Agent for damaging and / or removing b cell receptor-expressing cells, and therapeutic agent and pharmaceutical composition for autoimmune disease containing said agent

Abstract

Provided are: an agent for damaging and / or removing cell receptor (BCR)-expressing cells; and a therapeutic agent and a pharmaceutical composition for autoimmune disease each containing the agent. The agent for damaging and / or removing BCR-expressing cells comprises: a group capable of selectively binding to at least one selected from the group consisting of a BCR recognizing a self-antigen and an antibody recognizing the self-antigen; and a substance having a cytotoxic group.

Description

Agent for damaging and / or eliminating cells expressing B cell receptors, and therapeutic agent and pharmaceutical composition for autoimmune diseases containing said agent

[0001] The present invention relates to an agent for damaging and / or eliminating cells expressing B cell receptors (BCR), which is suitable for the treatment of autoimmune diseases, and a therapeutic agent and pharmaceutical composition for autoimmune diseases containing said agent.

[0002] Autoimmune diseases are diseases in which immune cells respond to components (autoantigens) that constitute the body itself, resulting in damage to the body's own organs, tissues, etc. Representative examples include ulcerative colitis (UC), primary sclerosing cholangitis (PSC), pemphigus, myasthenia gravis, anti-glomerular basement membrane nephritis, rapidly progressive glomerulonephritis, pemphigoid, neuromyelitis optica, anti-NMDA receptor encephalitis, and membranous nephropathy, many of which are designated as intractable diseases. New treatments for each autoimmune disease are desperately needed.

[0003] In particular, ulcerative colitis is an intractable disease of unknown cause in which erosions or inflammatory ulcers develop in the colonic mucosa, continuing from the rectum, and are accompanied by symptoms such as diarrhea, bloody stools, and abdominal pain. Ulcerative colitis affects young people as well as the elderly, and since it repeats remissions and relapses, long-term treatment is required. The number of patients is very large, and has been increasing worldwide in recent years.

[0004] Primary sclerosing cholangitis (PSC) is a progressive chronic liver disease that causes multiple, diffuse fibrous strictures in the bile ducts both inside and outside the liver, with approximately half of patients progressing to cirrhosis within 10 years. In cases where primary sclerosing cholangitis progresses to cirrhosis, liver transplantation becomes necessary, but many patients die before a transplant can be performed. Primary sclerosing cholangitis is thought to be a multifactorial disease, including immunological abnormalities, but the cause remains unknown. Primary sclerosing cholangitis is often associated with inflammatory bowel disease (IBD), and among inflammatory bowel diseases, ulcerative colitis is also present in a certain percentage of patients with primary sclerosing cholangitis (in Japan, it is reported that approximately 40% of patients with primary sclerosing cholangitis also have ulcerative colitis, and that approximately 60% of young patients with primary sclerosing cholangitis in particular also have ulcerative colitis. In Europe and the United States, it is reported that approximately 70-80% of patients with primary sclerosing cholangitis also have ulcerative colitis).

[0005] In the medical treatment of ulcerative colitis, 5-aminosalicylic acid preparations are used in mild cases, immunosuppressants such as steroids in moderate cases, and cytapheresis, biological preparations such as anti-TNFα antibodies, and JAK inhibitors are used in moderate to severe cases depending on the severity of the symptoms (for example, for anti-TNFα antibodies, see Non-Patent Document 1, website: UpToDate, [searched November 28, 2022], Internet: https: / / www.uptodate.com / contents / search? However, ulcerative colitis cannot yet be completely cured by medical treatment, and various treatments are associated with various side effects. For example, using anti-TNFα antibodies, which are used to treat moderate to severe ulcerative colitis, to suppress the function of TNFα can lead to side effects such as infections and malignant tumors. Anti-TNFα antibodies are certainly effective in treating ulcerative colitis. However, because the target TNFα itself plays a central role in the immune system and supports a wide range of biological functions, including infection prevention and antitumor activity, impairing TNFα, which is required under normal conditions, can lead to the wide range of side effects described above.

[0006] Furthermore, while medical treatment for primary sclerosing cholangitis includes the administration of drugs such as ursodeoxycholic acid, there is currently insufficient data to determine whether these drugs improve long-term prognosis, and new treatment options are desperately needed.

[0007] Nature Reviews Immunology volume 15, pages362-374 (2015)

[0008] The present invention has been made in consideration of the above-mentioned problems of the conventional technology, and aims to provide an agent for damaging and / or removing cells that express BCR, and a therapeutic agent and pharmaceutical composition for autoimmune diseases that contain said agent.

[0009] As a result of intensive research aimed at solving the above-mentioned problems, the present inventors have found that a substance having a group that selectively binds to at least one selected from the group consisting of BCR and antibodies that recognize the autoantigen, and a cytotoxic group, can damage and / or eliminate cells that express BCR. The present invention was completed based on the above findings.

[0010] That is, the present invention is as follows: <1> An agent for damaging and / or removing cells expressing a B cell receptor (BCR), comprising a substance having a cytotoxic group and a group that selectively binds to at least one selected from the group consisting of a BCR that recognizes an autoantigen and an antibody that recognizes the autoantigen. <2> The agent according to <1>, wherein the group that selectively binds to at least one selected from the group comprises an antigenic fragment or the full-length of the autoantigen. <3> The agent according to <1>, wherein the cytotoxic group comprises at least one group selected from the group consisting of a cytotoxic drug group, an anti-CD3 antibody group, a B cell inhibitory agent group, and a phagocytic marker group. <4> The agent according to <3>, wherein the cytotoxic drug group is a group containing at least one selected from the group consisting of monomethyl auristatin E (MMAE), deruxtecan, calicheamicin, MX-DTPA, emtansine, ozogamicin, camptothecin, saratarocan sodium, exatecan, mertansine, and SN-38, the B cell inhibitory group is a group containing at least one selected from the group consisting of an anti-CD20 antibody, an anti-CD19 antibody, and a B cell-activating factor (BAFF) receptor inhibitor, and / or the phagocytosis marker group is a group containing at least one selected from the group consisting of an IgG Fc region, phosphatidylserine, and phosphatidylcholine. <5> The agent according to <1>, wherein the substance comprises a conjugate in which the group that selectively binds to the B cell receptor and / or the antibody is bound to the cytotoxic group directly or via a linking group. <6> The agent according to <5>, wherein the group that selectively binds to the B cell receptor and / or the antibody is bound directly or via a linking group to at least one group selected from the group consisting of a cytotoxic drug group, an anti-CD3 antibody group, an anti-CD20 antibody group, and a phagocytosis marker group. <7> The agent according to <1>, wherein the autoantigen is integrin αvβ6 protein. <8> A therapeutic agent for an autoimmune disease, comprising the agent according to <1> above. <9> A pharmaceutical composition comprising the agent according to <8> above.

