Methods of cell selection

Abstract

The present invention is directed to a system of polynucleotides, as well as a method of using same, such as for determining the presence of a nucleic acid analyte in a cell.

Description

METHODS OF CELL SELECTIONREFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0001] The contents of the electronic sequence listing (EGG-P-011 -PCT. xml; size: 11,290 bytes; and date of creation: June 3, 2025) is herein incorporated by reference in its entirety.CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority of IL Patent Application No. 313316, entitled “METHODS OF CELL SELECTION”, filed June 4, 2024, the contents of which are incorporated herein by reference in their entirety.FIELD OF INVENTION

[0003] The present invention is in the field of molecular and cellular biology, and specifically is directed to, inter alia, a system of polynucleotides, and use thereof, such as for determining the presence of a nucleic acid analyte in a cell.BACKGROUND OF THE INVENTION

[0004] In both research and diagnostics, the identification and enrichment of specific subpopulations within heterogeneous cell samples are often required. Common approaches rely on protein-protein interactions facilitated by specific antibodies, with flow cytometry enabling cell sorting when antibodies are fluorophore-conjugated. However, limitations arise when targeting proteins lacking a unique structure, rendering them non-targetable by antibodies. Additionally, for intracellular proteins, the necessity of cell fixation and permeabilization hinders sequential cell growth postsorting. The constraints extend to in-situ hybridization (ISH) for specific RNA sequence identification, as cell fixation in this process impedes subsequent cell growth.

[0005] There is still a great need for systems and methods providing enhanced precision for both cell sorting and genetic analysis purposes.SUMMARY OF THE INVENTION

[0006] According to the first aspect, there is provided a system comprising: (a) a first polynucleotide comprising: a first nucleic acid sequence being complementary to a first portion of a nucleic acid analyte; a second nucleic acid sequence being complementary to a third nucleic acid sequence of asecond polynucleotide; a third nucleic acid sequence comprising a first portion of a ribozyme catalytic core, wherein the first portion is catalytically inactive; and a fourth nucleic acid sequence being complementary to a first portion of a third polynucleotide; wherein the first, second, third, and fourth nucleic acid sequences of the first polynucleotide are contiguous; (b) a second polynucleotide comprising: a first nucleic acid sequence being complementary to a second portion of the third polynucleotide; a second nucleic acid sequence comprising a second portion of the ribozyme catalytic core, wherein the second portion is catalytically inactive, and wherein the first portion and the second portion of the ribozyme catalytic core form an active ribozyme catalytic core when the first polynucleotide and the second polynucleotide hybridize to the nucleic acid analyte; a third nucleic acid sequence being complementary to the second nucleic acid sequence of the first polynucleotide; and a fourth nucleic acid sequence being complementary to a second portion of the nucleic acid analyte; wherein the first, second, third, and fourth nucleic acid sequences of the second polynucleotide are contiguous; and (c) a third polynucleotide comprising: the first portion being complementary to the fourth nucleic acid sequence of the first polynucleotide; the second portion being complementary to the first nucleic acid sequence of the second polynucleotide; and wherein the third polynucleotide is cleaved by the active ribozyme catalytic core, wherein a presence of the nucleic acid analyte in a sample is determined by detection of a signal generated by cleavage of the third polynucleotide by the active ribozyme catalytic core.

[0007] According to another aspect, there is provided a cell comprising the system of the invention.

[0008] According to another aspect, there is provided a method for determining the presence of a nucleic acid analyte in a cell, the method comprising contacting the cell with an effective amount of the system of the invention, and determining whether a signal is generated by the cleavage of the third polynucleotide by the active ribozyme catalytic core, wherein a detected signal is indicative of the third polynucleotide being cleaved by the active ribozyme catalytic core, thereby determining the presence of the nucleic acid analyte in the cell.

[0009] According to another aspect, there is provided a composition comprising the at least one cell sub-population comprising the nucleic acid analyte, separated or isolated according to the method of the invention.

[0010] In some embodiments, the active ribozyme catalytic core cleaves the third polynucleotide in a position located between the first portion and the second portion of the third polynucleotide.

[0011] In some embodiments, the nucleic acid analyte is a DNA molecule, RNA molecule, or a hybrid thereof.

[0012] In some embodiments, the nucleic acid analyte is a gene of interest or a transcript thereof.

[0013] In some embodiments, any one of: the first nucleic acid sequence of the first polynucleotide, the fourth nucleic acid of the second polynucleotide, and both, is of 15 to 30 nucleotides.

[0014] In some embodiments, any one of: the first nucleic acid sequence of the first polynucleotide, the fourth nucleic acid of the second polynucleotide, and both, is characterized by a GC content of 45-70%.

[0015] In some embodiments, the any one of: the second nucleic acid sequence of the first polynucleotide, the third nucleic acid of the second polynucleotide, and both, is of 3 to 10 nucleotides.

[0016] In some embodiments, any one of: the second nucleic acid sequence of the first polynucleotide, the third nucleic acid of the second polynucleotide, and both, is characterized by a GC content of 30-60%.

[0017] In some embodiments, any one of: the fourth nucleic acid sequence of the first polynucleotide, the first nucleic acid of the second polynucleotide, and both, is of 5 to 13 nucleotides.

[0018] In some embodiments, any one of: the fourth nucleic acid sequence of the first polynucleotide, the first nucleic acid of the second polynucleotide, and both, is characterized by a GC content of 40- 60%.

[0019] In some embodiments, the first portion of the ribozyme catalytic core comprises any one of: CGGTCGAAA (SEQ ID NO: 1) and CACCCATGT (SEQ ID NO: 2).

[0020] In some embodiments, the second portion of the ribozyme catalytic core comprises any one of: TCCGAGC (SEQ ID NO: 3) and AGCGAT (SEQ ID NO: 4).

[0021] In some embodiments, any one of the first polynucleotide, the second polynucleotide, and both, consists of DNA.

[0022] In some embodiments, the third polynucleotide comprises at least one RNA nucleotide.

[0023] In some embodiments, the at least one RNA nucleotide is located between the first portion and the second portion of the third polynucleotide.

[0024] In some embodiments, the detection is based on fluorescence, chemiluminescence, or nucleic acid amplification.

[0025] In some embodiments, the signal comprises a fluorescent signal.

[0026] In some embodiments, the third polynucleotide further comprises a quenched fluorophore and a quencher.

[0027] In some embodiments, the third polynucleotide further comprises a first flanking nucleic acid sequence and a second flanking nucleic acid sequence, wherein the first flanking nucleic acid sequence flanks the first portion of the third polynucleotide and the second flanking nucleic acid sequence flanks the second portion of the third polynucleotide.

