Cyclic GMP-amp synthase variants and use thereof
Constitutively active cGAS protein variants with specific amino acid substitutions address the inactivity issue of wild-type cGAS, inducing potent immune responses against infections and cancer by enhancing cGAMP synthesis and STING activation.
Patent Information
- Application Number
- PCT/IL2025/050479
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-04
- Filing Date
- 2025-06-04
- Publication Date
- 2025-12-11
AI Technical Summary
Wild-type cGAS proteins are inactive in the absence of cytoplasmic DNA, limiting their effectiveness in inducing an immune response against infections and cancer.
Development of constitutively active cyclic GMP-AMP synthase (cGAS) protein variants with specific amino acid substitutions that enhance cGAMP synthesis and STING activation, independent of cytosolic DNA presence.
The variants induce robust interferon and pro-inflammatory cytokine production, effectively enhancing immune responses against pathogens and cancer cells.
Smart Images

Figure IL2025050479_11122025_PF_FP_ABST
Abstract
Description
CYCLIC GMP-AMP SYNTHASE VARIANTS AND USE THEREOFCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 655,626, filed June 4, 2024, the content of which is incorporated herein by reference in its entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0001] The contents of the electronic sequence listing (EDIT-P-005-PCT.xml; Size: 282,704 bytes; and Date of Creation: May 26, 2025) are herein incorporated by reference in their entirety.FIELD OF INVENTION
[0002] The present invention is in the field of inducing / increasing an immune response.BACKGROUND OF THE INVENTION
[0003] Cytosolic immune sensor proteins are a group of diverse proteins that sense cytoplasmic DNA / RNA and trigger the production of interferon as a response. These sensors protect against infections to express / produce interferon that acts to enhance immune activity against the cell and its neighbors. The various immune sensor proteins work through interferon transcriptional regulators such as Stimulator of Interferon Genes (STING). These regulators activate interferon regulatory factors such as IRF3 and to a lesser extent IRF7. cGAS is a main activator of this pathway however, wild-type cGAS is only active in the presence of DNA which is generally absent from the cytoplasm of cells. New constitutively active forms of cGAS are therefore greatly needed.SUMMARY OF THE INVENTION
[0004] The present invention provides constitutively active cyclic GMP-AMP Synthase (cGAS) proteins. Nucleic acid molecules encoding the constitutively active proteins as well as pharmaceutical compositions comprising the constitutively active proteins are alsoprovided, as are methods of inducing an immune response against an infectious agent, a target cell and / or treating cancer.
[0005] According to a first aspect, there is provided a cyclic GMP-AMP synthase (cGAS) protein variant of SEQ ID NO: 1 or a fragment or derivative thereof, wherein the cGAS protein variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprises amino acid substitutions at a plurality of residues selected from the group consisting of: Y229, E230, H250, E276, S283, and D466 of SEQ ID NO: 1.
[0006] According to some embodiments, the amino acid substitutes are selected from the group consisting of: Y229 substituted to K or G, E230 substituted to D, R or N, H250 substituted to Q or K, E276 substituted to N, S283 substituted to T or K, and D466 substituted to P.
[0007] According to some embodiments, the cGAS protein variant comprises amino acid substitutes at all of Y229, E230, H250, E276, S283, and D466 of SEQ ID NO: 1, optionally comprising all of Y229K, E230R, H250Q, E276N, S283T and D466P.
[0008] According to some embodiments, the cGAS protein variant further comprises at least one additional substitution at a position selected from the group consisting of R185, S447 and Q478.
[0009] According to some embodiments, the additional amino acid substitutions are selected from R185 substituted to K, S477 substituted to H or K and Q478 substituted to P, R or K.
[0010] According to some embodiments, the cGAS protein variant comprises amino acid substitutes at all of R185, Y229, E230, H250, E276, S283, S447, D466 and Q478 of SEQ ID NO: 1, optionally comprising all of R185K, Y229K / G, E230R / N, H250Q, E276N, S283T, S447H, D466P and Q478P.
[0011] According to some embodiments, the fragment comprises amino acids 146 to 507 of SEQ ID NO: 1 and an N-terminal methionine.
[0012] According to some embodiments, the cGAS protein variant comprises or consists of a sequence selected from SEQ ID NO: 3-13, 34-37 and 39-107.
[0013] According to another aspect, there is provided a cyclic GMP-AMP synthase (cGAS) protein variant comprising SEQ ID NO: 14 or a fragment or derivative thereof, wherein the SEQ ID NO: 14 or a fragment or derivative thereof comprises amino acid substitutions at a plurality of residues selected from the group consisting of: E502, E515, S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, L354, E401, D408, Q448,L462, T469, Q473, T477, S493P, Y510, and N513 of SEQ ID NO: 14, wherein the substitution is to K, R or P.
[0014] According to some embodiments, the substitutions comprises amino acid substitutions at E502 and E515 and a plurality of residues selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, L354, E401, D408, Q448, L462, T469, Q473, T477, S493P, Y510, and N513 of SEQ ID NO: 14, wherein the substitution is to K, R or P.
[0015] According to some embodiments, the substitutions are selected from S 163K, A167K, E170K, G188K, S243K, E269K, S274K, S278K, E286K, I297K, A332P, A332K, E336K, A346K, L354K, E401K, D408K, Q448K, L462K, T469K, Q473K, T477R, S493P, S493K, E502K, Y510K, N513K, and E515K.
[0016] According to some embodiments, the SEQ ID NO: 14 or a fragment or derivative thereof comprises E502K and E515K.
[0017] According to some embodiments, the plurality of residues is at least 10 residues.
[0018] According to some embodiments, the cGAS protein variant comprises all of the following substitutions: S163K, A167K, E269K, E286K, E336K, L354K, Q473K, T477R, E502K, Y510K, N513K and E515K.
[0019] According to some embodiments, the cGAS protein variant comprises all of the following substitutions: a. a. S163K, A167K, E269K, E286K, E336K, L354K, L462K, Q473K, T477R, T469K, E502K, Y510K, N513K, and E515K; b. S243K or S278K; and c. Q448K or Q473K .
[0020] According to some embodiments, the fragment comprises amino acids 160 to 522 of SEQ ID NO: 14 and an N-terminal methionine.
[0021] According to some embodiments, the cGAS protein variant comprises or consists of a sequence selected from SEQ ID NO: 16, 38 and 108-174.
[0022] According to some embodiments, a fragment or derivative is a fragment or derivative comprising Cyclic guanosine monopho sphate-adeno sine monophosphate (cGAMP) synthesis activity.
[0023] According to some embodiments, the cGAS protein variant is a constitutively active cGAS.
[0024] According to some embodiments, constitutive activity is constitutive cGAMP synthesis activity.
[0025] According to some embodiments, constitutively comprises in the absence of cytosolic DNA.
[0026] According to some embodiments, constitutively active comprises constitutive activation of Stimulator of interferon genes (STING1).
[0027] According to another aspect, there is provided a nucleic acid molecule comprising an open reading frame encoding a cGAS protein variant of the invention.
[0028] According to some embodiments, the nucleic acid molecule further comprises at least one microRNA (miR) binding site of a miR expressed in a tissue selected from liver, muscle, kidney, brain, skin and lung and not expressed in immune cells.
[0029] According to some embodiments, the miR is selected from the miRs provided in Table 3.
[0030] According to some embodiments, the miR is mir-122.
[0031] According to another aspect, there is provided a pharmaceutical composition comprising a cGAS protein variant of the invention or a nucleic acid molecule of the invention and a pharmaceutically acceptable carrier, or excipient.
[0032] According to some embodiments, the cGAS protein variant or the nucleic acid molecule is encapsulated in a liquid nanoparticle (LNP).
[0033] According to another aspect, there is provided a method of inducing an immune response in a subject, the method comprising administering to the subject a pharmaceutical composition of the invention, thereby inducing an immune response in a subject.
[0034] According to some embodiments, the inducing an immune response comprises inducing expression of cGAMP, interferon or both in immune cells of the subject.
[0035] According to some embodiments, the subject suffers from a disease or condition characterized by a pathological cell and treatable by inducing an immune response against the pathological cell, and wherein the method is a method of treating the disease.
[0036] According to some embodiments, the disease is cancer and the pathological cell is a cancerous cell.
[0037] According to some embodiments, the disease is an infectious disease and the pathological cell is an infected cell.
[0038] According to another aspect, there is provided a method of enhancing an immune response in a subject receiving a vaccine, the method comprising administering a pharmaceutical composition of the invention to the subject, thereby enhancing an immune response in a subject receiving a vaccine.
[0039] According to some embodiments, the immune response is directed against a cancerous cell or a pathogen.
[0040] According to some embodiments, the method further comprises administering the vaccine to the subject.
[0041] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS
[0042] Figure 1: Table summarizing the new cGAS variants and controls and their cGAMP production after introduction into HCC1954 cells. “Li et al. 2021” refers to “Phosphorylation and chromatin tethering prevent cGAS activation during mitosis”, Science. 2021 Mar 19;371(6535):eabc5386.
[0043] Figure 2A-2D: (2A-2B) B ar graphs of IFNb mRNA levels in THP1 cells transfected with cGAS variants or controls at (2A) 24 hours and (2B) 48 hours following transfection. (2C) A bar graph of IFNb mRNA levels in THP1 cells 48 hours after transfection with the various cGAS variants or controls. (2D) A bar graph of IFNb protein production produced by THP1 cells transfected with either of the various cGAS variants or controls.
[0044] Figures 3A-3D: Bar graphs of (3A, 3C) IFN-a and (3B, 3D) IL -6 expression in serum from mice administered (3A-B) Adjuvant #1 and (3C-D) Adjuvant #2. Measurements were made at 6 hours and 24 hours after administration.
[0045] Figures 4A-4B: (4A) Bar graph of relative cGAMP produced in a liver cell line expressing mir-122 and a monocyte cell line expressing a construct with SEQ ID NO: 34 with and without incorporation of a mir-122 target site. (4B) Bar graph of relative mRNA expression of three genes in a monocyte cell line expressing a construct with SEQ ID NO: 34 with and without incorporation of a mir-122 target site. Data is shown as fold of control (lipofectamine with mCherry RNA) all normalized to a house keeping gene.DETAILED DESCRIPTION OF THE INVENTION
[0046] The present invention, in some embodiments, provides Cyclic GMP-AMP synthase (cGAS) protein variants. Nucleic acid molecules encoding the variants are provided. Compositions comprising the variants and / or nucleic acid molecule encoding the variants are provided. Methods of inducing an immune response and methods of enhancing an immune response by administering or introducing the variants, nucleic acid molecules and / or compositions of the invention are also provided.
[0047] The invention is based, at least in part, on the surprising finding of new cGAS constitutively active mutants. These mutants were found not only to be constitutively active at producing cGAMP in the absence of DNA and inducing expression of interferon but were also found to be superior to other known constitutively active variants.
[0048] By first aspect, there is provided a Cyclic GMP-AMP synthase (cGAS) protein variant comprising at least one amino acid substitution that increases cGAS function.
[0049] cGAS is a well characterized cytosolic immune sensor protein that acts to protect eukaryotic cells from bacterial and viral infection. The protein senses single stranded or double stranded DNA in the cytoplasm and catalyzes the synthesis of cGAMP. cGAMP then acts as a messenger molecule and activates all alleles of Stimulator of Interferon Genes (STING) to trigger the production of type-I interferons (e.g., interferons beta and alpha). In some embodiments, cGAS is mammalian cGAS. In some embodiments, cGAS is human cGAS. In some embodiments, cGAS is mouse cGAS. In some embodiments, cGAS is a eukaryotic protein.
[0050] In some embodiments, wild-type human cGAS gene, cDNA or mRNA comprises SEQ ID NO: 15. It will be understood by a skilled artisan that the mRNA sequence will comprise uracil bases in place of all thymine bases. In some embodiments, wild-type human cGAS gene, mRNA or cDNA consists of SEQ ID NO: 15. In some embodiments, wild-typehuman cGAS protein comprises SEQ ID NO: 14. In some embodiments, wild-type human cGAS protein consists of SEQ ID NO: 14. In some embodiments, wild-type mouse cGAS gene, cDNA or mRNA comprises SEQ ID NO: 2. In some embodiments, wild-type mouse cGAS gene, cDNA or mRNA consists of SEQ ID NO: 2. In some embodiments, wild-type mouse cGAS protein comprises SEQ ID NO: 1. In some embodiments, wild-type mouse cGAS protein consists of SEQ ID NO: 1.
[0051] In some embodiments, the cGAS variant is homologous to SEQ ID NO: 1. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% homology to SEQ ID NO: 1. Each possibility represents a separate embodiment of the invention. In some embodiments, homology is identity. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 1. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 80% sequence identity to SEQ ID NO: 1. In some embodiments, the cGAS variant comprises at least 85% sequence identity to SEQ ID NO: 1. In some embodiments, the cGAS variant comprises at least 90% sequence identity to SEQ ID NO: 1. In some embodiments, the cGAS variant comprises at least 95% sequence identity to SEQ ID NO: 1. In some embodiments, the cGAS variant comprises at least 99% sequence identity to SEQ ID NO: 1.
[0052] In some embodiments, the cGAS variant is homologous to SEQ ID NO: 14. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% homology to SEQ ID NO: 14. Each possibility represents a separate embodiment of the invention. In some embodiments, homology is identity. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 14. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 80% sequence identity to SEQ ID NO: 14. In some embodiments, the cGAS variant comprises at least 85% sequence identity to SEQ ID NO: 14. In some embodiments, the cGAS variant comprises at least 90% sequence identity to SEQ ID NO: 14. In some embodiments, the cGAS variant comprises at least 95% sequence identity to SEQ ID NO: 14. In some embodiments, the cGAS variant comprises at least 99% sequence identity to SEQ ID NO: 14.
[0053] In some embodiments, homology is comprising a percent identity of less than 100%. In some embodiments, a homologous sequence retains functionality. In some embodiments, functionality is cGAMP synthesis. In some embodiments, functionality is CDN synthesis. In some embodiments, functionality is STING activation. In some embodiments, functionalityis induction of interferon production. In some embodiments, functionality is induction of interferon secretion. In some embodiments, interferon is a type I interferon. In some embodiments, interferon is a type III interferon. In some embodiments, interferon is interferon beta. In some embodiments, interferon beta is interferon beta 1 (IFNB1). In some embodiments, interferon is interferon alpha. In some embodiments, interferon alpha is selected from interferon alpha 1, 2, 4, 5, 6, 7, 8, 10, 13, 14, 16, 17 and 21. In some embodiments, interferon is interferon lambda. In some embodiments, interferon lambda is selected from interferon lambda 1, 2, 3 and 4. In some embodiments, functionality is induction of a target downstream of interferon production. In some embodiments, the downstream target is an Interferon-induced protein with tetratricopeptide repeats (IFIT) protein. In some embodiments, the IFIT protein is selected from: IFIT1, IFIT2, IFIT3, and IFIT5. In some embodiments, the IFIT protein is IFIT1. In some embodiments, the downstream target is Interferon-induced GTP-binding protein Mxl (MX1).
[0054] In some embodiments, functionality is induction of proinflammatory cytokine and / or chemokine production. In some embodiments, functionality is induction of proinflammatory cytokine and / or chemokine secretion. Proinflammatory cytokines and chemokines are well known in the art and upregulation of any of them may be indicative of functionality. In some embodiments, the pro-inflammatory cytokine is selected from TNFa, IFNg, IL- IB, M-CSF, IL-6, IL-8 and IL- 15. In some embodiments, the pro-inflammatory cytokine is tumor necrosis factor alpha (TNFa). In some embodiments, the pro-inflammatory cytokine is interferon gamma (IFNg). In some embodiments, the pro-inflammatory cytokine is interleukin 1 beta (IL- IB). In some embodiments, the pro -inflammatory cytokine is colony stimulating factor 1 (CSF1 / M-CSF). In some embodiments, the pro-inflammatory cytokine is IL-6. In some embodiments, the pro-inflammatory cytokine is IL-8. In some embodiments, the pro-inflammatory chemokine is selected from CCL2, CCL3, CXCL1, CXCL9, CXCL10, CXCL11 and CCL4. In some embodiments, the pro-inflammatory chemokine is chemokine (C-C motif) 2 (CCL2). In some embodiments, the pro -inflammatory chemokine is CCL3. In some embodiments, the pro -inflammatory chemokine is chemokine (C-X-C motif) ligand 1 (CXCL1). In some embodiments, the pro-inflammatory chemokine is CCL4.
[0055] In some embodiments, the variant is constitutively active. In some embodiments, the homologous sequence is constitutively active. In some embodiments, the fragment is constitutively active. In some embodiments, the derivative is constitutively active. In some embodiments, the derivative is a homolog. In some embodiments, the derivative is a variant with homology or identity to the WT sequence. In some embodiments, the fragment is afunctional fragment. In some embodiments, a functional fragment is a fragment that retains functionality. In some embodiments, a functional fragment is a fragment that retains cGAMP synthesis. In some embodiments, a functional fragment is a fragment that retains cyclic dinucleotide (CDN) synthesis. In some embodiments, activity is cGAMP synthesis activity. In some embodiments, activity is CDN synthesis activity. In some embodiments, constitutively active comprises activity in the absence of cytosolic DNA. In some embodiments, constitutive activity comprises activation of Stimulator of interferon genes (STING1).