[0011] According to the present invention, cells expressing BCR (e.g., B cells) can be damaged and / or removed. Since the present invention can damage and / or remove cells expressing BCR (e.g., B cells), it is suitable as a therapeutic agent for autoimmune diseases and a pharmaceutical composition containing the therapeutic agent.

[0012] 4 shows the results of flow cytometry in which cells (HEK-293T(G5)) expressing anti-integrin αvβ6 antibody and CD79A and B (CD79 is a membrane protein that constitutes BCR) on the cell surface were selected and sorted. FIG. 4 shows the results of a cytotoxicity test using an anti-integrin αvβ6 antibody-anti-CD3 antibody complex. FIG. 4 shows the results of a cytotoxicity test using an anti-integrin αvβ6 antibody-anti-CD3 antibody complex. FIG. 4 shows the results of a cytotoxicity test using an anti-integrin αvβ6 antibody-anti-CD3 antibody complex. FIG. 4 shows the results of a cytotoxicity test using an anti-integrin αvβ6 antibody-anti-CD3 antibody complex. FIG. 4 shows the detection of HEK-293T cells expressing anti-integrin αvβ6 antibody. FIG. 4 shows the results of a HEK-G1 cytotoxicity test using a human integrin αvβ6-anti-CD3 antibody complex. FIG. 4 shows the results of a preparation of A20 cells expressing anti-integrin αvβ6 antibody. 1 is a diagram showing the concentration of anti-integrin αvβ6 antibody (G1) in A20-G1 culture supernatant. This diagram shows the results of an A20-G1 cytotoxicity test using a human integrin αvβ6-anti-CD3 antibody complex. This diagram shows the results of test 1 confirming the binding of the integrin αvβ6-mouse IgG2a-Fc complex to UC antibody 1. This diagram shows the results of test 2 confirming the binding of the integrin αvβ6-mouse IgG2a-Fc complex to UC antibody 5. This diagram shows the results of a test confirming the binding of the integrin αvβ6-mouse IgG2a-Fc complex to Fcγ receptors. This diagram shows a calibration curve at an absorbance of 450 nm of the concentration of the integrin αvβ6-mouse IgG2a-Fc complex contained in mouse plasma. This diagram shows the in vivo pharmacokinetics of the integrin αvβ6-mouse IgG2a-Fc complex. FIG. 1 shows the results of an in vivo test to confirm the ability of the integrin αvβ6-mouse IgG2a-Fc complex to remove anti-integrin αvβ6 antibodies from the blood in integrin αvβ6-immunized mice.

[0013] Hereinafter, embodiments of the present invention will be described in detail, but the present invention is not limited to the following embodiments and can be implemented with appropriate modifications within the scope of the object of the present invention.

[0014] <<Agent for damaging and / or removing BCR-expressing cells>> A first aspect of the present invention is an agent for damaging and / or removing BCR-expressing cells, the agent comprising a substance having a group that selectively (preferably specifically) binds to at least one selected from the group consisting of BCR that recognizes an autoantigen and an antibody that recognizes the autoantigen, and a cytotoxic group. The present invention also relates to a substance (e.g., a compound) having a group that selectively (preferably specifically) binds to at least one selected from the group consisting of BCR and antibodies that recognize an autoantigen, and a cytotoxic group.

[0015] In a first aspect, the B cell receptor (BCR) is a transmembrane receptor protein (membrane immunoglobulin) present on the outer surface of B cells that can recognize the above-mentioned autoantigens. The binding site of the receptor is composed of a membrane-bound antibody with a unique antigen-binding site that is randomly determined, as is the case with all antibodies.

[0016] In a first aspect, a substance having a group (e.g., a monovalent group) that selectively binds to at least one selected from the group consisting of BCR and antibodies that recognize autoantigens has a cytotoxic group as an active ingredient (e.g., a group or component that has pharmacological activity in the body of an animal, including a human, or a group or component that, when contacted with another substance such as a microbial contaminant, causes a physical or chemical change in the other substance or the active ingredient itself. Physical or chemical changes referred to here include binding, transfer, rearrangement, addition, elimination, decomposition, cleavage, oxidation, reduction, labeling, color development, luminescence, etc.). The substance may contain two or more types of the cytotoxic groups.

[0017] The substance has a group that selectively (preferably specifically) binds to at least one selected from the group consisting of BCR and antibodies that recognize an autoantigen, and the cytotoxic group, so that it can damage and / or remove cells that express BCR.

[0018] In a first aspect, a BCR-expressing cell refers to a cell (e.g., a B cell) that expresses a BCR (membrane immunoglobulin) having a structure similar to that of the antibody on its cell surface. BCR-expressing B cells can be activated by an autoantigen or an antigenic fragment thereof and differentiate into cells that produce an antibody that recognizes the autoantigen (cells that produce an autoantigen-recognizing antibody). Cells that produce an autoantigen-recognizing antibody also express a BCR having a structure similar to that of the antibody on their cell surface. Therefore, any substance that selectively binds to an autoantigen-recognizing antibody can selectively bind to cells that produce an autoantigen-recognizing antibody.

[0019] For example, anti-integrin αvβ6 antibody-expressing B cells that express a BCR with a structure similar to that of an anti-integrin αvβ6 antibody on their cell surface can be activated by integrin αvβ6 or an antigenic fragment thereof and differentiate into anti-integrin αvβ6 antibody-producing cells. Since anti-integrin αvβ6 antibody-producing B cells also express the membrane-type anti-integrin αvβ6 antibody, any substance that selectively binds to an anti-integrin αvβ6 antibody can selectively bind to anti-integrin αvβ6 antibody-producing B cells.