[0028] In some embodiments, any one of: the first flanking nucleic acid sequence, the second flanking nucleic acid sequence, and both, is of 20 to 30 nucleotides.

[0029] In some embodiments, any one of: the first flanking nucleic acid sequence, the second flanking nucleic acid sequence, and both, is characterized by a GC content of 50-60%.

[0030] In some embodiments, the system further comprises a pair of primers capable of amplifying the third polynucleotide.

[0031] In some embodiments, a first primer of the pair of primers is complementary to the first flanking nucleic acid sequence of the third polynucleotide and a second primer of the pair of primers is complementary to the second flanking nucleic acid sequence of the third polynucleotide.

[0032] In some embodiments, the cell is any one of: a wildtype cell, a naive cell, a transfected cell, a transformed cell, a genomically modified cell, and any combination thereof.

[0033] In some embodiments, the cell is a prokaryote cell or a eukaryote cell.

[0034] In some embodiments, the cell is derived from a subject.

[0035] In some embodiments, no detected signal is indicative of the third polynucleotide not being cleaved by the active ribozyme catalytic core, thereby determining the absence of the nucleic acid analyte in the cell.

[0036] In some embodiments, the determining is in a sample comprising the cell.

[0037] In some embodiments, the determining is based on fluorescence, chemiluminescence, or nucleic acid amplification.

[0038] In some embodiments, the cell is a heterogenous cell population comprising a plurality of cell sub-populations.

[0039] In some embodiments, at least one cell sub-population of the heterogenous population comprises the nucleic acid analyte and at least one cell sub-population of the heterogenous population is devoid of the nucleic acid analyte.

[0040] In some embodiments, the method further comprises separating or isolating the at least one cell sub-population comprising the nucleic acid analyte from the at least one cell sub-population being devoid of the nucleic acid analyte.

[0041] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0042] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. Inaddition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0043] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Fig. 1 includes a non-limiting scheme of the system of the invention. 1 - a first polynucleotide according to the system of the invention; 2 - a second polynucleotide according to the system of the invention; 3 - a third polynucleotide according to the system of the invention; 4 - a quencher; 5 - a quenched fluorophore; 6 - a nucleic acid analyte; and 7 - a luminescent fluorophore. Scissors schematically indicate a cleavage site in the third polynucleotide (3), to be cleaved by an active ribozyme catalytic core formed by the first polynucleotide (1) and the second polynucleotide (2).

[0045] Fig. 2 includes a non-limiting scheme of the system of the invention, la - a first nucleic acid sequence of the first polynucleotide according to the system of the invention; lb - a second nucleic acid sequence of the first polynucleotide according to the system of the invention; 1c - a third nucleic acid sequence of the first polynucleotide according to the system of the invention; Id - a fourth nucleic acid sequence of the first polynucleotide according to the system of the invention; 2a - a first nucleic acid sequence of the second polynucleotide according to the system of the invention; 2b - a second nucleic acid sequence of the second polynucleotide according to the system of the invention; 2c - a third nucleic acid sequence of the second polynucleotide according to the system of the invention; 2d - a fourth nucleic acid sequence of the second polynucleotide according to the system of the invention; 3a - a first portion of the third polynucleotide according to the system of the invention; 3b - a second portion of the third polynucleotide according to the system of the invention; 4 - a quencher; and 5 - a quenched fluorophore.

[0046] Fig. 3 includes a vertical bar graph showing proof-of-concept for sensing DsRed incorporation in chicken DF1 cells. ***: p-value < 0.001 ; N.S.: Non-significant.DETAILED DESCRIPTION

[0047] The present invention, in some embodiments, provides a system of polynucleotides, cells and compositions comprising same. Further provided is a method for determining the presence of a nucleic acid analyte in a cell.System

[0048] According to the first aspect, there is provided a system comprising: a first polynucleotide, a second polynucleotide, and a third polynucleotide.

[0049] In some embodiments, the first polynucleotide comprises a plurality of nucleic acid sequences. In some embodiments, the first polynucleotide comprises a first nucleic acid sequence, second nucleic acid sequence, a third nucleic acid sequence, a fourth nucleic acid sequence, or any combination thereof.

[0050] In some embodiments, the first nucleic acid sequence is complementary to a first portion of a nucleic acid analyte. In some embodiments, the second nucleic acid sequence is complementary to a third nucleic acid sequence of a second polynucleotide. In some embodiments, the third nucleic acid sequence comprises a first portion of a ribozyme catalytic core. In some embodiments, the first portion is catalytically inactive. In some embodiments, the fourth nucleic acid sequence is complementary to a first portion of a third polynucleotide.

[0051] In some embodiments, the first, second, third, and fourth nucleic acid sequences of the first polynucleotide are contiguous. In some embodiments, contiguous is from the 3’ end of the first polynucleotide to the 5’ end of the first polynucleotide. In some embodiments, the 5’ end to 3’ order (5’ ->3’) of the nucleic acid sequences of the first polynucleotide is: the fourth nucleic acid sequence, the third nucleic acid sequence, the second nucleic acid sequence, and the first nucleic acid sequence.

[0052] In some embodiments, the first polynucleotide is as depicted in Fig. 2. In some embodiments, the first polynucleotide according to Fig. 2 comprises a first nucleic acid sequence (la), second nucleic acid sequence (lb), a third nucleic acid sequence (1c), and a fourth nucleic acid sequence (Id).

[0053] In some embodiments, the second polynucleotide comprises a plurality of nucleic acid sequences. In some embodiments, the second polynucleotide comprises a first nucleic acid sequence, second nucleic acid sequence, a third nucleic acid sequence, a fourth nucleic acid sequence, or any combination thereof.

[0054] In some embodiments, the first nucleic acid sequence is complementary to a second portion of the third polynucleotide. In some embodiments, the second nucleic acid sequence comprises a second portion of the ribozyme catalytic core. In some embodiments, the third nucleic acid sequenceis complementary to the second nucleic acid sequence of the first polynucleotide. In some embodiments, the fourth nucleic acid sequence is complementary to a second portion of the nucleic acid analyte.

[0055] In some embodiments, the second portion is catalytically inactive. In some embodiments, the first portion and the second portion of the ribozyme catalytic core form an active ribozyme catalytic core. In some embodiments, the active ribozyme catalytic core is formed when the first polynucleotide and the second polynucleotide hybridize. In some embodiments, the active ribozyme catalytic core is formed when the first polynucleotide and the second polynucleotide hybridize to the nucleic acid analyte. In some embodiments, the active ribozyme catalytic core is formed when the first polynucleotide and the second polynucleotide hybridize to one another and to the nucleic acid analyte.

