Methods and compositions for expression of constitutively active RAP1A from the VMD2 promoter

Abstract

Disclosed is a nucleic acid construct comprising a nucleic acid sequence encoding a vitelloid macular dystrophy 2 (VMD2) promoter operably linked to a nucleic acid sequence encoding Rap1a. Disclosed is a vector comprising the nucleic acid construct disclosed herein. Disclosed is a composition comprising a nucleic acid construct or vector of the present disclosure. Also disclosed is a method of treating a subject with age-related macular degeneration, comprising administering one or more of the nucleic acid constructs, vectors, or compositions of the present disclosure to a subject in need thereof.

Description

[Background technology]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 905,880, filed September 25, 2019, which is hereby incorporated by reference in its entirety.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under Grant Nos. EY017011 and EY015130 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Reference to sequence listing The Sequence Listing submitted on September 25, 2019, is incorporated herein by reference pursuant to 37 U.S.C. 1.52(e)(5) as a text file entitled "21101_0402U1_Sequence_Listing.txt", created on September 24, 2019, and having a size of 4,547 bytes.

[0004] Age-related macular degeneration (AMD) remains the leading cause of legal blindness among older adults worldwide. Retinal pigment epithelial (RPE) dysfunction precedes both neovascular and atrophic AMD and may be important in the pathogenesis of these advanced forms of AMD. The RPE is a single layer of polarized cells crucial for retinal homeostasis. It maintains the outer blood-retinal barrier while regulating the delivery of nutrients and oxygen to the outer retina and the removal of metabolic waste products from photoreceptors. The RPE also produces growth factors at physiological levels that support the retina and choriocapillaris. With aging and increased pathological stress, the RPE may lose the efficiency of these functions. Consequently, debris accumulates within Bruch's membrane, manifesting as drusen beneath the RPE. As dysfunction progresses, the integrity of the RPE barrier is compromised, and the stressed RPE releases growth factors at pathological levels, leading to advanced AMD. Therefore, strategies to maintain or restore RPE function may represent potential targets for AMD therapy.

[0005] Thus, disclosed herein are compositions and methods for treating a subject with age-related macular degeneration. Summary of the Invention

[0006] Disclosed is a nucleic acid construct comprising a nucleic acid sequence encoding a vitelloid macular dystrophy 2 (VMD2) promoter operably linked to a nucleic acid sequence encoding activated Rap1a.

[0007] Disclosed are vectors that include the nucleic acid constructs disclosed herein.

[0008] Disclosed are compositions comprising the nucleic acid constructs or vectors disclosed herein.

[0009] Disclosed are recombinant cells comprising one or more of the nucleic acid constructs or vectors disclosed herein.

[0010] Disclosed are methods of treating a subject with age-related macular degeneration comprising administering to a subject in need thereof one or more of a nucleic acid construct, vector, or composition.

[0011] Disclosed are methods of inhibiting choroidal neovascularization (CNV) comprising administering to a subject one or more of the nucleic acid constructs, vectors, or compositions disclosed herein.

[0012] Disclosed are methods for reducing inflammatory signaling in choroidal tissue, comprising administering to a subject one or more of the nucleic acid constructs, vectors, or compositions disclosed herein.

[0013] Disclosed are methods of reducing VEGF expression in choroidal tissue, comprising administering to a subject one or more of the nucleic acid constructs, vectors, or compositions disclosed herein.

[0014] Additional advantages of the disclosed methods and compositions will be set forth in part in the description which follows, and in part will be understood from this description, or may be learned by practice of the disclosed methods and compositions. The advantages of the disclosed methods and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

[0015] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the disclosed methods and compositions and, together with the description, serve to explain the principles of the disclosed methods and compositions. [Brief explanation of the drawings]

[0016] [Figure 1A]Figure 1A and Figure 1B show diagrams of self-complementary adeno-associated virus 2 (sc-AAV2) vectors delivering constitutively active Rap1a (CARap1a) or GFP alone driven by (A) the RPE65 promoter (sc-AAV2-RPE65-CARap1a and sc-AAV2-RPE65-GFP) or (B) the VMD2 promoter (sc-AAV2-VMD2-CARap1a and sc-AAV2-VMD2-GFP). [Figure 1B] Figure 1A and Figure 1B show diagrams of self-complementary adeno-associated virus 2 (sc-AAV2) vectors delivering constitutively active Rap1a (CARap1a) or GFP alone driven by (A) the RPE65 promoter (sc-AAV2-RPE65-CARap1a and sc-AAV2-RPE65-GFP) or (B) the VMD2 promoter (sc-AAV2-VMD2-CARap1a and sc-AAV2-VMD2-GFP). [Figure 2A] Figures 2A and 2B show in vivo analysis of sc-AAV2 transduction in the RPE of wild-type mice. (A) Micron IV retinal imaging of GFP and (B) immunostaining of GFP and RPE65 in retinal cryosections from wild-type mice 5 weeks after injection of sc-AAV2-RPE65-GFP or sc-AAV2-VMD2-GFP vectors at a dose of 5 x 10 viral particles / µl. [Figure 2B] Figures 2A and 2B show in vivo analysis of sc-AAV2 transduction in the RPE of wild-type mice. (A) Micron IV retinal imaging of GFP and (B) immunostaining of GFP and RPE65 in retinal cryosections from wild-type mice 5 weeks after injection of sc-AAV2-RPE65-GFP or sc-AAV2-VMD2-GFP vectors at a dose of 5 x 10 viral particles / µl. [Figure 3A]Figures 3A, 3B, and 3C show that the sc-AAV2-VMD2 vector exhibits more specific GFP transduction and greater Rap1 expression in the RPE. (A) IHC of GFP in retinal cryosections, (B-C) Western blots of Rap1 and β-actin in the RPE / choroid (B is a representative gel image, C is densitometric quantification) from wild-type mice injected with either sc-AAV2-RPE65 or sc-AAV2-VMD2 (**p<0.01 vs. sc-AAV2-VMD2-GFP, n=5-6). [Figure 3B] Figures 3A, 3B, and 3C show that the sc-AAV2-VMD2 vector exhibits more specific GFP transduction and greater Rap1 expression in the RPE. (A) IHC of GFP in retinal cryosections, (B-C) Western blots of Rap1 and β-actin in the RPE / choroid (B is a representative gel image, C is densitometric quantification) from wild-type mice injected with either sc-AAV2-RPE65 or sc-AAV2-VMD2 (**p<0.01 vs. sc-AAV2-VMD2-GFP, n=5-6). [Figure 3C] Figures 3A, 3B, and 3C show that the sc-AAV2-VMD2 vector exhibits more specific GFP transduction and greater Rap1 expression in the RPE. (A) IHC of GFP in retinal cryosections, (B-C) Western blots of Rap1 and β-actin in the RPE / choroid (B is a representative gel image, C is densitometric quantification) from wild-type mice injected with either sc-AAV2-RPE65 or sc-AAV2-VMD2 (**p<0.01 vs. sc-AAV2-VMD2-GFP, n=5-6). [Figure 4A] Figures 4A and 4B show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a reduces choroidal neovascularization (CNV) in wild-type mice in a laser-induced CNV model. (A) Representative images of RPE / choroidal flat mounts and (B) quantification of CNV lesions (*p<0.05 vs. sc-AAV2-VMD2, n=40 spots from 12 mice). [Figure 4B] Figures 4A and 4B show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a reduces choroidal neovascularization (CNV) in wild-type mice in a laser-induced CNV model. (A) Representative images of RPE / choroidal flat mounts and (B) quantification of CNV lesions (*p<0.05 vs. sc-AAV2-VMD2, n=40 spots from 12 mice). [Figure 5A] Figures 5A-5D show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a reduces inflammation and VEGF in the RPE / choroid. Western blots of (A-B) phosphorylated NF-κB and (C-D) VEGF in the RPE / choroid of wild-type mice injected with sc-AAV2-VMD2 7 days after laser treatment (A and C are representative gel images, B and D are densitometric quantification; *p<0.05, **p<0.01 vs. sc-AAV2-VMD2-GFP; n=5-6). [Figure 5B] Figures 5A-5D show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a reduces inflammation and VEGF in the RPE / choroid. Western blots of (A-B) phosphorylated NF-κB and (C-D) VEGF in the RPE / choroid of wild-type mice injected with sc-AAV2-VMD2 7 days after laser treatment (A and C are representative gel images, B and D are densitometric quantification; *p<0.05, **p<0.01 vs. sc-AAV2-VMD2-GFP; n=5-6). [Figure 5C]Figures 5A-5D show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a reduces inflammation and VEGF in the RPE / choroid. Western blots of (A-B) phosphorylated NF-κB and (C-D) VEGF in the RPE / choroid of wild-type mice injected with sc-AAV2-VMD2 7 days after laser treatment (A and C are representative gel images, B and D are densitometric quantification; *p<0.05, **p<0.01 vs. sc-AAV2-VMD2-GFP; n=5-6). [Figure 5D] Figures 5A-5D show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a reduces inflammation and VEGF in the RPE / choroid. Western blots of (A-B) phosphorylated NF-κB and (C-D) VEGF in the RPE / choroid of wild-type mice injected with sc-AAV2-VMD2 7 days after laser treatment (A and C are representative gel images, B and D are densitometric quantification; *p<0.05, **p<0.01 vs. sc-AAV2-VMD2-GFP; n=5-6). [Figure 6A] Figures 6A-6D show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a does not activate apoptosis or autophagy. Western blots of (A-B) caspase 3 and (C-D) LC3A / B in the RPE / choroid of wild-type mice injected with sc-AAV2-VMD2 7 days after laser treatment (A and C are representative gel images, B and D are densitometric quantification; *p<0.05 vs. sc-AAV2-VMD2-GFP; n=5-6; CC, cytochrome C-treated cell lysate). [Figure 6B]Figures 6A-6D show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a does not activate apoptosis or autophagy. Western blots of (A-B) caspase 3 and (C-D) LC3A / B in the RPE / choroid of wild-type mice injected with sc-AAV2-VMD2 7 days after laser treatment (A and C are representative gel images, B and D are densitometric quantification; *p<0.05 vs. sc-AAV2-VMD2-GFP; n=5-6; CC, cytochrome C-treated cell lysate). [Figure 6C] Figures 6A-6D show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a does not activate apoptosis or autophagy. Western blots of (A-B) caspase 3 and (C-D) LC3A / B in the RPE / choroid of wild-type mice injected with sc-AAV2-VMD2 7 days after laser treatment (A and C are representative gel images, B and D are densitometric quantification; *p<0.05 vs. sc-AAV2-VMD2-GFP; n=5-6; CC, cytochrome C-treated cell lysate). [Figure 6D] Figures 6A-6D show that expression of active Rap1a in the RPE by sc-AAV2-VMD2-CARap1a does not activate apoptosis or autophagy. Western blots of (A-B) caspase 3 and (C-D) LC3A / B in the RPE / choroid of wild-type mice injected with sc-AAV2-VMD2 7 days after laser treatment (A and C are representative gel images, B and D are densitometric quantification; *p<0.05 vs. sc-AAV2-VMD2-GFP; n=5-6; CC, cytochrome C-treated cell lysate). [Figure 7A]Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7B] Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7C]Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7D] Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7E]Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7F] Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7G]Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7H] Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7I]Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7J] Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). [Figure 7K]Figures 7A–7K show that expression of activated Rap1a in RPE by adenovirus transduction reduces VEGF and NF-κB activation without increasing autophagy and cell death. (A) Western blots of virally transduced RPE and (B–C) Rap1 protein, (D–E) VEGF protein, (F) phosphorylated NF-κB (p-NF-κB) and total NF-κB, (G–H) LC3A / B protein, and (I) caspase-3 and cleaved caspase-3; and (J–K) TUNEL staining in human RPE transduced with adenovirus expressing GFP (Ad-GFP) or GFP and constitutively active Rap1a (Ad-63E) (*p<0.05, **p<0.01 vs. Ad-GFP; n=3; CC in Figure I refers to cytochrome C-treated cell lysates). DETAILED DESCRIPTION OF THE INVENTION

[0017] The methods and compositions of the present disclosure may be understood more readily by reference to the following detailed description of specific embodiments and examples contained therein, as well as the figures and their accompanying descriptions.