[0020] As used herein, "damage" refers to natural or artificial (e.g., chemical) damage inflicted on a cell. "Damage to a BCR-expressing cell" refers to disruption of the normal function of a BCR-expressing cell. Disruption of the function of a BCR-expressing cell includes, but is not limited to, a decrease in survival, growth, or proliferation.

[0021] As used herein, "removal" of cells expressing BCR means that the cells are removed from the subject's body (e.g., from the blood), or that some or all of the cells present in the body (e.g., from the blood) are removed from the body (e.g., from the blood).

[0022] The cytotoxic group is not particularly limited as long as it has cytotoxicity, but preferably contains at least one group (e.g., a monovalent group) selected from the group consisting of a cytotoxic drug group (cytotoxic drug group), an anti-CD3 antibody group, a B cell inhibitor group, and a phagocytic marker group. Examples of the cytotoxic drug group include groups containing at least one selected from the group consisting of a cytotoxic agent, a plasma cell inhibitor, an antitumor agent (e.g., an antitumor antibiotic), a microtubule damaging agent, a tubulin polymerization inhibitor, a radioactive substance, etc. Specific examples of the cytotoxic drug group include, but are not limited to, groups containing at least one selected from the group consisting of monomethyl auristatin E (MMAE), deruxtecan, calicheamicin, N-{2-[bis(carboxymethyl)amino]-3-(4-isothiocyanatophenyl)propyl}-N-{2-[bis(carboxymethyl)amino]propyl}glycine (MX-DTPA), emtansine, ozogamicin, camptothecin, saratarocan sodium, B-cell activating factor (BAFF) receptor inhibitors, anti-CD20 antibodies, anti-CD19 antibodies, exatecan, mertansine, SN-38, etc., with MMAE being preferred.

[0023] The anti-CD3 antibody group includes a group containing a functional fragment (e.g., a fragment containing the CD3 recognition domain) or the full-length anti-CD3 antibody. This allows T cells and the like to be brought into proximity (recruited) with target cells, thereby solving the above-mentioned problem. Specific examples of the B cell inhibitor group include, but are not limited to, a group containing at least one selected from the group consisting of a BAFF receptor inhibitor (e.g., ianalumab (VAY736)), an anti-CD20 antibody, an anti-CD19 antibody, and the like. Groups containing an anti-CD20 antibody, an anti-CD19 antibody, and the like include a group containing a functional fragment (e.g., a fragment containing the CD20 recognition domain, the CD19 recognition domain, and the like) or the full-length anti-CD20 antibody, an anti-CD19 antibody, and the like. This allows BCR-expressing cells to be attacked, thereby solving the above-mentioned problem. The phagocytosis marker group includes a group containing at least one selected from the group consisting of the Fc region of IgG, phosphatidylserine, and phosphatidylcholine. This makes it possible to recruit macrophages and the like, thereby solving the above-mentioned problems.

[0024] In the above substance, it is preferable that the group that selectively binds to BCR and / or the antibody is integrally bound (e.g., covalently bound) to the active ingredient (at least one group selected from the group consisting of a cytotoxic drug group, an anti-CD3 antibody group, a B cell inhibitory agent group, and a phagocytosis marker group) directly or via a linking group. As used herein, the term "conjugate" (antigen-drug conjugate) refers to a compound in which a group that selectively binds to BCR and / or the antibody (preferably a fragment or full-length having the antigenicity of an autoantigen (autoantigenicity)) and, as the active ingredient, the cytotoxic group are integrally bound (e.g., covalently bound) directly or via a linking group.

[0025] Examples of embodiments in which the group that selectively binds to BCR and / or the antibody is directly bonded to the active ingredient (cytotoxic group) include, but are not limited to, the following examples (a) to (d): (a) an amide bond between a carboxyl group of one group (for example, when the group has a carboxyl group at the terminal, when it has an aspartic acid residue or a glutamic acid residue in the side chain, etc.) and an amino group of the other group (for example, when it has an amino group at the terminal, when it has a lysine residue in the side chain, etc.), (b) a thioester bond between a carboxyl group of one group and a thiol group of the other group (for example, when it has a thiol group at the terminal, when it has a cysteine ​​residue in the side chain, etc.), (c) an ester bond between a carboxyl group of one group and a hydroxyl group of the other group (for example, when it has a hydroxyl group at the terminal, when it has a serine or threonine residue in the side chain, etc.), (d) a disulfide bond between a thiol group possessed by one group (for example, when a thiol group is possessed at a terminal, when a cysteine ​​residue is possessed in a side chain, etc.) and a thiol group possessed by the other group (for example, when a thiol group is possessed at a terminal, when a cysteine ​​residue is possessed in a side chain, etc.). The amide bond, thioester bond, ester bond, and disulfide bond can be formed by any organic chemical method.

[0026] First, examples of the bond between the group that selectively binds to BCR and / or the antibody and the linking group, and the bond between the active ingredient (cytotoxic group) and the linking group include (e) to (l) below, but the present invention is not limited to these.

[0027] (e) an amide bond formed from a carboxyl group (for example, when a carboxyl group is present at the terminal, when an aspartic acid residue or a glutamic acid residue is present in the side chain, etc.) or an N-hydroxysuccinimide activated ester group possessed by any of the above groups and an amino group possessed by any of the linking groups; (f) an ester bond formed from a carboxyl group (for example, when a carboxyl group is present at the terminal, when an aspartic acid residue or a glutamic acid residue is present in the side chain, etc.) possessed by any of the above groups and a hydroxyl group possessed by any of the linking groups; (g) a thioether bond formed from a thiol group (for example, when a thiol group is present at the terminal, when a cysteine ​​residue is present in the side chain, etc.) possessed by any of the above groups and a maleimide group possessed by any of the linking groups; (h) a thioether bond formed from a maleimide group possessed by any of the above groups and a thiol group (for example, when a thiol group is present at the terminal, when a cysteine ​​residue is present in the side chain, etc.) possessed by any of the above groups; (i) a thioester bond formed from an N-hydroxysuccinimide activated ester group possessed by any of the above groups and a thiol group possessed by any of the linking groups (for example, when a thiol group is possessed at the terminal, when a cysteine ​​residue is possessed in the side chain, etc.); (j) a thiol bond formed from a thiol group possessed by any of the above groups (for example, when a thiol group is possessed at the terminal, when a cysteine ​​residue is possessed in the side chain, etc.) and an N-hydroxysuccinimide activated ester group thiol group possessed by any of the linking groups (for example, when a thiol group is possessed at the terminal, when a cysteine ​​residue is possessed in the side chain, etc.); (k) an ester bond formed from an N-hydroxysuccinimide activated ester group possessed by any of the above groups and a hydroxyl group possessed by any of the linking groups (for example, when a hydroxyl group is possessed at the terminal, when a serine or threonine residue is possessed in the side chain, etc.); (l) an ester bond formed between a hydroxyl group of any of the above groups (for example, when a hydroxyl group is present at a terminal, when a serine or threonine residue is present in a side chain, etc.) and an N-hydroxysuccinimide-activated ester group of any linking group. The above amide bond, thioether bond, thioester bond, ester bond, and disulfide bond can be formed by any organic chemical method.

