiments performed according to the protocol outlined in Figure 51 (Figures 5J and 5K). It is found that for cultures pre-labeled with BrdU for 24 hours prior to transplantation, more than 50% of the human cells in the 1MPT grafts generated are TH + dopamine neurons, and close to 90% of the TH + cells BrdU + i.e. derived from pre-transplant proliferative progenitors; pre-transplant cells that have exited the cell cycle only contribute about 10% of the dopaminergic neurons within the graft.

[0483] To further verify the potential of the precursor cells, the in vitro maturation process described in Example 2 was performed using the hESC #H9 cell line according to the protocol outlined in Figure 17A, while using the SISBAR viral library in Example 10 for lineage tracing. On D28, EGFP + cells were sorted from the culture and split into two samples at a 1 :3 ratio of cells. One quarter of the sample cells were immediately subjected to transcriptome and barcode analysis, while the remaining three quarters of the sample cells were re-aggregated into spheroid cell aggregates and subjected to in vitro maturation on Matrigel-coated culture slides. Transcriptome and barcode analysis was performed on the in vitro maturation culture on day 49.

[0484] Integrating the datasets from pre- and post-maturation (Figures 17B and 17C), a total of twelve distinct cell types were identified, two precursor cell populations (P_dFP, P_mFP), eight neuroblast and neuron populations (2D_Nb, 2D_DA0, 2D_DA1, 2D_GLUT1, 2D_GLUT2, 2D_GLUT3, 2D_GLUT4, 2D_CART) (Figure 5B and Figure 2A), one population of vascularized leptomeningeal cells (2D_VLMC) and one population of ependymal cells (2D_Ependy) (Figures 17B to 17D). To compare the cell types generated from the in vivo maturation method described in Example 4 and Example 8, the single cell data from the grafts harvested after 1 month of in vivo maturation of the same barcoded virus-infected grafts described in Example 10 were integrated with the in vitro maturation data, as shown in Figure 17E. Figure 17E suggests that the cell types generated after similar time periods of in vitro and in vivo maturation were dominated by dopaminergic and glutamatergic neurons, but the molecular profiles of the same cell types were quite different and difficult to reconcile on UMAP. In addition, the marker genes expressed by the neuron subtypes were not consistent between the in vivo and in vitro maturation-derived neurons (Figure 17F). However, potentiality prospective and origin prospective analyses suggested that P_mFP clusters contributed to dopaminergic neurons and a small number of other glutamatergic neuron subtypes during in vitro maturation, while P_dFP clusters contributed to a large number of primarily glutamatergic neurons (Figures 17G and 17H). This result shows that even though the transcriptomic profiles of the terminal cell types generated under different maturation conditions were significantly affected, the different maturation conditions had limited impact on the potentiality of the precursor cells prepared by the methods disclosed herein, and ultimately generated approximately the same cell types.

[0485] Example 12:

[0486] This example describes an example of optimizing the 3D culture method of the present application by incorporating gradient Wnt activation.

[0487] hESC#H9 and hiPSC#C cells were cultured according to the 3D CHIR constant culture method described in Example 2, and D28 cultures were obtained. Clonal lineage analysis of the D28 cultures revealed that the diencephalic and mesencephalic floor plate progenitors likely shared a common origin before D21 (Figure 5D).

[0488] Therefore, hESC#H9 cells were cultured according to the 3D CHIR constant protocol described in Example 1, and two independent viral labeling studies were performed for D7 and D14 cultures, respectively, as illustrated in Figure 18A. One week later, single cell lineages and transcriptomes were recovered, respectively, to study the segregation of diencephalic floor plate progenitor lineage and mesencephalic floor plate progenitor lineage at specific stages of their genesis. It was found that the common ancestor of P_dFP and P_mFP lineages appeared before D7, and both remained in close contact during D7 to D21 (Figures 18D and 5D).

[0489] GO analysis of early P_dFP and P_mFP clusters in D14 cultures found a significant increase in Wnt signaling for P_mFP (Figures 18E and 6A). Therefore, by taking measures to suppress dFP genesis before D7, it is expected that the dFP fate of later cultures will be reduced or even eliminated.