[0056] In some embodiments, the first, second, third, and fourth nucleic acid sequences of the second polynucleotide are contiguous. In some embodiments, contiguous is from the 5’ end of the second polynucleotide to the 3’ end of the second polynucleotide.

[0057] In some embodiments, the 5’ end to 3’ order (5’ ->3’) of the nucleic acid sequences of the second polynucleotide is: the fourth nucleic acid sequence, the third nucleic acid sequence, the second nucleic acid sequence, and the first nucleic acid sequence.

[0058] In some embodiments, the second polynucleotide is as depicted in Fig. 2. In some embodiments, the second polynucleotide according to Fig. 2 comprises a first nucleic acid sequence (2a), second nucleic acid sequence (2b), a third nucleic acid sequence (2c), and a fourth nucleic acid sequence (2d).

[0059] In some embodiments, the third polynucleotide comprises a first portion being complementary to the fourth nucleic acid sequence of the first polynucleotide. In some embodiments, the third polynucleotide comprises a second portion being complementary to the first nucleic acid sequence of the second polynucleotide. In some embodiments, the third polynucleotide is cleaved by the active ribozyme catalytic core.

[0060] In some embodiments, the third polynucleotide comprises a first nucleic acid sequence and a second nucleic acid sequence, wherein the first nucleic acid sequence is complementary to the second nucleic acid sequence. In some embodiments, the first nucleic acid sequence is located in the 5' end of the third polynucleotide and the second nucleic acid sequence is located in the 3' end of the third polynucleotide. In some embodiments, the first nucleic acid sequence is located in the 3' end of the third polynucleotide and the second nucleic acid sequence is located in the 5' end of the third polynucleotide.

[0061] In some embodiments, the third polynucleotide is as depicted in Fig. 2. In some embodiments, the third polynucleotide according to Fig. 2 comprises a first portion (3a), and second portion (3b).

[0062] In some embodiments, a presence of the nucleic acid analyte in a sample is determined by detection of a signal generated by cleavage of the third polynucleotide by the active ribozyme catalytic core. In some embodiments, a signal generated by cleavage of the third polynucleotide by the active ribozyme catalytic core is indicative of the presence of the nucleic acid analyte in a sample. In some embodiments, lack of and / or no signal (normally) generated by cleavage of the third polynucleotide by the active ribozyme catalytic core is indicative of the absence of the nucleic acid analyte in a sample. In some embodiments, the absence of a signal normally generated by cleavage of the third polynucleotide by the active ribozyme catalytic core is indicative of the absence of the nucleic acid analyte in a sample. In some embodiments, the absence of the nucleic acid analyte in a sample is characterized by no signal generated by cleavage of the third polynucleotide by the active ribozyme catalytic core. In some embodiments, in the absence of the nucleic acid analyte in a sample the active ribozyme catalytic core is not formed, a signal is not generated, or both. In some embodiments, in the absence of the nucleic acid analyte in a sample the first polynucleotide and the second polynucleotide do not hybridize. In some embodiments, in the absence of the nucleic acid analyte in a sample the second nucleic acid sequence of the first polynucleotide and the third nucleic acid sequence of the second polynucleotide do not hybridize.

[0063] In some embodiments the active ribozyme catalytic core cleaves the third polynucleotide. In some embodiments, the active ribozyme catalytic core cleaves the third polynucleotide in a position located between the first portion and the second portions of the third polynucleotide.

[0064] In some embodiments, the nucleic acid analyte is a DNA molecule, RNA molecule, or a hybrid thereof. In some embodiments, the nucleic acid analyte comprises at least one DNA nucleobase or nucleotide, at least one RNA nucleobase or nucleotide, or a hybrid or a combination thereof.

[0065] In some embodiments, the nucleic acid analyte comprises a gene of interest or a transcript thereof.

[0066] As used herein, the term “gene of interest” refers to any gene (or transcript thereof) of importance or need of detection for a skilled artisan. In some embodiments, a gene of interest can be a disease-causing gene (or mutation therein), a wild type gene, an aberrant gene (inversion, deletion, insertion). In some embodiments, the gene of interest is a coding or non-coding gene. In some embodiments, the gene of interest is encoding a structural protein or an enzyme. In some embodiments, the gene of interest comprises a viral gene. In some embodiments, the gene of interest comprises a foreign gene (such as to be determined in a sample comprising a host cell). In someembodiments, the gene of interest is located in a plasmid, the expression of which is being driven from a plasmid, or both.

[0067] In some embodiments, the first nucleic acid sequence of the first polynucleotide, the fourth nucleic acid of the second polynucleotide, or both, is of 15 to 20 nucleotides, 15 to 25 nucleotides, 15 to 30 nucleotides, 20 to 25 nucleotides, 20 to 30 nucleotides, or 25 to 30 nucleotides. Each possibility represents a separate embodiment of the invention.

[0068] In some embodiments, the first nucleic acid sequence of the first polynucleotide, the fourth nucleic acid of the second polynucleotide, or both, is characterized by a guanine to cytosine (GC) content of 45-70%, 50-70%, 55-70%, 60-70%, 65-70%, 45-65%, 50-65%, 55-65%, 60-65%, 45- 60%, 50-60%, 55-60%, 45-55%, or 50-55%. Each possibility represents a separate embodiment of the invention.

[0069] In some embodiments, the second nucleic acid sequence of the first polynucleotide, the third nucleic acid of the second polynucleotide, or both, is of 3 to 10 nucleotides, 4 to 10 nucleotides, 5 to 10 nucleotides, 6 to 10 nucleotides, 7 to 10 nucleotides, 8 to 10 nucleotides, 9 to 10 nucleotides, 3 to 9 nucleotides, 4 to 9 nucleotides, 5 to 9 nucleotides, 6 to 9 nucleotides, 7 to 9 nucleotides, 8 to 9 nucleotides, 3 to 8 nucleotides, 4 to 8 nucleotides, 5 to 8 nucleotides, 6 to 8 nucleotides, or 7 to 8 nucleotides. Each possibility represents a separate embodiment of the invention.

[0070] In some embodiments, the second nucleic acid sequence of the first polynucleotide, the third nucleic acid of the second polynucleotide, and both, is characterized by a GC content of 30-60%, 35- 60%, 40-60%, 45-60%, 50-60%, 55-60%, 30-55%, 40-55%, 35-50%, 40-50%, or 35-55%. Each possibility represents a separate embodiment of the invention.