[0018] It is understood that the methods and compositions of the present disclosure are not limited to particular synthetic methods, particular analytical techniques, or particular reagents, unless otherwise specified, and as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0019] Disclosed herein are materials, compositions, and components that can be used in, in conjunction with, or in preparation for the disclosed methods and compositions, or that are products of the disclosed methods and compositions. These and other materials are disclosed herein, and as combinations, subsets, interactions, groups, etc., of these materials are disclosed, it is understood that although specific reference to each of the various individual and collective combinations and permutations of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. Thus, if a class of molecules A, B, and C is disclosed, as well as a class of molecules D, E, and F, and an example of a combined molecule AD is disclosed, each is individually and collectively contemplated, even if each is not individually described. Thus, in this example, each of the combinations AE, AF, BD, BE, BF, CD, CE, and CF is specifically contemplated and should be considered disclosed from the disclosure of A, B, and C, D, E, and F, and the example combination AD. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the subgroups AE, BF, and CE are specifically contemplated and should be considered disclosed from the disclosure of A, B, and C, D, E, and F, and exemplary combination AD. This concept applies to all aspects of this application, including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, where there are various additional steps that can be performed, it is understood that each of these additional steps can be performed with any particular embodiment or combination of embodiments of the disclosed methods, and that each such combination is specifically contemplated and should be considered disclosed.

[0020] A.Definition It is understood that the methods and compositions of the present disclosure are not limited to the particular methodology, protocols, and reagents described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the invention, which will be limited only by the appended claims.

[0021] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to a "nucleic acid sequence" includes a plurality of such nucleic acid sequences, a reference to a "vector" is a reference to one or more vectors and equivalents thereof known to those skilled in the art, and so forth.

[0022] "Operably linked" expression means that the promoter sequence is positioned relative to the coding sequence of the gene of interest so that transcription can be initiated. This means that the promoter is located upstream of the coding sequence at a distance that allows expression of the coding sequence.

[0023] The term "percent (%) homology" is used interchangeably herein with the term "percent (%) identity" and refers to the level of identity of a nucleic acid or amino acid sequence when aligned with a wild-type sequence using a sequence alignment program. For example, as used herein, 80% homology means the same as 80% sequence identity as determined by a defined algorithm; thus, a homolog of a given sequence has greater than 80% sequence identity over the length of the given sequence. Exemplary levels of sequence identity include, but are not limited to, 80, 85, 90, 95, 98% or more sequence identity to a given sequence, such as the coding sequence for any one of the polypeptides of the present invention described herein. Exemplary computer programs that can be used to determine identity between two sequences include, but are not limited to, the BLAST suite of programs, such as BLASTN, BLASTX, and TBLASTX, BLASTP, and TBLASTN, which are publicly available on the internet. See also Altschul, et al., 1990 and Altschul, et al., 1997. Sequence searches are typically performed using the BLASTN program to evaluate a given nucleic acid sequence against nucleic acid sequences in GenBank DNA sequences and other public databases. The BLASTX program is suitable for searching nucleic acid sequences translated in all reading frames against amino acid sequences in GenBank protein sequences and other public databases. Both BLASTN and BLASTX are run using default parameters of an open gap penalty of 11.0 and an extended gap penalty of 1.0, and utilize the BLOSUM-62 matrix. (See, e.g., Altschul, S. F., et al., Nucleic Acids Res. 25:3389-3402, 1997.)) Suitable alignment of selected sequences to determine "% identity" between two or more sequences is performed, for example, using the CLUSTAL-W program in Mac Vector version 13.0.7 operated with default parameters, including an open gap penalty of 10.0, an extended gap penalty of 0.1, and a BLOSUM30 similarity matrix.

[0024] As used herein, the term "wild-type" refers to a gene or gene product that has the characteristics of that gene or gene product when isolated from a natural source.

[0025] The terms "variant" and "mutant" are used interchangeably herein. As used herein, the term "mutant" refers to a modified nucleic acid or protein that exhibits the same characteristics when compared to a reference nucleic acid or protein sequence. A variant may be at least 65, 70, 75, 80, 85, 90, 95, or 99 percent homologous to a reference sequence. In some embodiments, the reference sequence may be a CARap1a nucleic acid sequence or an activated Rap1a protein sequence. A variant may also include a nucleotide sequence substantially similar to the sequence of an miRNA disclosed herein. "Variant" may mean a difference from a reference sequence in any way other than a simple deletion of nucleotides at the N- and / or C-terminus. A variant may also, or alternatively, include at least one substitution and / or at least one addition, and may include at least one deletion. Alternatively, or in addition, a variant may include a modification, such as a non-natural residue, at one or more positions relative to the reference nucleic acid or protein.

[0026] Substitution, deletion, insertion, or any combination thereof may be used to reach the final derivative or variant. Generally, these changes are made on a few nucleotides to minimize the change of the molecule. However, in certain circumstances, larger changes can be tolerated.

[0027] Generally, the nucleotide identity between individual variant sequences can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. Thus, a "variant sequence" can have a specified identity to a parent or reference sequence of the present invention (e.g., a wild-type sequence) and share biological function, including but not limited to, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, and 98%, or 99% of the specificity and / or activity of the parent sequence. For example, a "variant sequence" can be a sequence that contains one, two, three, or four nucleotide base changes compared to a parent or reference sequence of the present invention, and shares or improves the biological function, specificity, and / or activity of the parent sequence. Thus, a "variant sequence" can have a designated identity to a parent sequence of the invention and share biological function, including but not limited to, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the specificity and / or activity of the parent sequence. A variant sequence may also share at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the specificity and / or activity of a reference sequence (e.g., a wild-type sequence, a CArap1a nucleic acid sequence, or an active Rap1a protein sequence).

[0028] As used herein, the term "nucleic acid" refers to any natural or synthetic oligonucleotide or polynucleotide capable of hybridizing to a complementary nucleic acid by Watson-Crick base pairing, whether DNA, RNA, a DNA-RNA hybrid, single-stranded or double-stranded, sense or antisense. Nucleic acids of the present invention may also contain nucleotide analogs (e.g., BrdU) and non-phosphodiester internucleoside linkages (e.g., peptide nucleic acid (PNA) or thiodiester linkages). In particular, nucleic acids may include, but are not limited to, DNA, RNA, cDNA, gDNA, ssDNA, dsDNA, or any combination thereof.

[0029] An "effective amount" of a composition provided herein refers to a sufficient amount of the composition to provide the desired effect. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease (or underlying genetic defect) being treated, the particular composition used, its mode of administration, and the like. Therefore, an exact "effective amount" cannot be specified. However, an appropriate "effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.

[0030] By "treating" is meant administering a peptide, nucleic acid, vector, or composition of the invention to a subject, such as a human or other mammal (e.g., an animal model), that has an increased susceptibility to developing or has age-related macular degeneration, in order to prevent or slow the worsening of the effects of the disease or condition, or to partially or completely reverse the effects of the disease.

[0031] By "preventing" is meant minimizing the likelihood of a subject having an increased susceptibility to developing age-related macular degeneration.

[0032] "Optional" or "optionally" means that the event, circumstance, or material described thereafter may or may not occur, and that the description includes instances in which the event, circumstance, or material occurs or is present and instances in which it does not occur or is not present.

[0033] Ranges may be expressed herein as from "about" one particular value and / or to "about" another particular value. When such ranges are expressed, it is the range from one particular value and / or to the other particular value that is also expressly contemplated and considered to be disclosed, unless the context specifically indicates otherwise. Similarly, when values ​​are expressed as approximations, by the use of "about," it is understood that the particular value constitutes another specifically contemplated embodiment that should be considered as disclosed, unless the context specifically indicates otherwise. It will be further understood that the endpoints of each range are significant both in relation to the other endpoint and independently of the other endpoint, unless the context clearly indicates otherwise. Consequently, all individual values ​​and subranges of values ​​falling within an explicitly disclosed range are also to be considered expressly contemplated and disclosed, unless the context specifically indicates otherwise. The foregoing applies regardless of whether some or all of these embodiments are explicitly disclosed in a particular instance.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed methods and compositions belong. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the methods and compositions of the present invention, particularly useful methods, devices, and materials are as described. Publications cited herein and the materials for which they are cited are specifically incorporated herein by reference. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. No admission is made that any reference constitutes prior art. The discussion of a reference states what its author asserts, and the applicant reserves the right to challenge the accuracy and pertinence of the cited documents. Although numerous publications are referenced herein, such reference does not constitute an admission that any of these documents form part of the common general knowledge in the art.

[0035] Throughout this description and the claims, the word "comprise," and variations of that word, such as "comprising" and "comprises," mean "including, but not limited to," and are not intended to exclude, for example, other additional points, components, integers, or steps. In particular, in methods described as including one or more steps or actions, each step is expressly contemplated to include what is recited (unless the step includes limiting language such as "consisting of"), meaning that each step is not intended to exclude, for example, other additional points, components, integers, or steps not recited in the step.

[0036] B. Nucleic acid Disclosed is a nucleic acid construct comprising a nucleic acid sequence encoding the vitelloid macular dystrophy 2 (VMD2) promoter operably linked to a nucleic acid sequence encoding Rap1a. Also disclosed is a nucleic acid construct comprising a nucleic acid sequence encoding the vitelloid macular dystrophy 2 (VMD2) promoter operably linked to a nucleic acid sequence encoding constitutively active Rap1a. Also disclosed is a nucleic acid construct comprising a nucleic acid sequence encoding the vitelloid macular dystrophy 2 (VMD2) promoter operably linked to a nucleic acid sequence encoding active Rap1a.

[0037] In some embodiments, the VMD2 promoter is a human VMD2 promoter. In some embodiments, the human VMD2 promoter is (SEQ ID NO: 1).

[0038] In some embodiments, the VMD2 promoter is a variant of SEQ ID NO: 1. In some embodiments, the VMD2 promoter is 65, 70, 75, 80, 85, 90, 95, or 99 percent homologous to SEQ ID NO: 1.

[0039] In some embodiments, the encoded Rap1a protein is an active Rap1a protein. In some embodiments, the active Rap1a protein is encoded by a constitutively active Rap1a (CARap1a) nucleic acid sequence. As used herein, the terms "CARap1a," "constitutively active Rap1a," and "constitutively active Rap1a nucleic acid" are used interchangeably. In other words, a constitutively active Rap1a nucleic acid sequence may encode an active Rap1a protein. As used herein, the terms "active Rap1a protein" and "active Rap1a" are used interchangeably. In some embodiments, the active Rap1a protein is a human Rap1a protein. In some embodiments, a constitutively active Rap1a nucleic acid sequence encoding human active Rap1a is ATGCGGGAATACAAGCTTGTGGTGCTGGGCTCTGGAGGCGTGGGAAAGAGTGCGTTAACCGTCCAGTTTGTGCAGGGCATCTTTGTGGAGAAGTATGATCCCACTATAGAGGACTCCTACCGGAAACAGGTGGAGGTCGACTGTCAGCAATGTATGCTGGAGATCTTAGACACTGCAGGTACAGAA GAATTTACTGCCATGCGGGACCTGTACATGAAGAACGGGCAGGGCTTCGCTCTGGTATATTCCATCACCGCTCAGTCAACCTTTAACGACCTTCAGGATCTTCGCGAGCAGATCCTACGCGTGAAAGATACAGAGGACGTCCCAATGATACTAGTGGGCAACAAGTGTGACCTGGAGGATGAACGGGTTGTG GGCAAGGAGCAGGGTCAGAACCTGGCCAGGCAGTGGTGCAACTGTGCCTTTGGAATCTAGCGCCAAGTCCAAGATCAACGTAAACGAGATCTTCTACGACCTAGTACGTCAGATTAACCGGAAGACACCTGTGGAGAAGAAGAAACCTAAGAAGAAATCCTGCCTGCTTCTCTGA (SEQ ID NO: 2).

[0040] In some embodiments, the constitutively active Rap1a is a variant of SEQ ID NO:2. In some embodiments, the constitutively active Rap1a is 65, 70, 75, 80, 85, 90, 95, or 99 percent homologous to SEQ ID NO:2. In some embodiments, the constitutively active Rap1a variant must contain the underlined GAA sequence in SEQ ID NO:2 above. Thus, in some embodiments, the percent identity of a constitutively active Rap1a variant can be 65, 70, 75, 80, 85, 90, 95, or 99 percent homologous to SEQ ID NO:2 and can contain the underlined GAA sequence shown above in SEQ ID NO:2. In some embodiments, the codon present in the underlined GAA encodes glutamic acid. In some embodiments, the constitutively active Rap1a variant can contain any codon encoding glutamic acid at the underlined GAA position in SEQ ID NO:2. The nucleic acid sequence of wild-type Rap1a encodes glutamine at a sequence corresponding to GAA in SEQ ID NO: 2. Thus, in some embodiments, a nucleic acid sequence containing a nucleic acid mutation that results in an amino acid change from glutamine to glutamic acid can be a nucleic acid sequence of constitutively active Rap1a.