[0056] In some embodiments, activity is constitutive activity. In some embodiments, a fragment comprises at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 92, 93, 94, 95, 97, 98 or 99% of the protein. Each possibility represents a separate embodiment of the invention. In some embodiments, a fragment comprises at least 100, 150, 200, 250, 300, 350, 400, 430450, 500, or 520 amino acids. In some embodiments, a fragment comprises at least 200 amino acids. Each possibility represents a separate embodiment of the invention. In some embodiments, a fragment comprises at most 100, 150, 200, 250, 300, 350, 400, 430 450, 500, or 520 amino acids. Each possibility represents a separate embodiment of the invention.
[0057] In some embodiments, the fragment comprises a deletion in the N-terminal sequence of cGAS. In some embodiments, the fragment comprises an N-terminal truncation of cGAS. In some embodiments, the fragment comprises a deletion in the N-terminal sequence of mouse cGAS. In some embodiments, the fragment comprises an N-terminal truncation of mouse cGAS. In some embodiments, the fragment comprises amino acids 146 to 507 of SEQ ID NO: 1. In some embodiments, the fragment comprises a deletion of amino acids 1-145 of SEQ ID NO: 1. In some embodiments, the fragment comprises a deletion of amino acids 2- 145 of SEQ ID NO: 1. In some embodiments, the fragment comprises a deletion of amino acids 1-120, 1-125, 1-130, 1-135, 1-140, 1-145, 1-150, 1-155, 1-160, 1-165 or 1-170 of SEQ ID NO: 1. Each possibility represents a separate embodiment of the invention. In some embodiments, the fragment comprises a deletion of amino acids 2-120, 2-125, 2-130, 2-135, 2-140, 2-145, 2-150, 2-155, 2-160, 2-165 or 2-170 of SEQ ID NO: 1. Each possibility represents a separate embodiment of the invention. In some embodiments, the fragment comprises an N-terminal methionine. In some embodiments, the fragment consists of amino acids 146 to 507 of SEQ ID NO: 1 and an N-terminal methionine. In some embodiments, the wildtype sequence of the fragment comprises SEQ ID NO: 32.
[0058] In some embodiments, the cGAS variant is homologous to SEQ ID NO: 32. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% homology to SEQ ID NO: 32. Each possibility represents a separate embodiment of the invention. In some embodiments, homology is identity. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 32. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 80% sequence identity to SEQ ID NO: 32. In some embodiments, the cGAS variant comprises at least 85% sequence identity to SEQ ID NO: 32. In some embodiments, the cGAS variant comprises at least 90% sequence identity to SEQ ID NO: 32. In some embodiments, the cGAS variant comprises at least 95% sequence identity to SEQ ID NO: 32. In some embodiments, the cGAS variant comprises at least 99% sequence identity to SEQ ID NO: 32. In some embodiments, the at least one mutation is made in SEQ ID NO: 32.
[0059] In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising at least one amino acid substitution. In some embodiments, the at least one amino acid substitution is selected from D155, E166, E169, R185, Y229, E230, H250, E255, T260, S264, E276, S283, 1320, E324, G333, T334, N339, Q413, D416, Q433, S446, S447, A454, E458, T462, D466, Q478, E487, Y495, N499, and L507. In some embodiments, the at least one amino acid substitution is a substitution of a residue selected from the group consisting of: Y229, E230, E276, S283, and S447 of SEQ ID NO: 1. In some embodiments, the plurality of substitutions is at a plurality of residues selected from the group consisting of: Y229, E230, E276, S283, and S447 of SEQ ID NO: 1. In some embodiments, a plurality is at least 2, 3, 4, or 5, substitutions. Each possibility represents a separate embodiment of the invention. In some embodiments, the at least one amino acid substitution is a substitution of a residue selected from the group consisting of: Y229, E230, H250, E276, S283, and D466 of SEQ ID NO: 1. In some embodiments, the plurality of substitutions is at a plurality of residues selected from the group consisting of: Y229, E230, H250, E276, S283, and D466 of SEQ ID NO: 1. In some embodiments, a plurality is at least 2, 3, 4, 5, or 6 substitutions. Each possibility represents a separate embodiment of the invention. In some embodiments, the at least one amino acid substitution is a substitution of a residue selected from the group consisting of: E230, H250, and D466 of SEQ ID NO: 1. In some embodiments, the plurality of substitutions is at a plurality of residues selected from the group consisting of: E230, H250, and D466. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of E230, H250,and D466. In some embodiments, the at least one amino acid substitution is a substitution of a residue selected from the group consisting of: Y229, E230, and D466 of SEQ ID NO: 1. In some embodiments, the plurality of substitutions is at a plurality of residues selected from the group consisting of: Y229, E230, and D466. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of Y229, E230, and D466. In some embodiments, the at least one amino acid substitution is a substitution of a residue selected from the group consisting of: Y229, E230, E276, S283 and S447 of SEQ ID NO: 1. In some embodiments, the plurality of substitutions is at a plurality of residues selected from the group consisting of: Y229, E230, E276, S283 and S447. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of Y229, E230, E276, S283 and S447. In some embodiments, the at least one amino acid substitution is a substitution of a residue selected from the group consisting of: E230, Q413, and T462 of SEQ ID NO: 1. In some embodiments, the plurality of substitutions is at a plurality of residues selected from the group consisting of: E230, Q413, and T462. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of E230, Q413, and T462. In some embodiments, a plurality is at least 2. In some embodiments, a plurality is at least 3. In some embodiments, a plurality is at least 4. In some embodiments, a plurality is at least 5. In some embodiments, a plurality is at least 6. In some embodiments, a plurality is at least 6.
[0060] In some embodiments, the substitution is a substitution of tyrosine 229 (Y229). In some embodiments, Y229 is substituted to K or G. In some embodiments, Y229 is substituted to K. In some embodiments, Y229 is substituted to G.
[0061] In some embodiments, the substitution is a substitution of glutamic acid 230 (E230). In some embodiments, E230 is substituted to D, R or N. In some embodiments, E230 is substituted to D. In some embodiments, E230 is substituted to R. In some embodiments, E230 is substituted to N.
[0062] In some embodiments, the substitution is a substitution of glutamic acid 276 (E276). In some embodiments, E276 is substituted to N or K. In some embodiments, E276 is substituted to N. In some embodiments, E276 is substituted to K.
[0063] In some embodiments, the substitution is a substitution of serine 283 (S283). In some embodiments, S283 is substituted to T or K. In some embodiments, S283 is substituted to T. In some embodiments, S283 is substituted to K.
[0064] In some embodiments, the substitution is a substitution of serine 447 (S447). In some embodiments, S447 is substituted to H or K. In some embodiments, S447 is substituted to H. In some embodiments, S447 is substituted to K.
[0065] In some embodiments, the substitution is a substitution of histidine 250 (H250). In some embodiments, H250 is substituted to Q or K. In some embodiments, H250 is substituted to Q. In some embodiments, H250 is substituted to K.
[0066] In some embodiments, the substitution is a substitution of aspartic acid 466 (D466). In some embodiments, D466 is substituted to P.
[0067] In some embodiments, the variant comprises amino acid substitutions at all of Y229, E230, E276, S283, and S447 of SEQ ID NO: 1. In some embodiments, the variant comprises all of the following substitutions: Y229 to K or G, E230 to D, R or N, E276 to N or K, S283 to T or K, and S447 to H or K. In some embodiments, the variant comprises amino acid substitutions at all of Y229, E230, H250, E276, S283, and D466 of SEQ ID NO: 1. In some embodiments, the variant comprises all of the following substitutions: Y229 to K or G, E230 to D, R or N, H250 to Q or K, E276 to N or K, S283 to T or K, and D466 to P. In some embodiments, the variant comprises all of the following substitutions: Y229K, E230R, H250Q, E276N, S283T and D466P. In some embodiments, the variant comprises all of the following substitutions: E230R, H250Q, and D466P. In some embodiments, the variant comprises all of the following substitutions: Y229K, E230R, and D466P. In some embodiments, the variant comprises all of the following substitutions: Y229K, E230R, E276N, S283T and S447H. In some embodiments, the variant comprises all of the following substitutions: E230R, Q413K, and T462R.
[0068] In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution at all of the following positions: El 69, Y229, E255, T260, S264, E276, S283, E324, T334, N339, Q413, D416, Q433, S447, T462, E487, Y495, N499, and L507. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of: E169K, Y229K, E255K, T260K, S264K, E276N, S283T, E324K, T334K, N339K, Q413K, D416R, Q433K, S447H, T462R, E487K, Y495K, N499R, and L507R. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution at all of the following positions: E169, E255, T260, S264, E276, S283, E324, T334, N339, Q413, D416, Q433, S447, T462, E487, Y495, N499, and L507. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of: E169K,E255K, T260K, S264K, E276N, S283T, E324K, T334K, N339K, Q413K, D416R, Q433K, S447H, T462R, E487K, Y495K, N499R, and L507R. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution at all of the following positions: E169, H250, E255, E320, E324, T334, Q413, T462, D466, E487, Y495, N499, and L507. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of: E169K, H250Q, E255K, E320R, E324K, T334K, Q413K, T462R, D466P, E487K, Y495K, N499R, and L507R. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution at all of the following positions: Y229, E230, E276, S283, and S447. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of: Y229K, E230R, E276N, S283T, and S447H.
[0069] In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution at all of the following positions: 1) El 69, Y229, E255, T260, S264, E276, S283, E324, T334, N339, Q413, D416, Q433, S447, T462, E487, Y495, N499, and L507; or 2) E230, H250, and D466. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of: 1) E169K, Y229K, E255K, T260K, S264K, E276N, S283T, E324K, T334K, N339K, Q413K, D416R, Q433K, S447H, T462R, E487K, Y495K, N499R, and L507R; or 2) E230R, H250Q, and D466P. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution at all of the following positions: 1) E169, E255, T260, S264, E276, S283, E324, T334, N339, Q413, D416, Q433, S447, T462, E487, Y495, N499, and L507; or 2) Y229, E230, and D466. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of: 1) E169K, E255K, T260K, S264K, E276N, S283T, E324K, T334K, N339K, Q413K, D416R, Q433K, S447H, T462R, E487K, Y495K, N499R, and L507R; or 2) Y229K, E230R, and D466P. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution at all of the following positions: 1) E169, H250, E255, E320, E324, T334, Q413, T462, D466, E487, Y495, N499, and L507; or 2) Y229, E230, E276, S283 and S447. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of: 1) E169K, H250Q, E255K, E320R, E324K, T334K, Q413K, T462R, D466P, E487K, Y495K, N499R, and L507R; or 2) Y229K, E230R, E276N, S283T and S447H. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution at all of the following positions: 1) Y229, E230, E276, S283, and S447; or 2) E230, Q413, and T462. In some embodiments,the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of: 1) Y229K, E230R, E276N, S283T, and S447H; or 2) E230R, Q413K, and T462R.
[0070] In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of E230, H250, and D466 and at least one other substitution. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of Y229, E230, and D466 and at least one other substitution. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of Y229, E230, E276, S283 and S447 and at least one other substitution. In some embodiments, the variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprising substitution of E230, Q413, and T462 and at least one other substitution. In some embodiments, the variant comprises all of the following substitutions: E230R, H250Q, and D466P and at least one other substitution. In some embodiments, the variant comprises all of the following substitutions: Y229K, E230R, and D466P and at least one other substitution. In some embodiments, the variant comprises all of the following substitutions: Y229K, E230R, E276N, S283T and S447H and at least one other substitution. In some embodiments, the variant comprises all of the following substitutions: E230R, Q413K, and T462R and at least one other substitution.
[0071] In some embodiments, at least one other substitution is a plurality of additional substitutions. In some embodiments, the at least one other substitution is selected from D155, E166, E169, R185, Y229, E230, H250, E255, T260, S264, E276, S283, 1320, E324, G333, T334, N339, Q413, D416, Q433, S446, S447, A454, E458, T462, D466, Q478, E487, Y495, N499, and L507. In some embodiments, the at least one other substitution is selected from D155, E166, E169, R185, Y229, E255, T260, S264, E276, S283, 1320, E324, G333, T334, N339, Q413, D416, Q433, S446, S447, A454, E458, T462, Q478, E487, Y495, N499, and L507. In some embodiments, the at least one other substitution is selected from D155, E166, E169, R185, H250, E255, T260, S264, E276, S283, 1320, E324, G333, T334, N339, Q413, D416, Q433, S446, S447, A454, E458, T462, Q478, E487, Y495, N499, and L507. In some embodiments, the at least one other substitution is selected from D155, E166, E169, R185, H250, E255, T260, S264, 1320, E324, G333, T334, N339, Q413, D416, Q433, S446, A454, E458, T462, D466, Q478, E487, Y495, N499, and L507. In some embodiments, the at least one other substitution is selected from D155, E166, E169, R185, Y229, H250, E255, T260, S264, E276, S283, 1320, E324, G333, T334, N339, D416, Q433, S446, S447, A454, E458, D466, Q478, E487, Y495, N499, and L507.
[0072] In some embodiments, D 155 is substituted to lysine (D155K). In some embodiments, E166 is substituted to arginine (E166R) or lysine (E166K). In some embodiments, E166 is substituted to E166R. In some embodiments, R185 is substituted to lysine (R185K). In some embodiments, Y229 is substituted to lysine (Y229K) or glycine (Y229G). In some embodiments, Y229 is substituted to Y229K. In some embodiments, E230 is substituted to arginine (E230R), aspartic acid (E230D) or asparagine (E230N). In some embodiments, E230 is substituted to E230R. In some embodiments, H250 is substituted to glutamine (H250Q). In some embodiments, E255 is substituted to lysine (E255K). In some embodiments, T260 is substituted to lysine (T260K). In some embodiments, S264 is substituted to lysine (S264K). In some embodiments, E276 is substituted to asparagine (E276N) or lysine (E276K). In some embodiments, E276 is substituted to E276N. In some embodiments, S283 is substituted to threonine (S283T) or lysine (S283K). In some embodiments, S283 is substituted to S283T. In some embodiments, 1320 is substituted to lysine (I320K). In some embodiments, E324 is substituted to lysine (E324K). In some embodiments, G333 is substituted to serine (G333S). In some embodiments, T334 is substituted to lysine (T334K). In some embodiments, N339 is substituted to lysine (N339K). In some embodiments, Q413 is substituted to lysine (Q413K). In some embodiments, D416 is substituted to arginine (D416R). In some embodiments, Q433 is substituted to lysine (Q433K). In some embodiments, S447 is substituted to histidine (S447H) or lysine (S447K). In some embodiments, S447 is substituted to S447H. In some embodiments, A454 is substituted to lysine (A454K). In some embodiments, E458 is substituted to lysine (E458K). In some embodiments, T462 is substituted to arginine (T462R) or lysine (T462K). In some embodiments, T462 is substituted to T462R. In some embodiments, D466 is substituted to proline (D466P). In some embodiments, Q478 is substituted to proline (Q478P), arginine (Q478R) or lysine (Q478K). In some embodiments, Q478 is substituted to Q478P. In some embodiments, E487 is substituted to lysine (E487K). In some embodiments, Y495 is substituted to lysine (Y495K). In some embodiments, N499 is substituted to arginine (N499R). In some embodiments, L507 is substituted to arginine (L507R).
[0073] In some embodiments, the variant further comprises at least one additional substitution. In some embodiments, the additional substitution is at a position selected from the group consisting of H250 and D466. In some embodiments, the substitution is a substitution of histidine 250 (H250). In some embodiments, H250 is substituted to K or Q. In some embodiments, H250 is substituted to K. In some embodiments, H250 is substituted to Q. In some embodiments, the substitution is a substitution of aspartic acid 466 (D466). Insome embodiments, D466 is substituted to P. In some embodiments, the additional substitution is at a position is S447. In some embodiments, S447 is substituted to H or K. In some embodiments, S447 is substituted to H. In some embodiments, S447 is substituted to K. In some embodiments, the additional substitution is at a position selected from the group consisting of R185, S447 and Q478. In some embodiments, the substitution is a substitution of arginine 185 (R185). In some embodiments, R185 is substituted to K. In some embodiments, the substitution is a substitution of glutamine 478 (Q478). In some embodiments, Q478 is substituted to P, R or K. In some embodiments, Q478 is substituted to P. In some embodiments, Q478 is substituted to R. In some embodiments, Q478 is substituted to K. In some embodiments, the additional substitution comprises substitution at all of R185, S 477 and Q478.
[0074] In some embodiments, the at least one amino acid substitution is a substitution of a residue selected from the group consisting of: Y229, E230, H250, E276, S283, S447, and D466 of SEQ ID NO: 1. In some embodiments, the fragment or derivative comprises the residue to be substituted. In some embodiments, the at least one amino acid substitution is a plurality of substitutions. In some embodiments, the plurality of substitutions is at a plurality of residues selected from the group consisting of: Y229, E230, H250, E276, S283, S447, and D466 of SEQ ID NO: 1. In some embodiments, a plurality is at least 2, 3, 4, 5, 6, 7, 8 or 9 substitutions. Each possibility represents a separate embodiment of the invention. In some embodiments, a plurality is at least 2. In some embodiments, a plurality is at least 3. In some embodiments, a plurality is at least 4. In some embodiments, a plurality is at least 5. In some embodiments, a plurality is at least 6. In some embodiments, a plurality is at least 7. In some embodiments, a plurality is at least 8. In some embodiments, a plurality is at least 9.