[0071] In some embodiments, the fourth nucleic acid sequence of the first polynucleotide, the first nucleic acid of the second polynucleotide, or both, is of 5 to 13 nucleotides, 6 to 13 nucleotides, 7 to 13 nucleotides, 8 to 13 nucleotides, 9 to 13 nucleotides, 10 to 13 nucleotides, 11 to 13 nucleotides, 12 to 13 nucleotides, 6 to 11 nucleotides, 6 to 12 nucleotides, 5 to 8 nucleotides, 5 to 9 nucleotides, 5 to 10 nucleotides, or 7 to 9 nucleotides. Each possibility represents a separate embodiment of the invention.

[0072] In some embodiments, the fourth nucleic acid sequence of the first polynucleotide, the first nucleic acid of the second polynucleotide, or both, is characterized by a GC content of 40-60%, 45- 60%, 50-60%, 55-60%, 40-55%, 45-55%, 50-55%, 40-50%, or 45-50%. Each possibility represents a separate embodiment of the invention.

[0073] In some embodiments, the first portion of the ribozyme catalytic core comprises the nucleic acid sequence CGGTCGAAA (SEQ ID NO: 1). In some embodiments, the first portion of the ribozyme catalytic core comprises the nucleic acid sequence CACCCATGT (SEQ ID NO: 2).

[0074] In some embodiments, the second portion of the ribozyme catalytic core comprises the nucleic acid sequence TCCGAGC (SEQ ID NO: 3). In some embodiments, the second portion of the ribozyme catalytic core comprises the nucleic acid sequence AGCGAT (SEQ ID NO: 4).

[0075] In some embodiments, the first polynucleotide, the second nucleotide, or both, consists of DNA.

[0076] In some embodiments, the third polynucleotide comprises at least one RNA nucleobase or nucleotide. In some embodiments, the third polynucleotide comprises a plurality of RNA nucleobases or nucleotides. In some embodiments, the at least one RNA nucleobase or nucleotide is located between the first portion and the second portion of the third polynucleotide. In some embodiments, the plurality of RNA nucleobases or nucleotides is located between the first portion and the second portion of the third polynucleotide.

[0077] As used herein, the term “plurality” refers to any integer being equal to or greater than 2.

[0078] In some embodiments, detection is based on fluorescence, chemiluminescence, or nucleic acid amplification.

[0079] In some embodiments, the signal comprises or is a fluorescent signal. In some embodiments, the third polynucleotide further comprises a quenched fluorophore. In some embodiments, the third polynucleotide further comprises a quencher. In some embodiments, the third polynucleotide further comprises a quenched fluorophore and a quencher. In some embodiments, the quencher is bound to the first or second nucleic acid sequence of the third polynucleotide, and the quenched fluorophore is bound to the second or first nucleic acid sequence of the third polynucleotide, respectively.

[0080] In some embodiments, the third polynucleotide further comprises a first flanking nucleic acid sequence and a second flanking nucleic acid sequence. In some embodiments, the first flanking nucleic acid sequence flanks the first portion of the third polynucleotide and the second flanking nucleic acid sequence flanks the second portion of the third polynucleotide. In some embodiments, the first flanking nucleic acid sequence is located at the utmost 5’ end of the third polynucleotide. In some embodiments, the second flanking nucleic acid sequence is located at the utmost 5’ end of the third polynucleotide. In some embodiments, the first flanking nucleic acid sequence is located at the utmost 3’ end of the third polynucleotide. In some embodiments, the second flanking nucleic acid sequence is located at the utmost 3’ end of the third polynucleotide.

[0081] In some embodiments, the first flanking nucleic acid sequence, the second flanking nucleic acid sequence, or both, is of 20 to 30 nucleotides, 22 to 30 nucleotides, 25 to 30 nucleotides, 27 to 30 nucleotides, 20 to 28 nucleotides, 20 to 27 nucleotides, 20 to 25 nucleotides, 23 to 30 nucleotides, 23 to 27 nucleotides, 24 to 28 nucleotides, or 25 to 28 nucleotides. Each possibility represents a separate embodiment of the invention.

[0082] In some embodiments, the first flanking nucleic acid sequence, the second flanking nucleic acid sequence, or both, is characterized by a GC content of 50-60%, 52-60%, 55-60%, 57-60%, 50- 57%, 53-57%, 52-58%, 53-59%, or 51-56%. Each possibility represents a separate embodiment of the invention.

[0083] In some embodiments, the system further comprises a pair of primers capable of amplifying the third polynucleotide. In some embodiments, the pair of primers are capable of amplifying the third polynucleotide by hybridizing to the first and second flanking nucleic acid sequences of the third polynucleotide.

[0084] In some embodiments, a first primer of the pair of primers is complementary to the first flanking nucleic acid sequence of the third polynucleotide and a second primer of a pair of primers is complementary to the second flanking nucleic acid sequence of the third polynucleotide.

[0085] In some embodiments, a first primer of the pair of primers is complementary to the first flanking nucleic acid sequence of the third polynucleotide and a second primer of a pair of primers is hybridizing to the second flanking nucleic acid sequence of the third polynucleotide.

[0086] In some embodiments, a first primer of the pair of primers is hybridizing to the first flanking nucleic acid sequence of the third polynucleotide and a second primer of a pair of primers is complementary to the second flanking nucleic acid sequence of the third polynucleotide.

[0087] In some embodiments, complementary comprises reverse and complementary.

[0088] As used herein, the terms hybridizing and complementary are interchangeable and refer to the ability of nucleic acid sequences, e.g., single stranded nucleic acid sequences to bind to one another via formation of hydrogen bonds between complementing nucleotides, e.g., A and T / U, and G and C.

[0089] In some embodiments, complementarity ranges between 75 to 100%, 80 to 100%, 85 to 100%, 90 to 100%, 95 to 100%, or 97 to 100%. Each possibility represents a separate embodiment of the invention.

[0090] In some embodiments, the polynucleotide(s) of the system of the invention is an artificial polynucleotide. In some embodiments, there is provided an artificial DNA molecule comprising any one of the polynucleotides of the system of the invention.

[0091] In some embodiments, the artificial DNA molecule comprises or is an artificial vector.Cells and compositions

[0092] According to another aspect, there is provided a cell comprising the system of the invention.

[0093] In some embodiments, the cell is a prokaryote cell. In some embodiments, the cell is a eukaryote cell.