[0041] In some embodiments, the constitutively active Rap1a is a variant of SEQ ID NO:3. ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACAGTTCAGTTTGTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTACAGAAAGCAAGTTGAAGTCGATTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGGACAGAG CAA TTTACAGCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTAGTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATTTTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTGGAAGATGAGCGAGTA GTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAACTGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGACCTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCATGTCTGCTGCTCTAG (SEQ ID NO: 3) In some embodiments, the constitutively active Rap1a is 65, 70, 75, 80, 85, 90, 95, or 99 percent homologous to SEQ ID NO:3. In some embodiments, the constitutively active Rap1a variant must include a CAA to GAA (underlined in SEQ ID NO:3) mutation. In some embodiments, additional mutations other than the CAA to GAA mutation may be present. Thus, in some embodiments, the percent identity of the constitutively active Rap1a variant may be 65, 70, 75, 80, 85, 90, 95, or 99 percent homologous to SEQ ID NO:3 and may include at least the underlined CAA to GAA mutation. Thus, the encoded active Rap1a includes a glutamine to glutamic acid mutation.

[0042] In some embodiments, the constitutively active Rap1a encodes an active Rap1a. MREYKLVVLGSGGVGKSALTVQFVQGIFVEKYDPTIEDSYRKQVEVDCQQCMLEILDTAGTEEFTAMRDLYMKNGQGFALVYSITAQSTFNDLQDLREQILRVKDTEDVPMILVGNKCDLEDERVVGKEQGQNLARQWCNCAFLESSAKSKINVNEIFYDLVRQINRKTPVEKKKPKKKSCLLL (SEQ ID NO: 4). In some embodiments, active Rap1a is 65, 70, 75, 80, 85, 90, 95, or 99 percent homologous to SEQ ID NO: 4. In some embodiments, active Rap1a variants must include a glutamic acid (E) at position 63, shown in bold in SEQ ID NO: 4 above. Thus, in some embodiments, the percent identity of an active Rap1a variant can be 65, 70, 75, 80, 85, 90, 95, or 99 percent homologous to SEQ ID NO: 4 and can include at least the bolded E amino acid shown above in SEQ ID NO: 4. In some embodiments, active Rap1a and wild-type Rap1a are identical except for the Q→E mutation at position 63 in active Rap1A.

[0043] In some embodiments, any of the nucleic acid constructs of the present disclosure may further comprise a nucleic acid sequence encoding a marker. For example, a nucleic acid construct is disclosed that comprises a nucleic acid sequence encoding a VMD2 promoter operably linked to a nucleic acid sequence encoding an activated Rap1a, which further comprises a nucleic acid sequence encoding a marker.

[0044] In some embodiments, the marker can be a label. In some embodiments, the marker gene can be the E. coli lacZ gene, which encodes β-galactosidase, or green fluorescent protein (GFP). In some embodiments, the marker can be a selectable marker. Examples of selectable markers suitable for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin.

[0045] In some embodiments, the VMD2 promoter can be a constitutive promoter or an inducible promoter. An inducible promoter is a promoter whose activity can be controlled by certain environmental conditions or the presence of specific compounds, thus allowing for the control of the expression of a gene of interest (e.g., a constitutively active Rap1a). In some embodiments, the promoter can be derived from a natural gene or can include a synthetic DNA segment.

[0046] In one aspect, disclosed herein are compositions that include an inducible promoter within the constructs disclosed herein so that transcription of a selected gene (e.g., constitutively active Rap1a) can be turned on and off, thereby minimizing cytotoxicity that can sometimes be caused by the expression of cytotoxic viral proteins and increasing the stability of cells containing the vector. For example, high levels of VSV-G (envelope protein) and Vpr expression can be cytotoxic (Yee, J.-K., et al., Proc. Natl. Acad. Sci., 91:9654-9568 (1994)). Therefore, expression of these proteins in the packaging cells of the present invention can be controlled by an inducible operator system, such as the inducible Tet operator system (Gibco BRL, Carlsbad, CA), which allows for strict control of gene expression (i.e., production of retroviral particles) by the concentration of tetracycline in the culture medium. That is, in the Tet operator system, in the presence of tetracycline, tetracycline binds to a Tet transactivator fusion protein (tTA), preventing the binding of tTA to the Tet operator sequence and allowing expression of genes under the control of the Tet operator sequence (Gossen et al. (1992) PNAS 89:5547-5551), which is incorporated herein by reference in its entirety for its teaching of tTA and for enabling expression of genes under the control of Tet operator sequences. In the absence of tetracycline, tTA binds to Tet operator sequences preventing expression of genes under the control of the Tet operator.

[0047] Other examples of inducible operator systems that can be used to control protein expression include: 1) inducible eukaryotic promoters responsive to metal ions (e.g., metallothionein promoters) or glucocorticoid hormones; and 2) the LacSwitch™ Inducible Mammalian Expression System in E. coli (Stratagene) (La Jolla, CA). Briefly, in the E. coli lactose operon, the Lac repressor binds to the lac operator as a homotetramer and blocks transcription of the lac2 gene. Inducers such as allolactose (a physiological inducer) or isopropyl-β-D-thiogalactoside (IPTG, a synthetic inducer) bind to the Lac repressor, causing a conformational change that effectively reduces the repressor's affinity for the operator. When the repressor is removed from the operator, transcription from the lactose operon resumes.

[0048] C. Vector Disclosed are vectors that include any of the nucleic acid constructs disclosed herein.

[0049] The term "expression vector" includes any vector (e.g., a plasmid, cosmid, or phage chromosome) that contains a genetic construct in a form suitable for expression by a cell (e.g., linked to transcriptional regulatory elements). "Plasmid" and "vector" are used interchangeably, as the plasmid is a commonly used form of vector. Furthermore, the invention is intended to include other vectors that serve equivalent functions.

[0050] In some embodiments, the vector can be a viral vector.For example, the viral vector can be an adeno-associated viral vector.In some embodiments, the vector can be a non-viral vector, such as a DNA-based vector.

[0051] i. Viral and non-viral vectors There are many compositions and methods that can be used to deliver the disclosed nucleic acids to cells, either in vitro or in vivo. These methods and compositions can be broadly divided into two categories: viral-based delivery systems and non-viral-based delivery systems. For example, nucleic acids can be delivered through numerous direct delivery systems, such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via carriers such as cationic liposomes for the transfer of genetic material into cells. Suitable transfection methods, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct DNA diffusion, are described, for example, by Wolff, JA, et al., Science, 247, 1465-1468, (1990); and Wolff, JANature, 352, 815-818, (1991). Such methods are well known in the art and can be easily adapted for use with the compositions and methods described herein. In certain cases, the methods can be adapted to function specifically with large DNA molecules. Furthermore, these methods can be used to target certain diseases and cell populations by using the targeting properties of the carrier.

[0052] An expression vector can be any nucleotide construct (e.g., a plasmid) used to deliver a gene or gene fragment into a cell, or any nucleotide construct used as part of a general strategy for delivering a gene or gene fragment, for example, as part of a recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)). For example, an expression vector comprising a nucleic acid sequence capable of encoding the VMD2 promoter operably linked to a nucleic acid sequence encoding Rap1a is disclosed herein.

[0053] The "control elements" present in an expression vector are the untranslated regions of the vector, i.e., enhancers, promoters, 5' untranslated regions, and 3' untranslated regions, that interact with host cell proteins to effect transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of appropriate transcription and translation factors may be used, including constitutive and inducible promoters. For example, when cloning in a bacterial system, an inducible promoter such as the hybrid lacZ promoter of the pBLUESCRIPT phagemid (Stratagene, La Jolla, CA) or pSPORT1 plasmid (Gibco BRL, Gaithersburg, MD) may be used. When it is necessary to generate a cell line containing multiple copies of a polypeptide-encoding sequence, SV40- or EBV-based vectors may be advantageously used with an appropriate selectable marker.

[0054] Enhancers generally refer to DNA sequences that function at any distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78:993 (1981)) or 3' (Lusky, M. L. et al., Mol. Cell Bio. 3:1108 (1983)) to the transcription unit. Furthermore, enhancers can be found within introns (Banerji, J. Let al., Cell 33:729 (1983)) as well as within the coding sequence itself (Osborne, T. F. et al., Mol. Cell Bio. 4:1293 (1984)). They are usually between 10 and 300 bp in length and function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters may also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of gene expression. Many enhancer sequences are currently known from mammalian genes (globin, elastase, albumin, α-fetoprotein, and insulin), but enhancers from eukaryotic viruses are typically used for general expression. Suitable examples include the SV40 enhancer on the late side of the replication origin (100 to 270 bp), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

[0055] The promoter or enhancer may be specifically activated by either light or specific chemical events that trigger its function. The system may be controlled by agents such as tetracycline and dexamethasone. There are also methods to enhance viral vector gene expression by exposure to irradiation, such as gamma irradiation, or alkylating chemotherapy drugs.

[0056] Optionally, the promoter or enhancer region can act as a constitutive promoter or enhancer to maximize expression of the polynucleotide of the invention. In certain constructs, the promoter or enhancer region is active in all eukaryotic cell types, even if it is only expressed in certain cell types at certain times.

[0057] Expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells) may also contain sequences necessary for transcription termination, which can affect mRNA expression. These regions are transcribed as polyadenylation segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3' untranslated region also contains a transcription termination site. Preferably, the transcription unit also contains a polyadenylation region. One advantage of this region is that it increases the likelihood that the transcription unit will be processed and transported like mRNA. The identification and use of polyadenylation signals in expression constructs is well established. Preferably, a homologous polyadenylation signal is used in transgene constructs. In one particular transcription unit, the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of approximately 400 bases.

[0058] The expression vector may contain a nucleic acid sequence encoding a marker product. This marker product can be used to determine whether the gene has been delivered to the cell and whether it is being expressed once delivered. Marker genes include, but are not limited to, the E. coli lacZ gene encoding β-galactosidase and the gene encoding green fluorescent protein.

[0059] In some embodiments, the marker may be a selectable marker. Examples of selectable markers suitable for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. When such selectable markers are successfully transferred into mammalian host cells, the transformed mammalian host cells can survive when placed under selective pressure. There are two widely used distinct categories of selective regimens. The first category is based on cellular metabolism and the use of mutant cell lines that lack the ability to grow independent of supplemented media. Two examples are CHO DHFR- cells and mouse LTK- cells. These cells lack the ability to grow without the addition of nutrients such as thymidine or hypoxanthine. Because these cells lack certain genes required for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to media supplementation is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thereby altering their growth requirements. Individual cells that are not transformed with the DHFR or TK gene will not be able to survive in unsupplemented medium.

[0060] Another type of selection that can be used in conjunction with the compositions and methods disclosed herein is dominant selection, which refers to a selection scheme that can be used with any cell type and does not require the use of mutant cell lines. These schemes typically use a drug to inhibit the growth of host cells. Those cells that harbor the novel gene will express a protein that confers drug resistance and will survive the selection. Examples of such dominant selection methods use neomycin (Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982)), mycophenolic acid (Mulligan, R.C. and Berg, P. Science 209:1422 (1980)), or hygromycin (Sugden, B. et al., Mol. Cell. Biol. 5:410-413 (1985)). Three examples employ bacterial genes under eukaryotic control to confer resistance to the appropriate drugs, G418 or neomycin (geneticin), xgpt (mycophenolic acid), or hygromycin, respectively. Others include the neomycin analogue G418 and puramycin.