[0490] It ...

Claims

1. A method for in vitro differentiation of pluripotent stem cells, comprising: Step A: culturing pluripotent stem cells in suspension in the presence of a combination of at least one inhibitor of BMP signaling, at least one inhibitor of TGF-β1 signaling, at least one activator of Wnt signaling, and at least one activator of Sonic hedgehog (SHH) signaling, to obtain a differentiated cell population A expressing at least one marker indicative of floor plate progenitor cells; Step B: culturing the differentiated cell population A in suspension first in the presence of a combination of at least one activator of Wnt signaling and at least one activator of Sonic hedgehog (SHH) signaling, and then in the presence of a combination of at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of FGF signaling, to obtain a differentiated cell population B expressing at least one marker indicative of floor plate progenitor cells; and Step C: culturing the differentiated cell population B in suspension in the presence of a combination of at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of FGF signaling, to obtain a differentiated cell population C expressing at least one marker indicative of midbrain floor plate progenitor cells; Optionally, the method further comprises Step D: culturing the differentiated cell population C in suspension in the presence of a combination of at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of FGF signaling, to obtain a differentiated cell population D expressing at least one marker indicative of midbrain floor plate progenitor cells; Optionally, the method further comprises Step E: culturing the differentiated cell population D obtained in Step D in suspension under conditions promoting differentiation of dopaminergic precursor cells or dopaminergic neurons, to obtain a mature cell population E; Optionally, at least about 10% of the cells in the mature cell population E express at least one or more dopaminergic neuronal marker selected from TH, EN1, PITX3, SLC18A2, or TMCC3; Optionally, the mature cell population E is free of TPH2-positive serotonergic neurons; Optionally, the conditions promoting differentiation of dopaminergic precursor cells or dopaminergic neurons are adherent or suspension culture of the differentiated cell population D or the spheroidal cell aggregates in a neuronal maturation medium for at least 10 days, preferably 10 to 14 days.

2. The method of claim 1, which does not comprise a step of culturing cells using a feeder layer or using a culture vessel coated with a coating reagent; Optionally, the suspension culture in steps A to D is static suspension culture or dynamic suspension culture.

3. The method of claim 1 or 2, wherein, the concentration of the at least one activator of Wnt signaling is substantially maintained or increased, preferably increased, during the course of the Step A, relative to the initial concentration at the time of the first contact with the pluripotent stem cells; Optionally, the concentration of the at least one activator of Wnt signaling is increased after the fourth day after the first contact with the pluripotent stem cells; Optionally, the concentration of the at least one Wnt signaling activator is increased by at least about 300%, preferably about 350% to about 2000%, more preferably about 400% to about 1500%; Optionally, the initial concentration of the at least one Wnt signaling activator is about 0.2 to about 1.0 μM, preferably about 0.2 to about 0.8 μM; Optionally, the concentration of the at least one Wnt signaling activator is increased by at least about 1.0 μM, preferably about 1.0 to about 15.0 μM, more preferably about 3.0 to about 10.0 μM.