[0075] In some embodiments, the variant comprises amino acid substitutions at all of Y229, E230, H250, E276, S283, S447, and D466 of SEQ ID NO: 1. In some embodiments, the variant comprises all of the following substitutions: Y229 to K or G, E230 to D, R or N, H250 to K or Q, E276 to N or K, S283 to T or K, S447 to H or K and D466 to P. In some embodiments, the variant comprises amino acid substitutions at all of R185, Y229, E230, H250, E276, S283, S447, D466 and Q478 of SEQ ID NO: 1. In some embodiments, the variant comprises all of the following substitutions: R185 to K, Y229 to K or G, E230 to D, R or N, H250 to K or Q, E276 to N or K, S283 to T or K, S447 to H or K, D466 to P and Q478 to P, K or R. In some embodiments, the variant comprises all of the following substitutions: R185K, Y229 to K or G (Y229K / G), E230 to R or N (E230R / N), H250Q, E276N, S283T, S447H, D466P and Q478P.
[0076] In some embodiments, the variant further comprises at least one additional substitution. In some embodiments, the additional substitution is at a position selected from the group consisting of R185 and Q478. In some embodiments, the additional substitution is a substitution of arginine 185 (R185). In some embodiments, R185 is substituted to K. In some embodiments, the additional substitution is a substitution of glutamine 478 (Q478). In some embodiments, Q478 is substituted to P, K or R. In some embodiments, Q478 is substituted to P. In some embodiments, Q478 is substituted to K. In some embodiments, Q478 is substituted to R. In some embodiments, the substitution is substitution of both R185 and Q478. In some embodiments, the variant comprises both R185 substitute to K and Q478 substituted to P, K or R. In some embodiments, the variant comprises amino acid substitutions at all of R185, Y229, E230, H250, E276, S283, S447, D466 and Q478 of SEQ ID NO: 1. In some embodiments, the variant comprises all of the following substitutions: R185 to K, Y229 to K or G, E230 to D, R or N, H250 to K or Q, E276 to N, S283 to T or K, S447 to H or K, D466 to P and Q478 to P, K or R.
[0077] In some embodiments, the additional substitution is at position selected from the group consisting of T260, Q413, D416 and T462. In some embodiments, the additional substitution is a second additional substitution that is in addition to the first additional substitution. In some embodiments, the second additional substitution is at position selected from the group consisting of T260, Q413, D416 and T462. In some embodiments, the additional substitution is a substitution of threonine 260 (T260). In some embodiments, T260 is substituted to K. In some embodiments, the additional substitution is a substitution of glutamine 413 (Q413). In some embodiments, Q413 is substituted to K. In some embodiments, the additional substitution is a substitution of aspartic acid 416 (D416). In some embodiments, D416 is substituted to R. In some embodiments, the additional substitution is a substitution of threonine 462 (T462). In some embodiments, T462 is substituted to K or R. In some embodiments, T462 is substituted to K. In some embodiments, T462 is substituted to R. In some embodiments, the substitution is a substitution of a plurality of T260, Q413, D416 and T462. In some embodiments, the substitution is a substitution of all of T260, Q413, D416 and T462. In some embodiments, the variant comprises amino acid substitutions at all of R185, Y229, E230, H250, T260, E276, S283, Q413, D416, S447, T462, D466 and Q478 of SEQ ID NO: 1. In some embodiments, the variant comprises all of the following substitutions: R185 to K, Y229 to K or G, E230 to D, R or N, H250 to K or Q, T260 to K, E276 to N, S283 to T or K, Q413 to K, D416 to R, S447 to H or K, T 462 to K or R, D466 to P and Q478 to P, K or R.
[0078] In some embodiments, the additional substitution is at position selected from the group consisting of E166 and E169. In some embodiments, the additional substitution is a second additional substitution that is in addition to the first additional substitution. In some embodiments, the second additional substitution is at a position selected from the group consisting of E166 and E169. In some embodiments, the additional substitution is a third additional substitution that is in addition to the first and second additional substitutions. In some embodiments, the third additional substitution is at a position selected from the group consisting of E166 and E169. In some embodiments, the additional substitution is substitution of glutamic acid 166 (E166). In some embodiments, E166 is substituted to K or R. In some embodiments, E166 is substituted to K. In some embodiments, E166 is substituted to R. In some embodiments, the additional substitution is substitution of glutamic acid 169 (E169). In some embodiments, E169 is substituted to K. In some embodiments, the substitution is substitution of both E166 and E169. In some embodiments, the variant comprises both E166 substitute to K or R and E169 substituted to K. In some embodiments, the variant comprises amino acid substitutions at all of E166, E169, R185, Y229, E230, H250, T260, E276, S283, Q413, D416, S447, T462, D466 and Q478 of SEQ ID NO: 1. In some embodiments, the variant comprises all of the following substitutions: E166 to K or R, E169 to K, R185 to K, Y229 to K or G, E230 to D, R or N, H250 to K or Q, T260 to K, E276 to N, S283 to T or K, Q413 to K, D416 to R, S447 to H or K, T 462 to K or R, D466 to P and Q478 to P, K or R.
[0079] In some embodiments, any substitution to K also includes substitution to R. In some embodiments, any substitution to R also includes substitution to K. In some embodiments, any substitution to K or R is a substitution to a positively charged amino acid. In some embodiments, any substitution to E also includes substitution to D. In some embodiments, any substitution to D also includes substitution to E. In some embodiments, any substitution to E or D is a substitution to a negatively charged amino acid.
[0080] In some embodiments, the variant comprises an amino acid sequence selected from SEQ ID NO: 3-13 and 34-37. In some embodiments, the variant comprises an amino acid sequence selected from SEQ ID NO: 3-13, 34-37 and 39-107. In some embodiments, the variant consists of an amino acid sequence selected from SEQ ID NO: 3-13 and 34-37. In some embodiments, the variant comprises SEQ ID NO: 3. In some embodiments, the variant consists of SEQ ID NO: 3. In some embodiments, the variant comprises SEQ ID NO: 4. In some embodiments, the variant consists of SEQ ID NO: 4. In some embodiments, the variant comprises SEQ ID NO: 5. In some embodiments, the variant consists of SEQ ID NO: 5. Insome embodiments, the variant comprises SEQ ID NO: 6. In some embodiments, the variant consists of SEQ ID NO: 6. In some embodiments, the variant comprises SEQ ID NO: 7. In some embodiments, the variant consists of SEQ ID NO: 7. In some embodiments, the variant comprises SEQ ID NO: 8. In some embodiments, the variant consists of SEQ ID NO: 8. In some embodiments, the variant comprises SEQ ID NO: 9. In some embodiments, the variant consists of SEQ ID NO: 9. In some embodiments, the variant comprises SEQ ID NO: 10. In some embodiments, the variant consists of SEQ ID NO: 10. In some embodiments, the variant comprises SEQ ID NO: 11. In some embodiments, the variant consists of SEQ ID NO: 11. In some embodiments, the variant comprises SEQ ID NO: 12. In some embodiments, the variant consists of SEQ ID NO: 12. In some embodiments, the variant comprises SEQ ID NO: 13. In some embodiments, the variant consists of SEQ ID NO: 13. In some embodiments, the variant comprises SEQ ID NO: 34. In some embodiments, the variant consists of SEQ ID NO: 34. In some embodiments, the variant comprises SEQ ID NO: 35. In some embodiments, the variant consists of SEQ ID NO: 35. In some embodiments, the variant comprises SEQ ID NO: 36. In some embodiments, the variant consists of SEQ ID NO: 36. In some embodiments, the variant comprises SEQ ID NO: 37. In some embodiments, the variant consists of SEQ ID NO: 37. In some embodiments, the variant comprises SEQ ID NO: 39. In some embodiments, the variant consists of SEQ ID NO: 39. In some embodiments, the variant comprises SEQ ID NO: 40. In some embodiments, the variant consists of SEQ ID NO: 40. In some embodiments, the variant comprises SEQ ID NO: 41. In some embodiments, the variant consists of SEQ ID NO: 41. In some embodiments, the variant comprises SEQ ID NO: 42. In some embodiments, the variant consists of SEQ ID NO: 42. In some embodiments, the variant comprises SEQ ID NO: 43. In some embodiments, the variant consists of SEQ ID NO: 43. In some embodiments, the variant comprises SEQ ID NO: 44. In some embodiments, the variant consists of SEQ ID NO: 44. In some embodiments, the variant comprises SEQ ID NO: 45. In some embodiments, the variant consists of SEQ ID NO: 45. In some embodiments, the variant comprises SEQ ID NO: 46. In some embodiments, the variant consists of SEQ ID NO: 46. In some embodiments, the variant comprises SEQ ID NO: 47. In some embodiments, the variant consists of SEQ ID NO: 47. In some embodiments, the variant comprises SEQ ID NO: 48. In some embodiments, the variant consists of SEQ ID NO: 48. In some embodiments, the variant comprises SEQ ID NO: 49. In some embodiments, the variant consists of SEQ ID NO: 49. In some embodiments, the variant comprises SEQ ID NO: 50. In some embodiments, the variant consists of SEQ ID NO: 50. In some embodiments, the variant comprises SEQ ID NO: 51. In some embodiments, the variantconsists of SEQ ID NO: 51. In some embodiments, the variant comprises SEQ ID NO: 52. In some embodiments, the variant consists of SEQ ID NO: 52. In some embodiments, the variant comprises SEQ ID NO: 53. In some embodiments, the variant consists of SEQ ID NO: 53. In some embodiments, the variant comprises SEQ ID NO: 54. In some embodiments, the variant consists of SEQ ID NO: 54. In some embodiments, the variant comprises SEQ ID NO: 55. In some embodiments, the variant consists of SEQ ID NO: 55. In some embodiments, the variant comprises SEQ ID NO: 56. In some embodiments, the variant consists of SEQ ID NO: 56. In some embodiments, the variant comprises SEQ ID NO: 57. In some embodiments, the variant consists of SEQ ID NO: 57. In some embodiments, the variant comprises SEQ ID NO: 58. In some embodiments, the variant consists of SEQ ID NO: 58. In some embodiments, the variant comprises SEQ ID NO: 59. In some embodiments, the variant consists of SEQ ID NO: 59. In some embodiments, the variant comprises SEQ ID NO: 60. In some embodiments, the variant consists of SEQ ID NO: 60. In some embodiments, the variant comprises SEQ ID NO: 61. In some embodiments, the variant consists of SEQ ID NO: 61. In some embodiments, the variant comprises SEQ ID NO: 62. In some embodiments, the variant consists of SEQ ID NO: 62. In some embodiments, the variant comprises SEQ ID NO: 63. In some embodiments, the variant consists of SEQ ID NO: 63. In some embodiments, the variant comprises SEQ ID NO: 64. In some embodiments, the variant consists of SEQ ID NO: 64. In some embodiments, the variant comprises SEQ ID NO: 65. In some embodiments, the variant consists of SEQ ID NO: 65. In some embodiments, the variant comprises SEQ ID NO: 66. In some embodiments, the variant consists of SEQ ID NO: 66. In some embodiments, the variant comprises SEQ ID NO: 67. In some embodiments, the variant consists of SEQ ID NO: 67. In some embodiments, the variant comprises SEQ ID NO: 68. In some embodiments, the variant consists of SEQ ID NO: 68. In some embodiments, the variant comprises SEQ ID NO: 69. In some embodiments, the variant consists of SEQ ID NO: 69. In some embodiments, the variant comprises SEQ ID NO: 70. In some embodiments, the variant consists of SEQ ID NO: 70. In some embodiments, the variant comprises SEQ ID NO: 71. In some embodiments, the variant consists of SEQ ID NO: 71. In some embodiments, the variant comprises SEQ ID NO: 72. In some embodiments, the variant consists of SEQ ID NO: 72. In some embodiments, the variant comprises SEQ ID NO: 73. In some embodiments, the variant consists of SEQ ID NO: 73. In some embodiments, the variant comprises SEQ ID NO: 74. In some embodiments, the variant consists of SEQ ID NO: 74. In some embodiments, the variant comprises SEQ ID NO: 75. In some embodiments, the variant consists of SEQ ID NO: 75. In some embodiments, the variantcomprises SEQ ID NO: 76. In some embodiments, the variant consists of SEQ ID NO: 76. In some embodiments, the variant comprises SEQ ID NO: 77. In some embodiments, the variant consists of SEQ ID NO: 77. In some embodiments, the variant comprises SEQ ID NO: 78. In some embodiments, the variant consists of SEQ ID NO: 78. In some embodiments, the variant comprises SEQ ID NO: 79. In some embodiments, the variant consists of SEQ ID NO: 79. In some embodiments, the variant comprises SEQ ID NO: 80. In some embodiments, the variant consists of SEQ ID NO: 80. In some embodiments, the variant comprises SEQ ID NO: 81. In some embodiments, the variant consists of SEQ ID NO: 81. In some embodiments, the variant comprises SEQ ID NO: 82. In some embodiments, the variant consists of SEQ ID NO: 82. In some embodiments, the variant comprises SEQ ID NO: 83. In some embodiments, the variant consists of SEQ ID NO: 83. In some embodiments, the variant comprises SEQ ID NO: 84. In some embodiments, the variant consists of SEQ ID NO: 84. In some embodiments, the variant comprises SEQ ID NO: 85. In some embodiments, the variant consists of SEQ ID NO: 85. In some embodiments, the variant comprises SEQ ID NO: 86. In some embodiments, the variant consists of SEQ ID NO: 86. In some embodiments, the variant comprises SEQ ID NO: 87. In some embodiments, the variant consists of SEQ ID NO: 87. In some embodiments, the variant comprises SEQ ID NO: 88. In some embodiments, the variant consists of SEQ ID NO: 88. In some embodiments, the variant comprises SEQ ID NO: 89. In some embodiments, the variant consists of SEQ ID NO: 89. In some embodiments, the variant comprises SEQ ID NO: 90. In some embodiments, the variant consists of SEQ ID NO: 90. In some embodiments, the variant comprises SEQ ID NO: 91. In some embodiments, the variant consists of SEQ ID NO: 91. In some embodiments, the variant comprises SEQ ID NO: 92. In some embodiments, the variant consists of SEQ ID NO: 92. In some embodiments, the variant comprises SEQ ID NO: 93. In some embodiments, the variant consists of SEQ ID NO: 93. In some embodiments, the variant comprises SEQ ID NO: 94. In some embodiments, the variant consists of SEQ ID NO: 94. In some embodiments, the variant comprises SEQ ID NO: 95. In some embodiments, the variant consists of SEQ ID NO: 95. In some embodiments, the variant comprises SEQ ID NO: 96. In some embodiments, the variant consists of SEQ ID NO: 96. In some embodiments, the variant comprises SEQ ID NO: 97. In some embodiments, the variant consists of SEQ ID NO: 97. In some embodiments, the variant comprises SEQ ID NO: 98. In some embodiments, the variant consists of SEQ ID NO: 98. In some embodiments, the variant comprises SEQ ID NO: 99. In some embodiments, the variant consists of SEQ ID NO: 99. In some embodiments, the variant comprises SEQ ID NO: 100. In some embodiments, the variantconsists of SEQ ID NO: 100. In some embodiments, the variant comprises SEQ ID NO: 101. In some embodiments, the variant consists of SEQ ID NO: 101. In some embodiments, the variant comprises SEQ ID NO: 102. In some embodiments, the variant consists of SEQ ID NO: 102. In some embodiments, the variant comprises SEQ ID NO: 103. In some embodiments, the variant consists of SEQ ID NO: 103. In some embodiments, the variant comprises SEQ ID NO: 104. In some embodiments, the variant consists of SEQ ID NO: 104. In some embodiments, the variant comprises SEQ ID NO: 105. In some embodiments, the variant consists of SEQ ID NO: 105. In some embodiments, the variant comprises SEQ ID NO: 106. In some embodiments, the variant consists of SEQ ID NO: 106. In some embodiments, the variant comprises SEQ ID NO: 107. In some embodiments, the variant consists of SEQ ID NO: 107.
[0081] In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 3. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 4. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 5. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 6. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 7. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 8. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 9. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 10. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 11. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100%sequence identity to SEQ ID NO: 12. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 13. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 34. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 35. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 36. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 37. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to any one of SEQ ID NO: 39-107. Each possibility represents a separate embodiment of the invention.