[0028] The linking group can be appropriately selected by a person skilled in the art and is not particularly limited, and examples thereof include linkers having 1 to 50 carbon atoms (preferably 2 to 40 carbon atoms, more preferably 3 to 30 carbon atoms, even more preferably 4 to 20 carbon atoms, and particularly preferably 5 to 15 carbon atoms) which may or may not contain a keto group, an ether bond, a thioether bond, an amide bond, a divalent succinimide group, and / or a divalent maleimide group.

[0029] More specific examples of the linking group include linkers containing maleimide, caproyl spacer, valine, citrulline, and a p-aminobenzyloxycarbonyl group as constituent components, peptide linkers containing glycine and serine, consisting of about 1 to 10 amino acids such as GGGGSGGGGS (SEQ ID NO: 9) or about 2 to 5 amino acids such as GGGGS (SEQ ID NO: 10), any polyethylene glycol (PEG) linker (preferably a flexible PEG linker), 4-(3-mercapto-2,5-dioxo-1-pyrrolidinylmethyl)cyclohexanecarboxylic acid linker, 4-mercaptovaleric acid linker, etc. Specific examples of the PEG linker include linkers having 1 to 10 PEG units, preferably linkers having 2 to 8 PEG units, more preferably linkers having 3 to 6 PEG units, and even more preferably linkers having 4 or 5 PEG units.

[0030] In the first aspect, the group that selectively binds to at least one selected from the group consisting of BCR and antibodies that recognize an autoantigen preferably comprises an antigenic (autoantigenic) fragment or the full-length of the autoantigen. In the first aspect, the group that selectively binds to at least one selected from the group consisting of BCR and antibodies that recognize an autoantigen more preferably comprises an antigenic fragment or the full-length of the autoantigen, and even more preferably comprises an antigenic fragment or the full-length of integrin αvβ6 protein.

[0031] (Autoantigen) In a first aspect, "autoantigen" refers to a normal substance in an animal's body that can cause autoimmunity (e.g., autoimmune disease) when an immune response is triggered against the antigen in the animal. The autoantigen can be a protein or peptide, a lipoprotein, a lipid, a carbohydrate, or a nucleic acid. The nucleic acid can be DNA or RNA. Autoantigens include, but are not limited to, enzymes, structural proteins, secreted proteins, cell surface receptors, and cytokines. In the first aspect, the autoantigen preferably includes a fragment or full-length protein having antigenicity (autoantigenicity).

[0032] From the viewpoint of application to autoimmune diseases, the above-mentioned autoantigen is preferably an autoantigen involved in autoimmune diseases, and more preferably integrin αvβ6 protein involved in ulcerative colitis or primary sclerosing cholangitis.

[0033] Integrins, in their natural form, are proteins consisting of heterodimeric molecules composed of two subunit chains, an α chain and a β chain. Known α chains include α1 to α11, αv, αX, αM, αL, αD, αE, and αIIb, and β chains include β1 to β8, with multiple isoforms consisting of different combinations of these. Integrins are present on the surface of epithelial cells and bind to extracellular matrix proteins such as laminin and fibronectin on the surface of connective tissue, playing an important role in cell adhesion.

[0034] Integrin αvβ6 is a heterodimeric molecule containing αv as the α chain and β6 as the β chain. Integrin αvβ6 is rarely expressed in normal tissues, but is expressed on the surface of epithelial cells upon inflammatory stimulation.

[0035] (Antigenic Fragment or Full-Length Integrin αvβ6 Protein) The origin of the antigenic fragment or whole integrin αvβ6 used in the present invention is not particularly limited, but is preferably the same species as the subject. Nucleotide sequence information of the genes encoding the integrin αv chain and β6 chain of mammalian species such as humans, and amino acid sequence information of each chain, can be obtained from publicly known databases (such as GenBank). In particular, the amino acid sequence of the preproprotein of human integrin αv chain isoform 1 is registered under GenBank Accession Number NP_002201.2 and is shown in SEQ ID NO: 1. The amino acid sequence of the precursor of the human integrin β6 chain is registered under GenBank Accession Number NP_000879.2 and is shown in SEQ ID NO: 2. Amino acid sequence information of the integrin αv chain and β6 chain of various mammals other than humans can also be obtained from publicly known databases (such as GenBank). Integrin αvβ6 may be composed of an αv chain and a β6 chain containing an amino acid sequence formed by further post-translational modification of one or both of the amino acid sequences of the αv chain and the β6 chain registered in the database. For example, the partial sequence from positions 1 to 30 in the amino acid sequence of SEQ ID NO: 1 is a signal peptide sequence, and the amino acid sequence of the mature polypeptide of the human integrin αv chain comprises the sequence from positions 31 to 1048 in the amino acid sequence of SEQ ID NO: 1. Similarly, the partial sequence from positions 1 to 21 in the amino acid sequence of SEQ ID NO: 2 is a signal peptide sequence, and the amino acid sequence of the mature polypeptide of the human integrin β6 chain comprises the sequence from positions 22 to 788 in the amino acid sequence of SEQ ID NO: 2. In the amino acid sequence of the human integrin αv chain shown in SEQ ID NO: 1, positions 31 to 992 correspond to the extracellular domain, positions 993 to 1016 correspond to the transmembrane domain, and positions 1017 to 1048 correspond to the intracellular domain, respectively. In addition, in the amino acid sequence of the human integrin β6 chain shown in SEQ ID NO: 2, positions 22 to 707 correspond to the extracellular domain, positions 708 to 730 correspond to the transmembrane domain, and positions 731 to 788 correspond to the intracellular domain.