4. The method according to any one of claims 1 to 3, wherein, said step A lasts for at least 5 days, preferably 5 to 8 days, more preferably 6 to 7 days; Optionally, the concentration of the at least one BMP signaling inhibitor in said step A is about 0.5 to about 10.0 μM, preferably about 0.5 to about 5.0 μM; Optionally, the concentration of the at least one TGF-β1 signaling inhibitor in said step A is about 1.0 to about 10.0 μM, preferably about 2.0 to about 10.0 μM; Optionally, the concentration of the at least one Sonic hedgehog (SHH) signaling activator in said step A is about 0.1 to about 2.0 μM, preferably about 0.2 to about 1.0 μM; Optionally, said step B lasts for at least 5 days, preferably 5 to 8 days, more preferably 6 to 7 days; Optionally, the concentration of the at least one Wnt signaling activator in said step B is about 0.2 to about 15.0 μM, preferably about 0.2 to about 10.0 μM; Optionally, the concentration of the at least one Sonic hedgehog (SHH) signaling activator in said step B is about 0.1 to about 2.0 μM, preferably about 0.2 to about 1.0 μM; Optionally, the concentration of the at least one FGF signaling activator in said step B is about 10 to about 500 ng / ml, preferably about 20 to about 200 ng / ml; Optionally, said step C lasts for at least 5 days, preferably 5 to 8 days, more preferably 6 to 7 days; Optionally, in said step C, the concentration of the at least one Sonic hedgehog (SHH) signaling activator and the at least one FGF signaling activator is essentially maintained relative to their concentration at the end of said step B; Optionally, said step D lasts for at least 5 days, preferably 5 to 8 days, more preferably 6 to 7 days; Optionally, in said step D, the concentration of the at least one Sonic hedgehog (SHH) signaling activator and the at least one FGF signaling activator is reduced to below their concentration at the end of said step C, respectively; Optionally, in said step D, the concentration of the at least one Sonic hedgehog (SHH) signaling activator is reduced to about 0.1 to about 1.0 μM, preferably to about 0.1 to about 0.5 μM; Optionally, the concentration of the at least one FGF signaling activator in step D is reduced to about 10 to about 200 ng / ml, preferably to about 10 to about 100 ng / ml.

5. The method of any one of claims 1 to 4, wherein, the differentiated cell population A comprises a subpopulation A1 expressing at least one marker indicative of floor plate progenitor cells and a subpopulation A2 expressing at least one marker indicative of neurons and neuroblasts; optionally, the differentiated cell population A further comprises a subpopulation A3 expressing at least one marker indicative of mid-hindbrain isthmic progenitor cells; optionally, the marker indicative of floor plate progenitor cells is selected from any one of FOXA2, OTX2, SOX2, or any combination thereof; optionally, the marker indicative of neurons and neuroblasts is selected from any one of NEUROD1, NEUROD4, NEUROG2, or any combination thereof; optionally, the marker indicative of mid-hindbrain isthmic progenitor cells is selected from any one of FGF17, FGF8, S100A11, FOXH1, GBX2, or any combination thereof; Optionally, the differentiated cell population B comprises a subpopulation B1 expressing at least one marker indicative of floor plate progenitor cells and a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and any one of or any combination of a subpopulation B3 positive for GDF15, a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmic progenitor cells; optionally, the marker indicative of floor plate progenitor cells is selected from any one of FOXA2, OTX2, SOX2, CORIN, or any combination thereof; optionally, the marker indicative of neurons and neuroblasts is selected from any one of NEUROD1, NEUROD4, NEUROG2, GAP43, or STMN2, or any combination thereof; optionally, the marker indicative of hindbrain floor plate progenitor cells is selected from PLSCR5 and / or PDE1A; optionally, the marker indicative of mid-hindbrain isthmic progenitor cells is selected from any one of FGF17, FGF8, WIF1, or any combination thereof; Optionally, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells and a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and any one of or any combination of subpopulation C3 positive for GDF15, subpopulation C4 expressing at least one marker indicative of diencephalon floor plate progenitor cells, subpopulation C5 positive for CD36, subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells; optionally, the marker indicative of midbrain floor plate progenitor cells is selected from any one of or any combination of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, WNT5A, ARX, ALCAM, CMTM8, RGS2, TFF3, SERPINF1, CMTM7; optionally, the marker indicative of neurons and neuroblasts is selected from any one of or any combination of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2; optionally, the marker indicative of diencephalon floor plate progenitor cells is selected from any one of or any combination of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609; optionally, the marker indicative of hindbrain floor plate progenitor cells is selected from any one of or any combination of HOXB3, HOXB6, HOXB8, or HOXB9; optionally, the marker indicative of mid-hindbrain isthmus progenitor cells is selected from any one of or any combination of FGF17, FGF8, WIF1, KRT7; Optionally, the differentiated cell population C comprises a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells and a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and any one of or any combination of subpopulation C3 positive for GDF15, subpopulation C4 expressing at least one marker indicative of diencephalon floor plate progenitor cells, subpopulation C5 positive for CD36, subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells; optionally, the marker indicative of midbrain floor plate progenitor cells is selected from any one of or any combination of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, WNT5A, ARX, ALCAM, CMTM8, RGS2, TFF3, SERPINF1, CMTM7; optionally, the marker indicative of neurons and neuroblasts is selected from any one of or any combination of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2; optionally, the marker indicative of diencephalon floor plate progenitor cells is selected from any one of or any combination of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609; optionally, the marker indicative of hindbrain floor plate progenitor cells is selected from any one of or any combination of HOXB3, HOXB6, HOXB8, or HOXB9; optionally, the marker indicative of mid-hindbrain isthmus progenitor cells is selected from any one of or any combination of FGF17, FGF8, WIF1, KRT7; Optionally, said differentiated cell population D comprises a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells and a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and any one or any combination of a subpopulation D3 positive for GDF15, a subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, a subpopulation D5 positive for CD36, a subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, or a subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells; optionally, said marker indicative of midbrain floor plate progenitor cells is selected from any one or any combination of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, or WNT5A; optionally, said marker indicative of neurons and neuroblasts is selected from any one or any combination of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2; optionally, said marker indicative of diencephalic floor plate progenitor cells is selected from any one or any combination of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609; optionally, said marker indicative of floor plate lateral progenitor cells is selected from any one or any combination of SHISA3, NTRK2, PLP1, SOX3, or LIX1; optionally, said marker indicative of hindbrain floor plate progenitor cells is selected from any one or any combination of HOXB3, HOXB6, HOXB8, or HOXB9.