[0082] In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising at least one amino acid substitution. In some embodiments, the at least one substitution is substitution of a residue selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, L354, E401, D408, Q448, L462, T469, Q473, T477, S493P, E502, Y510, N513 and E515 of SEQ ID NO: 14. In some embodiments, the at least one substitution is substitution of a residue selected from the group consisting of: S163, A167, E170, G188, V206, S243, E269, S274, S278, E286, 1297, S313, S326, A332, E336, A346, L354, E401, D408, R423, Q448, L462, T469, Q473, T477, S493P, E502, Y510, N513 and E515 of SEQ ID NO: 14. In some embodiments, the fragment or derivative comprises the residue to be substituted. In some embodiments, the at least one substitution is a plurality of substitutions. In some embodiments, the substitution is to K, R or P. In some embodiments, the substitution is to a positively charged amino acid. In some embodiments, the substitution is to K or R. In some embodiments, the substitution is to K. In some embodiments, the plurality of substitutions are at a plurality of residues selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, L354, E401, D408, Q448, L462, T469, Q473, T477, S493P, E502, Y510, N513 and E515 of SEQ ID NO: 14. In some embodiments, the plurality of substitutions are at a plurality of residues selected from thegroup consisting of: S163, A167, E170, G188, V206, S243, E269, S274, S278, E286, 1297, S313, S326, A332, E336, A346, L354, E401, D408, R423, Q448, L462, T469, Q473, T477, S493P, E502, Y510, N513 and E515 of SEQ ID NO: 14. In some embodiments, a plurality is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 substitution. Each possibility represents a separate embodiment of the invention. In some embodiments, a plurality is at least 2 substitutions. In some embodiments, a plurality is at least 10 substitutions. In some embodiments, a plurality is at least 12 substitutions. In some embodiments, a plurality is at least 16 substitutions.
[0083] In some embodiments, the substitution is S163K. In some embodiments, the substitution is A167K. In some embodiments, the substitution is E170K. In some embodiments, the substitution is G188K. In some embodiments, the substitution is V206M. In some embodiments, the substitution is S243K. In some embodiments, the substitution is E269K. In some embodiments, the substitution is S274K. In some embodiments, the substitution is S278K. In some embodiments, the substitution is E286K. In some embodiments, the substitution is I297K. In some embodiments, the substitution is S313N. In some embodiments, the substitution is S326N. In some embodiments, the substitution is substitution of A332 to P or K (A332P / K). In some embodiments, the substitution is A332P. In some embodiments, the substitution is A332K. In some embodiments, the substitution is E336K. In some embodiments, the substitution is A346K. In some embodiments, the substitution is L354K. In some embodiments, the substitution is E401K. In some embodiments, the substitution is D408K. In some embodiments, the substitution is R423K. In some embodiments, the substitution is Q448K. In some embodiments, the substitution is L462K. In some embodiments, the substitution is T469K. In some embodiments, the substitution is Q473K. In some embodiments, the substitution is T477R. In some embodiments, the substitution is substitution of S493 to P or K (S493P / K). In some embodiments, the substitution is S493P. In some embodiments, the substitution is S493K. In some embodiments, the substitution is E502K. In some embodiments, the substitution is Y510K. In some embodiments, the substitution is N513K. In some embodiments, the substitution is E515K.
[0084] In some embodiments, the at least one amino acid substitution is a substitution of a residue selected from the group consisting of: E502 and E515 of SEQ ID NO: 14. In some embodiments, the plurality of substitutions is at a plurality of residues selected from the group consisting of: E502 and E515. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution of E502 and E515. Insome embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution of L354, E502 and E515. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution of L354, Q473, E502, N513 and E515. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution of E269, S278, E286, E336, Q448, T477, E502, Y510 and E515.
[0085] In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution at positions E502 and E515 and in at least one additional position selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, L354, E401, D408, Q448, L462, T469, Q473, T477, S493P, Y510, and N513 of SEQ ID NO: 14 or a fragment or derivative thereof. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution at positions E502 and E515 and in a plurality of position selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, L354, E401, D408, Q448, L462, T469, Q473, T477, S493P, Y510, and N513 of SEQ ID NO: 14 or a fragment thereof. In some embodiments, the plurality is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substitutions. Each possibility represents a separate embodiment of the invention.
[0086] In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution at positions E502, E515 and L354, and in at least one additional position selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, E401, D408, Q448, L462, T469, Q473, T477, S493P, Y510, and N513 of SEQ ID NO: 14 or a fragment thereof. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution at positions E502, E515 and L354, and in a plurality of positions selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, E401, D408, Q448, L462, T469, Q473, T477, S493P, Y510, and N513 of SEQ ID NO: 14 or a fragment thereof. In some embodiments, the plurality is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substitutions. Each possibility represents a separate embodiment of the invention.
[0087] In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution at positions E502, E515, L354, Q473, and N513, and in at least one additional position selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, E401, D408, Q448,L462, T469, T477, S493P, and Y510 of SEQ ID NO: 14 or a fragment thereof. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution at positions E502, E515, L354, Q473, E502, and N513, and in a plurality of positions selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, E401, D408, Q448, L462, T469, T477, S493P, and Y510 of SEQ ID NO: 14 or a fragment thereof. In some embodiments, the plurality is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 substitutions. Each possibility represents a separate embodiment of the invention.
[0088] In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution of E502K and E515K. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution of L354K, E502K and E515K. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution of L354K, Q473K, E502K, N513K and E515K. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution of E269K, S278K, E286K, E336K, Q448K, T477R, E502K, Y510K and E515K.
[0089] In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution E502K and E515K, and at least one substitution selected from: S163K, A167K, E170K, G188K, S243K, E269K, S274K, S278K, E286K, I297K, A332P, A332K, E336K, A346K, L354K, E401K, D408K, Q448K, L462K, T469K, Q473K, T477R, S493P, S493K, E502K, Y510K, N513K, and E515K. In some embodiments, the variant comprises all of S163K, A167K, E170K, G188K, V206M, S243K, E269K, S274K, S278K, E286K, I297K, S313N, S326N, A332P, E336K, A346K, L354K, E401K, D408K, R423K, Q448K, L462K, T469K, Q473K, T477R, S493P, Y510K, and N513K. In some embodiments, the variant comprises SEQ ID NO: 14 or a fragment or derivative thereof comprising substitution E502K and E515K, and a plurality of substitutions selected from: S163K, A167K, E170K, G188K, S243K, E269K, S274K, S278K, E286K, I297K, A332P, A332K, E336K, A346K, L354K, E401K, D408K, Q448K, L462K, T469K, Q473K, T477R, S493P, S493K, E502K, Y510K, N513K, and E515K. In some embodiments, the variant comprises all of S163K, A167K, E170K, G188K, V206M, S243K, E269K, S274K, S278K, E286K, I297K, S313N, S326N, A332P, E336K, A346K, L354K, E401K, D408K, R423K, Q448K, L462K, T469K, Q473K, T477R, S493P, Y510K, and N513K. In some embodiments, the plurality is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, or 21 substitutions. Each possibility represents a separate embodiment of the invention.
[0090] In some embodiments, the variant comprises at least 10 substitutions selected from: S163K, A167K, E170K, G188K, S243K, E269K, S274K, S278K, E286K, I297K, A332P, A332K, E336K, A346K, L354K, E401K, D408K, Q448K, L462K, T469K, Q473K, T477R, S493P, S493K, E502K, Y510K, N513K, and E515K. In some embodiments, the variant comprises all of S163K, A167K, E170K, G188K, V206M, S243K, E269K, S274K, S278K, E286K, I297K, S313N, S326N, A332P, E336K, A346K, L354K, E401K, D408K, R423K, Q448K, L462K, T469K, Q473K, T477R, S493P, E502K, Y510K, N513K, and E515K. In some embodiments, the variant comprises SEQ ID NO: 16. In some embodiments, the variant consists of SEQ ID NO: 16. In some embodiments, the variant comprises all of S163K, A167K, E170K, G188K, S243K, E269K, S274K, S278K, E286K, I297K, A332K, E336K, A346K, L354K, E401K, D408K, Q448K, L462K, T469K, Q473K, T477R, S493K, E502K, Y510K, N513K, and E515K. In some embodiments, the variant comprises SEQ ID NO: 38. In some embodiments, the variant consists of SEQ ID NO: 38. In some embodiments, the variant comprises all of S163K, A167K, E269K, E286K, E336K, L354K, Q473K, T477R, E502K, Y510K, N513K and E515K. In some embodiments, the variant comprises all of the following: S163K, A167K, E269K, E286K, E336K, L354K, L462K, Q473K, T477R, T469K, E502K, Y510K, N513K, E515K, S243K or S278K, and Q448K or Q473K. In some embodiments, the variant comprises all of the following: S163K, A167K, E269K, E286K, E336K, L354K, L462K, Q473K, T477R, T469K, E502K, Y510K, N513K, E515K, S243K Q448K. In some embodiments, the variant comprises all of the following: S163K, A167K, E269K, E286K, E336K, L354K, L462K, Q473K, T477R, T469K, E502K, Y510K, N513K, E515K, S243K Q473K. In some embodiments, the variant comprises all of the following: S163K, A167K, E269K, E286K, E336K, L354K, L462K, Q473K, T477R, T469K, E502K, Y510K, N513K, E515K, S278K Q448K. In some embodiments, the variant comprises all of the following: S163K, A167K, E269K, E286K, E336K, L354K, L462K, Q473K, T477R, T469K, E502K, Y510K, N513K, E515K, S278K Q473K.
[0091] In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 16. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 38. Each possibility represents a separate embodiment of the invention.
[0092] In some embodiments, the fragment comprises a deletion in the N-terminal sequence of human cGAS. In some embodiments, the fragment comprises an N-terminal truncation of human cGAS. In some embodiments, the fragment comprises amino acids 160 to 522 of SEQ ID NO: 14. In some embodiments, the fragment comprises a deletion of amino acids 1-159 of SEQ ID NO: 14. In some embodiments, the fragment comprises a deletion of amino acids 2-159 of SEQ ID NO: 14. In some embodiments, the fragment comprises a deletion of amino acids 1-130, 1-140, 1-150, 1-159 or 1-170 of SEQ ID NO: 14. Each possibility represents a separate embodiment of the invention. In some embodiments, the fragment comprises a deletion of amino acids 2-130, 2-140, 2-150, 2-159 or 2-170 of SEQ ID NO: 14. Each possibility represents a separate embodiment of the invention. In some embodiments, the fragment comprises an N-terminal methionine. In some embodiments, the fragment consists of amino acids 160 to 522 of SEQ ID NO: 14 and an N-terminal methionine. In some embodiments, the fragment comprises a wildtype sequence of SEQ ID NO: 33.
[0093] In some embodiments, the cGAS variant is homologous to SEQ ID NO: 33. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% homology to SEQ ID NO: 33. Each possibility represents a separate embodiment of the invention. In some embodiments, homology is identity. In some embodiments, the cGAS variant comprises at least 60, 65, 70, 75, 80, 85, 90, 93, 95, 97, 98, 99 or 100% sequence identity to SEQ ID NO: 33. Each possibility represents a separate embodiment of the invention. In some embodiments, the cGAS variant comprises at least 80% sequence identity to SEQ ID NO: 33. In some embodiments, the cGAS variant comprises at least 85% sequence identity to SEQ ID NO: 33. In some embodiments, the cGAS variant comprises at least 90% sequence identity to SEQ ID NO: 33. In some embodiments, the cGAS variant comprises at least 95% sequence identity to SEQ ID NO: 33. In some embodiments, the cGAS variant comprises at least 99% sequence identity to SEQ ID NO: 33. In some embodiments, the at least one mutation is made in SEQ ID NO: 33.
[0094] In some embodiments, the variant comprises or consists of a sequence selected from SEQ ID NO: 16, 38 and 108-174. In some embodiments, the variant comprises SEQ ID NO: 16. In some embodiments, the variant consists of SEQ ID NO: 16. In some embodiments, the variant comprises SEQ ID NO: 38. In some embodiments, the variant consists of SEQ ID NO: 38. In some embodiments, the variant comprises SEQ ID NO: 108. In some embodiments, the variant consists of SEQ ID NO: 108. In some embodiments, the variant comprises SEQ ID NO: 109. In some embodiments, the variant consists of SEQ ID NO: 109. In some embodiments, the variant comprises SEQ ID NO: 110. In some embodiments, thevariant consists of SEQ ID NO: 110. In some embodiments, the variant comprises SEQ ID NO: 111. In some embodiments, the variant consists of SEQ ID NO: 111. In some embodiments, the variant comprises SEQ ID NO: 112. In some embodiments, the variant consists of SEQ ID NO: 112. In some embodiments, the variant comprises SEQ ID NO: 113. In some embodiments, the variant consists of SEQ ID NO: 113. In some embodiments, the variant comprises SEQ ID NO: 114. In some embodiments, the variant consists of SEQ ID NO: 114. In some embodiments, the variant comprises SEQ ID NO: 115. In some embodiments, the variant consists of SEQ ID NO: 115. In some embodiments, the variant comprises SEQ ID NO: 116. In some embodiments, the variant consists of SEQ ID NO: 116. In some embodiments, the variant comprises SEQ ID NO: 117. In some embodiments, the variant consists of SEQ ID NO: 117. In some embodiments, the variant comprises SEQ ID NO: 118. In some embodiments, the variant consists of SEQ ID NO: 118. In some embodiments, the variant comprises SEQ ID NO: 119. In some embodiments, the variant consists of SEQ ID NO: 119. In some embodiments, the variant comprises SEQ ID NO: 120. In some embodiments, the variant consists of SEQ ID NO: 120. In some embodiments, the variant comprises SEQ ID NO: 121. In some embodiments, the variant consists of SEQ ID NO: 121. In some embodiments, the variant comprises SEQ ID NO: 122. In some embodiments, the variant consists of SEQ ID NO: 122. In some embodiments, the variant comprises SEQ ID NO: 123. In some embodiments, the variant consists of SEQ ID NO: 123. In some embodiments, the variant comprises SEQ ID NO: 124. In some embodiments, the variant consists of SEQ ID NO: 124. In some embodiments, the variant comprises SEQ ID NO: 125. In some embodiments, the variant consists of SEQ ID NO: 125. In some embodiments, the variant comprises SEQ ID NO: 126. In some embodiments, the variant consists of SEQ ID NO: 126. In some embodiments, the variant comprises SEQ ID NO: 127. In some embodiments, the variant consists of SEQ ID NO: 127. In some embodiments, the variant comprises SEQ ID NO: 128. In some embodiments, the variant consists of SEQ ID NO: 128. In some embodiments, the variant comprises SEQ ID NO: 129. In some embodiments, the variant consists of SEQ ID NO: 129. In some embodiments, the variant comprises SEQ ID NO: 130. In some embodiments, the variant consists of SEQ ID NO: 130. In some embodiments, the variant comprises SEQ ID NO: 131. In some embodiments, the variant consists of SEQ ID NO: 131. In some embodiments, the variant comprises SEQ ID NO: 132. In some embodiments, the variant consists of SEQ ID NO: 132. In some embodiments, the variant comprises SEQ ID NO: 133. In some embodiments, the variant consists of SEQ ID NO: 133. In some embodiments, the variant comprises SEQ ID NO: 134. In some embodiments, the variant consists of SEQ ID NO: 134. In some embodiments, thevariant comprises SEQ ID NO: 135. In some embodiments, the variant consists of SEQ ID NO: 135. In some embodiments, the variant comprises SEQ ID NO: 136. In some embodiments, the variant consists of SEQ ID NO: 136. In some embodiments, the variant comprises SEQ ID NO: 137. In some embodiments, the variant consists of SEQ ID NO: 137. In some embodiments, the variant comprises SEQ ID NO: 138. In some embodiments, the variant consists of SEQ ID NO: 138. In some embodiments, the variant comprises SEQ ID NO: 139. In some embodiments, the variant consists of SEQ ID NO: 139. In some embodiments, the variant comprises SEQ ID NO: 140. In some embodiments, the variant consists of SEQ ID NO: 140. In some embodiments, the variant comprises SEQ ID NO: 141. In some embodiments, the variant consists of SEQ ID NO: 141. In some embodiments, the variant comprises SEQ ID NO: 142. In some embodiments, the variant consists of SEQ ID NO: 142. In some embodiments, the variant comprises SEQ ID NO: 143. In some embodiments, the variant consists of SEQ ID NO: 143. In some embodiments, the variant comprises SEQ ID NO: 144. In some embodiments, the variant consists of SEQ ID NO: 144. In some embodiments, the variant comprises SEQ ID NO: 145. In some embodiments, the variant consists of SEQ ID NO: 145. In some embodiments, the variant comprises SEQ ID NO: 146. In some embodiments, the variant consists of SEQ ID NO: 146. In some embodiments, the variant comprises SEQ ID NO: 147. In some embodiments, the variant consists of SEQ ID NO: 147. In some embodiments, the variant comprises SEQ ID NO: 148. In some embodiments, the variant consists of SEQ ID NO: 148. In some embodiments, the variant comprises SEQ ID NO: 149. In some embodiments, the variant consists of SEQ ID NO: 149. In some embodiments, the variant comprises SEQ ID NO: 150. In some embodiments, the variant consists of SEQ ID NO: 150. In some embodiments, the variant comprises SEQ ID NO: 151. In some embodiments, the variant consists of SEQ ID NO: 151. In some embodiments, the variant comprises SEQ ID NO: 152. In some embodiments, the variant consists of SEQ ID NO: 152. In some embodiments, the variant comprises SEQ ID NO: 153. In some embodiments, the variant consists of SEQ ID NO: 153. In some embodiments, the variant comprises SEQ ID NO: 154. In some embodiments, the variant consists of SEQ ID NO: 154. In some embodiments, the variant comprises SEQ ID NO: 155. In some embodiments, the variant consists of SEQ ID NO: 155. In some embodiments, the variant comprises SEQ ID NO: 156. In some embodiments, the variant consists of SEQ ID NO: 156. In some embodiments, the variant comprises SEQ ID NO: 157. In some embodiments, the variant consists of SEQ ID NO: 157. In some embodiments, the variant comprises SEQ ID NO: 158. In some embodiments, the variant consists of SEQ ID NO: 158. In some embodiments, the variant comprises SEQ ID NO: 159. In some embodiments, thevariant consists of SEQ ID NO: 159. In some embodiments, the variant comprises SEQ ID NO: 160. In some embodiments, the variant consists of SEQ ID NO: 160. In some embodiments, the variant comprises SEQ ID NO: 161. In some embodiments, the variant consists of SEQ ID NO: 161. In some embodiments, the variant comprises SEQ ID NO: 162. In some embodiments, the variant consists of SEQ ID NO: 162. In some embodiments, the variant comprises SEQ ID NO: 163. In some embodiments, the variant consists of SEQ ID NO: 163. In some embodiments, the variant comprises SEQ ID NO: 164. In some embodiments, the variant consists of SEQ ID NO: 164. In some embodiments, the variant comprises SEQ ID NO: 165. In some embodiments, the variant consists of SEQ ID NO: 165. In some embodiments, the variant comprises SEQ ID NO: 166. In some embodiments, the variant consists of SEQ ID NO: 166. In some embodiments, the variant comprises SEQ ID NO: 167. In some embodiments, the variant consists of SEQ ID NO: 167. In some embodiments, the variant comprises SEQ ID NO: 168. In some embodiments, the variant consists of SEQ ID NO: 168. In some embodiments, the variant comprises SEQ ID NO: 169. In some embodiments, the variant consists of SEQ ID NO: 169. In some embodiments, the variant comprises SEQ ID NO: 170. In some embodiments, the variant consists of SEQ ID NO: 170. In some embodiments, the variant comprises SEQ ID NO: 171. In some embodiments, the variant consists of SEQ ID NO: 171. In some embodiments, the variant comprises SEQ ID NO: 172. In some embodiments, the variant consists of SEQ ID NO: 172. In some embodiments, the variant comprises SEQ ID NO: 173. In some embodiments, the variant consists of SEQ ID NO: 173. In some embodiments, the variant comprises SEQ ID NO: 174. In some embodiments, the variant consists of SEQ ID NO: 174.