[0061] As used herein, a plasmid or viral vector refers to an agent that transports a nucleic acid of the present disclosure, such as a nucleic acid sequence capable of encoding one or more of the disclosed peptides, into a cell without degradation and contains a promoter that drives gene expression in the cell to which it is delivered. In some embodiments, the nucleic acid sequences disclosed herein are derived from either a virus or a retrovirus. Viral vectors include, for example, adenovirus, adeno-associated virus, herpesvirus, vaccinia virus, poliovirus, AIDS virus, neurotropic virus, Sindbis virus, and other RNA viruses, including those with an HIV backbone. Also suitable are any virus families that share the properties of these viruses that make them suitable for use as vectors. Retroviruses include murine moloney leukemia virus (MMLV) and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors can carry larger gene payloads, i.e., transgenes or marker genes, than other viral vectors, and for this reason are commonly used vectors. However, they are less useful in non-proliferating cells. Adenoviral vectors are relatively stable, easy to work with, have high titers, can be delivered in aerosol formulations, and can transfect non-dividing cells. Pox virus vectors are large, have several sites for inserting genes, and are thermostable, allowing them to be stored at room temperature. A preferred embodiment is a viral vector that has been engineered to suppress the immune response of the host organism elicited by viral antigens. A preferred vector of this type would carry the coding region for interleukin 8 or 10.

[0062] Viral vectors can have higher throughput (i.e., the ability to introduce genes) than chemical or physical methods for introducing genes into cells. Typically, viral vectors contain nonstructural early genes, structural late genes, RNA polymerase III transcripts, inverted terminal repeats necessary for replication and encapsidation, and promoters that control the transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more of the early genes removed, and a gene or gene / promoter cassette is inserted into the viral genome in place of the removed viral DNA. This type of construct can carry up to approximately 8 kb of foreign genetic material. The necessary functions of the removed early genes are typically supplied by cell lines engineered to express the gene products of the early genes in trans.

[0063] Retroviral vectors are generally described by Verma, I. M., Retroviral vectors for gene transfer. In Microbiology, Amer. Soc. for Microbiology, pp. 229-232, Washington, (1985), which is incorporated herein by reference in its entirety. Examples of methods for using retroviral vectors in gene therapy are described in U.S. Pat. Nos. 4,868,116 and 4,980,286, PCT applications WO 90 / 02806 and WO 89 / 07136, and Mulligan, (Science 260:926-932 (1993)), the teachings of which are incorporated herein by reference in their entirety for teaching methods for using retroviral vectors in gene therapy.

[0064] Retroviruses are essentially packages that pack nucleic acid cargo into a nucleic acid cargo carrying a packaging signal that ensures efficient packaging of replicated daughter molecules into the package coat. In addition to the packaging signal, numerous other molecules are required in cis for replication and packaging of the replicated virus. A typical retroviral genome contains the gag, pol, and env genes, which are involved in the construction of the protein coat. It is the gag, pol, and env genes that are typically replaced by foreign DNA that are transported into target cells. Retroviral vectors typically contain a packaging signal for incorporation into the package coat, factors required for reverse transcription, including a primer-binding site for binding a tRNA primer for reverse transcription, long terminal repeats that guide RNA strand switching during DNA synthesis, purine-rich sequences from the 5' LTR to the 3' LTR that function as priming sites for second-strand DNA synthesis, and specific sequences near the ends of the LTRs that allow the retroviral DNA insert to be inserted into the host genome. This amount of nucleic acid is sufficient to deliver from one to many genes, depending on the size of each transcript. It is preferable to include either a positively or negatively selectable marker along with any other genes in the insert.

[0065] Because the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically produced by placing them in packaging cell lines. Packaging cell lines are cell lines that have been transfected or transformed with a retrovirus that contains the replication and packaging machinery but lacks a packaging signal. When a vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles by machinery provided in cis by the helper cells. The genome of this machinery is not packaged because it lacks the necessary signals.

[0066] The construction of replication-deficient adenoviruses has been described (Berkner et al., J. Virology 61:1213-1220 (1987); Massie et al., Mol. Cell. Biol. 6:2872-2883 (1986); Haj-Ahmad et al., J. Virology 57:267-274 (1986); Davidson et al., J. Virology 61:1226-1239 (1987); Zhang, "Generation and identification of recombinant adenovirus by liposome-mediated transfection and PCR analysis," BioTechniques 15:868-872 (1993)). The advantage of using these viruses as vectors is that they are limited in the extent to which they can spread to other cell types because, although they can replicate within the initially infected cell, they are unable to form new infectious viral particles.Recombinant adenoviruses have been shown to express in respiratory epithelia, hepatocytes, vascular endothelium, CNS parenchyma, and numerous other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); Roessler, J. Clin. Invest. 92:1085-1092 (1993); Moullier, Nature Genetics 4:154-159 (1993); La Salle, Science 259:988-990 (1993); Gomez-Foix, J. Biol. Chem. 267:25129-25134 (1992); Rich, Human Gene Therapy 4:461-476 (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, Circulation Research 73:1201-1207 (1993); Bout, Human Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); and Ragot, J. Gen. Virology 74:501-507 (1993)), the teachings of which are incorporated herein by reference in their entireties for teaching methods of using retroviral vectors in gene therapy.Recombinant adenovirus achieves gene transfer by binding to specific cell surface receptors, and the virus is then internalized by receptor-mediated endocytosis in the same manner as wild-type or replication-deficient adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51:650-655 (1984); Seth, et al., Mol. Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319(1993)).

[0067] Viral vectors can be based on adenoviruses with the E1 gene removed, and these viruses are produced in cell lines such as the human 293 cell line. Optionally, both the E1 and E3 genes are removed from the adenoviral genome.

[0068] Another type of viral vector that can be used to introduce the polynucleotides of the present invention into cells is based on adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it infects numerous cell types and is nonpathogenic to humans. AAV-type vectors can transport approximately 4 to 5 kb, and wild-type AAV is known to stably integrate into chromosome 19. Vectors containing this site-specific integration property are preferred. A particularly preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain marker genes such as the herpes simplex virus thymidine kinase gene HSV-tk or the gene encoding green fluorescent protein GFP.

[0069] In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) flanking at least one cassette containing a promoter that directs cell-specific expression operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene that is not native to AAV or B19 parvovirus. Typically, the AAV and B19 coding regions are deleted, resulting in a safe, non-cytotoxic vector. The AAV ITRs or variants thereof confer infectivity and site-specific integration but not cytotoxicity, and the promoter directs cell-specific expression. U.S. Patent No. 6,261,834 is incorporated herein by reference in its entirety for material related to AAV vectors.

[0070] The inserted genes in viral and retroviral vectors usually contain promoters or enhancers that help control the expression of the desired gene product. A promoter is generally one or more DNA sequences that function when located in a relatively fixed position relative to the transcription start site. A promoter contains core elements required for basic interaction between RNA polymerase and transcription factors, and may also contain upstream elements and response elements.

[0071] Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors. Furthermore, the disclosed nucleic acid sequences can be delivered to target cells in non-nucleic acid-based systems. For example, the disclosed polynucleotides can be delivered via electroporation, lipofection, or calcium phosphate precipitation. The delivery mechanism selected will depend, in part, on the type of targeted cell and whether delivery is occurring, for example, in vivo or in vitro.

[0072] Thus, in addition to the disclosed expression vectors, the compositions can include lipids such as liposomes, e.g., cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes. Liposomes can further include proteins, if desired, to facilitate targeting to specific cells. Compositions containing peptides and cationic liposomes can be administered to the blood, target organs, or inhaled into the airways to target cells in the airways. For example, compositions containing the peptides or nucleic acid sequences described herein and cationic liposomes can be administered to lung cells in a subject. For more information on liposomes, see, e.g., Brigham et al. Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Felgner et al. Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); U.S. Patent No. 4,897,355. Additionally, the compounds can be administered as components of microcapsules that can be targeted to specific cell types, such as macrophages, or where the diffusion or delivery of the compound from the microcapsules is engineered for a specific rate or dose.

[0073] D. Composition Compositions comprising the nucleic acid construct or vector of the present disclosure are disclosed. Compositions comprising a nucleic acid construct are disclosed, wherein the nucleic acid construct comprises a nucleic acid sequence encoding a VMD2 promoter operably linked to a constitutively active Rap1a nucleic acid sequence. Compositions comprising a nucleic acid construct are disclosed, wherein the nucleic acid construct comprises a nucleic acid sequence encoding a VMD2 promoter operably linked to a nucleic acid sequence encoding an active Rap1a. Also disclosed are compositions comprising a vector, such as a viral vector, comprising a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid sequence encoding a VMD2 promoter operably linked to a nucleic acid sequence encoding an active Rap1a.

[0074] The disclosed compositions can further comprise a pharmaceutically acceptable carrier.

[0075] 1. Delivery of the Composition In the methods described herein, delivery (or administration) of the composition to a cell can be achieved via a variety of mechanisms. As defined above, compositions comprising any one or more of the peptides, nucleic acids, and / or vectors described herein are disclosed herein, and can be made into compositions that may also include a carrier, such as a pharmaceutically acceptable carrier. For example, pharmaceutical compositions are disclosed that include the peptides disclosed herein and a pharmaceutically acceptable carrier.

[0076] For example, the compositions described herein may contain a pharmaceutically acceptable carrier. "Pharmaceutically acceptable" refers to a material or carrier selected to minimize any degradation of the active ingredient and minimize any adverse side effects in the subject, as is well known to those skilled in the art. Examples of carriers include dimyristoyl phosphatidylcholine (DMPC), phosphate-buffered saline, or multivesicular liposomes. For example, PG:PC:cholesterol:peptide or PC:peptide can be used as a carrier in the present invention. Other suitable pharmaceutically acceptable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of a pharmaceutically acceptable salt is used in the formulation to render the formulation isotonic. Other examples of pharmaceutically acceptable carriers include, but are not limited to, saline, Ringer's solution, and dextrose solution. The pH of the solution can be about 5 to about 8 or about 7 to about 7.5. Other carriers include sustained-release preparations, such as semipermeable matrices of solid hydrophobic polymers containing the composition, which matrices are in the form of shaped articles, such as films, stents (implanted in blood vessels during angioplasty procedures), liposomes, or microparticles.It will be clear to those skilled in the art that certain carriers may be more preferable depending on, for example, the route of administration and concentration of the composition being administered.These are most typically the standard carriers for administering drugs to humans, including solutions such as sterilized water, physiological saline, and buffered solutions at physiological pH.

[0077] Pharmaceutical compositions may also contain carriers, thickeners, diluents, buffers, preservatives, etc., as long as the intended activity of the polypeptides, peptides, nucleic acids, and vectors of the invention is not impaired. Pharmaceutical compositions may also contain one or more active ingredients (in addition to the compositions of the invention), such as antimicrobial agents, anti-inflammatory agents, anesthetics, etc. Pharmaceutical compositions may be administered in several ways, depending on whether local or systemic treatment is desired and on the area to be treated.

[0078] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, and inert gases.

[0079] Formulations for optical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, and the like may be necessary or desirable.

[0080] Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids, or binders may be desirable. Some compositions may be administered as pharmaceutically acceptable acid or base addition salts formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or inorganic bases such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl, and arylamines, and substituted ethanolamines.

[0081] The delivery techniques of the present disclosure can be used not only with the compositions of the present disclosure, but also with the nucleic acid constructs and vectors of the present disclosure.

[0082] E. Recombinant Cells Recombinant cells comprising one or more of the nucleic acid constructs or vectors of the present disclosure are disclosed. For example, recombinant cells comprising a nucleic acid construct are disclosed, wherein the nucleic acid construct comprises a nucleic acid sequence encoding a VMD2 promoter operably linked to a nucleic acid sequence encoding Rap1a.

[0083] In some embodiments, the cell is a mammalian cell, hi some embodiments, the cell is a retinal pigment epithelial (RPE) cell.

[0084] F. Treatment method Disclosed are methods of treating a subject with age-related macular degeneration comprising administering to a subject in need thereof one or more of the nucleic acid constructs, vectors, or compositions of the present disclosure.

[0085] In some embodiments, the composition is administered via subretinal administration. In some embodiments, the composition is administered via intravitreal administration. In some embodiments, the composition is administered via intravitreal administration, and the composition is administered in an amount of 5×1012 The 7M8 AAV vector construct is included at a concentration of viral particles. Other known routes of administration can also be used with the methods of the present disclosure.