6. The method of any one of claims 1 to 5, wherein, Said differentiated cell populations C and D are both in the form of neurospheres, said neurospheres having a core comprising GDF15 positive cells, Optionally, said GDF15 positive cells represent at most about 10% of the total cell number of said neurospheres; Optionally, said neurospheres have an average Feret diameter of about 50 microns to about 5 millimeters, preferably of about 0.1 to about 2 millimeters; Optionally, said neurospheres are independent from each other and / or adhered to form aggregates comprising a plurality of said neurospheres.

7. The method of any one of claims 1 to 6, wherein, Said pluripotent stem cells are selected from embryonic stem cells, induced pluripotent stem cells (iPSCs), parthenogenetic stem cells; Optionally, said pluripotent stem cells are derived from a human, a non-human primate, a rodent, or a companion animal; Optionally, it further comprises using said pluripotent stem cells in the form of a spheroidal agglomerate for said step A; Optionally, said spheroidal agglomerate has an average Feret diameter of about 300 pm or less, preferably of about 25 to about 100 pm; Optionally, said spheroidal agglomerate comprises on average about 5 to about 1000 pluripotent stem cells, preferably about 10 to about 800, more preferably about 20 to about 600, per spheroidal agglomerate.

8. The method of any one of claims 1 to 7, wherein, said differentiated cell population C or said differentiated cell population D, upon transplantation into a host brain, forms a graft with astrocytes clustered in a central portion and dopaminergic neurons distributed throughout the region; optionally, said graft comprises at least about 20% of dopaminergic neurons out of the total cells of the graft; optionally, said graft comprises about 65% or less of astrocytes out of the cells of the central portion of the graft; optionally, said graft comprises less than about 50% of glutamatergic neurons out of the total cells of the graft; optionally, the method further comprises a step of digesting the obtained differentiated cell population C or D into single or oligocells clumps; optionally, it further comprises a step of reaggregating said digested single or oligocells clumps into spheroidal cell aggregates; optionally, said digestion is an enzymatic digestion using a digestion enzyme; said digestion enzyme is preferably selected from GCDR (STEMCELL), ReLeSR (STEMCELL), Accutase (STEMCELL or Gibco), TrypLE Express (Gibco), TrypLE Select (Gibco) or Papain; optionally, said digested cell population is blown into single or oligocells clumps; optionally, said reaggregation is a suspension culture of said single or said oligocells clumps for at least 24 hours, preferably from 24 to 72 hours to form spheroidal cell aggregates; optionally, said spheroidal aggregates have an average Feret diameter of about 300 pm or less, preferably from about 25 to about 100 pm.