[0036] In this specification, unless otherwise specified, antigenic fragments or the whole of the integrin αvβ6 protein are collectively referred to as "integrin αvβ6." Furthermore, in this specification, unless otherwise specified, integrin αvβ6 is not limited to a native form containing a mature or immature amino acid sequence, and may be a mutant form equivalent to the native integrin αvβ6.

[0037] Furthermore, integrin αvβ6 is not limited to a form in which both the natural or mutant α chain and β chain containing mature or immature amino acid sequences are in their full length (i.e., the entire integrin αvβ6), but may also be in the form of an antigenic fragment of integrin αvβ6.

[0038] The antigenic fragment or whole integrin αvβ6 may be prepared by adding another peptide to each chain of the antigenic fragment or whole integrin αvβ6 (e.g., added to the C-terminus), or by adding biotin to the antigenic fragment, whole integrin αvβ6, or each chain of the whole integrin αvβ6 (e.g., added to the C-terminus). Examples of other peptides include, but are not limited to, coiled-coil sequences (e.g., acidic tail sequences or basic tail sequences), tag (or label) sequences, etc. These other peptides are used, for example, in the production of the antigenic fragment or whole integrin αvβ6, to facilitate dimerization, purification, or immobilization on a support. The other peptide may be added via a linker sequence. The linker sequence can be appropriately selected by those skilled in the art. For example, a peptide linker consisting of about 1 to 10 amino acids such as GGGGSGGGGS (SEQ ID NO: 9) or about 2 to 5 amino acids such as GGGGS (SEQ ID NO: 10) containing glycine or serine may be used, but is not limited thereto.

[0039] Antigenic fragments of integrin αvβ6 include fragments in which at least one of the αv and β6 chains constituting the integrin dimer is shorter than the mature or immature native form or a mutant thereof. Examples include integrin αvβ6 fragments containing the extracellular region of the αv or β6 chain. Specifically, examples of antigenic fragments of integrin αvβ6 include dimers containing an αv chain comprising a partial sequence from Phe at position 31 to Val at position 992 of the amino acid sequence of the αv chain shown in SEQ ID NO: 1, and / or a β6 chain comprising a partial sequence from Gly at position 22 to Asn at position 707 of the amino acid sequence of the β6 chain shown in SEQ ID NO: 2. The αv or β6 chain fragment may also contain a signal sequence. Therefore, another example of an integrin αvβ6 fragment is a dimer comprising an αv chain that includes a partial sequence from Met at position 1 to Val at position 992 of the amino acid sequence of the αv chain shown in SEQ ID NO: 1, and / or a dimer comprising a β6 chain that includes a partial sequence from Met at position 1 to Asn at position 707 of the amino acid sequence of the β6 chain shown in SEQ ID NO: 2. The antigenic fragment of integrin αvβ6 preferably forms a dimer, and more preferably has binding activity to extracellular matrix proteins such as laminin and fibronectin. The binding activity of an antigenic fragment of integrin αvβ6 to extracellular matrix proteins can be confirmed, for example, by ELISA.

[0040] The formation of a dimer by the entire integrin αvβ6 or an antigenic fragment thereof can be confirmed, for example, by the detection of a band corresponding to the molecular weight of the dimer when the entire integrin αvβ6 or an antigenic fragment thereof is subjected to SDS-PAGE in the absence of 2-mercaptoethanol, and the disappearance of the band corresponding to the molecular weight of the dimer when the entire integrin αvβ6 or an antigenic fragment thereof is subjected to SDS-PAGE in the presence of 2-mercaptoethanol.

[0041] An example of a commercially available integrin αvβ6 is recombinant human integrin αvβ6 (R&D Systems, Minnesota, USA, product number 3817-AV). This recombinant human integrin αvβ6 is a dimer of an αv chain consisting of a partial sequence from Phe at position 31 to Val at position 992 of the amino acid sequence of the αv chain shown in SEQ ID NO: 1, together with a linker sequence and an acidic tail sequence added to the C-terminus, and a β6 chain consisting of a partial sequence from Gly at position 22 to Asn at position 707 of the amino acid sequence of the β6 chain shown in SEQ ID NO: 2, together with a linker sequence and a basic tail sequence added to the C-terminus.

[0042] More specific embodiments of the αv chain constituting the entire or antigenic fragment of integrin αvβ6 include polypeptides selected from the group consisting of: (I) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 or a partial sequence of the amino acid sequence set forth in SEQ ID NO: 1 from Phe at position 31 to Thr at position 1048; (II) a polypeptide comprising a partial sequence of the amino acid sequence set forth in SEQ ID NO: 1 and functionally equivalent to the polypeptide of (I); (III) a polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or a partial sequence thereof and functionally equivalent to the polypeptide of (I); and (IV) a polypeptide comprising an amino acid sequence in which one or more amino acids have been substituted, deleted, and / or added in the amino acid sequence set forth in SEQ ID NO: 1 or a partial sequence thereof and functionally equivalent to the polypeptide of (I).

[0043] The polypeptides (I) to (IV) may be polypeptides comprising an amino acid sequence in which another amino acid sequence is further added to at least one of the N-terminus and C-terminus, preferably the C-terminus, of the amino acid sequence or partial sequence defined in (I) to (IV).

[0044] In the above (II), (III), and (IV), examples of polypeptides functionally equivalent to the polypeptide of (I) include polypeptides that can form dimers with an integrin β6 chain (particularly preferably, a polypeptide chain consisting of the amino acid sequence shown in SEQ ID NO: 2, a polypeptide chain consisting of a partial sequence from Gly at position 22 to Cys at position 788 of the amino acid sequence shown in SEQ ID NO: 2, or a polypeptide chain consisting of a partial sequence from Gly at position 22 to Asn at position 707 of the amino acid sequence shown in SEQ ID NO: 2), and that the formed dimer has the ability to bind to extracellular matrix proteins, such as laminin and fibronectin, to which native integrin αvβ6 or commercially available integrin αvβ6 can bind.