[0094] In some embodiments, the cell comprises a wildtype cell, a naive cell, a transfected cell, a transformed cell, a genomically modified cell, an infected cell, or any combination thereof. In some embodiments, the cell is a cell of a subject. In some embodiments, the cell is obtained or derived from a subject. In some embodiments, a cell comprises a plurality of cells. In some embodiments, the cell is a cell of a biopsy obtained or derived from a subject. In some embodiments, the cell is in the form of a biological sample obtained or derived from a subject, comprising at least one cell of the subject.

[0095] According to another aspect, there is provided a composition comprising the system of the invention. In some embodiments, there is provided a composition comprising the system of the invention and at least one cell. In some embodiments, there is provided a composition comprising at least one cell comprising the system of the invention.

[0096] In some embodiments, the composition further comprises an acceptable carrier.Methods of use

[0097] According to another aspect, there is provided a method for determining the presence of a nucleic acid analyte in a cell. In some embodiments, the cell is in a sample. In some embodiments, the method is an in vitro or ex vivo method.

[0098] In some embodiments, the method comprises contacting a cell with an effective amount of the system of the invention. In some embodiments, the method comprises determining whether a signal is detected by the cleavage of the third polynucleotide by the active ribozyme catalytic core. In some embodiments, the determining comprises determining whether a detectable signal is emitted by the cleavage of the third polynucleotide by the active ribozyme catalytic core.

[0099] In some embodiments, determining the presence comprises determining the amount or abundance of nucleic acid analyte in a cell. In some embodiments, determining the presence comprises quantifying the amount or abundance of nucleic acid analyte in a cell. In some embodiments, the quantifying is by an amplification methodology, such as, but not limited to quantitative PCR (qPCR).

[0100] In some embodiments, the determining is in or of the contacted cell.

[0101] In some embodiments, a detected signal is indicative of the third polynucleotide being cleaved by the active ribozyme catalytic core. In some embodiments, a detected signal is indicative of the presence of the nucleic acid analyte in the cell.

[0102] In some embodiments, no detected signal or no signal is indicative of the third polynucleotide not being cleaved by the active ribozyme catalytic core. In some embodiments, no detected signal or no signal is indicative of the absence of the nucleic acid analyte in the cell.

[0103] In some embodiments, the determining is in a sample comprising the cell.

[0104] In some embodiments, the determining is based on fluorescence, chemiluminescence, or nucleic acid amplification.

[0105] Methods and means for fluorescence, chemiluminescence, and nucleic acid amplification, are common and would be apparent to one of ordinary skill in the art. Non-limiting examples of which include, but are not limited to, fluorescent / chemiluminescent microscopy, PCR, RT-PCR, quantitative RT-PCR, densitometry, to name a few, some which are exemplified herein.

[0106] In some embodiments, the cell comprises a heterogenous cell population. In some embodiments, a heterogenous cell population comprises a plurality of cell sub-populations.

[0107] In some embodiments, at least one cell sub -population of a heterogenous population comprises the nucleic acid analyte. In some embodiments, at least one cell sub-population of a heterogenous population is devoid of the nucleic acid analyte.

[0108] In some embodiments, the method further comprises separating or isolating the at least one cell sub-population comprising the nucleic acid analyte from the at least one cell sub-population being devoid of the nucleic acid analyte.

[0109] Methods and means for cell sorting or separation are common and would be apparent to one of ordinary skill in the art. Non-limiting example for such a method of cell sorting includes, but is not limited to, fluorescence-activated cell sorting (FACS).

[0110] According to another aspect, there is provided a composition comprising the at least one cell sub-population comprising the nucleic acid analyte. In some embodiments, the at least one cell subpopulation comprising the nucleic acid analyte is obtained by separation or isolation from the at least one cell sub-population of a heterogenous population being devoid of the nucleic acid analyte according to the method of the invention. According to another aspect, there is provided a composition comprising the at least one cell sub -population comprising the nucleic acid analyte obtained according to the method of the invention.

[0111] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition is a pharmaceutical composition.

[0112] As used herein, the term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodiumstearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents such as acetates, citrates or phosphates. Antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; and agents for the adjustment of tonicity such as sodium chloride or dextrose are also envisioned. The carrier may comprise, in total, from about 0.1% to about 99.99999% by weight of the pharmaceutical compositions presented herein.

[0113] As used herein, the term "pharmaceutically acceptable" means suitable for administration to a subject, e.g., a human. For example, the term "pharmaceutically acceptable" can mean approved by a regulatory agency of the Federal or a state government or listed in the U. S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.Kit

[0114] According to another aspect, there is provided a kit comprising a first polynucleotide, a second polynucleotide, and a third polynucleotide, as disclosed herein.

[0115] In some embodiments, the first polynucleotide comprises a first nucleic acid sequence being complementary to a first portion of a nucleic acid analyte; a second nucleic acid sequence being complementary to a third nucleic acid sequence of a second polynucleotide; a third nucleic acid sequence comprising a first portion of a ribozyme catalytic core, wherein the first portion is catalytically inactive; and a fourth nucleic acid sequence being complementary to a first portion of a third polynucleotide, wherein the first, second, third, and fourth nucleic acid sequences of the first polynucleotide are contiguous.

[0116] In some embodiments, the second polynucleotide comprises a first nucleic acid sequence being complementary to a second portion of a third polynucleotide; a second nucleic acid sequence comprising a second portion of a ribozyme catalytic core, wherein the second portion is catalytically inactive, and wherein the first portion and the second portion of the ribozyme catalytic core form an active ribozyme catalytic core when the first polynucleotide and the second polynucleotide hybridize to a nucleic acid analyte; a third nucleic acid sequence being complementary to the second nucleic acid sequence of the first polynucleotide; and a fourth nucleic acid sequence being complementary to a second portion of the nucleic acid analyte.

[0117] In some embodiments, the third polynucleotide comprises a first portion being complementary to the fourth nucleic acid sequence of the first polynucleotide; a second portion being complementary to the first nucleic acid sequence of the second polynucleotide; and wherein the third polynucleotide is cleaved or capable of being cleaved by the active ribozyme catalytic core.

[0118] In some embodiments, the kit further comprises instructions for preparing the system of the invention, comprising mixing the first, second, and third polynucleotides. In some embodiments, the instructions further comprise instruction for determining the presence of a nucleic acid analyte in a cell, the instructions comprise contacting the cell with an effective amount of the system prepared according to the kit of the invention.

[0119] In some embodiments, the kit is for preparing the system of the invention. In some embodiments, the kit is for determining the presence of a nucleic acid analyte in a cell.