9. The method of any one of claims 1 to 8, wherein said at least one inhibitor of BMP signaling is selected from any one of DMH-1, Noggin, LDN193189 or a derivative thereof, or any combination thereof; optionally, said at least one inhibitor of TGF-β1 signaling is selected from any one of SB431542 or A83-01 or a derivative thereof, or any combination thereof; optionally, said at least one activator of Wnt signaling is selected from any one of CHIR99021, WNT1, WNT5A, WNT3A, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, SB-216763, or a combination thereof; optionally, said at least one activator of Sonic hedgehog (SHH) signaling is selected from any one of SAG (N-methyl-N’-(3-pyridinylphenyl)-N’-(3-chlorobenzo[b]thiophene-2-carbonyl)-1,4-diaminocyclohexane), SHH protein or an active fragment thereof, or Purmorphamine, or a combination thereof; optionally, said at least one activator of FGF signaling is selected from any one of FGF8, FGF8a, FGF17, FGF18, FGF8b, FGF2, FGF4, or a combination thereof.

10. The method of any one of claims 1 to 9, wherein, said differentiated cell populations A to D express substantially no or very low levels of TH.

11. The method of any one of claims 1 to 10, comprising: Step A: culturing pluripotent stem cells in suspension for at least 5 days in the presence of a combination of about 0.5 to about 10.0 μΜ DMH-1, about 1.0 to about 10.0 μΜ SB431542, about 0.2 to about 1.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG, wherein the concentration of CHIR99021 is substantially maintained; to obtain a differentiated cell population A; Step B: culturing the differentiated cell population A first in suspension in the presence of a combination of about 0.2 to about 15.0 μΜ CHIR99021 and about 0.1 to about 2.0 μΜ SAG, and then in suspension in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b, to obtain a differentiated cell population B; and Step C: culturing the differentiated cell population B in suspension for at least 5 days in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b, to obtain a differentiated cell population C; optionally, the concentrations of SAG and FGF8b are substantially maintained relative to their concentrations at the end of said Step B; optionally, further comprising Step D: culturing the differentiated cell population C in suspension for at least 5 days in the presence of a combination of about 0.1 to about 1.0 μΜ SAG and about 10 to about 200 ng / ml FGF8b, to obtain a differentiated cell population D; optionally, the concentrations of SAG and FGF8b are lower than their concentrations at the end of said Step C, respectively.

12. The method of any one of claims 1 to 10, comprising: Step A: culturing pluripotent stem cells in suspension for at least 5 days in the presence of a combination of about 0.5 to about 10.0 μΜ DMH-1, about 1.0 to about 10.0 μΜ SB431542, about 0.2 to about 1.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG, wherein the concentration of CHIR99021 is increased after day 4 of Step A; to obtain a differentiated cell population A; Step B: culturing the differentiated cell population A first in suspension in the presence of a combination of about 0.2 to about 15.0 μΜ CHIR99021 and about 0.1 to about 2.0 μΜ SAG, and then in suspension in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b, to obtain a differentiated cell population B; and Step C: culturing the differentiated cell population B in suspension for at least 5 days in the presence of a combination of about 0.1 to about 2.0 μΜ SAG and about 10 to about 500 ng / ml FGF8b, to obtain a differentiated cell population C; optionally, the concentrations of SAG and FGF8b are substantially maintained relative to their concentrations at the end of said Step B; optionally, further comprising Step D: culturing the differentiated cell population C in suspension for at least 5 days in the presence of a combination of about 0.1 to about 1.0 μΜ SAG and about 10 to about 200 ng / ml FGF8b, to obtain a differentiated cell population D; optionally, the concentrations of SAG and FGF8b are lower than their concentrations at the end of said Step C, respectively. Step D: culturing the population of differentiated cells C in suspension for at least 5 days in the presence of about 0.1 to about 1.0 μΜ SAG and about 10 to about 200 ng / ml FGF8b in combination; optionally, the concentrations of SAG and FGF8b are lower than their concentrations at the end of said step C, respectively.