[0086] In some embodiments of the therapeutic methods of the present disclosure, the expression of active Rap1 can be increased in a subject without increasing markers of autophagy or apoptosis. For example, a method of treating a subject with age-related macular degeneration is disclosed, comprising administering to a subject in need thereof one or more of the nucleic acid constructs, vectors, or compositions of the present disclosure, wherein the expression of Rap1 is increased in the subject without increasing markers of autophagy or apoptosis in the subject. In some embodiments, The expression of active Rap1 can be increased in a subject's retinal epithelial cells without increasing markers of autophagy or apoptosis. For example, a method of treating a subject with age-related macular degeneration is disclosed, comprising administering to a subject in need thereof one or more of the nucleic acid constructs, vectors, or compositions of the present disclosure, wherein the expression of active Rap1 can be increased in a subject's retinal epithelial cells without increasing markers of autophagy or apoptosis in the subject's retinal epithelial cells.

[0087] In some embodiments, active Rap1a can be expressed at a level at least twice that of active Rap1a expressed in a control subject. In some embodiments, active Rap1a can be expressed at a level at least 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, or 10-fold that of active Rap1a expressed in a control subject. In some embodiments, active Rap1a can be expressed at a level at least 10-fold, 20-fold, 30-fold, 40-fold, or 50-fold that of active Rap1a expressed in a control subject.

[0088] In some embodiments, the optimal dose of one of the vectors of the present disclosure is 5 x 10 for subretinal injection. 8In some embodiments, the dose may be, but is not limited to, 2.5 x 10 8 , 3×10 8 , 3.5×10 8 , 4×10 8 , 4.5×10 8 , 5×10 8 , 5.5×10 8 , 6×10 8 , 6.5×10 8 , 7×10 8 , 7.5×10 8 , 8×10 8 , 8.5×10 8 , 9×10 8 , 9.5×10 8 , 1×10 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 In some embodiments, particularly for intravitreal injection, the dose may be higher. For example, the higher dose may be, but is not limited to, 5×10 11 , 5.5×10 11 , 6×10 11 , 6.5×10 11 , 7×10 11 , 7.5×10 11 , 8×10 11 , 8.5×10 11 , 9×10 11 , 9.5×10 11 , 1×10 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 It could be.

[0089] Disclosed are methods for treating a subject with age-related macular degeneration, comprising administering to a subject in need thereof one or more nucleic acid constructs, vectors, or compositions of the present disclosure in combination with administering to the subject one or more anti-VEGF agents. Disclosed are methods for treating a subject with age-related macular degeneration, comprising administering to a subject in need thereof one or more nucleic acid constructs, vectors, or compositions of the present disclosure, and further comprising administering to the subject one or more anti-VEGF agents. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be administered simultaneously. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be co-administered in a single formulation. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be administered in separate formulations. Thus, the nucleic acid construct, vector, or composition and the anti-VEGF agent can still be administered simultaneously, regardless of whether they are formulated together in a single formulation or in separate formulations. Co-administration can include administering the nucleic acid construct, vector, or composition and the anti-VEGF agent within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 minutes of each other.

[0090] G. Methods of Inhibition Disclosed are methods of inhibiting choroidal neovascularization (CNV) comprising administering to a subject any of the disclosed nucleic acid constructs, vectors, or compositions.

[0091] Also disclosed are methods for reducing CNV, comprising administering any of the disclosed nucleic acid constructs, vectors, or compositions to a subject. The disclosed methods are methods for reducing CNV, comprising administering one or more of the disclosed nucleic acid constructs, vectors, or compositions to a subject in need thereof.

[0092] In some aspects, the administration in the methods of the present disclosure is subretinal or intravitreal administration. In some aspects, the administration can be by intravenous route.

[0093] In some embodiments of the therapeutic methods of the present disclosure, the expression of active Rap1a can be increased in a subject without increasing markers of autophagy or apoptosis. For example, disclosed are methods of reducing CNV in a subject, comprising administering one or more nucleic acid constructs, vectors, or compositions of the present disclosure to a subject in need thereof, wherein the expression of active Rap1 is increased in the subject without increasing markers of autophagy or apoptosis in the subject. In some embodiments, the expression of active Rap1 can be increased in retinal epithelial cells of a subject without increasing markers of autophagy or apoptosis. For example, disclosed are methods of reducing CNV in a subject, comprising administering one or more nucleic acid constructs, vectors, or compositions of the present disclosure to a subject in need thereof, wherein the expression of active Rap1 is increased in retinal epithelial cells of the subject without increasing markers of autophagy or apoptosis in the subject's retinal epithelial cells.

[0094] In some embodiments, active Rap1a can be expressed at a level at least twice that of active Rap1a expressed in a control subject. In some embodiments, active Rap1a can be expressed at a level at least 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, or 10-fold that of active Rap1a expressed in a control subject. In some embodiments, active Rap1a can be expressed at a level at least 10-fold, 20-fold, 30-fold, 40-fold, or 50-fold that of active Rap1a expressed in a control subject.

[0095] In some embodiments, the optimal dose of one of the vectors of the present disclosure is 5 x 10 for subretinal injection. 8 In some embodiments, the dose may be, but is not limited to, 2.5 x 108 , 3×10 8 , 3.5×10 8 , 4×10 8 , 4.5×10 8 , 5×10 8 , 5.5×10 8 , 6×10 8 , 6.5×10 8 , 7×10 8 , 7.5×10 8 , 8×10 8 , 8.5×10 8 , 9×10 8 , 9.5×10 8 , 1×10 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 In some embodiments, particularly for intravitreal injection, the dose may be higher. For example, the higher dose may be, but is not limited to, 5×10 11 , 5.5×10 11 , 6×10 11 , 6.5×10 11 , 7×10 11 , 7.5×10 11 , 8×10 11 , 8.5×10 11 , 9×10 11 , 9.5×10 11 , 1×10 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 It could be.

[0096] Disclosed are methods for inhibiting or reducing CNV, comprising administering any of the nucleic acid constructs, vectors, or compositions disclosed herein to a subject, and further comprising administering one or more anti-VEGF agents to the subject. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be administered simultaneously. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be co-administered in a single formulation. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be administered in separate formulations. Thus, the nucleic acid construct, vector, or composition and the anti-VEGF agent can still be administered simultaneously, regardless of whether they are formulated together in a single formulation or in separate formulations. Co-administration can include administering the nucleic acid construct, vector, or composition and the anti-VEGF agent within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 minutes of each other.

[0097] H. Methods for Reducing Inflammatory Signaling Disclosed are methods for reducing inflammatory signaling in choroidal tissue, comprising administering to a subject any of the nucleic acid constructs, vectors, or compositions of the present disclosure.

[0098] In some aspects, administration in the methods of the present disclosure is subretinal, intravitreal, or intravenous administration.

[0099] In some embodiments of the methods of the present disclosure, the expression of activated Rap1a can be increased in a subject without increasing markers of autophagy or apoptosis. For example, a method is disclosed for reducing inflammatory signaling in choroidal tissue, comprising administering to a subject any of the nucleic acid constructs, vectors, or compositions of the present disclosure, wherein the expression of activated Rap1a is increased in the subject without increasing markers of autophagy or apoptosis in the subject. In some embodiments, the expression of activated Rap1a can be increased in retinal epithelial cells of a subject without increasing markers of autophagy or apoptosis. For example, a method is disclosed for reducing inflammatory signaling in choroidal tissue, comprising administering to a subject any of the nucleic acid constructs, vectors, or compositions of the present disclosure, wherein the expression of activated Rap1a can be increased in retinal epithelial cells of a subject without increasing markers of autophagy or apoptosis in the subject's retinal epithelial cells.

[0100] In some embodiments, active Rap1a can be expressed at a level at least twice that of active Rap1a expressed in a control subject. In some embodiments, active Rap1a can be expressed at a level at least 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, or 10-fold that of active Rap1a expressed in a control subject. In some embodiments, active Rap1a can be expressed at a level at least 10-fold, 20-fold, 30-fold, 40-fold, or 50-fold that of active Rap1a expressed in a control subject.

[0101] In some embodiments, the optimal dose of one of the vectors of the present disclosure is 5 x 10 for subretinal injection. 8 In some embodiments, the dose may be, but is not limited to, 2.5 x 10 8 , 3×10 8 , 3.5×10 8 , 4×10 8 , 4.5×10 8 , 5×10 8 , 5.5×108 , 6×10 8 , 6.5×10 8 , 7×10 8 , 7.5×10 8 , 8×10 8 , 8.5×10 8 , 9×10 8 , 9.5×10 8 , 1×10 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 In some embodiments, particularly for intravitreal injection, the dose may be higher. For example, the higher dose may be, but is not limited to, 5×10 11 , 5.5×10 11 , 6×10 11 , 6.5×10 11 , 7×10 11 , 7.5×10 11 , 8×10 11 , 8.5×10 11 , 9×10 11 , 9.5×10 11 , 1×10 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 It could be.

[0102] Disclosed is a method for reducing inflammatory signaling in choroidal tissue, comprising administering to a subject any of the nucleic acid constructs, vectors, or compositions disclosed herein, and further comprising administering to a subject one or more anti-VEGF agents. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be administered simultaneously. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be co-administered in a single formulation. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be administered in separate formulations. Therefore, the nucleic acid construct, vector, or composition and the anti-VEGF agent can also be administered simultaneously, regardless of whether they are formulated together in a single formulation or in separate formulations. Co-administration can include administering the nucleic acid construct, vector, or composition and the anti-VEGF agent within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 minutes of each other.

[0103] I. Methods of Reducing VEGF Expression Disclosed are methods of reducing VEGF expression in choroidal tissue, comprising administering to a subject any of the nucleic acid constructs, vectors, or compositions of the present disclosure.

[0104] In some aspects, administration in the methods of the present disclosure is subretinal, intravitreal, or intravenous administration.

[0105] In some embodiments of the therapeutic methods of the present disclosure, the expression of activated Rap1a can be increased in a subject without increasing markers of autophagy or apoptosis. For example, a method for reducing VEGF expression in choroidal tissue is disclosed, comprising administering to a subject any of the nucleic acid constructs, vectors, or compositions of the present disclosure, wherein the expression of activated Rap1a is increased in the subject without increasing markers of autophagy or apoptosis. In some embodiments, the expression of activated Rap1a can be increased in retinal epithelial cells of a subject without increasing markers of autophagy or apoptosis. For example, a method for reducing VEGF expression in choroidal tissue is disclosed, comprising administering to a subject any of the nucleic acid constructs, vectors, or compositions of the present disclosure, wherein the expression of activated Rap1a is increased in retinal epithelial cells of a subject without increasing markers of autophagy or apoptosis.

[0106] In some embodiments, active Rap1a can be expressed at a level at least twice that of active Rap1a expressed in a control subject. In some embodiments, active Rap1a can be expressed at a level at least 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, or 10-fold that of active Rap1a expressed in a control subject. In some embodiments, active Rap1a can be expressed at a level at least 10-fold, 20-fold, 30-fold, 40-fold, or 50-fold that of active Rap1a expressed in a control subject.

[0107] In some embodiments, the optimal dose of one of the vectors of the present disclosure is 5 x 10 for subretinal injection. 8 In some embodiments, the dose may be, but is not limited to, 2.5 x 10 8 , 3×10 8 , 3.5×10 8 , 4×10 8 , 4.5×10 8 , 5×10 8 , 5.5×108 , 6×10 8 , 6.5×10 8 , 7×10 8 , 7.5×10 8 , 8×10 8 , 8.5×10 8 , 9×10 8 , 9.5×10 8 , 1×10 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 In some embodiments, particularly for intravitreal injection, the dose may be higher. For example, the higher dose may be, but is not limited to, 5×10 11 , 5.5×10 11 , 6×10 11 , 6.5×10 11 , 7×10 11 , 7.5×10 11 , 8×10 11 , 8.5×10 11 , 9×10 11 , 9.5×10 11 , 1×10 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 It could be.

[0108] Disclosed is a method for reducing VEGF expression in choroidal tissue, comprising administering to a subject any of the nucleic acid constructs, vectors, or compositions disclosed herein, and further comprising administering to a subject one or more anti-VEGF agents. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be administered simultaneously. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be co-administered in a single formulation. In some embodiments, the nucleic acid construct, vector, or composition and the anti-VEGF agent can be administered in separate formulations. Therefore, the nucleic acid construct, vector, or composition and the anti-VEGF agent can also be administered simultaneously, regardless of whether they are formulated together in a single formulation or in separate formulations. Co-administration can include administering the nucleic acid construct, vector, or composition and the anti-VEGF agent within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 minutes of each other.