[0045] The partial sequence in (II) includes a partial sequence from Phe at position 31 to Val at position 992 in the amino acid sequence shown in SEQ ID NO: 1. The partial sequences in (III) and (IV) include a partial sequence from Phe at position 31 to Thr at position 1048 in the amino acid sequence shown in SEQ ID NO: 1, or a partial sequence from Phe at position 31 to Val at position 992 in the amino acid sequence shown in SEQ ID NO: 1.

[0046] The sequence identity in (III) above is preferably 90% or more, more preferably 95% or more, even more preferably 96% or more, particularly preferably 97% or more, and most preferably 98% or more, or 99% or more.

[0047] In (IV) above, "one or more" means, for example, 1 to 100, preferably 1 to 50, preferably 1 to 30, preferably 1 to 20, preferably 1 to 15, preferably 1 to 10, preferably 1 to 5, preferably 1 to 4, preferably 1 to 3, preferably 1 to 2, or preferably 1.

[0048] More specific embodiments of the β6 chain constituting the entire or antigenic fragment of integrin αvβ6 include polypeptides selected from the group consisting of: (V) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 or a partial sequence from Gly at position 22 to Cys at position 788 of the amino acid sequence set forth in SEQ ID NO: 2; (VI) a polypeptide comprising a partial sequence of the amino acid sequence set forth in SEQ ID NO: 2 and functionally equivalent to the polypeptide of (V); (VII) a polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2 or a partial sequence thereof and functionally equivalent to the polypeptide of (V); and (VIII) a polypeptide comprising an amino acid sequence in which one or more amino acids have been substituted, deleted, and / or added in the amino acid sequence set forth in SEQ ID NO: 2 or a partial sequence thereof and functionally equivalent to the polypeptide of (V).

[0049] The polypeptides (V) to (VIII) may be polypeptides comprising an amino acid sequence in which another amino acid sequence is further added to at least one of the N-terminus and C-terminus, preferably the C-terminus, of the amino acid sequence or partial sequence defined in (V) to (VIII).

[0050] In the above (VI), (VII), and (VIII), examples of polypeptides functionally equivalent to the polypeptide of (V) include polypeptides that can form dimers with an integrin αv chain (particularly preferably, a polypeptide chain consisting of the amino acid sequence shown in SEQ ID NO: 1, a polypeptide chain consisting of a partial sequence from Phe at position 31 to Thr at position 1048 of the amino acid sequence shown in SEQ ID NO: 1, or a polypeptide chain consisting of a partial sequence from Phe at position 31 to Val at position 992 of the amino acid sequence shown in SEQ ID NO: 1), and that the formed dimer has the ability to bind to extracellular matrix proteins, such as laminin and fibronectin, to which native integrin αvβ6 or commercially available integrin αvβ6 can bind.

[0051] The partial sequence in (VI) may be a partial sequence from Gly at position 22 to Asn at position 707 in the amino acid sequence shown in SEQ ID NO: 2. The partial sequences in (VII) and (VIII) may be a partial sequence from Gly at position 22 to Cys at position 788 in the amino acid sequence shown in SEQ ID NO: 2, or a partial sequence from Gly at position 22 to Asn at position 707 in the amino acid sequence shown in SEQ ID NO: 2.

[0052] The sequence identity in (VII) above is preferably 90% or more, more preferably 95% or more, even more preferably 96% or more, particularly preferably 97% or more, and most preferably 98% or more, or 99% or more.

[0053] In (VIII) above, "one or more" means, for example, 1 to 100, preferably 1 to 50, preferably 1 to 30, preferably 1 to 20, preferably 1 to 15, preferably 1 to 10, preferably 1 to 5, preferably 1 to 4, preferably 1 to 3, preferably 1 to 2, or preferably 1.

[0054] In the above (III) and (VII), the sequence identity of the amino acid sequences can be determined using methods well known to those skilled in the art, sequence analysis software, etc. Examples of sequence analysis software include the blastp program of the BLAST algorithm and the fasta program of the FASTA algorithm.

[0055] (BCR and antibody recognizing autoantigen) In the first aspect, the BCR and antibody recognizing the autoantigen are not particularly limited as long as they recognize the autoantigen, and are preferably a BCR and antibody recognizing integrin αvβ6 protein.

[0056] As used herein, the term "anti-integrin αvβ6 antibody" refers to an antibody that specifically binds to integrin αvβ6 or an antigenic fragment thereof.

[0057] Therefore, the anti-integrin αvβ6 antibody to be removed in the present invention is an anti-integrin αvβ6 antibody that is specifically produced in subjects suffering from ulcerative colitis or primary sclerosing cholangitis, which are autoimmune diseases. The anti-integrin αvβ6 antibody is an autoantibody (pathogenic autoantibody). Anti-integrin αvβ6 autoantibodies are absent or almost absent in healthy individuals.

[0058] Furthermore, the anti-integrin αvβ6 antibody has the activity of competing with fibronectin for binding to integrin αvβ6. That is, the anti-integrin αvβ6 antibody is an antibody that specifically binds to integrin αvβ6 and inhibits the binding of integrin αvβ6 to fibronectin. As used herein, "inhibition" also encompasses suppression, reduction, and loss.

[0059] The anti-integrin αvβ6 antibody preferably inhibits or suppresses the binding between integrin αvβ6 and fibronectin via the RGD tripeptide motif of fibronectin, and more preferably binds to an epitope containing the RGD-binding domain on integrin αvβ6.

[0060] Even more preferably, the anti-integrin αvβ6 antibody comprises an RGD peptide sequence or a sequence analogous thereto. Examples of sequences analogous to RGD peptides include, but are not limited to, RGRD (SEQ ID NO: 7), RGSGD (SEQ ID NO: 8), RED, KGD, and SGD. The RGD peptide sequence or a sequence analogous thereto is preferably contained in the complementarity-determining region (CDR) of the heavy chain and / or light chain of the anti-integrin αvβ6 antibody, more preferably in CDR2 or CDR3 of the heavy chain, particularly preferably in CDR2 or CDR3 of the heavy chain, and even more preferably in CDR3 of the heavy chain. For example, the anti-integrin αvβ6 antibody comprises a heavy chain CDR3 comprising the sequence shown in AKVIPRIRGSGDKAGIKDYYYYGMDV (SEQ ID NO: 3), ATDRPLKLRGRDYNYYVMDV (SEQ ID NO: 4), AKDRGRRGDSGWYRHFDY (SEQ ID NO: 5), or ARDRGFRGDTAMIKGGMDV (SEQ ID NO: 6).