13. A population of cells prepared by the method of any one of claims 1 to 12.

14. A population of cells comprising a subpopulation Al expressing at least one marker indicative of floor plate progenitor cells and a subpopulation A2 expressing at least one marker indicative of neurons and neuroblasts; Optionally, the marker indicative of floor plate progenitor cells is selected from any one of FOXA2, OTX2, SOX2, or any combination thereof; Optionally, the marker indicative of neurons and neuroblasts is selected from any one of NEUROD1, NEUROD4, NEUROG2, or any combination thereof; Optionally, the population of cells further comprises a subpopulation A3 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells; Optionally, the marker indicative of mid-hindbrain isthmus progenitor cells is selected from any one of FGF17, FGF8, S100A11, FOXH1, GBX2, or any combination thereof; optionally, the subpopulation Al comprises about 50.0 to about 99.9% of the total number of cells, the subpopulation A2 comprises about 0.1% to about 10.0% of the total number of cells, and the subpopulation A3 comprises about 0% to about 10.0% of the total number of cells.

15. A population of cells comprising a subpopulation Bl expressing at least one marker indicative of floor plate progenitor cells and a subpopulation B2 expressing at least one marker indicative of neurons and neuroblasts, and any one of a subpopulation B3 positive for GDF15, a subpopulation B4 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or a subpopulation B5 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells; Optionally, the marker indicative of floor plate progenitor cells is selected from any one of FOXA2, OTX2, SOX2, CORIN, or any combination thereof; Optionally, the marker indicative of neurons and neuroblasts is selected from any one of NEUROD1, NEUROD4, NEUROG2, GAP43, or STMN2, or any combination thereof; Optionally, the marker indicative of hindbrain floor plate progenitor cells is selected from PLSCR5 and / or PDE1A; Optionally, the marker indicative of mid-hindbrain isthmus progenitor cells is selected from any one of FGF17, FGF8, S100A11, FOXH1, GBX2, or any combination thereof; optionally, the subpopulation Bl comprises about 50.0 to about 99.9% of the total number of cells, the subpopulation B2 comprises about 0.1% to about 30.0% of the total number of cells, the subpopulation B3 comprises about 0% to about 10.0% of the total number of cells, the subpopulation B4 comprises about 0% to about 10.0% of the total number of cells, and the subpopulation B5 comprises about 0% to about 10.0% of the total number of cells.

16. A cell population comprising a subpopulation C1 expressing at least one marker indicative of midbrain floor plate progenitor cells and a subpopulation C2 expressing at least one marker indicative of neurons and neuroblasts, and any one or any combination of a combination of subpopulation C3 positive for GDF15, subpopulation C4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, subpopulation C5 positive for CD36, subpopulation C6 expressing at least one marker indicative of hindbrain floor plate progenitor cells, or subpopulation C7 expressing at least one marker indicative of mid-hindbrain isthmus progenitor cells; Optionally, the marker indicative of midbrain floor plate progenitor cells is selected from any one or any combination thereof of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, or WNT5A; Optionally, the marker indicative of neurons and neuroblasts is selected from any one or any combination thereof of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2; Optionally, the marker indicative of diencephalic floor plate progenitor cells is selected from any one or any combination thereof of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609; Optionally, the marker indicative of hindbrain floor plate progenitor cells is selected from any one or any combination thereof of HOXB3, HOXB6, HOXB8, or HOXB9; Optionally, the marker indicative of mid-hindbrain isthmus progenitor cells is selected from any one or any combination thereof of FGF17, FGF8, WIF1, KRT7; optionally, the subpopulation C1 comprises about 40.0 to about 99.9% of the total number of cells, the subpopulation C2 comprises about 0.1% to about 10.0% of the total number of cells, the subpopulation C3 comprises about 0% to about 20.0% of the total number of cells, the subpopulation C4 comprises about 0% to about 20.0% of the total number of cells, the subpopulation C5 comprises about 0% to about 10.0% of the total number of cells, the subpopulation C6 comprises about 0% to about 10.0% of the total number of cells, and the subpopulation C7 comprises about 0% to about 10.0% of the total number of cells.