[0120] In some embodiments, the kit further comprises a cell (or a sample comprising same).

[0121] According to another aspect, there is provided a method for preparing the system of the invention. In some embodiments, the method comprises synthesizing the first, second, and third polynucleotides disclosed herein. In some embodiments, the method further comprising conjugating a fluorophore, a quencher, or both to the third polynucleotide. In some embodiments, conjugating is directly or indirectly conjugating. In some embodiments, indirectly conjugating comprises synthesizing the third polynucleotide from a plurality of nucleotides, at least one of which comprising a fluorophore, at least one of which comprising a quencher, or both. In some embodiments, directly conjugating comprises synthesizing the third polynucleotide and conjugating a fluorophore, a quencher, or both, to the synthesizing third polynucleotide.General

[0122] The term "subject" as used herein refers to an animal, more particularly to non-human mammals and human organism. Non-human animal subjects may also include prenatal forms of animals, such as, e.g., embryos or fetuses. Non-limiting examples of non-human animals include: horse, cow, camel, goat, sheep, dog, cat, non-human primate, mouse, rat, rabbit, hamster, guinea pig, pig. In one embodiment, the subject is a human. Human subjects may also include fetuses. In one embodiment, a subject in need thereof is a subject afflicted with and / or at risk of being afflicted with a condition associated with increased cell proliferation, deubiquitination activity, or combination thereof.

[0123] Any concentration ranges, percentage range, or ratio range recited herein are to be understood to include concentrations, percentages or ratios of any integer within that range and fractions thereof, such as one tenth and one hundredth of an integer, unless otherwise indicated.

[0124] Any number range recited herein relating to any physical feature, such as polymer subunits, size or thickness, are to be understood to include any integer within the recited range, unless otherwise indicated.

[0125] As used herein, the terms “subject” or “individual” or “animal” or “patient” or “mammal,” refers to any subject, particularly a mammalian subject, for whom therapy is desired, for example, a human.

[0126] In the discussion unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conj oins.

[0127] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a”, “an” and “at least one” are used interchangeably in this application.

[0128] The descriptions of the various embodiments of the present invention have been presented for purposes of illustration but are not intended to be exhaustive or limited to the embodiments disclosed. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The terminology used herein was chosen to best explain the principles of the embodiments, the practical application or technical improvement over technologies found in the marketplace, or to enable others of ordinary skill in the art to understand the embodiments disclosed herein.

[0129] In the discussion unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conj oins.

[0130] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise.

[0131] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about”. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims areapproximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0132] In the description and claims of the present application, each of the verbs, “comprise”, “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb. Other terms as used herein are meant to be defined by their well-known meanings in the art.

[0133] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0134] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated herein above and as claimed in the claims section below finds experimental support in the following examples.EXAMPLES

[0135] Generally, the nomenclature used herein, and the laboratory procedures utilized in the present invention include molecular, biochemical, bioengineering, bioprocessing, microbiological, and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manualof Basic Technique" by Freshney, Wiley -Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); Molecular Cell Biology Berk A. et al. 8thedition; Molecular Biotechnology : Principles and Applications of Recombinant DN, Glick BR. 5thedition; Culture of Animal Cells : A Manual of Basic Technique and Specialized Applications Freshney IR, 7thedition;; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); “Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference. Other general references are provided throughout this document.Materials and MethodsSequences

[0136] All sequences are from 5’ to 3’.

[0137] DNA bases are capitalized, RNA bases are in lowercase.

[0138] Catalytic core sequences are bolded.

[0139] For each RNA two catalytic cores were tested - 17E or Org.DsRedExpress

[0140] HDP1 (17E):GTGCTTCACGTACACCTTGGAGCCAAGGCGGTCGAAATACTCTCCC (SEQ ID NO: 5); and HDP2 (17E): CCTCTCGATATCTCCGAGCCCTTGTACTGGAACTGGGGGGACAGGAT (SEQ ID NO: 6).

[0141] HDP1 (Org): GTGCTTCACGTACACCTTGGAGCCAAGCACCCATGTTACTCTCCC (SEQ ID NO: 7); and HDP2 (Org):CCTCTCGATATCAGCGATCTTGTACTGGAACTGGGGGGACAGGAT (SEQ ID NO: 8).

[0142] Substrate (For qPCR):CCAGATCACGTGAGCAGCATGACTTCTACGCAGCAGAAAAAAAAAAAGGGAGAGTAT aGGATATCGAGAGGAAAAAAAAAATCTGCTGCGTAGACCAGTCTGATGCTCGACGACA TGT (SEQ ID NO: 9).

[0143] Primers for qPCR quantification: Forward: CCAGATCACGTGAGCAGCATGA (SEQ ID NO: 10); and Reverse: ACATGTCGTCGAGCATCAGACTGG (SEQ ID NO: 11).

[0144]

[0145] Substrate (For FACS): / 6-FAM / -ACAGCAGCAAAAAAAAAGGGAGAGTATaGGATATCGAGAGGAAAAAAAAAGCTGCTG - / BHQ-ldT / A (SEQ ID NO: 12).Protocol

[0146] Eighty thousand (80K) cells were seed per well in a 24-well plate with 450 pl medium.

[0147] For cell transfection, the probes were mixed in 50 pl JetOptimus buffer, as follows: 1 / 6 pl of 100 pM HDP1, 1 / 6 pl of 100 pM HDP2 and either 1 / 6 pl or 1 / 2 pl of 100 pM qPCR or FACS substrate, respectively.

[0148] The tube was spun, and the JetOptimus reagent added thereafter. The ratio between the total DNA and JetOptimus reagent was kept at 1 : 1.

[0149] Tube(s) was incubated for 10 minutes at RT and then poured on cells. Thereafter, incubation for 15 minutes took place, and PbC12 was added at a final concentration of 20 mM.

[0150] Tube(s) was then incubated for 2 hours, and cells were collected for RNA analysis (qPCR) and / or FACS.EXAMPLE 1RNA-based cell sorting

[0151] A proof-of-concept experiment was conducted in clonal DF 1 cells that were stably transfected with DsRed-express and control parental DF1 cells.

[0152] Cells underwent transfection with either the substrate only or a combination of substrate and HDP. As a positive control, both sets of cells were transfected with the substrate, HDP, and an exogenous synthetic DNA template designed to resemble the targeted DsRed sequence. Due to the fluorescence features of DsRed+ DF1 cells, substrate quantification was quantified through qRT- PCR, employing primers flanking the cleavable motif.