[0095] By another aspect, there is provided a nucleic acid molecule comprising an open reading frame encoding a cGAS variant of the invention.
[0096] In some embodiments, the cGAS variant of the present disclosure is further linked to an additional peptide or polypeptide or protein. In some embodiments, the cGAS variant is part of a chimeric protein. In some embodiments, the cGAS variant is part of a fusion protein. In some embodiments, the cGAS variant is linked to an antibody. In some embodiments, the cGAS variant is linked to a navigator peptide or element. In some embodiments, the cGAS variant is linked to a small molecule.
[0097] The term "nucleic acid" is well known in the art. A "nucleic acid" as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or acytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). In some embodiments, the nucleic acid molecule is a DNA molecule. In some embodiments, the nucleic acid molecule is an RNA molecule. In some embodiments, the nucleic acid molecule is an mRNA. In some embodiments, the nucleic acid molecule is a translatable molecule.
[0098] In some embodiments, the nucleic acid molecule is a vector. In some embodiments, the vector is an expression vector. In some embodiments, the expression vector comprises at least one regulatory element configured to express the encoded protein in a target cell. In some embodiments, the nucleic acid molecule is a plasmid. In some embodiments, the nucleic acid molecule is suitable for in vitro transcription. In some embodiments, the nucleic acid molecule is suitable for in vitro translation. In some embodiments, the expression vector is a mammalian expression vector. In some embodiments, the expression vector is a human expression vector. In some embodiments, an open reading frame is a coding region.
[0099] The term "expression" as used herein refers to the biosynthesis of a gene product, including the transcription and / or translation of said gene product. Thus, expression of a nucleic acid molecule may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or other functional RNA) and / or translation of RNA into a precursor or mature protein (polypeptide).
[0100] Expressing a gene or protein within a cell is well known to one skilled in the art. It can be carried out by, among many methods, transfection, viral infection, or direct alteration of the cell’s genome. In some embodiments, the gene is in an expression vector such as plasmid or viral vector. In some embodiments, the nucleic acid molecule encoding the protein of interest is delivered by lipid nanoparticle (LNP).
[0101] A vector nucleic acid sequence generally contains at least an origin of replication for propagation in a cell and optionally additional elements, such as a heterologous polynucleotide sequence, expression control element (e.g., a promoter, enhancer), selectable marker (e.g., antibiotic resistance), poly-Adenine sequence.
[0102] The vector may be a DNA plasmid delivered via non-viral methods or via viral methods. The viral vector may be a retroviral vector, a herpesviral vector, an adenoviral vector, an adeno-associated viral vector or a poxviral vector, a lenti-virus. The promoters may be active in mammalian cells. The promoter may be a viral promoter.
[0103] In some embodiments, the gene is operably linked to a promoter. The term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element or elements in a manner that allows for expression of the nucleotide sequence (e.g.,in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).
[0104] In some embodiments, the vector is introduced into the cell by standard methods including electroporation (e.g., as described in From et al., Proc. Natl. Acad. Sei. USA 82, 5824 (1985)), Heat shock, infection by viral vectors, high velocity ballistic penetration by small particles with the nucleic acid either within the matrix of small beads or particles, or on the surface (Klein et al., Nature 327. 70-73 (1987)), lipid transfectant (e.g., lipofectamine) and / or the like.
[0105] The term "promoter" as used herein refers to a group of transcriptional control modules that are clustered around the initiation site for an RNA polymerase i.e., RNA polymerase II. Promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.
[0106] In some embodiments, nucleic acid sequences are transcribed by RNA polymerase II (RNAP II and Pol II). RNAP II is an enzyme found in eukaryotic cells. It catalyzes the transcription of DNA to synthesize precursors of mRNA and most snRNA and microRNA.
[0107] In some embodiments, mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (±), pGL3, pZeoSV2(±), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK- RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
[0108] In some embodiments, expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses are used by the present invention. SV40 vectors include pSVT7 and pMT2. In some embodiments, vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo- 5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallo thionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
[0109] In some embodiments, recombinant viral vectors, which offer advantages such as lateral infection and targeting specificity, are used for in vivo expression. In oneembodiment, lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. In one embodiment, the result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. In one embodiment, viral vectors are produced that are unable to spread laterally. In one embodiment, this characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
[0110] Various methods can be used to introduce the expression vector of the present invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
[0111] It will be appreciated that other than containing the necessary elements for the transcription and translation of the inserted coding sequence (encoding the polypeptide), the expression construct of the present invention can also include sequences engineered to optimize stability, production, purification, yield or activity of the expressed polypeptide.
[0112] In some embodiments, the nucleic acid molecule further comprises at least one microRNA (miR) binding site. In some embodiments, the binding site is in an untranslated region (UTR). In some embodiments, the UTR is a 5’ UTR. In some embodiments, the UTR is a 3’ UTR. In some embodiments, the binding site is in a coding region. In some embodiments, the binding site is in the coding region near the N-terminus of the coding region. In some embodiments, the binding site is in the coding region near the C-terminus of the coding region. In some embodiments, the coding region is the coding region of the variant. In some embodiments, near is within 100, 90, 80, 75, 70, 60, 50, 40, 30, 25, 20 or 10 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the binding site is at the C-terminus. In some embodiments, the binding site is at the N-terminus. In some embodiments,the binding site is immediately after the codon coding for the N-terminal methionine.
[0113] In some embodiments, the binding site is for miR expressed in a tissue. In some embodiments, the tissue is an off-target tissue. In some embodiments, the tissue is not an immune cell. In some embodiments, the miR is not expressed by immune cells. In some embodiments, the immune cells are antigen-presenting cells. In some embodiments, an antigen presenting cell is a selected from a monocyte, a macrophage, and a dendritic cell. In some embodiments, the tissue is selected from a tissue provided in Table 3. In some embodiments, the tissue is selected from liver, muscle, kidney, brain, skin and lung. In some embodiments, the tissue is liver. In some embodiments, the miR is selected from the miRs provided in Table 3. In some embodiments, the tissue is a tissue selected from Table 3 and the miR is a miR provided in Table 3corresponding to that tissue. In some embodiments, the miR is miR- 122.
[0114] By another aspect, there is provided a composition comprising a cGAS variant of the invention.
[0115] By another aspect, there is provided a composition comprising a nucleic acid molecule of the invention.
[0116] In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier, or excipient. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier, excipient or adjuvant. In some embodiments, the composition further comprises an additional adjuvant.
[0117] As used herein, the term “carrier” or “excipient” refers to any component of a pharmaceutical composition that is not the active agent. As used herein, the term “pharmaceutically acceptable carrier” refers to non-toxic, inert solid, semi-solid liquid filler, diluent, encapsulating material, formulation auxiliary of any type, or simply a sterile aqueous medium, such as saline. Some examples of the materials that can serve as pharmaceutically acceptable carriers are sugars, such as lactose, glucose and sucrose, starches such as corn starch and potato starch, cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt, gelatin, talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol, polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate, agar; buffering agents such as magnesium hydroxide andaluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline, Ringer's solution; ethyl alcohol and phosphate buffer solutions, as well as other non-toxic compatible substances used in pharmaceutical formulations. Suitable pharmaceutically acceptable carriers, excipients, and diluents in this regard are well known to those of skill in the art, such as those described in The Merck Index, Thirteenth Edition, Budavari et al., Eds., Merck & Co., Inc., Rahway, N.J. (2001); the CTFA (Cosmetic, Toiletry, and Fragrance Association) International Cosmetic Ingredient Dictionary and Handbook, Tenth Edition (2004); and the “Inactive Ingredient Guide,” U.S. Food and Drug Administration (FDA) Center for Drug Evaluation and Research (CDER) Office of Management, the contents of all of which are hereby incorporated by reference in their entirety. Examples of pharmaceutically acceptable excipients, carriers and diluents useful in the present compositions include distilled water, physiological saline, Ringer's solution, dextrose solution, Hank's solution, and DMSO. These additional inactive components, as well as effective formulations and administration procedures, are well known in the art and are described in standard textbooks, such as Goodman and Gillman’s: The Pharmacological Bases of Therapeutics, 8th Ed., Gilman et al. Eds. Pergamon Press (1990); Remington’s Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa. (1990); and Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott Williams & Wilkins, Philadelphia, Pa., (2005), each of which is incorporated by reference herein in its entirety. The presently described composition may also be contained in artificially created structures such as liposomes, ISCOMS, slow -releasing particles, and other vehicles which increase the half-life of the peptides or polypeptides in serum. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. Liposomes for use with the presently described peptides are formed from standard vesicle-forming lipids which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally determined by considerations such as liposome size and stability in the blood. A variety of methods are available for preparing liposomes as reviewed, for example, by Coligan, J. E. et al, Current Protocols in Protein Science, 1999, John Wiley & Sons, Inc., New York, and see also U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369.
[0118] The carrier may comprise, in total, from about 0.1% to about 99.99999% by weight of the pharmaceutical compositions presented herein.
[0119] In some embodiments, the composition comprises a therapeutically effective amount of the cGAS variant. In some embodiments, the composition comprises a therapeuticallyeffective amount of the nucleic acid molecule. In some embodiments, therapeutically effective is effective in enhancing an immune response. In some embodiments, therapeutically effective is effective in inducing an immune response. The term "therapeutically effective amount" can refer to a number of cells effective to treat a disease or disorder in a mammal. The term “a therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic, enhancing or prophylactic result. The exact dosage form and regimen would be determined by the physician according to the patient's condition.
[0120] In some embodiments, the composition is formulated for administration to a subject. In some embodiments, the subject is a human. In some embodiments, administration is systemic administration. As used herein, the terms “administering,” “administration,” and like terms refer to any method which, in sound medical practice, delivers a composition containing an active agent to a subject in such a manner as to provide a therapeutic effect. One aspect of the present subject matter provides for intramuscular administration of a therapeutically effective amount of a composition of the present subject matter to a patient in need thereof. Other suitable routes of administration can include parenteral, subcutaneous, oral, intravenous, nasal, intrathecal, intracranial and intraperitoneal.
[0121] The dosage administered will be dependent upon the age, health, and weight of the recipient, type of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
[0122] In some embodiments, the cGAS protein variant or the nucleic acid molecule is encapsulated in a nanoparticle. In some embodiments, the composition is a liquid nanoparticle (LNP) composition. In some embodiments, the nanoparticle is a LNP. LNPs are well known in the art and any LNP known can be used. In particular LNPs whose use in delivery of nucleic acid molecules, and in particular RNA, and even more in particular mRNA, has been demonstrated will be used. LNPs for delivery of RNA are well known.
[0123] By another aspect, there is provided a method of inducing an immune response in a subject, the method comprising introducing a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention into the subject, thereby inducing an immune response. By a further aspect, there is provided a method of inducing an immune response against a target, the method comprising introducing a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention, thereby inducing an immune response against a target.
[0124] By another aspect, there is provided a method of inducing an immune response against a target cell, the method comprising introducing into the target cell a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention, thereby inducing an immune response against a target cell.
[0125] By another aspect, there is provided a method of inducing an immune response in a subject, the method comprising administering to the subject a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention, thereby inducing an immune response in a subject.
[0126] By another aspect, there is provided a method of treating a disease or condition in a subject, the method comprising administering the composition of the invention to the subject, thereby treating the disease or condition.
[0127] By another aspect, there is provided a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention for use in inducing an immune response in a target cell.
[0128] By another aspect, there is provided a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention for use in inducing an immune response in a subject.
[0129] By another aspect, there is provided a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention for use in treating a disease or condition.
[0130] By another aspect, there is provided a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention for use in the production of a medicament for inducing an immune response in a target cell.
[0131] By another aspect, there is provided a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention for use in the production of a medicament for inducing an immune response in a subject.
[0132] By another aspect, there is provided a cGAS variant of the invention, a nucleic acid molecule of the invention or a composition of the invention for use in the production of a medicament for treating a disease or condition.
[0133] In some embodiments, the target cell is in a subject. In some embodiments, the target cell is a disease cell. In some embodiments, the subject is in need of a method of the invention. In some embodiments, the subject suffers from a disease or condition. In someembodiments, the disease or condition is characterized by a pathological cell. In some embodiments, the target cell is a pathological cell. In some embodiments, the disease is treatable by inducing an immune response. In some embodiments, the immune response is an immune response against the target cell. In some embodiments, the target cell does not comprise cytoplasmic DNA.
[0134] In some embodiments, the disease is a proliferative disease. In some embodiments, the proliferative disease is cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the pathological cell is a cancer cell. As used herein "cancer" or "premalignancy" are diseases associated with cell proliferation. In some embodiments, the cancer is selected from hepato-biliary cancer, brain cancer (e.g., glioblastoma), cervical cancer, urogenital cancer (e.g., urothelial cancer), testicular cancer, prostate cancer, thyroid cancer, ovarian cancer, nervous system cancer, ocular cancer, lung cancer, soft tissue cancer (e.g., synovial sarcoma and liposarcoma), bone cancer, pancreatic cancer, bladder cancer, skin cancer, intestinal cancer, hepatic cancer, rectal cancer, colorectal cancer, esophageal cancer, gastric cancer, gastroesophageal cancer, breast cancer (e.g., triple negative breast cancer), renal cancer (e.g., renal carcinoma), skin cancer, head and neck cancer, leukemia and lymphoma. In some embodiments, the cancer is selected from breast cancer and ovarian cancer. In some embodiments, the cancer is not characterized by the presence of cytoplasmic DNA. In some embodiments, the DNA is single stranded. In some embodiments, the DNA is double stranded. In some embodiments, the pathological cell is a cancerous cell.
[0135] In some embodiments, the disease is an infectious disease. In some embodiments, the pathological cell is an infected cell. In some embodiments, the subject is infected with a pathogen. In some embodiments, the pathological cell is a cell of the pathogen. In some embodiments, the pathogen is a bacterium. In some embodiments, the disease is a bacterial infection. In some embodiments, the pathological cell is a bacterial cell. In some embodiments, the pathological cell is a cell infected with a bacterium. In some embodiments, the disease is a viral infection. In some embodiments, the pathological cell is a cell infected with the virus. In some embodiments, the pathogen is a virus. In some embodiments, the pathogen is a parasite. In some embodiments, the disease is parasitic infection. In some embodiments, the pathological cell is a cell of the parasite. In some embodiments, a pathological cell is a cell infected with the parasite. In some embodiments, the pathological cell is an infected cell.