17. A cell population comprising a subpopulation D1 expressing at least one marker indicative of midbrain floor plate progenitor cells and a subpopulation D2 expressing at least one marker indicative of neurons and neuroblasts, and any one or any combination of a combination of subpopulation D3 positive for GDF15, subpopulation D4 expressing at least one marker indicative of diencephalic floor plate progenitor cells, subpopulation D5 positive for CD36, subpopulation D6 expressing at least one marker indicative of floor plate lateral progenitor cells, or subpopulation D7 expressing at least one marker indicative of hindbrain floor plate progenitor cells; Optionally, the marker indicative of midbrain floor plate progenitor cells is selected from any one of EN1, LMX1A, CORIN, PTPRO, COL3A1, KITLG, ADAMTS1, ABCA5, ADAMTS9, TWIST1, or WNT5A, or any combination thereof; Optionally, the marker indicative of neurons and neuroblasts is selected from any one of NEUROD1, NEUROG2, GAP43, STMN4, or STMN2, or any combination thereof; Optionally, the marker indicative of diencephalic floor plate progenitor cells is selected from any one of SIM2, MSX1, BAMBI, GPC3, EGFL6, BARHL1, BARHL2, FAM181B, HOPX, SPRY1, GLIS3, CRH, LYPD1, COL9A1, LINC02609, or any combination thereof; Optionally, the marker indicative of floor plate lateral progenitor cells is selected from any one of SHISA3, NTRK2, PLP1, SOX3, or LIX1, or any combination thereof; Optionally, the marker indicative of hindbrain floor plate progenitor cells is selected from any one of HOXB3, HOXB6, HOXB8, or HOXB9, or any combination thereof; optionally, the subpopulation D1 comprises about 40.0 to about 99.0% of the total number of cells, the subpopulation D2 comprises about 0.1% to about 40.0% of the total number of cells, the subpopulation D3 comprises about 0% to about 30.0% of the total number of cells, the subpopulation D4 comprises about 0% to about 10.0% of the total number of cells, the subpopulation D5 comprises about 0% to about 10.0% of the total number of cells, the subpopulation D6 comprises about 0% to about 10.0% of the total number of cells, and the subpopulation D7 comprises about 0% to about 10.0% of the total number of cells.

18. The cell population of any one of claims 14-17, wherein, The respective subpopulations and / or the ratio of the respective subpopulations to the total number of cells are determined by single cell transcriptome sequencing.

19. The cell population of any one of claims 13 to 18, which expresses substantially no or very low levels of TH.

20. A pharmaceutical composition or a kit comprising the cell population of any one of claims 13 to 18; optionally, the cell population is in the form of single cells or oligocells clumps, or in the form of spheroid cell aggregates re-aggregated from the single cells and / or the oligocells clumps; optionally, the pharmaceutical composition or the kit further comprises a pharmaceutically acceptable excipient; Optionally, the excipient is an injection vehicle; optionally, the injection vehicle is selected from any one of DMEM / F-12 medium, Neurobasal medium, artificial cerebrospinal fluid (ACSF), normal saline, phosphate buffered saline (PBS or DPBS), Hank's balanced salt solution (HBSS), lactated Ringer's injection, or sodium acetate Ringer's injection; Optionally, the vehicle is of pharmaceutical grade or GMP production grade; Optionally, the excipient is an injection vehicle; optionally, the injection vehicle is selected from any one of DMEM / F-12 medium, Neurobasal medium, artificial cerebrospinal fluid (ACSF), normal saline, phosphate buffered saline (PBS or DPBS), Hank's balanced salt solution (HBSS), lactated Ringer's injection, or sodium acetate Ringer's injection; Optionally, the vehicle is of pharmaceutical grade or GMP production grade; Optionally, the pharmaceutical composition or the kit further comprises a supplemental agent selected from any one of human serum albumin (HSA), B-27 supplement, glial derived neurotrophic factor (GDNF), brain derived neurotrophic factor (BDNF), a ROCK inhibitor, a nuclease, or L-ascorbic acid, or any combination thereof; Optionally, the ROCK inhibitor is selected from any one of Y27632, H-1152, fasudil, risuteganib, naftopidil, or bexarotene, or any combination thereof; Optionally, the nuclease is selected from any one of Pulmozyme, DNase I, or Benzonuclease, or any combination thereof.