[0061] The binding dissociation constant (KD value) of the anti-integrin αvβ6 antibody to integrin αvβ6 or a fragment thereof is preferably 100 nM or less, more preferably 50 nM or less, and particularly preferably 25 nM or less. Preferably, an anti-integrin αvβ6 antibody comprising an RGD peptide sequence or a sequence analogous thereto, more preferably an RGD peptide sequence or a sequence analogous thereto in heavy or light chain CDR2 or CDR3, particularly preferably in heavy chain CDR2 or CDR3, and even more preferably in heavy chain CDR3, binds to integrin αvβ6 or an antigenic fragment thereof with a KD value of, for example, 100 nM or less, preferably 50 nM or less, more preferably 25 nM or less. Furthermore, the anti-integrin αvβ6 antibody preferably exhibits the property of capturing integrin αvβ6 with an adsorption rate of 50% or greater for an integrin αvβ6 protein fragment weighing at least twice the weight of the capturing antibody, or at least twice the weight of the capturing antibody multiplied by the ratio of the integrin αvβ6 protein fragment to the molecular weight of the entire integrin αvβ6. As used herein, "adsorption rate" refers to the ratio of the amount of antigen-bound antibody to the amount of antibody added in an antigen-antibody reaction system. For example, the amount of free antibody (the amount of antibody not bound to the antigen) after adding the antibody to a reaction system containing the antigen can be measured to determine the ratio of the amount of antibody bound to the amount of antibody added to the reaction system. It has been found that the concentration of integrin αvβ6 antibody in the sera of UC and PSC patients is approximately 5-10 μg / mL.

[0062] (Method for damaging and / or removing BCR-expressing cells) The present invention also relates to a method for damaging and / or removing BCR-expressing cells, comprising the step of contacting the agent according to the first aspect with BCR-expressing cells. The BCR-expressing cells may be in vitro cells or in vivo cells. Contact with in vivo cells can be achieved via intravenous administration, subcutaneous administration, intramuscular injection, intraperitoneal administration, etc. The contact can be achieved by adding the agent according to the first aspect to a cell culture solution and culturing the cells. The medium and culture conditions used can be appropriately set depending on the cells used, but are typically cultured at 37°C, 5% CO ２The incubation period can be 1 to overnight, 1 to 12 hours, 2 to 6 hours, or 3 to 5 hours. If necessary, the cells may be washed to remove the agent according to the first aspect, and then further incubated for 1 to 4 days or more, and up to 6 to 10 days.

[0063] <Therapeutic Agent for Autoimmune Disease> A second aspect of the present invention is a therapeutic agent for autoimmune disease, comprising the agent according to the first aspect. The target autoimmune disease is not particularly limited. Specific examples of target autoimmune diseases include ulcerative colitis and primary sclerosing cholangitis. In the second aspect, a combination of the autoimmune disease and the autoantigen is preferably such that the autoimmune disease is ulcerative colitis or primary sclerosing cholangitis, and the autoantigen is integrin αvβ6 protein.

[0064] In previous studies, the inventors demonstrated that anti-integrin αvβ6 antibodies are specifically produced in patients with ulcerative colitis or primary sclerosing cholangitis (International Publication No. WO 2020 / 141608). Integrin αvβ6 is known to bind to ligands such as fibronectin by recognizing the RGD tripeptide motif. Furthermore, in in vitro experiments using ELISA, the inventors' previous studies demonstrated that the addition of autoantibodies derived from ulcerative colitis patients inhibited the binding of integrin αvβ6 to fibronectin in a concentration-dependent manner, that the inhibitory activity correlated with the anti-integrin αvβ6 antibody titer derived from the patients, and that the binding of the patient-derived autoantibodies to integrin αvβ6 was inhibited by RGD peptide in a concentration-dependent manner (Gastroenterology Vol. 160, No. 7, June 2021, Pages 2383-2394). Furthermore, in the present invention, the inventors have found that anti-integrin αvβ6 antibodies are involved in the pathogenesis of ulcerative colitis and primary sclerosing cholangitis.

[0065] (Subject) The subject to which the therapeutic agent according to the second aspect is applied is an animal suffering from the above-mentioned autoimmune disease and in need of treatment. Preferably, the subject is an animal that is positive for an antibody that recognizes the corresponding autoantigen in the body (e.g., in the blood) (an animal that produces an anti-integrin αvβ6 antibody in the body). More preferably, the subject is an animal that is positive for an antibody that recognizes the corresponding autoantigen in the body (e.g., in the blood) and does not improve with other treatments (e.g., conventional treatments). The type of animal is not particularly limited and may be a human or other non-human mammal, but is preferably a human. The therapeutic agent according to the second aspect may contain a buffer, a stabilizer, or the like as necessary. The mode of administration of the therapeutic agent according to the second aspect is not particularly limited and may be administered to a subject via routes such as oral, intramuscular, intravenous, transdermal, nasal, or inhalation (transbronchial). Such an administration route can be appropriately selected by a person skilled in the art. The dosage, administration frequency, administration period, etc., are also appropriately determined by a person skilled in the art based on the type, sex, age, symptoms, etc. of the subject.

[0066] <<Pharmaceutical Composition>> A third aspect of the present invention is a pharmaceutical composition comprising the agent according to the second aspect. The third aspect is preferably a pharmaceutical composition for treating an autoimmune disease. In the third aspect, specific and preferred examples of the autoimmune disease, subject, and administration mode include the same specific and preferred examples as those described above for the second aspect.