[0109] J.Kit The above-mentioned materials, as well as other materials, can be packaged together in any suitable combination as a kit useful for carrying out or aiding in carrying out the disclosed methods. This is useful when the components of a given kit are designed and adapted for use together in the disclosed methods. For example, kits are disclosed that include one or more of the disclosed nucleic acid constructs, vectors, or compositions. Also disclosed are kits for producing any of the disclosed vectors, which include a nucleic acid construct that includes a nucleic acid sequence encoding a VMD2 promoter operably linked to a nucleic acid sequence encoding Rap1a. The kit may also contain a vector backbone. [Example]

[0110] Activation of the GTPase protein Rap1a has been found to protect the barrier function of the RPE from inflammatory stress. In a mouse model of laser-induced choroidal neovascularization (CNV), Rap1 activity was reduced in RPE and choroid tissues, but intravitreal delivery of 8-CPT-2Me-cAMP to activate endogenous Rap1 inhibited laser-induced CNV. Gene therapy has been explored as a potential approach to specifically target the RPE and reduce the number of treatments required for intravitreal delivery. Due to their lack of pathogenicity, low immunogenicity, relatively long-term transgene expression compared to intravitreal neutralizing antibodies or pharmacological agents, and high transduction efficiency, adenovirus-associated virus (AAV) vectors are becoming a promising tool for treating retinal degeneration. To increase active Rap1a in the RPE, constitutively active Rap1a (CARap1a) delivered in a self-complementary AAV2 (sc-AAV2) viral vector driven by the RPE65 promoter (sc-AAV2-RPE65) was found to reduce experimental CNV in Rap1b-deficient but not wild-type mice.

[0111] The insufficient reduction of CNV in wild-type mice by CARap1a delivered via sc-AAV2-RPE65 was predicted to be related to the weak transcriptional activity of the RPE65 promoter. To test this possibility, the RPE65 promoter was compared with another RPE-specific promoter, vitelloid macular dystrophy 2 (VMD2). The two promoters, RPE65 and VMD2, were compared in driving CARap1a expression in the RPE and reducing experimental CNV in wild-type mice. In this study, the effect of exogenous CARap1a expression was also evaluated and compared in eyes treated with two different promoters, RPE65 and VMD2.

[0112] 1.Results Generation of self-complementary adeno-associated virus 2 (sc-AAV2) driven by the VMD2 promoter. Self-complementary adeno-associated virus 2 (sc-AAV2) with a green fluorescent protein (GFP) tag was used in this study. We generated sc-AAV2 driven by the mouse RPE65 promoter, which expressed either GFP alone or activated Rap1a (CARap1a) (Figure 1A). To compare the transcriptional activity of the RPE65 and VMD2 promoters in delivering activated Rap1a to the RPE, the mouse VMD2 promoter was cloned into the sc-AAV2 vector, replacing the RPE65 promoter, to drive either GFP or GFP and activated Rap1a (CARap1a) (Figure 1B).

[0113] In vivo analysis of sc-AAV2 transduction and Rap1 expression. To determine viral transduction efficiency, 5 × 10 8sc-AAV2-RPE65 or sc-AAV2-VMD2 virus was delivered at 1 μL of viral particles / μL into the subretinal space of both eyes of 6-week-old wild-type mice. Viral transduction was determined by visualization of GFP using a Micron IV retinal live imaging system 5 weeks after injection. As shown in Figure 2A, both sc-AAV2-RPE65 and sc-AAV2-VMD2 showed GFP expression, whereas PBS-injected eyes did not. To confirm that viral transduction targeted the RPE, GFP-positive eyes were harvested and RPE / choroid cryosections were immunolabeled with GFP and RPE65 antibodies. Both sc-AAV2-RPE65 and sc-AAV2-VMD2 virus-treated eyes showed co-labeling of GFP and RPE65 (Figure 2B), indicating that both viral vectors can transduce the RPE of wild-type mice. To further determine the specificity of AAV2 viral transduction, GFP immunostaining was performed on whole retinal cryosections. In retinas treated with sc-AAV2-RPE65, GFP immunolabeling was localized not only within the RPE layer but also in retinal ganglion cells and photoreceptor outer segments (PR / OS). However, in retinas treated with sc-AAV2-VMD2, GFP immunolabeling was found only in the RPE layer and PR / OS (Figure 3A), indicating that sc-AAV2-VMD2 has higher specificity in transduction of the RPE.

[0114] Rap1a protein levels were measured by Western blot using an antibody against total Rap1 in RPE / choroid tissues obtained from GFP-positive eyes 5 weeks after subretinal injection. As shown in Figures 3B and 3C, Rap1 protein was significantly increased in RPE / choroid lysates treated with sc-AAV2-CARap1a compared with sc-AAV2-VMD2-GFP. However, eyes treated with sc-AAV2-RPE65-CARap1a showed no increase in Rap1 protein compared with sc-AAV2-RPE65-GFP. The data in Figures 2 and 3 provide evidence that although both sc-AAV2-RPE65 and sc-AAV2-VMD2 transduced the RPE of wild-type mice, only sc-AAV2-VMD2 efficiently drove Rap1a expression.

[0115] Expression of activated Rap1a in the RPE delivered by sc-AAV2-VMD2 reduces CNV in wild-type mice. Expression of activated Rap1a in the RPE by sc-AAV2-RPE65 reduced laser-induced CNV in Rap1-deficient mice, but not in wild-type mice. We determined whether increasing Rap1a in the RPE by sc-AAV2-VMD2 reduces laser-induced CNV in wild-type mice by comparing outcomes with those of mice given subretinal injections of sc-AAV2-RPE65. To compare each experimental vector with its respective control, we used ANOVA analysis, considering each CNV lesion as an individual data point. Consistent with previous findings, sc-AAV2-RPE65-CARap1a did not reduce CNV compared to sc-AAV2-RPE65-GFP, whereas sc-AAV2-VMD2-CARap1a significantly reduced CNV compared to sc-AAV2-VMD2-GFP by ANOVA analysis (p = 0.026) (Figure 4). To further confirm whether each CNV lesion could be considered as an individual data point, statistical analysis was performed using mixed-effects linear regression to compare sc-AAV2-VMD2-CARap1a and sc-AAV2-VMD2-GFP. The amount of correlation between spots within the same eye was measured by the intraclass correction coefficient (ICC), with an ICC = 0.16, 95% CI (0.02, 0.53). This indicates that conventional two-sample ANOVA is not appropriate when all observations or spots require independence. Mixed-effects linear regression analysis revealed a mean ± SE of 619,928 ± 124,932 in the sc-AAV2-VMD2-CARap1a group compared with 952,091 ± 124,932 in the control group (sc-AAV2-VMD2-GFP), a statistically significant difference compared with sc-AAV2-VMD2-GFP (mean difference, 336,162; 95% CI: 2,454 to 647,778; p = 0.05). Mixed-effects linear regression analysis confirmed that sc-AAV2-VMD2-CARap1a significantly reduced CNV in wild-type mice.

[0116] Expression of activated Rap1a in the RPE reduces inflammatory signaling and VEGF expression in RPE / choroid tissues. Both inflammation and VEGF signaling are involved in the pathogenesis of AMD. Laser treatment significantly increases TNFα in RPE / choroid tissues, and inhibition of TNFα with an intravitreal neutralizing antibody has previously been found to reduce CNV. By employing TNFα-mediated signaling as a test case, we determined whether increasing activated Rap1a in the RPE by sc-AAV2-VMD2-CARap1a reduces inflammation. Phosphorylation of nuclear factor kappa of activated B cells (NF-κB), a downstream effector of TNFα, was measured in RPE / choroid lysates by Western blot. As shown in Figures 5A and 5B, phosphorylated NF-κB (p-NF-κB) was significantly reduced by sc-AAV2-VMD2-CARap1a compared to sc-AAV2-VMD2-GFP. In the same tissue lysates, VEGF protein was also significantly reduced by sc-AAV2-VMD2-CARap1a compared with sc-AAV2-VMD2-CARap1a (Figures 5C and 5D).

[0117] Expression of activated Rap1a in the RPE reduces caspase-3 and LC3A / B in RPE / choroid tissues. The results in Figures 3 and 4 provide evidence supporting the hypothesis that the sc-AAV2-VMD2 vector efficiently drives expression of activated Rap1a specifically in the RPE and reduces CNV in wild-type mice. Because protein delivery can overwhelm its ability to maintain viability, we determined whether the increase in activated Rap1a in the RPE by sc-AAV2-VMD2-CARap1a overwhelms RPE homeostasis. Caspase-3, the apoptosis maker cleaved caspase-3, and the autophagy regulator LC3A / B were measured in RPE / choroid lysates obtained from eyes treated with sc-AAV2-VMD2. As shown in Figure 6, compared with sc-AAV2-VMD2-GFP, total caspase 3 (Figures 6A and 6B) and LC3A / B (Figures 6C and 6D) in the RPE / choroid tissues were significantly reduced by sc-AAV2-VMD2-CARap1a. Cleaved caspase 3 was not detected in the RPE / choroid tissues from either group. Collectively, the data shown in Figure 6 indicate that expression of active Rap1a in the RPE by sc-AAV2-VMD2 does not result in caspase 3 activation or excessive autophagy activation.

[0118] Expression of activated Rap1a in RPE cells reduces VEGF, TNFα-induced NF-κB activation, and LC3A / B without causing cell death. To further evaluate the effects of activated Rap1a on VEGF expression, activation of inflammatory signaling, autophagy, and cell death, we performed a series of experiments in cultured human RPE cells transduced with an adenovirus expressing the Rap1a Q63E mutant (Ad-63E), which constitutively activates Rap1a, or a control adenovirus expressing GFP alone (Ad-GFP). Viral transduction was monitored by GFP visualization. 48 hours after viral transduction, approximately 80% of RPE cells were GFP-positive (Figure 7A), and total Rap1 protein measured by Western blot was increased in RPE cells transduced with Ad-63E compared to Ad-GFP (Figures 7B and 7C). In Ad-63E-transduced RPE, VEGF protein (Figures 7D and 7E), TNFα-induced p-NF-κB (Figure 7F), and LC3A / B (Figures 7G and 7H) were significantly reduced compared with Ad-GFP. Cleaved caspase 3 was not detected in either Ad-GFP- or Ad-63E-transduced RPE cells (Figure 7I). To further determine whether exogenous expression of active Rap1a induces cell death, TUNEL staining was performed on RPE 48 hours after viral transduction. As shown in Figures 7J and 7K, Ad-63E transduction did not increase TUNEL-positive cells compared with Ad-GFP. Collectively, the data shown in Figure 7 provide further support that expression of exogenous active Rap1a reduces inflammation and VEGF without increasing cell death and autophagy.

[0119] 2. Consideration AMD is a complex, multifactorial disease characterized by irreversible central vision loss. While the pathophysiological steps of AMD are still being elucidated, extensive evidence supports the concept that AMD progression is influenced by the interplay of aging, genetic, and environmental factors. These interactions trigger signaling pathways involved in inflammation, oxidative stress, cell death mechanisms, and angiogenesis in RPE and choroidal endothelial cells, leading to cellular degeneration and vision loss due to CNV. While therapies targeting vascular endothelial growth factor (VEGF) have significantly improved clinical outcomes in neovascular AMD, visual improvement occurs in fewer than half of treated patients, and treatment for dry AMD remains inadequate.

[0120] Gene therapy has attracted much attention in the treatment of AMD because it offers the possibility of long-term treatment, which would reduce the number of repeated treatments required for localized delivery of anti-VEGF agents via intravitreal injection. Gene therapy also offers the possibility of targeting specific cells by using cell-specific promoters. Using a gene therapy approach, it was previously reported that exogenous expression of active Rap1a in the RPE by the sc-AAV2-RPE65 vector significantly reduced laser-induced CNV in Rap1b-deficient mice but not in wild-type mice. In this study, we tested another RPE-specific promoter, VMD2, in driving active Rap1a expression in the RPE of wild-type mice and compared its effectiveness with sc-AAV2-RPE65. This study demonstrated that the sc-AAV2-VMD2 vector efficiently drove active Rap1a expression in the RPE of wild-type mice and that transduction of sc-AAV2-VMD2 had higher specificity in the RPE compared with sc-AAV2-RPE65. The sc-AAV2-RPE65 promoter did not increase active Rap1a in the RPE of wild-type mice. Mice treated with sc-AAV2-VMD2-CARap1a, which increased active Rap1a in the RPE, showed a significant reduction in CNV compared with those treated with the control vector, sc-AAV2-VMD2-GFP. The findings of this study support the hypothesis that VMD2 has stronger activity in driving active Rap1a expression in the RPE and that increasing active Rap1a can reduce CNV in wild-type mice.