21. A kit comprising (a) at least one inhibitor of BMP signaling, (b) at least one inhibitor of TGF-β1 signaling, (c) at least one activator of Wnt signaling, (d) at least one activator of Sonic hedgehog (SHH) signaling, and (e) at least one activator of FGF signaling; Optionally, it further comprises (f) instructions for inducing differentiation of stem cells into a population of differentiated cells, said population of differentiated cells being the population of cells of claim 16 or 17.

22. Use of the population of cells of any one of claims 13 to 19 in the manufacture of a medicament for preventing, ameliorating, and / or treating a neurological disorder; Optionally, the neurological disorder is caused by a decrease in the number and / or function of midbrain dopaminergic neurons; Optionally, the neurological disorder is associated with an increase in age or aging; Optionally, the neurological disorder is selected from any one of Parkinson’s disease, Parkinson-plus syndrome, Huntington’s disease, Alzheimer’s disease, or multiple sclerosis, or any combination thereof; Optionally, the neurological disorder is selected from any one of tremor, bradykinesia, flexed posture, postural instability, rigidity, dysphagia, or dementia, or any combination thereof.

23. A method of preventing, ameliorating, or treating a neurological disorder, the method comprising administering to a subject in need thereof an effective amount of the population of cells of any one of claims 13 to 19, or the pharmaceutical composition of any one of claims 18 to 20; Optionally, the neurological disorder is caused by a decrease in the number and / or function of midbrain dopaminergic neurons; Optionally, the neurological disorder is associated with an increase in age or aging; Optionally, the neurological disorder is selected from any one of Parkinson’s disease, Parkinson-plus syndrome, Huntington’s disease, Alzheimer’s disease, or multiple sclerosis, or any combination thereof; Optionally, the neurological disorder is selected from any one of tremor, bradykinesia, flexed posture, postural instability, rigidity, dysphagia, or dementia, or any combination thereof.

24. A method of using the cell population of any one of claims 13 to 19 to establish an in vitro model for identifying, screening and / or validating drug candidates having prophylactic, ameliorating or therapeutic activity on a nervous system disorder.

25. A differentiation medium for pluripotent stem cells, comprising: (a1) about 0.5 to about 10.0 μΜ DMH-1, about 1.0 to about 10.0 μΜ SB431542, about 0.2 to about 1.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG; (a2) about 0.5 to about 10.0 μΜ DMH-1, about 1.0 to about 10.0 μΜ SB431542, about 1.0 to about 15.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG; (b1) about 0.2 to about 15.0 μΜ CHIR99021, and about 0.1 to about 2.0 μΜ SAG; (b2) about 0.1 to about 2.0 μΜ SAG, and about 10 to about 500 ng / ml FGF8b; or (d) about 0.1 to about 1.0 μΜ SAG, and about 10 to about 200 ng / ml FGF8b; optionally, further comprising DMEM / F-12 supplemented with 1x MEM non-essential amino acids and 1x N2 supplement.

Citation Information

Patent Citations

  • Method for differentiating pluripotent stem cells into midbrain black matter dopaminergic nerve cells

    CN114292814A

  • Method for producing and separating midbrain dopaminergic neurons

    CN114650836A

  • Methods of producing midbrain dopaminergic neurons, midbrain neurons and uses thereof

    CN115768875A

  • Methods of in vitro differentiation of midbrain dopamine (MDA) neurons

    US20180094242A1