[0136] In some embodiments, introducing is exogenously introducing. In some embodiments, introducing is expressing. In some embodiments, exogenously expressingcomprises overexpression. In some embodiments, in a cell is in the cytoplasm of the cell. In some embodiments, expressing is expressing in the cytoplasm of the cell. In some embodiments, in a cell is the endoplasmic reticulum (ER) of a cell. In some embodiments, expressing is expressing in the ER of the cell. In some embodiments, expressing is expressing in the nucleus of the cell. In some embodiments, expressing is expressing in the mitochondria of the cell. In some embodiments, expressing is contacting. In some embodiments, expressing is contacting the cell. In some embodiments, the contacting induces expression in the cytoplasm. In some embodiments, contacting is contacting with the cytoplasm of the target cell. In some embodiments, contacting is contacting with the ER of the target cell. In some embodiments, overexpressing comprises contacting the target cell with the immune sensor protein. In some embodiments, overexpressing comprises contacting the target cell with an mRNA encoding the immune sensor protein. In some embodiments, overexpressing comprises contacting the target cell with a nucleic acid expression vector comprising an open reading frame encoding the cGAS protein variant. In some embodiments, the open reading frame is operatively linked to a regulatory element active in the target cell. In some embodiments, the regulatory element is a promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a conditional promoter. In some embodiments, the promoter is a tissue or cell type- specific promoter. In some embodiments, the promoter can be induced or activated in the target cell.
[0137] In some embodiments, overexpressing comprises transferring the cGAS variants to the target cell. In some embodiments, transferring is transferring from an LNP. In some embodiments, transferring is transferring with an LNP. In some embodiments, transferring is transferring from an exosome. In some embodiments, transferring is transferring a nucleic acid molecule encoding the cGAS variant to the target cell. In some embodiments, transferring is transferring a polypeptide / protein to the target cell. In some embodiments, transferring is transferring from a delivery cell to the target cell. In some embodiments, the delivery cell is a cell that expresses Granzyme. In some embodiments, the delivery cell naturally expresses Granzyme. In some embodiments, the delivery cell expresses Granzyme before modification. In some embodiments, the Granzyme is Granzyme B. In some embodiments, the delivery cell is a cell that expresses Perforin. In some embodiments, the delivery cell expresses perforin before the modification. In some embodiments, the delivery cell is a cell that expresses Granzyme and Perforin. In some embodiments, expression is secretion. Cells that express / secrete the combination of Granzyme and Perforin are wellknown in the art and any such cells may be used. In some embodiments, the delivery cell is an immune cell. In some embodiments the delivery cell is a white blood cell. In some embodiments, the delivery cell is a leukocyte. In some embodiments, a leukocyte is a lymphocyte or a myeloid cell. In some embodiments, the cell is a CD45+ cell. In some embodiments, the white blood cell (CD45+ cell) expresses Granzyme and / or Perforin. In some embodiments, the delivery cell is capable of forming an immune synapse. In some embodiments, the delivery cell is a cell that produces immune synapses. In some embodiments, the delivery cell is characterized by the ability to form an immune synapse with a target cell. In some embodiments, the delivery cell is a lymphocyte. In some embodiments, the delivery cell is a myeloid cell. In some embodiments, the delivery cell is selected from a lymphocyte and a myeloid cell. In some embodiments, the myeloid cell is a macrophage. In some embodiments, myeloid cells comprise macrophages. In some embodiments, the myeloid cell is a dendritic cell. In some embodiments, myeloid cells comprise dendritic cells. In some embodiments, the lymphocyte is a T cell. In some embodiments, the lymphocyte is an NK cell. In some embodiments, the lymphocyte is selected from a T cell and an NK cell. In some embodiments, the delivery cell is selected from a T cell, an NK cell and a myeloid cell. In some embodiments, the delivery cell is selected from a T cell, an NK cell and a macrophage. In some embodiments, a cell that can form an immune synapse is selected from a T cell, an NK cell, a B cell, a mast cell, a neutrophil and a macrophage. In some embodiments, a cell that can form an immune synapse is selected from a T cell, an NK cell, a B cell, a mast cell, a neutrophil, a monocyte, a dendritic cell, and a myeloid cell. In some embodiments, a cell that can form an immune synapse is selected from a T cell, an NK cell, a B cell, a mast cell and a macrophage. In some embodiments, a cell that can form an immune synapse is selected from a T cell, an NK cell, a B cell, and a macrophage. In some embodiments, a cell that can form an immune synapse is selected from a T cell, an NK cell, a B cell, a mast cell and a macrophage. In some embodiments, a cell that can form an immune synapse is selected from a T cell, an NK cell, a B cell, and a myeloid cell. In some embodiments, a cell that can form an immune synapse is selected from a T cell, an NK cell, and a macrophage. In some embodiments, a cell that can form an immune synapse is selected from a T cell, an NK cell, and a myeloid cell. In some embodiments, the delivery cell is selected from a lymphocyte and a cell that is capable of producing a phagocytic synapse. In some embodiments, an immune synapse is a phagocytic synapse. In some embodiments, the delivery cell is selected from a lymphocyte and a macrophage.In some embodiments, the delivery cell is selected from a lymphocyte and a myeloid cell.
[0138] As used herein, the terms “immune synapse” and “immunological synapse” are used interchangeably and refer to a physical interface between an immune cell and a target cell, which is often an antigen-presenting cell. In some embodiments, an immune synapse is a supramolecular activation cluster. In some embodiments, the synapse comprises three concentric rings of protein clusters that mediate transfer of proteins between the immune cell and its target. In some embodiments, the synapse comprises adhesion molecules in the periphery. It will be understood by a skilled artisan that the adhesion molecules of the immunological synapse result in increased avidity and sustained contact between effector and target cell. This increased avidity / contact enables more potent transport of molecules. In this way synapse formation produces a solution to the problem of successful and efficient transfer of therapeutic molecules. In some embodiments, the synapse comprises a high density of T cell receptors and co -stimulatory molecules. In some embodiments, the high density is in the center of the immunological synapse. In some embodiments, immune synapse formation triggers immune cell activation. In some embodiments, immune synapse formation triggers lymphocyte activation. In some embodiments, immune synapse formation triggers T cell activation. In some embodiments, activation is activation above a minimum threshold needed for execution of effector function. In some embodiments, activation is activation above or equal to artificial activation by an anti-CD3 antibody. In some embodiments, activation is activation above or equal to artificial activation by IL-2. In some embodiments, activation is activation above artificial activation by an anti-CD3 antibody. In some embodiments, activation is activation above artificial activation by IL-2.
[0139] In some embodiments, the delivery cell is a cell of adoptive cell transfer. In some embodiments, the delivery cell is a therapeutic cell. In some embodiments, the delivery cell is a tumor infiltrating lymphocyte (TIL). In some embodiments, the delivery cell is an adoptive T cell. In some embodiments, the delivery cell is an adoptive NK cell. In some embodiments, the delivery cell is a CAR cell. In some embodiments, the CAR cell is a CAR T cell. In some embodiments, the CAR cell is a CAR NK cell. In some embodiments, the delivery cell is a cell in culture. In some embodiments, the delivery cell has been expanded. In some embodiments, the delivery cell is in vivo.
[0140] In some embodiments, the cell is modified to express the cGAS variant. In some embodiments, the modification is performed in-vitro or ex-vivo. In some embodiments, the modification is performed in vivo. In some embodiments, the modification is performed by introduction of the immune sensor protein or a nucleotide sequence encoding the immunesensor protein. In some embodiments, the modification is performed by introduction of cGAS variant or a nucleotide sequence encoding the cGAS variant. In vitro introduction of a molecule of interest to cells is well known in the art and may be performed for a nonlimiting example by electroporation, transfection, infection, by plasmid, virus and liposomes. In some embodiments, the modification is performed by introducing a nucleotide sequence and / or molecule (e.g., DNA and RNA) to be expressed in the lymphocyte.
[0141] Methods of recombinant protein generation and recombinant DNA generation are well known in the art, and any such method for making the molecules of the invention may be employed. As used herein, the term “recombinant protein” refers to a protein which is coded for by a recombinant nucleic acid molecule (DNA or RNA) and is thus not naturally occurring. The term “recombinant DNA or RNA” refers to DNA or RNA molecules formed by laboratory methods of genetic recombination. Generally, this recombinant molecule is in the form of an mRNA, a vector, a plasmid or a virus, used to express the recombinant protein in a cell.
[0142] As used herein, the terms “peptide”, "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues. In another embodiment, the terms "peptide", "polypeptide" and "protein" as used herein encompass native peptides, peptidomimetics (typically including non-peptide bonds or other synthetic modifications) and the peptide analogues peptoids and semipeptoids or any combination thereof. In another embodiment, the peptides polypeptides and proteins described have modifications rendering them more stable or mor active while in the body or more capable of penetrating into cells. In one embodiment, the terms “peptide”, "polypeptide" and "protein" apply to naturally occurring amino acid polymers. In another embodiment, the terms “peptide”, "polypeptide" and "protein" apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid. Methods of identifying protein location are well known in the art, the include immunohistochemistry, immuno staining, fluorescent staining, and many others. Any method of protein identification, localization, and / or visualization may be used.
[0143] In some embodiments, the cGAS variant is constitutively active. In some embodiments, constitutively active comprises catalyzing cGAMP synthesis constitutively. In some embodiments, constitutively active comprises catalyzing CDN synthesis constitutively. In some embodiments, constitutively active comprises constitutive activation of STING. In some embodiments, constitutively active comprises constitutive induction of interferon secretion. In some embodiments, interferon is a type I interferon. In someembodiments, interferon is interferon beta. In some embodiments, interferon is interferon alpha. In some embodiments, constitutively is in the absence of DNA. In some embodiments, DNA is single stranded DNA. In some embodiments, DNA is double stranded DNA. In some embodiments, DNA is cytosolic DNA. In some embodiment, constitutively active is active in the absence of oligomerization. In some embodiments, constitutively active is constitutively active in the cytoplasm of a cell. In some embodiments, the cell is a cell that does not comprise cytoplasmic DNA. In some embodiments, does not comprise is does not comprise above levels present in healthy cells. In some embodiments, constitutively active is constitutively active in the nucleus of a cell. In some embodiments, the cGAS variant does not exist in nature. In some embodiments, the cGAS variant is not a naturally occurring protein.
[0144] The variant cGAS proteins of the invention are superior to constitutively active cGAS protein known in the art. For a non-limiting example, human cGAS comprising a R236E (arginine 236 to glutamic acid) mutation or comprising an R255E (arginine 255 to glutamic acid) mutation or both has been shown to be constitutively active but is inferior to the molecules of the invention in its ability to constitutively induce cGAMP, CDNs, interferon and an immune response.
[0145] In some embodiments, the method induces an immune response against the target cell. In some embodiments, the method further induces an immune response against cells adjacent to the target cell. In some embodiments, the method further induces an immune response against cells proximal to the target cell. In some embodiments, proximal is within the same tissue. In some embodiments, proximal is within the same tumor. In some embodiments, proximal is within the same metastasis. In some embodiments, proximal is within at most 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 cells. Each possibility represents a separate embodiment of the invention. In some embodiments, cells is cell diameters.
[0146] In some embodiments, the method induces cGAMP production in the target cell. In some embodiments, the method induces CDN production in the target cell. In some embodiments, the method induces STING activation in the target cell. In some embodiments, the method induces interferon secretion from the target cell. In some embodiments, interferon is a Type I interferon. In some embodiments, interferon is interferon beta. In some embodiments, interferon is interferon alpha. In some embodiments, the method induces cGAMP transfer to the adjacent cells. In some embodiments, the method induces cGAMP transfer to the proximal cells. In some embodiments, the method induces CDN transfer tothe adjacent cells. In some embodiments, the method induces CDN transfer to the proximal cells. In some embodiments, the method induces interferon secretion from adjacent cells. In some embodiments, the method induces interferon secretion from proximal cells.
[0147] Cyclic dinucleotides (CDNs) are cyclic molecules comprising only two monophosphate bases connected to each other by two phosphodiester bonds. Examples of CDNs include cGAMP, c-di-GMP and c-di-AMP for example. In some embodiments, the CDN is a 2’3’-CDN. In some embodiments, the CDN is a 2’5’-CDN. In some embodiments, the CDN is a 3’5’-CDN. In some embodiments, the CDN is cGAMP. In some embodiments, the CDN is a c-di-AMP. In some embodiments, the CDN is 2’ 5 ’-cGAMP. In some embodiments, the CDN is 3’5’-cGAMP. In some embodiments, cGAS produces 2’5’- cGAMP. In some embodiments, DNCV and / or DNCV2 produce 3’5’-cGAMP. In some embodiments, disA and / or dacA produce c-di-AMP.
[0148] In some embodiments, the target cell is in a subject suffering from a disease and the method is a method of treating the disease. In some embodiments, the method comprises administering a composition of the invention to the subject, thereby treating the disease. In some embodiments, the disease is characterized by the presence of a pathological cell. In some embodiments, the target cell is the pathological cell. In some embodiments, the target cell is proximal to the pathological cell. In some embodiments, the disease is treatable by inducing an immune response in the subject. In some embodiments, the disease is treatable by inducing an immune response against the target cell. In some embodiments, the disease is treatable by inducing an immune response against the pathological cell. In some embodiments, the disease is cancer. In some embodiments, the method is a method of treating cancer. In some embodiments, the pathological cell is a cancerous cell. In some embodiments, the target cell is a cancerous cell. The use of cGAS and specifically constitutively active or overactive forms of cGAS to treat cancer is well know in the art, and support for this treatment modality can be found for example in International Patent Publications WO2023 / 161178, W02019 / 014391, WO2022 / 221188, W02020 / 006038, WO2023 / 220746 and WO2023220747, the contents of which are hereby incorporated by reference in their entireties. In some embodiments, superior is superior to at least one of: SEQ ID NO: 19-28 and 30-31.
[0149] By another aspect, there is provided a method of enhancing an immune response in a subject, the method comprising administering a composition of the invention to the subject, thereby enhancing an immune response.
[0150] In some embodiments, the method is an in vivo method. In some embodiments, the method is an in vitro method. In some embodiments, the method is an ex vivo method.
[0151] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is in need of the method of the invention. In some embodiments, the subject is receiving a vaccine. In some embodiments, the immune response is response to the vaccine. In some embodiments, the method is a method of enhancing the response to a vaccine. In some embodiments, the method is a method of improving a vaccine. In some embodiments, the composition of the invention is an adjuvant. In some embodiments, the composition of the invention acts as an adjuvant to the vaccine. In some embodiments, a disease is prevented by inducing an immune response in the subject. In some embodiments, a disease is treatable by inducing an immune response in the subject. In some embodiments, the disease is a proliferative disease. In some embodiments, the proliferative disease is cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the nucleic acid molecule of the invention acts as a cancer vaccine. In some embodiments, the disease is an infectious disease. In some embodiments, the subject is infected with a pathogen. In some embodiments, the cGAS variant of the invention is an adjuvant. In some embodiments, the cGAS variant of the invention acts as an adjuvant to the vaccine. In some embodiments, the nucleic acid molecule of the invention is an adjuvant. In some embodiments, the nucleic acid molecule of the invention acts as an adjuvant to the vaccine.
[0152] As used herein, the term “adjuvant” refers to substance that enhances the body’s immune response to an antigen. In some embodiments, the vaccine comprises an antigen. In some embodiments, the immune response to the vaccine is the immune response to the antigen. In some embodiments, the antigen is associated with a pathogen (e.g., virus, bacteria, etc.). In some embodiments, the antigen is associated with a proliferative disorder (e.g., cancer cell). In some embodiments, the method further comprises administering the vaccine. In some embodiments, the method further comprises administering the antigen. In some embodiments, administering the vaccine is administering the antigen. In some embodiments, the composition of the invention is administered before the vaccine. In some embodiments, the composition of the invention is administered after the vaccine. In some embodiments, the composition of the invention is administered with the vaccine. In some embodiments, the composition of the invention is administered concomitantly to the vaccine. In some embodiments, the method further comprises administering the vaccine to the subject. In some embodiments, the composition of the invention is part of the vaccine. Insome embodiments, the cGAS variant of the invention is part of the vaccine. In some embodiments, the nucleic acid molecule of the invention is part of the vaccine. In some embodiments, part of the nucleic acid molecule is comprised in the vaccine.
[0153] In some embodiments, the vaccine is a live vaccine. In some embodiments, the live vaccine is a live-attenuated vaccine. In some embodiments, the vaccine is an inactivated vaccine. In some embodiments, the vaccine is a subunit vaccine. In some embodiments, the vaccine is a vector vaccine. In some embodiments, the vector is a viral vector. In some embodiments, the vaccine is an RNA vaccine. In some embodiments, the RNA is messenger RNA (mRNA). In some embodiments, the vaccine is an RNA vaccine and the composition comprise a nucleic acid molecule of the invention. In some embodiments, the nucleic acid of the invention is an RNA. In some embodiments, the RNA is mRNA. In some embodiments, the RNA comprises a cap. In some embodiments, the cap is a 5’ cap. In some embodiments, the cap is a cap analog. Examples of caps that can be used as part of in vivo RNA therapy can be found for non-limiting example in Shanmugasundaram et al., “Recent advances in modified cap analogs: synthesis, biochemical properties and mRNA based vaccines”, Chem Rec. 2022 Aug;22(8):e202200005, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the RNA comprises a poly A tail. In some embodiments, the RNA is formulated to in vivo delivery.