[0153] The proof-of-concept demonstrated specific substrate cleavage in DsRed+ cells, highlighting the targeted RNA sensing capability (Fig. 3). In contrast, non-specific cleavage was observed when the exogenous template sequence was introduced, as expected.EXAMPLE 2

[0154] The inventors distinguish between Abl2 mouse lung cells that harbor and express Luciferase and the parental Ab 12 cells that do not harbor Luciferase, using two RNA sensing-based assays: (1) qRT-PCR: the inventors use two single stranded DNA (ssDNA) probes complementary to adjacent regions on the luciferase mRNA sequence and a hybrid DNA / RNA substrate. Substrate cleavage is assessed by qRT-PCR using primers designed to detect the intact, non-cleaved substrate; and (2) FACS: the inventors use two ssDNA probes complementary to adjacent regions on the luciferase mRNA sequence and a hybrid DNA / RNA substrate conjugated to both fluorescein and a blackhole quencher. Substrate cleavage is assessed by quantifying fluorescence via flow cytometry.

[0155] The following protocol defines the steps for applying RNA-sensing techniques to demonstrate specific substrate cleavage in Luciferase+Ab 12 cells and to design a FACS-based method to distinguish between Luciferase+to Luciferase- Ab 12 cells.Reagents and Materials

[0156] 100 pM ssDNA probe #1 for Luciferase, 100 pM ssDNA probe #2 for Luciferase, 100 pM ssDNA / RNA hybrid substrate for qRT-PCR, 100 pM ssDNA / RNA hybrid substrate for FACS (fluorescein + quencher), 100 pM ssDNA / RNA hybrid control substrate for FACS (fluorescein only), 100 pM ssDNA probe equivalent to Luciferase target sequence, Luciferase+and Luciferase- Abl2 cells, Commercial transfection reagent, 200 mM di-cationic salt (e.g., PbCL, CuCL), Primers for qRT-PCR substrate quantification, Reagents for qRT-PCR (e.g., SYBR-ROX mix), and Commercial DNA extraction kit. qRT-PCR analysis

[0157] The inventors grow Luciferase+and Luciferase- Abl2 cells, separately, in two wells, each of a 24-well plate (500 pL medium per well), reaching 50-75% confluency. The inventors replace the medium with 450 pL of fresh medium. Two transfection mixtures are prepared, each in 100 pL of transfection buffer, as follows. Mixture 1 : Probe #1: 1 / 3 pL, Probe #2: 1 / 3 pL, and qRT-PCR substrate: 1 / 3 pL. Mixture 2 (Control): Probe #1 : 1 / 3 pL, Probe #2: 1 / 3 pL, qRT-PCR substrate: 1 / 3 pL, and Luciferase equivalent DNA template: 1 / 3 pL.

[0158] The transfection reagent is added to each mixture according to the manufacturer’s instructions. The mixture are gently mixed and incubated at room temperature for 10 minutes. Fifty (50) pL of each transfection mixture are added to each well of Luciferase+and Luciferase- cells (separately). The cells are incubated at 37 °C for 15 minutes. Fifty (50) pL of the di -cationic solution are added to each well and mixed gently, and the cells are incubated for 2 hours. The medium is discarded, and DNA is extracted using a commercial kit.

[0159] Four qRT-PCR mixtures are prepared as follows (one per condition): Thirty (30) pL SYBR- ROX mix, 1.5 pL of forward primer, 1.5 pL of reverse primer, 22.5 ng of DNA, and UPW to 60 pL total volume. Twenty (20) pL are loaded per well in triplicates on a 96-well plate and running qRT- PCR.FACS analysis

[0160] Cells are grown as described above. Three transfection mixtures are prepared, each in 100 pL of transfection buffer, as follows. Mixture 1 : Probe #1 : 1 / 3 pL, Probe #2: 1 / 3 pL, and FACS substrate (fluorescein + quencher): 1 pL. Mixture 2 (Control): Probe #1 : 1 / 3 pL, Probe #2: 1 / 3 pL, FACS substrate (fluorescein + quencher): 1 pL, and Luciferase equivalent DNA template: 1 / 3 pL. Mixture 3 (Fluorescein only control): Probe #1 : 1 / 3 pL, Probe #2: 1 / 3 pL, and FACS substrate (fluorescein only): 1 pL.

[0161] The transfection reagent is added to each mixture according to the manufacturer’s instructions. The mixture are gently mixed and incubated at room temperature for 10 minutes. Fifty (50) pL of each transfection mixture are added to each well of Luciferase+and Luciferase- cells (separately). The cells are incubated at 37 °C for 15 minutes. Fifty (50) pL of the di -cationic solution are added to each well and mixed gently, and the cells are incubated for 2 hours. The medium is discarded, and the cells are harvested using trypsin. The cells are then centrifuged and resuspended in sterile PBS. Thereafter, the samples are analyzed by flow cytometry so as to quantify green fluorescence intensity.Results qRT-PCR

[0162] Higher Ct values are expected (indicating lower substrate levels) in Luciferase+cells compared to Luciferase- cells, reflecting cleavage of the substrate. A reduction of at least 2-fold is expected. In the control samples transfected with the DNA template equivalent to the Luciferase sequence, the inventors expect reduced substrate levels (higher Ct) in both cell types.FACS

[0163] The inventors expect increased green fluorescence in Luciferase+cells relative to Luciferasecells, reflecting specific substrate cleavage. This may be represented by both a higher percentage of fluorescent cells and / or higher fluorescence intensity, with at least a 2-fold increase in the fluorescent cell population. In the control samples containing the Luciferase DNA template or the non-quenched substrate, the inventors expect high fluorescence regardless of the cell type.

[0164] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by references into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to beincorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Claims

CLAIMSWhat is claimed is:

1. A system comprising:(a) a first polynucleotide comprising: i. a first nucleic acid sequence being complementary to a first portion of a nucleic acid analyte; ii. a second nucleic acid sequence being complementary to a third nucleic acid sequence of a second polynucleotide; iii. a third nucleic acid sequence comprising a first portion of a ribozyme catalytic core, wherein said first portion is catalytically inactive; and iv. a fourth nucleic acid sequence being complementary to a first portion of a third polynucleotide; wherein said first, second, third, and fourth nucleic acid sequences of said first polynucleotide are contiguous;(b) a second polynucleotide comprising: i. a first nucleic acid sequence being complementary to a second portion of said third polynucleotide; ii. a second nucleic acid sequence comprising a second portion of said ribozyme catalytic core, wherein said second portion is catalytically inactive, and wherein said first portion and said second portion of said ribozyme catalytic core form an active ribozyme catalytic core when said first polynucleotide and said second polynucleotide hybridize to said nucleic acid analyte; iii. a third nucleic acid sequence being complementary to said second nucleic acid sequence of said first polynucleotide; and iv. a fourth nucleic acid sequence being complementary to a second portion of said nucleic acid analyte; wherein said first, second, third, and fourth nucleic acid sequences of said second polynucleotide are contiguous;(c) a third polynucleotide comprising: i. said first portion being complementary to said fourth nucleic acid sequence of said first polynucleotide; ii. said second portion being complementary to said first nucleic acid sequence of said second polynucleotide; and wherein said third polynucleotide is cleaved by said active ribozyme catalytic core, wherein a presence of said nucleic acid analyte in a sample is determined by detection of a signal generated by cleavage of said third polynucleotide by said active ribozyme catalytic core.