[0121] Crosstalk and feedback loops involving inflammation, oxidative signaling, and angiogenesis are involved in the pathogenesis of AMD. The role of inflammation in experimental CNV was previously examined using the proinflammatory cytokine TNFα as an example of a cytokine associated with AMD and CNV. We reported that intravitreal TNFα contributed to experimental CNV through a mechanism involving reactive oxygen species (ROS)-induced VEGF production in the RPE. Furthermore, activation of Rap1a in the RPE reduced reactive oxygen species production. Here, in this study, eyes treated with sc-AAV2-VMD2-CARap1a showed significantly reduced VEGF and NF-κB phosphorylation in RPE / choroid tissue compared with control eyes treated with sc-AAV2-VMD2-GFP. These findings were further supported by the significant reduction in VEGF and p-NF-κB in cultured human RPE following increased activated Rap1a via adenoviral gene transfer. However, similar effects were not observed in eyes treated with sc-AAV2-RPE65-CARap1a. These results support the hypothesis that increasing active Rap1a in the RPE reduces CNV by reducing VEGF. Reducing inflammatory signaling can reduce stimuli that contribute to CNV, as previously found using TNFα as an inflammatory cytokine, but it can also reduce atrophic AMD by interfering with processes that lead to cell death.

[0122] One concern regarding the introduction of protective proteins is the risk of overwhelming the cell's natural protein management capabilities. Autophagy is one of the mechanisms by which cells cope with stress and maintain cellular homeostasis. Through autophagy, misfolded or aggregated proteins and damaged organelles formed in response to excessive cellular stress can be degraded. Therefore, increased autophagy may indirectly reflect increased cellular stress. To determine whether gene therapy-mediated introduction of activated Rap1a induces apoptotic cell death or excessive activation of autophagy, we evaluated the expression of cleaved caspase 3 as a marker of apoptosis and LC3A / B as a marker of autophagy following the induction of exogenous activated Rap1a expression in RPE cells with sc-AAV2-VMD2. Compared with sc-AAV2-VMD2-GFP, sc-AAV2-VMD2-CARap1a did not increase cleaved caspase-3 but reduced caspase-3 and LC3A / B in the RPE / choroid tissues of wild-type mice subjected to a laser-induced CNV model. Increasing active Rap1a in human RPE cells in vitro reduced LC3A / B without increasing caspase-3 activation and cell death as determined by TUNEL staining.

[0123] In conclusion, the VMD2 promoter more specifically targeted the RPE and increased Rap1 expression compared with the RPE65 promoter. Increased activation of Rap1a in the RPE by the VMD2 promoter reduced three effectors associated with advanced AMD: VEGF, activated NF-κB, and LC3A / B. Activation of Rap1a protects against AMD-related stimuli leading to inflammation and angiogenesis, maintaining RPE integrity and function. The sc-AAV2-VMD2 vector may be an efficient and safe tool for delivering genetic material to the RPE.

[0124] 3. Materials and Methods Animals. Five-week-old wild-type C57BL / 6J (male and female) mice were purchased from Jackson Laboratory (Bar Harbor, ME). All animal procedures were performed in accordance with the University of Utah guidelines (Guide for the Care and Use of Laboratory Animals) and the Society of Vision and Ophthalmology Statement for the Use of Animals in Ophthalmological and Vision Research. All experimental protocols were approved by the IACUC and the University of Utah Institutional Biosafety Committee. Anesthesia was achieved with ketamine (100 mg / kg) and xylazine (20 mg / kg), and euthanasia was achieved by cervical dislocation after placement under anesthesia.

[0125] Construction of RPE65 or VMD2 promoter-driven self-complementary adeno-associated virus 2 (sc-AAV2) vectors driven by the mouse RPE65 promoter were generated by the University of North Carolina Vector Core (Chapel Hill, NC) as previously described. Briefly, the CMV promoter in the sc-AAV2 vector was replaced with the mouse RPE65 promoter (1507 bp) (kindly provided by T. Michael Redmond), and a synthetic sequence for constitutively active human Rap1a Q63E mutant_ENREF_22 (CARap1a) was cloned into the scAAV2 vector along with the RPE65 promoter (scAAV2-RPE65-CARap1a-GFP). An sc-AAV2 construct lacking the CARap1a sequence served as a control vector (scAAV2-RPE65-GFP). To compare the transduction efficiency and specificity of the RPE65 and VMD2 promoters, sc-AAV22 vectors driven by the mouse VMD2 promoter (624 bp) were generated by the University of Florida Powell Gene Therapy Center (Gainesville, FL). The CARap1a sequence was cloned into sc-AAV2-VMD2 to produce sc-AAV2-VMD2-CARap1a-GFP, and the sc-AAV2-VMD2-GFP vector was used as a control. Virus was produced, purified, and titered at the Florida Powell Gene Therapy Center.

[0126] Subretinal injection, Micron IV imaging, and laser-induced CNV model. One microliter of sc-AAV2 (5 × 10 in PBS with fluorescein) 8 The sc-AAV2 virus (diluted into viral particles) was injected into the subretinal space of each eye of 6-week-old mice. Transduction of the sc-AAV2 virus was monitored by in vivo live imaging using a Micron IV retinal imaging system (Phoenix Research Laboratories, Pleasanton, CA) as previously described.

[0127] Five weeks after sc-AAV2 virus injection, 11-week-old mice underwent laser irradiation to induce CNV. Both eyes of each mouse were dilated with a single drop of 1% tropicamide ophthalmic solution. After dilation, the mice were anesthetized and treated with 532 nm laser photocoagulation of four spots, each approximately two papillary diameters from the optic nerve, using a Phoenix Image-Guided Laser System 94 (Phoenix Micron IV, Pleasanton, CA) at an intensity of approximately 460 mW and a duration of 100 ms. Successful treatment was assessed by the production of cavitation bubbles, which confirmed the disruption of Bruch's membrane. 7 Seven days after laser treatment, mice were euthanized and eyes were collected for CNV volume and protein analysis.

[0128] Preparation of retinal pigment epithelium (RPE) / choroid flatmounts and analysis of CNV lesion volume. Eyes were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 1 hour. After removal of the cornea, lens, vitreous, and retina, the posterior cup of the RPE / choroid / sclera was fixed in 4% paraformaldehyde for an additional hour. After three washes in PBS, the cups were blocked for 30 minutes at room temperature in PBS containing 1% bovine serum albumin (BSA) and 0.5% Triton X-100. They were then incubated overnight at 4°C with AlexaFluor 568-conjugated isolectin B4 (1:200, Invitrogen, Carlsbad, CA) to label invading choroidal vessels and anti-GFP antibodies to label GFP in the RPE (1:500, ABCAM, Cambridge, MA). After staining, radial incisions were made in the eyecups and flat-mounted onto microscope slides using Vectashield mounting medium (Vector Laboratories, Burlingame, CA) for confocal imaging. The flatmounts were imaged by taking optical Z-sections at 3 μm intervals using a confocal microscope (FV1000, Olympus, Japan), and CNV lesion volume was measured using Imaris image analysis software (Bitplane USA, Concord, MA). Lesions with obvious hemorrhage or bridging CNV were excluded.

[0129] Immunostaining in retinal cryosections. After euthanasia, eyes were enucleated and fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 1 hour. After removal of the cornea and lens, the eyecups were incubated with 10% sucrose for two hours, followed by 30% sucrose overnight at 4°C. They were then embedded in optimal cutting temperature (OCT) (Tissue-Tek, Hatfield, PA) and sectioned. For immunofluorescence, cryosections (12 μm) were incubated in 5% normal goat serum in PBS / 0.1% Triton X-100 for 1 hour to block nonspecific binding of the primary antibodies, followed by incubation overnight at 4°C with rabbit anti-GFP (1:200) and RPE65 (1:100) antibodies obtained from Abcam (Cambridge, UK). After washing three times in PBS, sections were incubated for 1 hour with a FITC-conjugated goat anti-rabbit secondary antibody against GFP (1:200) and an AlexaFluor 594-conjugated goat anti-mouse secondary antibody against RPE65 (Invitrogen, Carlsbad, CA). Nuclei were stained with TO-PRO-3 (1:500, Thermo Fisher Scientific, Waltham, MA). After washing in PBS, sections were mounted in Fluoromount-G (Southern Biotech, Birmingham, AL). Images were captured at 20x magnification using an inverted microscope (Olympus 1x81, Japan).

[0130] Cell culture and adenoviral transduction. Human primary RPE (hRPE; Lonza, Walkersville, MD) were grown in retinal pigment epithelial basal medium (RtEBM, Lonza) and used from passages 4–6. Cells were transduced with adenoviral constructs expressing green fluorescent protein (Ad-GFP) or GFP-tagged activated Rap1a (Ad-63E), kindly provided by Keith Burridge (University of North Carolina, Chapel Hill, NC). Forty-eight hours after viral transduction, cells were incubated with recombinant TNF-α (10 ng / mL, R&D Systems, Minneapolis, MN) or PBS for 24 hours.

[0131] TUNEL assay in cultured cells. The TUNEL assay was performed according to the manufacturer's instructions (In Situ Cell Death Kit, TMR Red, Roche Diagnostics, Indianapolis, IN). Human RPE cells were seeded on cell culture coverslips (Thermo Scientific, Rochester, NY). After treatment, cells were first fixed in 4% paraformaldehyde for 1 hour at room temperature. After washing three times with PBS, cells were incubated with freshly prepared permeabilization solution (0.1% Triton X-100 in 0.1% sodium citrate) on ice for 2 minutes. After permeabilization, some cells were incubated with DNase I (3000 U / mL in 50 mM Tris-HCl, pH 7.5, 1 mg / mL BSA) for 10 minutes at 15–25°C as a positive control. Cells incubated with labeling solution alone without enzyme solution served as a negative control. To identify TUNEL+ cells, cells were incubated with the TUNEL reaction mixture (labeling solution and enzyme solution mixed 10:1) in a humidified incubator in the dark at 37°C for 60 minutes. After two washes in PBS, coverslips were mounted with DAPI Fluoromount G. Images were acquired using a fluorescent microscope with five random images per coverslip. TUNEL+ cells, determined by co-labeling with DAPI-stained nuclei, were quantified, and the average of TUNEL+ cells in five images obtained from the same coverslip was used for comparison. There were five to six coverslips per condition.

[0132] Protein preparation and Western blot. Protein lysates were extracted from RPE / choroid tissue as previously described. 7Briefly, RPE / choroid tissues were homogenized for 20 min on ice in radioimmunoprecipitation assay buffer (RIPA) (20 mM Tris pH 7.4, 120 mM NaCl, 0.5% sodium deoxycholate, 1% Triton X-100, 0.1% SDS, 10% glycerol) containing a protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN) and the phosphatase inhibitor orthovanadate (2 mM, Sigma-Aldrich, St. Louis, MO). Protein lysates were collected by centrifugation at 13,000 rpm for 5 min at 4°C. Protein concentrations in the supernatants were quantified by bicinchoninic acid assay (BCA) (Pierce, Rockford, IL). Twenty micrograms of protein from RPE / choroid tissue was loaded onto 4% to 12% NuPAGE Bis-Tris gels (Invitrogen, Carlsbad, CA), transferred to PVDF membranes (Invitrogen), and then incubated with antibodies against Rap1 (1:1000, BD Biosciences, San Jose, CA), VEGF (1:500, Santa Cruz Biotechnology, Santa Cruz, CA), caspase 3, LC3A, or phosphorylated NF-κB (1:1000, Cell Signaling Technology, Danvers, MA). The membranes were reprobed with HRP-conjugated β-actin (Santa Cruz Biotechnology) as a loading control.

[0133] Densitometry was analyzed using the software UN-SCAN-IT version 7.1 (Silk Scientific, Orem, UT).