[0154] In some embodiments, an mRNA of the disclosure comprises one or more modified nucleobases, nucleosides, or nucleotides. In some embodiments, modified mRNAs may have useful properties, including enhanced stability, efficiency of protein production, intracellular retention, as compared to a reference unmodified mRNA. An mRNA encoding a cGAS of interest may comprise other structural properties as described herein for mRNA constructs including modified nucleobases, 5' cap, and poly A tail. In some embodiments, the RNA is suitable for in vitro transcription (IVT). In some embodiments, the mRNA comprises a 5’ cap. In some embodiments, the cap is a guanine cap. In some embodiments, the cap is a methyl-guanine cap. In some embodiments, the cap is a 7-methylguanylate cap. In some embodiments, the RNA modification p is a m7G(5')ppp(5')A RNA . In some embodiments, the cap is a m7G(5')ppp(5')G RNA cap. In some embodiments, the cap is an m7G(5')ppp(5)(2'- OMeA)pG RNA cap. In some embodiments, a 5' terminal cap is 7 mG(5')ppp(5')NlmpNp. In some embodiments the cap is added enzymatically. In some embodiments the cap is added enzymatically after IVT reaction. In some embodiments the cap is added during IVT reaction using modified nucleotides. In some embodiments, the RNA comprises modified nucleotides. In some embodiments, the RNA comprises amodification. In some embodiments, a modified uridine is used. In some embodiments, a modified cytosine is used. In some embodiments, the RNA modification is a pseudouridine. In some embodiments, the RNA modification is a methoxy-uridine. In some embodiments, the RNA modification is a 5-Methoxy-uridine. In some embodiments, the RNA modification is a 5’-methoxy-pseudouridine. In some embodiments, the RNA modification is a N1 methylpseudouridine. mRNA caps and RNA modified nucleotides for in vitro transcription are well known in the art and any such cap may be used as part of the nucleic acid molecule of the invention.
[0155] In some embodiments, the RNA comprises an untranslated region (UTR). In some embodiments, the UTR is a 5’ UTR. In some embodiments, the UTR is a 3’ UTR. In some embodiments, the RNA comprises a 5’ UTR and a 3’ UTR. 5’ and 3’ UTRs for in vitro translation are well known in the art and any such cap may be used as part of the nucleic acid molecule of the invention. Examples of 5’ and 3’ UTRs that may be used include, for example, the alpha globulin 5’ UTR, the alpha globulin 3’ UTR, the beta globulin 5’ UTR, the beta globulin 3’ UTR, the mtRNRl (Mitochondrially encoded 12S ribosomal RNA) 3’ UTR, the AES (Amino terminal enhancer of split) 3 ’UTR and combination thereof (see Niessen et al., 2019, “Improved mRNA-based therapeutic gene delivery by expressionaugmenting 3’ UTRs identified by cellular library screening”, Mol. Ther. 27, 824-836, and International Patent Publication WO2017 / 060314, the contents of which are hereby incorporated by reference in their entirety).
[0156] By another aspect, there is provided a vaccine composition comprising an antigen or nucleic acid molecule encoding the antigen and a cGAS variant of the invention or a nucleic acid molecule of the invention.
[0157] By another aspect, there is provided a composition comprising a lipid nanoparticle (LNP) encapsulating a nucleic acid molecule of the invention.
[0158] In some embodiments, the vaccine comprises an mRNA formulated in a lipid nanoparticle (LNP). In some embodiments, the mRNA is a nucleic acid molecule of the invention. In some embodiments, the mRNA comprises an open reading frame encoding a variant cGAS of the present disclosure.
[0159] Lipid nanoparticles are well known in the art and any such nanoparticle may be used. Examples of LNPs include, but are not limited to liposomes, micelles, solid lipid nanoparticles, nano structured lipid carriers and cubosomes. The term “liposome” as used herein refers to an artificial small spherical vesicle comprised of lipid molecules enclosing ahydrophilic center. In some embodiments, the liposome comprises a lipid monolayer. In some embodiments, the liposome comprises a lipid bilayer. In some embodiments, the LNP encapsulates a nucleic acid molecule of the invention. In some embodiments, the liposome is a stealthy liposome.
[0160] LNPs for mRNA delivery in vivo have been extensively studied. See for example Hou et al., 2021, “Lipid nanoparticles for mRNA delivery”, Nature Reviews Materials, 6, 1078-1094 the contents of which are hereby incorporated by reference in their entirety. LNPs in particular have been used for mRNA vaccine delivery such as the Pfizer-BioNTech Covid- 19 vaccine (BNT162b2) and the Moderna Covid-19 vaccine (mRNA-1273). In some embodiments, the vaccine comprises an mRNA incorporated lipid nanoparticle. In some embodiments, the vaccine is an mRNA vaccine. In some embodiments, the vaccine is an LNP based vaccine. In some embodiments, the LNP comprises a structural lipid, cholesterol and a PEGylated lipid. In some embodiments, the structural lipid is a phospholipid. In some embodiments, the structural lipid is an ionizable lipid. In some embodiments, the structural lipid is a cationic lipid. In some embodiments, the structural lipid is an ionizable cationic lipid. In some embodiments, the lipid is a positively charged lipid. In some embodiments, the lipid is positively charged at low pH. In some embodiments, low pH is acidic pH. In some embodiments, the LNP further comprises distearoylphosphatidylcholine (DSPC). In some embodiment, the LNP comprises ALC-0315, ALC-0159, DSPC and cholesterol. In some embodiments, the LNP comprise SM-102, PEG2000-DMG, 1,2-distearoyl-sn-glycero- 3 -phosphocholine and cholesterol. In some embodiments, molar ratios of the positively charged lipid:PEGylated lipid:cholesterol:DSPC are 46.3:1.6:42.7:9.4. In some embodiments, molar ratios of the positively charged lipid:PEGylated lipid:cholesterol:DSPC are 50:1.5:38.5:10. ALC-0315 is also known as ((4-hydroxybutyl)azanediyl)bis(hexane6,l- diyl)bis(2-hexyldecanoate). ALC-0159 is also known as 2 [(polyethylene glycol)-2000]- N,N-ditetradecylacetamide. SM-102 is also known as Heptadecan-9-yl 8-((2-hydroxyethyl) (6-oxo-6-(undecyloxy)hexyl)amino) octane. PEG2000-DMG is also known as 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000.
[0161] In some embodiments, the antigen is a protein and the vaccine composition comprises a cGAS variant protein of the invention. In some embodiments, the vaccine composition comprises an antigen and a cGAS variant protein of the invention. In some embodiments, the vaccine composition comprises a nucleic acid molecule encoding the antigen and a nucleic acid molecule of the invention.
[0162] As used herein, the term "about" when combined with a value refers to plus and minus 10% of the reference value. For example, a length of about 1000 nanometers (nm) refers to a length of 1000 nm+- 100 nm.
[0163] It is noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the polypeptide" includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.
[0164] In those instances where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description or claims, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."
[0165] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.
[0166] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the followingexamples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.
[0167] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.EXAMPLES
[0168] Generally, the nomenclature used herein, and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference. Other general references are provided throughout this document.Materials and Methods
[0169] Plasmid production: The different cGAS mutant sequences were produced in plasmids suitable for mRNA IVT by PCR. During the PCR reaction T7 binding site and poly A were added by the F and R premiers.
[0170] cGAS mRNA synthesis: mRNA was synthesized in vitro by T7 RNA polymerase- mediated transcription with 5-Methoxy-uridine, or N1M pseudouridine in place of uridine.The mRNA was capped with clean cap - m7G(5')ppp(5)(2'- OMeA)pG to increase mRNA translation. These modifications both increase the stability and reduce immunogenicity of the mRNA.
[0171] 2’ 3’-cGAMP ELISA: MDA453 and HCC1954 Cells were seeded in triplicate wells at a density of 25,000 and 50,000 cells / well, and transfected with mRNA using 0.15 ul / well Lipofectamine™ MessengerMAX™ Transfection Reagent (Thermo Fisher, Cat# LMRNA001) according to the manufacturer’s instructions. Supernatants were harvested 24 / 48h after transfection and 2’ 3’-cGAMP levels were determined by the 2’ 3’-cGAMP ELISA kit (CAYMAN, Cat# 501700-96) according to the manufacturer’s instructions.
[0172] IFN-b ELISA assay: THP-1 Cells were seeded in triplicate wells at a density of 800,000 cells / well in 24-well plates and transfected with the mRNA using Lipofectamine™ MessengerMAX™ Transfection Reagent according to the manufacturer’s instructions. Supernatants were harvested 24 / 48 / 72h after transfection, and IFN-b levels were determined by a Human IFN-Beta ELISA Kit (PBL assay science, Cat#: 41410) according to the manufacturer’s instructions.
[0173] Optical density (OD) was measured at 450nm on a microplate reader.
[0174] IFN-b qPCR assay: THP-1 Cells were seeded in triplicate wells at a density of 800,000 cells / well and transfected with mRNA using Lipofectamine™ MessengerMAX™ Transfection Reagent (Thermo Fisher, Cat# LMRNA001) according to the manufacturer’s instructions. Supernatants were harvested 24 / 48 / 72h after transfection, and IFN-b levels were determined by qPCR using NZY total RNA isolation kit (NYZ tech, Cat# NYZMB 13402), Verso cDNA Synthesis Kit (Thermo Fisher, Cat#AB1453B), FastSYBER Green Master MIX Thermo Fisher, Cat#AB4385612). Samples were measured with QuantStudio5 device. The following primers were used: F - AATACCCTCCCTTCCTCCAA (SEQ ID NO: 17); RCCCATCGAAGTGCTGAGATTAC (SEQ ID NO: 18).Example 1: Design and selection of constitutively active cGAS variants
[0175] In order to design constitutively active cGAS variants, design procedures were performed on human and mouse cGAS variants bound to DNA and ligand (PDB ID codes 6047 and 5N6I respectively) using the Rosetta atomistic design suite. Active site positions were fixed throughout all design steps.
[0176] Constitutively active cGAS variants of the present disclosure were generated. For comparison, WT forms of cGAS, inactive forms, and several constitutively active variants previously disclosed in the literature (International Patent Applications WO2022 / 221188 and WO2023 / 161178) were also generated. In order to evaluate the activity of these variants a cGAMP ELISA was performed in the absence of exogenous DNA. To this end, HCC1954 human breast cancer cells were transfected with constructs encoding the variants and controls. cGAMP levels were measured in the media 24 hours following transfection. The results from the top cGAMP producing variants are provided in Figure 1, along with results from several controls including WT mouse cGAS and WT human cGAS and truncated forms lacking the N-terminus of cGAS (residues 2-145, an initial methionine is retained). While both wild-type mouse and human cGAS produced very little cGAMP in the absence of exogenous DNA, the listed mutants produced robust production. Results showed greater than an order of magnitude increase in cGAMP. In contrast, the constitutively active mutants known in the art that were tested showed relatively poor production. This assay was also performed in a second breast cancer cell line, MDA-MB-453 cells and similar results were obtained.
[0177] In order to evaluate the ability of the newly constructed variants to initiate immune response by elevation of IFN expression, the constructs were transfected into the human monocyte cell line, THP-1. First, the ability of one of the newly constructed variants (SEQ ID NO: 3) to activate IFNb was evaluated and compared to that of inactive cGAS (SEQ ID NO: 29) as well as to that of STINGV155M, which was previously suggested as a potential adjuvant (see Tse et al., “mRNA-encoded, constitutively active STINGV155Mis a potent genetic adjuvant of antigen-specific CD8+ T cell response” Mol Ther. 2021 Jul 7;29(7):2227-2238). To this end, THP-1 cells were either not transfected (denoted in the graph as THP-1) or transfected with either mCherry, the cGAS variant (SEQ ID NO: 3), inactive cGAS or STINGV155M. Interferon beta (IFNb) mRNA levels were measured by qPCR after 24 hours (Fig. 2A) and 48 hours (Fig. 2B) following transfection. Results were normalized to THP-1 cells transfected with mCherry mRNA. The cGAS variant of the invention was superior to STINGV155Min its ability to activate IFNb both at 24 hours and 48 hours after transfection, showing more than a 4-fold increase in IFNb levels (Fig. 2A-2B).
[0178] The experiment was repeated with a second cGAS variant of the invention (SEQ ID NO: 34). IFNb mRNA levels (qPCR) were measured 48 hours after transfection and results were normalized to THP-1 transfected with mCherry mRNA. As before, SEQ ID NO: 3 produced more than 4 times the levels of IFNb as compared to STINGV155M(Fig. 2C). Aspredicted by the ELISA, SEQ ID NO: 34 was even better, producing more than an order of magnitude increase in IFNb transcription as compared to STINGV155M.
[0179] Next the constitutively active variants of the present disclosure were screened for their ability to induce elevated IFNb protein level (as measured by ELISA) 48 hours following transfection. As before THP-1 cells were transfected with the various constructs and media was removed 48 hours later for ELISA testing. All the constitutively active variants tested were superior to the wildtype cGAS (Fig. 2D). A previously reported constitutively active cGAS (SEQ ID NO: 19) and STINGV155Mwere used as positive controls and showed increased IFNb protein production, with the STING mutant had a greater effect. All of the new variants were superior to SEQ ID NO: 19 in their ability to induce IFNb protein and 9 of the 13 tested (SEQ ID NO: 34, 3, 16, 4, 5, 10, 6, 7 and 9) produced greater levels of IFNb protein than STINGV155M(Fig. 2D, bars above the dashed line). SEQ ID NO: 3 and 34 even showed greater than an order of magnitude increase in IFNb levels as compared to SEQ ID NO: 19 and many showed greater than an order of magnitude increase as compared to the wild-type cGAS.
[0180] Taken together, this data demonstrates that the new cGAS mutants are not only constitutively active, but they are superior to any other cGAS mutants known in the art. It is also notable that mouse cGAS proteins produced constitutive activity in human cells, indicating that these proteins can be used for therapy in humans.Example 2: Constitutive cGAS mutants enhance immune response to vaccination
[0181] To further demonstrate the advantage of using the cGAS variants of the present disclosure as adjuvants, in vivo studies are performed. To evaluate the in vivo immuno stimulatory effect and safety profile, two test adjuvants were made. The first is an LNP-encapsulated mRNA adjuvant encoding the mouse mutant cGAS of SEQ ID NO: 34 (Adjuvant #1). The second is an LNP-encapsulated mRNA adjuvant encoding the human mutant cGAS of SEQ ID NO: 38 (Adjuvant #2). mRNA was modified with Nlmethyl pseudouridine and encapsulated in LNP comprised of ALC-0315, ALC-0159, DSPC and cholesterol. The adjuvants were tested across a dosing range in C57LB / 6 mice with a focus on cytokine induction and tolerability.
[0182] Female C57BL / 6 mice (6-8 weeks old) were randomly assigned into groups (n = 4 per group) and administered intramuscular (I.M.) injections of the LNP-formulated mRNA constructs at doses of 0.1 pg, 0.5 pg, 1 pg, or 5 pg per mouse. Equivalent groups received corresponding doses of an inactive (dead) adjuvant formulation as control. Serum sampleswere collected at 6 hours and 24 hours post-injection and mice were monitored daily for clinical symptoms and body weight changes over a 14-day observation period to assess systemic toxicity.
[0183] Levels of interferon- alpha (IFN-a) and interleukin-6 (IL-6) in serum were quantified using standard ELISA assays according to manufacturer protocols. Both adjuvants produced a dose dependent increase in IFN-a (Fig. 3A, 3C) and IL-6 (Fig. 3B, 3D). Cytokine and chemokine levels in both adjuvant groups consistently exceeded those observed in the corresponding inactive control groups and the peak expression was observed at 6 hours, though the increase persisted, albeit at lower levels, even until 24 hours after administration. Adjuvant #1 (Fig. 3A-B) was significantly superior to Adjuvant #2 (Fig. 3C-D) at the highest dose tested, although at the lower doses the superiority was less apparent. Regardless, both were highly potent immune stimulators. No mice exhibited clinical signs of distress or weight loss, and all animals either maintained or gained weight during the 14-day postinjection period.Example 3: Additional constitutive cGAS mutants
[0184] Following the initial screening of constitutively active cGAS variants additional variants were generated. Mouse variants were designed on the truncated mouse cGAS (amino acids 146-507 of SEQ ID NO: 1, which is SEQ ID NO: 32), as the best mutant (SEQ ID NO: 34) had been a truncation. The activity of these variants was evaluated by the same cGAMP ELISA performed in the absence of exogenous DNA. To this end, HuH7 cells were transfected with constructs encoding the variants and controls. cGAMP levels were measured in the media 24 hours following transfection. The results from the top cGAMP producing variants are provided in Table 1 below. Results are provided as fold induction compared to the leading variant: SEQ ID NO: 34 and the variants are ordered based on increased activity level. All of SEQ ID NO: 78-107 produced superior results as compared to SEQ ID NO: 34, which was itself more than an order of magnitude better than cGAS variants known in the art. Even the most mild of the new variants (SEQ ID NO: 39), produced 15% of the induction produced by SEQ ID NO: 34. As SEQ ID NO: 34 was more than an order of magnitude better than the variants known in the art, even SEQ ID NO: 39 is superior to those already known mutants. Variants were produced that were equivalent or inferior compared to those known in the art, but these were discarded and not investigated further. Selected variants were also tested in additional cell lines and similar results were observed.