2. The system of claim 1, wherein said active ribozyme catalytic core cleaves said third polynucleotide in a position located between said first portion and said second portion of said third polynucleotide.

3. The system of claim 1 or 2, wherein said nucleic acid analyte is a DNA molecule, RNA molecule, or a hybrid thereof.

4. The system of any one of claims 1 to 3, wherein said nucleic acid analyte is a gene of interest or a transcript thereof.

5. The system of any one of claims 1 to 4, wherein any one of said first nucleic acid sequence of said first polynucleotide, said fourth nucleic acid of said second polynucleotide, and both, is of 15 to 30 nucleotides.

6. The system of any one of claims 1 to 5, wherein any one of said first nucleic acid sequence of said first polynucleotide, said fourth nucleic acid of said second polynucleotide, and both, is characterized by a GC content of 45-70%.

7. The system of any one of claims 1 to 6, wherein any one of said second nucleic acid sequence of said first polynucleotide, said third nucleic acid of said second polynucleotide, and both, is of 3 to 10 nucleotides.

8. The system of any one of claims 1 to 7, wherein any one of said second nucleic acid sequence of said first polynucleotide, said third nucleic acid of said second polynucleotide, and both, is characterized by a GC content of 30-60%.

9. The system of any one of claims 1 to 8, wherein any one of: said fourth nucleic acid sequence of said first polynucleotide, said first nucleic acid of said second polynucleotide, and both, is of 5 to 13 nucleotides.

10. The system of any one of claims 1 to 9, wherein any one of: said fourth nucleic acid sequence of said first polynucleotide, said first nucleic acid of said second polynucleotide, and both, is characterized by a GC content of 40-60%.

11. The system of any one of claims 1 to 10, wherein said first portion of said ribozyme catalytic core comprises any one of: CGGTCGAAA (SEQ ID NO: 1) and CACCCATGT (SEQ ID NO: 2).

12. The system of any one of claims 1 to 11, wherein said second portion of said ribozyme catalytic core comprises any one of: TCCGAGC (SEQ ID NO: 3) and AGCGAT (SEQ ID NO: 4).

13. The system of any one of claims 1 to 12, wherein any one of said first polynucleotide, said second polynucleotide, and both, consists of DNA.

14. The system of any one of claims 1 to 13, wherein said third polynucleotide comprises at least one RNA nucleotide.

15. The system of claim 14, wherein said at least one RNA nucleotide is located between said first portion and said second portion of said third polynucleotide.

16. The system of any one of claims 1 to 15, wherein said detection is based on fluorescence, chemiluminescence, or nucleic acid amplification.

17. The system of any one of claims 1 to 16, wherein said signal comprises a fluorescent signal.

18. The system of any one of claims 1 to 17, wherein said third polynucleotide further comprises a quenched fluorophore and a quencher.

19. The system of any one of claims 1 to 18, wherein said third polynucleotide further comprises a first flanking nucleic acid sequence and a second flanking nucleic acid sequence, wherein said first flanking nucleic acid sequence flanks said first portion of said third polynucleotide and said second flanking nucleic acid sequence flanks said second portion of said third polynucleotide.

20. The system of claim 19, wherein any one of: said first flanking nucleic acid sequence, said second flanking nucleic acid sequence, and both, is of 20 to 30 nucleotides.

21. The system of claim 19 or 20, wherein any one of: said first flanking nucleic acid sequence, said second flanking nucleic acid sequence, and both, is characterized by a GC content of 50-60%.

22. The system of any one of claims 19 to 21, further comprising a pair of primers capable of amplifying said third polynucleotide.

23. The system of claim 22, wherein a first primer of said pair of primers is complementary to said first flanking nucleic acid sequence of said third polynucleotide and a second primer of said pair of primers is complementary to said second flanking nucleic acid sequence of said third polynucleotide.

24. A cell comprising the system of any one of claims 1 to 23.

25. The cell of claim 24, being any one of: a wildtype cell, a naive cell, a transfected cell, a transformed cell, a genomically modified cell, and any combination thereof.

26. The cell of claim 24 or 25, being a prokaryote cell or a eukaryote cell.

27. The cell of any one of claims 24 to 26, being derived from a subject.

28. A method for determining the presence of a nucleic acid analyte in a cell, the method comprising contacting the cell with an effective amount of the system of any one of claims 1 to 23, and determining whether a signal is generated by the cleavage of said third polynucleotide by said active ribozyme catalytic core, wherein a detected signal is indicative of said third polynucleotide being cleaved by said active ribozyme catalytic core, thereby determining the presence of the nucleic acid analyte in the cell.

29. The method of claim 28, wherein no detected signal is indicative of said third polynucleotide not being cleaved by said active ribozyme catalytic core, thereby determining the absence of the nucleic acid analyte in the cell.

30. The method of claim 28 or 29, wherein said determining is in a sample comprising said cell.

31. The method of any one of claims 28 to 30, wherein said determining is based on fluorescence, chemiluminescence, or nucleic acid amplification.

32. The method of any one of claims 28 to 31, wherein said cell is derived from a subject.

33. The method of any one of claims 28 to 32, wherein said cell is a heterogenous cell population comprising a plurality of cell sub-populations.

34. The method of claim 33, wherein at least one cell sub-population of said heterogenous population comprises said nucleic acid analyte and at least one cell subpopulation of said heterogenous population being devoid of said nucleic acid analyte.

35. The method of claim 34, further comprising separating or isolating said at least one cell sub-population comprising said nucleic acid analyte from said at least one cell subpopulation being devoid of said nucleic acid analyte.

36. A composition comprising said at least one cell sub-population comprising said nucleic acid analyte, separated or isolated according to the method of claim 35.

37. The composition of claim 36, further comprising a pharmaceutically acceptable carrier.

Images