[0134] Statistical Analysis: Analysis of variance (ANOVA) was used to analyze protein expression and TUNEL-positive cells and compare experimental and control groups using one observation per animal or cell well from each treatment. Conventional ANOVA requires that all data points or observations are independent, which is true when only one observation per animal is used. When multiple observations per animal are used, this assumption is usually violated because observations within the same animal tend to be more similar than observations between animals. The intraclass correlation coefficient (ICC) can be used to determine how correlated the observations are. If the ICC is equal to zero, conventional ANOVA provides a correct analysis. However, if the ICC is greater than 0, a method such as mixed-effects linear regression is required. This method is essentially ANOVA with standard error adjustment to account for the lack of independence of the observations. For CNV lesion outcomes, mixed-effects linear regression was used with one eye per animal to account for the lack of independence due to clustered or focal spots within the same eye.

[0135] Results were expressed as mean ± SEM. A P value of ≤0.05 was considered statistically significant. In the animal study, at least 40 spots from 12 mice were analyzed for CNV volume. Retinal sections for GFP staining and Western blotting of Rap1 protein were collected from 3 to 6 different mice.

[0136] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein which equivalents are intended to be encompassed by the following claims. References 1 Blasiak,J.,Petrovski,G.,Vereb,Z.,Facsko,A.& Kaarniranta,K.Oxidative stress,hypoxia,and autophagy in the neovascular processes of age-related macular degeneration.Biomed Res Int 2014,768026,doi:10.1155 / 2014 / 768026(2014). 2 Wang,H.& Hartnett,M.E.Regulation of signaling events involved in the pathophysiology of neovascular AMD.Molecular vision 22,189-202(2016). 3 Bhutto,I.& Lutty,G.Understanding age-related macular degeneration(AMD):relationships between the photoreceptor / retinal pigment epithelium / Bruch’s membrane / choriocapillaris complex.Mol Aspects Med 33,295-317,doi:10.1016 / j.mam.2012.04.005(2012). 4 Sparrow,J.R.,Ueda,K.& Zhou,J.Complement dysregulation in AMD:RPE-Bruch’s membrane-choroid.Mol Aspects Med 33,436-445,doi:10.1016 / j.mam.2012.03.007(2012). 5 Ford,K.M.,Saint-Geniez,M.,Walshe,T.,Zahr,A.& D’Amore,P.A.Expression and Role of VEGF in the Adult Retinal Pigment Epithelium.Investigative ophthalmology & visual science 52,9478-9487(2011). 6 Ablonczy,Z.,Dahrouj,M.& Marneros,A.G.Progressive dysfunction of the retinal pigment epithelium and retina due to increased VEGF-A levels.FASEB J,doi:10.1096 / fj.13-248021(2014). 7 Wang,H.et al.Retinal pigment epithelial cell expression of active Rap 1a by scAAV2 inhibits choroidal neovascularization.Mol Ther Methods Clin Dev 3,16056,doi:10.1038 / mtm.2016.56(2016). 8 Wittchen,E.S.et al.Rap1 GTPase Activation and Barrier Enhancement in RPE Inhibits Choroidal Neovascularization In Vivo.PloS one 8,e73070,doi:10.1371 / journal.pone.0073070(2013). 9 Naso,M.F.,Tomkowicz,B.,Perry,W.L.,3rd & Strohl,W.R.Adeno-Associated Virus(AAV) as a Vector for Gene Therapy.BioDrugs :clinical immunotherapeutics,biopharmaceuticals and gene therapy 31,317-334,doi:10.1007 / s40259-017-0234-5(2017). 10 Laredj,L.N.& Beard,P.Adeno-Associated Virus Activates an Innate Immune Response in Normal Human Cells but Not in Osteosarcoma Cells.Journal of Virology 85,13133-13143,doi:10.1128 / jvi.05407-11(2011). 11 Mingozzi,F.& High,K.A.Immune responses to AAV vectors:overcoming barriers to successful gene therapy.Blood 122,23-36,doi:10.1182 / blood-2013-01-306647(2013). 12 He,L.,Marioutina,M.,Dunaief,J.L.& Marneros,A.G.Age- and gene-dosage-dependent cre-induced abnormalities in the retinal pigment epithelium.Am J Pathol 184,1660-1667,doi:10.1016 / j.ajpath.2014.02.007(2014). 13 Moshfegh,Y.et al.BESTROPHIN1 mutations cause defective chloride conductance in patient stem cell-derived RPE.Human molecular genetics 25,2672-2680,doi:10.1093 / hmg / ddw126(2016). 14 Wang,H.,Fotheringham,L.,Wittchen,E.S.& Hartnett,M.E.Rap1 GTPase Inhibits Tumor Necrosis Factor-alpha-Induced Choroidal Endothelial Migration via NADPH Oxidase- and NF-kappaB-Dependent Activation of Rac1.Am J Pathol 185,3316-3325,doi:10.1016 / j.ajpath.2015.08.017(2015). 15 Fritsche,L.G.et al.Age-related macular degeneration:genetics and biology coming together.Annu Rev Genomics Hum Genet 15,151-171,doi:10.1146 / annurev-genom-090413-025610(2014). 16 Lancon,A.,Frazzi,R.& Latruffe,N.Anti-Oxidant,Anti-Inflammatory and Anti-Angiogenic Properties of Resveratrol in Ocular Diseases.Molecules 21,304,doi:10.3390 / molecules21030304(2016). 17 Telander,D.G.Inflammation and age-related macular degeneration(AMD).Semin Ophthalmol 26,192-197,doi:10.3109 / 08820538.2011.570849(2011). 18 Sobrin,L.& Seddon,J.M.Nature and nurture- genes and environment-predict onset and progression of macular degeneration.Prog Retin Eye Res 40,1-15,doi:10.1016 / j.preteyeres.2013.12.004(2014). 19 Ehlken,C.et al.Switch of anti-VEGF agents is an option for nonresponders in the treatment of AMD.Eye(London,England) 28,538-545,doi:10.1038 / eye.2014.64(2014). 20 Veloso,C.E.,de Almeida,L.N.,Recchia,F.M.,Pelayes,D.& Nehemy,M.B.VEGF gene polymorphism and response to intravitreal ranibizumab in neovascular age-related macular degeneration.Ophthalmic Res 51,1-8,doi:10.1159 / 000354328(2014). 21 Theodossiadis,P.G.,Liarakos,V.S.,Sfikakis,P.P.,Vergados,I.A.& Theodossiadis,G.P.Intravitreal administration of the anti-tumor necrosis factor agent infliximab for neovascular age-related macular degeneration.American journal of ophthalmology 147,825-830,830 e821,doi:10.1016 / j.ajo.2008.12.004(2009). 22 Markomichelakis,N.N.,Theodossiadis,P.G.& Sfikakis,P.P.Regression of neovascular age-related macular degeneration following infliximab therapy.American journal of ophthalmology 139,537-540,doi:10.1016 / j.ajo.2004.09.058(2005). 23 Wang,H.,Han,X.,Wittchen,E.S.& Hartnett,M.E.TNF-alpha mediates choroidal neovascularization by upregulating VEGF expression in RPE through ROS-dependent beta-catenin activation.Molecular vision 22,116-128(2016). 24 Wang,H.et al.Activation of Rap1 inhibits NADPH oxidase-dependent ROS generation in retinal pigment epithelium and reduces choroidal neovascularization.FASEB J,doi:10.1096 / fj.13-240028(2013). 25 Ahmed,C.M.et al.Repurposing an orally available drug for the treatment of geographic atrophy.Molecular vision 22,294-310(2016). 26 Sennlaub,F.et al.CCR2 +monocytes infiltrate atrophic lesions in age‐related macular disease and mediate photoreceptor degeneration in experimental subretinal inflammation in <em> Cx3cr1< / em> deficient mice.EMBO Molecular Medicine 5,1775-1793,doi:10.1002 / emmm.201302692(2013). 27 Ardeljan,D.& Chan,C.C.Aging is not a disease:distinguishing age-related macular degeneration from aging.Prog Retin Eye Res 37,68-89,doi:10.1016 / j.preteyeres.2013.07.003(2013). 28 Oslowski,C.M.& Urano,F.Measuring ER stress and the unfolded protein response using mammalian tissue culture system.Methods in enzymology 490,71-92,doi:10.1016 / B978-0-12-385114-7.00004-0(2011). 29 Keeling,E.,Lotery,A.J.,Tumbarello,D.A.& Ratnayaka,J.A.Impaired Cargo Clearance in the Retinal Pigment Epithelium(RPE) Underlies Irreversible Blinding Diseases.Cells 7,doi:10.3390 / cells7020016(2018). 30 Karakosta,A.et al.Choice of analytic approach for eye-specific outcomes:one eye or two? American journal of ophthalmology 153,571-579.e571,doi:10.1016 / j.ajo.2011.08.032(2012). 31 Murdoch,I.E.,Morris,S.S.& Cousens,S.N.People and eyes:statistical approaches in ophthalmology.The British journal of ophthalmology 82,971-973,doi:10.1136 / bjo.82.8.971(1998).

Claims

1. A nucleic acid construct comprising a nucleic acid sequence encoding a vitelloid macular dystrophy 2 (VMD2) promoter operably linked to a nucleic acid sequence encoding activated Rap1a, wherein the nucleic acid sequence encoding activated Rap1a comprises the sequence of SEQ ID NO:

2.

2. The nucleic acid construct according to claim 1 , wherein the nucleic acid sequence encoding activated Rap1a is CARap1a.

3. The nucleic acid construct of claim 1 or 2, wherein the VMD2 promoter is a human VMD2 promoter.

4. The nucleic acid construct according to any one of claims 1 to 3, wherein the activated Rap1a is human activated Rap1a.

5. The nucleic acid construct of any one of claims 1 to 4, further comprising a selectable marker.

6. 6. The nucleic acid construct of claim 5, wherein the selectable marker is operably linked to the vitelloid macular dystrophy 2 (VMD2) promoter.

7. The nucleic acid construct of claim 5 or 6, wherein the selectable marker is a label.

8. The nucleic acid construct of any one of claims 1 to 7, wherein the VMD2 promoter is inducible or constitutive.

9. A vector comprising the nucleic acid construct according to any one of claims 1 to 8.

10. The vector of claim 9 , wherein the vector is a viral vector.

11. The vector of claim 10 , wherein the viral vector is an adeno-associated viral vector.

12. A composition comprising the nucleic acid construct of any one of claims 1 to 8 or the vector of any one of claims 9 to 11.

13. The composition of claim 12 further comprising a pharmaceutically acceptable carrier.

14. A composition comprising the viral vector of claim 10 or 11.

15. 15. The composition of claim 14, further comprising a pharmaceutically acceptable carrier.

16. A recombinant cell comprising the nucleic acid construct of any one of claims 1 to 8 or the vector of any one of claims 9 to 11.

17. The recombinant cell of claim 16, wherein the cell is a mammalian cell.

18. 18. The recombinant cell of claim 16 or 17, wherein the cell is a retinal pigment epithelial (RPE) cell.

19. 12. A composition comprising the nucleic acid construct of any one of claims 1 to 8 or the vector of any one of claims 9 to 11 for use in a method for treating a subject with age-related macular degeneration, the method comprising administering the composition to a subject in need thereof.

20. A composition comprising the nucleic acid construct of any one of claims 1 to 8 or the vector of any one of claims 9 to 11, for use in a method for inhibiting choroidal neovascularization (CNV), the method comprising administering the composition to a subject in need thereof.

21. A composition comprising the nucleic acid construct of any one of claims 1 to 8 or the vector of any one of claims 9 to 11 for use in a method for reducing choroidal neovascularization (CNV), the method comprising administering the nucleic acid construct of any one of claims 1 to 8 or the vector of any one of claims 9 to 11 to a subject in need thereof.

22. A composition comprising the nucleic acid construct of any one of claims 1 to 8 or the vector of any one of claims 9 to 11 for use in a method for reducing inflammatory signaling in choroidal tissue, the method comprising administering the nucleic acid construct to a subject in need thereof.

23. A composition comprising the nucleic acid construct of any one of claims 1 to 8 or the vector of any one of claims 9 to 11 for use in a method for reducing VEGF expression in choroidal tissue, the method comprising administering the nucleic acid construct to a subject in need thereof.

24. The composition according to any one of claims 19 to 23, wherein the administration is intravitreal administration.

25. The composition of any one of claims 19 to 24, wherein the expression of activated Rap1a is increased in the subject without increasing markers of autophagy or apoptosis.

26. The composition of any one of claims 19 to 25, wherein the activated Rapla is expressed at a level at least twice that of Rapla expressed in a control subject.

27. 27. The composition of any one of claims 19 to 26, further comprising administering to the subject one or more anti-VEGF agents.

Images