[0185] Table 1: Additional truncated mouse cGAS mutants
[0186] In analyzing the produced variants, it became apparent that substitutions of certain positions were conserved. 77 of the active variants contained a mutation at position glutamic acid 230 (E230), histidine 250 (H250) and aspartic acid 466 (D446) in the wild-type mouse cGAS (SEQ ID NO: 1). Specifically, the mutations E230R, H250Q and D466P were observed in many of the best mutants. It was also common (78 of the variants) to find mutation of tyrosine 229 (Y229) with mutation of H250 and D446. The mutations Y229K, H250Q and D466P were observed in many of the best mutants. Similarly, 69 of the variants contained mutations at isoleucine 320 (1320), glutamine 413 (Q413) and tyrosine 462 (T462), which mutations I320K, Q413K and T462R observed in many of the best mutants. Other combinations were also found to be common: E169K, Y229K, E255K, T260K, S264K, E276N, S283T, E324K, T334K, N339K, Q413K, D416R, Q433K, S447H, T462R, E487K, Y495K, N499R, and L507R (6 of the variants); E169K, H250Q, E255K, E320R, E324K, T334K, Q413K, T462R, D466P, E487K, Y495K, N499R, and L507R (32 of the variants); and Y229K, E230R, E276N, S283T, and S447H (14 of the variants). As is readily apparent, most of the mutations either abolish a negatively charged amino acid (D or E), produce a positively charged amino acid (R or K) or both.
[0187] Human variants were also designed on the truncated human cGAS (amino acids 160- 522 of SEQ ID NO: 14, which is SEQ ID NO: 33), as the best mutant (SEQ ID NO: 38) had been a truncation. The activity of these variants was evaluated as before. The results fromthe top cGAMP producing variants are provided in Table 2 below. Results are provided as fold induction compared to the leading variant: SEQ ID NO: 38 and the variants are ordered from worst to best. All of SEQ ID NO: 128-173 produced as good or superior results as compared to SEQ ID NO: 38, which was itself more than an order of magnitude better than the best human cGAS variants known in the art. Even the worst of the new variants (SEQ ID NO: 108), produced 30% of the induction produced by SEQ ID NO: 38. As SEQ ID NO: 38 was more than an order of magnitude better than the human variants known in the art, even SEQ ID NO: 108 is superior to those already known mutants. Human variants were produced that were equivalent or inferior compared to those known in the art, but these were discarded and not investigated further. Selected variants were also tested in additional cell lines and similar results were observed.
[0188] Table 2: Additional truncated human cGAS mutants
[0189] It was notable that all the functional variants contained both a E502K and E515K mutations. Additionally, every variant contained either an E268K or E269K mutation. It was even more notable in the human variants that every mutation produced a positively charged amino acid: lysine or arginine. Although frequently these mutations also removed a negatively charged amino acid, it was striking that uniformly every mutation produced a positive amino acid, with at least 10 positively charged amino acids being added in every variant. Beyond locations 502 and 515, mutations L354K, E269K, E336K, T477R, Y510K and N513K were observed in every human variant but 1. Further, all the variants that were at least as good at SEQ ID NO: 38 contained all of the following mutations: S163K, A167K, E269K, E286K, E336K, L354K, Q473K, T477R, E502K, Y510K, N513K and E515K. A slightly larger signature also comprising 1) S243K or S278K; 2) Q448K or Q473K; 3) L462K and 4) T469K included all of the variants at least as good as SEQ ID NO: 38 except for two. It is notable that SEQ ID NO: 136 contained this minimal signature of at least 16 mutations and was highly active (1.5 fold higher levels of cGAMP as compared to SEQ ID NO: 38).Example 4: Addition of miRs to restrict variant expression
[0190] For selective expression of the construct in target cells and / or target tissues miRNAs can be utilized. The miRNAs are selected based on the desired indications and target tissue. For example, in the case of treating cancer, the constructs aim to limit the expression to the tissue that comprises the cancer. In the case of vaccine adjuvants designed for intramuscular injection, the constructs aim to promote immune response via their expression in immune cells (e.g., antigen-presenting cells (APCs) such as monocytes, macrophages, and dendritic cells). To achieve restricted expression mainly in immune cells while maximizing immuneactivation, specific miRNA target sites are incorporated into the mRNA construct encoding the variant proteins. This prevents off-target expression and minimizes unwanted expression and immune activation in non-target organs. To this end our experiments utilized miRNA target sequences which are included either in the untranslated regions (UTRs) or within the N-terminal or C-terminal region of the translated sequence, allowing for post-transcriptional suppression in tissues expressing these miRNAs.
[0191] Reports on intramuscular injection of LNPs containing nucleic acid molecules have found detectable levels in liver, spleen, kidney, muscle, skin and the brain (although reports vary). As such, mirs against cells of these organs were selected for testing (see Table 3). Because immune cells are the target cell type, silencing in the spleen was avoided as a precaution.
[0192] Table 3: miRs for silencing in specific organs
[0193] The liver is known to have the highest accumulation of mRNA-LNPs, therefore as a proof of concept the mir-122 target sequence CAAACACCATTGTCACACTCCA (SEQ ID NO: 175) was incorporated at various locations in the SEQ ID NO: 34 construct. HCC1954 cells that are negative for mir-122 were made to express the mir-target containing constructs, an inactive cGAS as a negative control and SEQ ID NO: 34 as a positive control. The cellswere then electroporated with mir-122 or a control irrelevant mir and cGAMP levels were measured after 24 hours.
[0194] As expected mir-122 has no effect on the normal SEQ ID NO: 34 construct. Three locations near the C-terminus of the coding region of SEQ ID NO: 34 were tested for insertion of the mir-122 target sequence and an average reduction of 22.7% cGAMP expression was observed when mir-122 was added (as compared to the control mir). Three locations near the N-terminus of the coding region of SEQ ID NO: 34 were also tested and produced an average reduction of 51%. Finally, two locations in the 5’ UTR before the SEQ ID NO: 34 coding region were tested and these produced an average reduction of 64.5%. This data taken together indicates that the mir target sites can be used to limit expression of the constitutively active cGAS proteins.
[0195] Finally, to confirm the effectiveness of the mir target site insertion in an endogenous system, a liver cell line expressing mir-122 (HuH7) and the monocyte cell line THP1 were both made to express the unmodified SEQ ID NO: 34 and the construct with an insertion of the mir-122 target site. cGAMP production was measured after 24 hours. Although no reduction in cGAMP production was observed in the monocytes when the target site was included, in liver cells the mir-122 target site resulted in a 88% reduction in cGAMP levels (Fig. 4A). This strongly indicates that inclusion of the mir target site is sufficient to significantly inhibit expression of the variant cGAS and thus immune activation.
[0196] So as to confirm that the immune response in the monocytes was not at all inhibited by inclusion of the mir target site, three downstream genes were examined by qPCR. Expression of Interferon beta (IFNb), Interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) and Interferon-induced GTP-binding protein Mxl (MX1) all did not change when the target site was present (Fig. 4B).Example 5: Additional in vivo testing
[0197] The various constructs were further tested in vivo. The ability to produce a dosedependent immunostimulatory effect is tested as before by injecting mice with the various constructs in LNPs and monitoring the production of cytokines (e.g., IFNA) and chemokines (e.g., IL-6) after 6 hours and 24 hours. All the constructs produce an immunostimulatory effect and greatly increase cytokine / chemokine production.
[0198] In vivo induction of Ag specific CD8 T cell response is also examined. To this end, mRNA is used to express constitutively active and stabilized cGAS as a genetic adjuvantalongside mRNA-encoded antigens in LNPs. To assess adjuvant potency, the genetic adjuvants are co-administered with mRNA encoding ovalbumin (OVA).
[0199] C57BL / 6 mice arc immunized intramuscularly on day 0 and day 14, with an mRNA- LNP (10 ug / mouse) coformulated into LNPs with OVA and cGAS genetic adjuvant variants. On day 21 and / or day 50, the percentage of SIINFEKL- specific CD8+ T cells in spleens is determined by intracellular staining of IFN-g, TNF-a, and IL-2 after a 4-hour ex vivo stimulation with cognate peptide.
[0200] Further, immunization with LNP-encapsulated mRNA expressing the E7 oncoprotein of HPV is also performed. Antigen- specific CD8+ T cell responses are compared between all groups.
[0201] In vivo induction of adjuvant effect is also tested. C57BL / 6 mice are injected intramuscularly with mRNA-LNP encoding cGAS genetic adjuvant variants at 5, 10, 20 and 50 ug per mouse. Serum cytokine levels were assessed at 6 h after injection. It is tested whether addition of cGAS genetic adjuvant to an mRNA-encoded cancer antigen vaccine with HPV E6 and E7model antigens could result in tumor volume reduction and / or longer survival. C57BL / 6 mice (n=10 per group) are inoculated with 2.5xl0A5 TC-1 tumor cells (lung epithelial cells that have been transformed with oncogenic human papillomavirus (HPV) E6 and E7 genes). To this end, mRNA vaccine is administered intramuscularly on days 0 and 7 in established tumors (100 mmA3). Tumor growth and Kaplan-Meier survival curves of mice treated with mRNA vaccine encoding HPV E6 / E7 with or without mRNA encoding CGAS genetic adjuvant variants.Example 6. Constitutive cGAS mutants enhance immune response to infectious disease vaccination
[0202] Immunogenicity of formulations containing different doses of antigen with and without cGAS adjuvant is evaluated in BALB / c mice. To this end, naive or primed female Balb / c mice (6-8 weeks old) are treated with LNP containing both the virion antigen and cGAS adjuvant mRNA in different dosage as control the antigen only mRNA is used. Whole blood will be collected at study day -1, 14, 21, 28, 35 and 49. Serum will be collected and used to test antibody responses. Spleen will be collected at study endpoint and splenocytes will be prepared for CMI testing. The immunological study endpoints will include: Antibody responses monitored with one or more of the following: Binding Antibody Titer (ELISA), Competitive Antibody Titer (Competitive ELISA), Pseudovirus Neutralization Titer (VNA),and CMI responses that will be monitored with 4 cytokines ELISPOT assay with prototype peptide Thl vs Th2 response.
[0203] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
Claims
CLAIMS:
1. A Cyclic GMP-AMP synthase (cGAS) protein variant of SEQ ID NO: 1 or a fragment or derivative thereof, wherein said cGAS protein variant comprises SEQ ID NO: 1 or a fragment or derivative thereof comprises amino acid substitutions at a plurality of residues selected from the group consisting of: Y229, E230, H250, E276, S283, and D466 of SEQ ID NO: 1.
2. The cGAS protein variant of claim 1, wherein said amino acid substitutes are selected from the group consisting of: Y229 substituted to K or G, E230 substituted to D, R or N, H250 substituted to Q or K, E276 substituted to N, S283 substituted to T or K, and D466 substituted to P.
3. The cGAS protein variant of claim 1 or 2, comprising amino acid substitutes at all of Y229, E230, H250, E276, S283, and D466 of SEQ ID NO: 1, optionally comprising all of Y229K, E230R, H250Q, E276N, S283T and D466P.
4. The cGAS protein variant of any one of claim 1 to 3, further comprising at least one additional substitution at a position selected from the group consisting of R185, S447 and Q478.
5. The cGAS protein variant of claim 4, wherein said additional amino acid substitutions are selected from R185 substituted to K, S477 substituted to H or K and Q478 substituted to P, R or K.
6. The cGAS protein variant of claim 4 or 5, comprising amino acid substitutes at all of R185, Y229, E230, H250, E276, S283, S447, D466 and Q478 of SEQ ID NO: 1, optionally comprising all of R185K, Y229K / G, E230R / N, H250Q, E276N, S283T, S447H, D466P and Q478P.
7. The cGAS protein variant of any one of claims 1 to 6, wherein said fragment comprises amino acids 146 to 507 of SEQ ID NO: 1 and an N-terminal methionine.
8. The cGAS protein variant of any one of claims 1 to 7, comprising or consisting of a sequence selected from SEQ ID NO: 3-13, 34-37 and 39-107.
9. A Cyclic GMP-AMP synthase (cGAS) protein variant comprising SEQ ID NO: 14 or a fragment or derivative thereof, wherein said SEQ ID NO: 14 or a fragment or derivative thereof comprises amino acid substitutions at a plurality of residues selected from the group consisting of: E502, E515, S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, L354, E401, D408, Q448, L462, T469, Q473, T477, S493P, Y510, and N513 of SEQ ID NO: 14, wherein said substitution is to K, R or P.
10. The cGAS protein variant of claim 9, wherein said substitutions comprises amino acid substitutions at E502 and E515 and a plurality of residues selected from the group consisting of: S163, A167, E170, G188, S243, E269, S274, S278, E286, 1297, A332, E336, A346, L354, E401, D408, Q448, L462, T469, Q473, T477, S493P, Y510, and N513 of SEQ ID NO: 14, wherein said substitution is to K, R or P.
11. The cGAS protein variant of claim 9 or 10, wherein said substitutions are selected from S163K, A167K, E170K, G188K, S243K, E269K, S274K, S278K, E286K, I297K, A332P, A332K, E336K, A346K, L354K, E401K, D408K, Q448K, L462K, T469K, Q473K, T477R, S493P, S493K, E502K, Y510K, N513K, and E515K.
12. The cGAS protein variant of any one of claims 9 to 11, wherein said SEQ ID NO: 14 or a fragment or derivative thereof comprises E502K and E515K.
13. The cGAS protein variant of any one of claims 9 to 12, wherein said plurality of residues is at least 10 residues.
14. The cGAS protein variant of any one of claims 9 to 13, comprising all of the following substitutions: S163K, A167K, E269K, E286K, E336K, L354K, Q473K, T477R, E502K, Y510K, N513K and E515K.
15. The cGAS protein variant of claim 14, comprising all of the following substitutions: a. S163K, A167K, E269K, E286K, E336K, L354K, L462K, Q473K, T477R, T469K, E502K, Y510K, N513K, and E515K; b. S243K or S278K; and c. Q448K or Q473K .
16. The cGAS protein variant of any one of claims 9 to 15, wherein said fragment comprises amino acids 160 to 522 of SEQ ID NO: 14 and an N-terminal methionine.
17. The cGAS protein variant of any one of claims 9 to 16, comprising or consisting of a sequence selected from SEQ ID NO: 16, 38 and 108-174.
18. The cGAS protein variant of any one of claims 1 to 17, wherein a fragment or derivative is a fragment or derivative comprising Cyclic guanosine monophosphateadenosine monophosphate (cGAMP) synthesis activity.
19. The cGAS protein variant of any one of claims 1 to 18, being a constitutively active cGAS.
20. The cGAS protein variant of claim 19, wherein constitutive activity is constitutive cGAMP synthesis activity.
21. The cGAS protein variant of claim 19 or 20, wherein constitutively comprises in the absence of cytosolic DNA.
22. The cGAS protein variant of any one of claims 18 to 21, wherein constitutively active comprises constitutive activation of Stimulator of interferon genes (STING1).
23. A nucleic acid molecule comprising an open reading frame encoding a cGAS protein variant of any one of claims 1 to 22.
24. The nucleic acid molecule of claim 23, further comprising at least one microRNA (miR) binding site of a miR expressed in a tissue selected from liver, muscle, kidney, brain, skin and lung and not expressed in immune cells.
25. The nucleic acid molecule of claim 24, wherein said miR is selected from the miRs provided in Table 3.
26. The nucleic acid molecule of claim 24 or 25, wherein said miR is mir-122.
27. A pharmaceutical composition comprising a cGAS protein variant of any one of claims 1 to 21 or a nucleic acid molecule of any one of claims 22 to 26 and a pharmaceutically acceptable carrier, or excipient.
28. The pharmaceutical composition of claim 27, wherein said cGAS protein variant or said nucleic acid molecule is encapsulated in a liquid nanoparticle (LNP).
29. A method of inducing an immune response in a subject, the method comprising administering to said subject a pharmaceutical composition of claim 26 or 27, thereby inducing an immune response in a subject.
30. The method of claim 29, wherein said inducing an immune response comprises inducing expression of cGAMP, interferon or both in immune cells of said subject.
31. The method of claim 29 or 30, wherein said subject suffers from a disease or condition characterized by a pathological cell and treatable by inducing an immune response against said pathological cell, and wherein said method is a method of treating said disease.
32. The method of claim 31, wherein said disease is cancer and said pathological cell is a cancerous cell.
33. The method of claim 31, wherein said disease is an infectious disease and said pathological cell is an infected cell.
34. A method of enhancing an immune response in a subject receiving a vaccine, the method comprising administering a pharmaceutical composition of claim 27 or 28 to said subject, thereby enhancing an immune response in a subject receiving a vaccine.
35. The method of claim 34, wherein the immune response is directed against a cancerous cell or a pathogen.
36. The method of claim 34 or 35, further comprising administering said vaccine to said subject.
Citation Information
Patent Citations
Designed constitutively active cyclic GMP-amp synthase as a genetically encoded stimulant of interferons
WO2022221188A1
mRNA encoding a constitutively-active cyclic GMP-amp synthase and lipid delivery vehicles for same
WO2023220746A1