[0067] The pharmaceutical composition according to the third aspect may or may not contain a pharmacologically acceptable carrier (formulation additive). The type of formulation additive used in the preparation of the pharmaceutical composition, the ratio of the formulation additive to the active ingredient, and the method of preparation of the composition can be appropriately selected by those skilled in the art depending on the form of the composition. Formulation additives can generally be incorporated in an amount of 1% to 99% by weight of the active ingredient. Here, various organic or inorganic carrier substances commonly used as formulation materials are used as pharmacologically acceptable carriers, and are incorporated as excipients, lubricants, binders, disintegrants in solid preparations, and solvents, solubilizers, suspending agents, isotonicity agents, buffers, soothing agents, etc. in liquid preparations. Furthermore, formulation additives such as preservatives, antioxidants, colorants, and sweeteners can also be used as needed. Suitable examples of excipients include lactose, sucrose, D-mannitol, D-sorbitol, starch, pregelatinized starch, dextrin, crystalline cellulose, low-substituted hydroxypropyl cellulose, sodium carboxymethylcellulose, gum arabic, dextrin, pullulan, light anhydrous silicic acid, synthetic aluminum silicate, magnesium aluminometasilicate, etc. Suitable examples of lubricants include magnesium stearate, calcium stearate, talc, colloidal silica, etc. Suitable examples of binders include pregelatinized starch, sucrose, gelatin, gum arabic, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, crystalline cellulose, sucrose, D-mannitol, trehalose, dextrin, pullulan, hydroxypropyl cellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, etc. Preferable examples of disintegrants include lactose, sucrose, starch, carboxymethylcellulose, carboxymethylcellulose calcium, croscarmellose sodium, carboxymethylstarch sodium, light anhydrous silicic acid, low-substituted hydroxypropylcellulose, etc. Preferable examples of solvents include water for injection, physiological saline, Ringer's solution, alcohol, propylene glycol, polyethylene glycol, sesame oil, corn oil, olive oil, cottonseed oil, etc.Suitable examples of solubilizing agents include polyethylene glycol, propylene glycol, D-mannitol, trehalose, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate, sodium salicylate, and sodium acetate. Suitable examples of suspending agents include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glycerin monostearate; hydrophilic polymers such as polyvinyl alcohol, polyvinylpyrrolidone, sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, and hydroxypropylcellulose; polysorbates, and polyoxyethylene hydrogenated castor oil. Suitable examples of isotonic agents include sodium chloride, glycerin, D-mannitol, D-sorbitol, and glucose. Suitable examples of buffering agents include buffer solutions such as phosphates, acetates, carbonates, and citrates. Suitable examples of soothing agents include benzyl alcohol.

[0068] Suitable examples of preservatives include parahydroxybenzoic acid esters, chlorobutanol, benzyl alcohol, phenethyl alcohol, dehydroacetic acid, sorbic acid, etc. Suitable examples of antioxidants include sulfites, ascorbic acid, etc. Suitable examples of coloring agents include water-soluble food tar dyes (e.g., food dyes such as Food Red No. 2 and No. 3, Food Yellow No. 4 and No. 5, Food Blue No. 1 and No. 2, water-insoluble lake dyes (e.g., aluminum salts of the above-mentioned water-soluble food tar dyes), natural dyes (e.g., β-carotene, chlorophyll, red iron oxide, etc.), etc. Suitable examples of sweeteners include saccharin sodium, dipotassium glycyrrhizinate, aspartame, stevia, etc.

[0069] Dosage forms of pharmaceutical compositions include oral preparations such as tablets, capsules (including soft capsules and microcapsules), granules, powders, syrups, emulsions, and suspensions; and parenteral preparations such as injections (e.g., subcutaneous injections, intravenous injections, intramuscular injections, intratumoral injections, intraperitoneal injections, intracerebral injections, and intravitreal injections), infusions, topical preparations (e.g., intranasal preparations, transdermal preparations, ointments, etc.), suppositories (e.g., rectal suppositories, vaginal suppositories, etc.), pellets, infusions, and sustained-release preparations, each of which can be safely administered orally or parenterally. The compositions can be prepared by methods commonly used in the pharmaceutical technology field, such as those described in the Japanese Pharmacopoeia. Specific preparation methods for the formulations are described in detail below.

[0070] For example, injections are produced by dissolving, suspending, or emulsifying the above-mentioned protein or polypeptide as an active ingredient in an aqueous solvent (e.g., distilled water, physiological saline, Ringer's solution, etc.) or an oily solvent (e.g., vegetable oils such as olive oil, sesame oil, cottonseed oil, and corn oil, propylene glycol, etc.) together with dispersants (e.g., polysorbate 80, polyoxyethylene hydrogenated castor oil 60, etc.), polyethylene glycol, carboxymethylcellulose, sodium alginate, etc.), preservatives (e.g., methylparaben, propylparaben, benzyl alcohol, chlorobutanol, phenol, etc.), isotonicity agents (e.g., sodium chloride, glycerin, D-mannitol, D-sorbitol, glucose, etc.). In this case, additives such as solubilizing agents (e.g., sodium salicylate, sodium acetate, etc.), stabilizers (e.g., human serum albumin, etc.), and soothing agents (e.g., benzyl alcohol, etc.) may be used, if desired.

[0071] Oral preparations are produced by adding, for example, excipients (e.g., lactose, sucrose, starch, D-mannitol, etc.), disintegrants (e.g., carboxymethylcellulose calcium, etc.), binders (e.g., pregelatinized starch, gum arabic, carboxymethylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, etc.), or lubricants (e.g., talc, magnesium stearate, polyethylene glycol 6000, etc.) to the above-mentioned protein or polypeptide as an active ingredient, followed by compression molding, and then coating with a coating base by a method known per se, as needed, for the purposes of taste masking, enteric coating, or sustained release. Examples of such coating bases include sugar coating bases, water-soluble film coating bases, enteric film coating bases, and sustained-release film coating bases. Sucrose is used as the sugar coating base, and one or more of talc, precipitated calcium carbonate, gelatin, gum arabic, pullulan, carnauba wax, etc. may also be used in combination. Examples of water-soluble film coating bases include cellulose polymers such as hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethyl cellulose, and methylhydroxyethyl cellulose; synthetic polymers such as polyvinyl acetal diethylaminoacetate, aminoalkyl methacrylate copolymer E (Eudragit E (trade name), Rohm Pharma Co., Ltd.), and polyvinylpyrrolidone; and polysaccharides such as pullulan.

[0072] Examples of enteric film coating bases include cellulose-based polymers such as hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate succinate, carboxymethylethylcellulose, and cellulose acetate phthalate; acrylic acid-based polymers such as methacrylic acid copolymer L [Eudragit L (trade name), Rohm Pharma Co., Ltd.], methacrylic acid copolymer LD [Eudragit L-30D55 ​​(trade name), Rohm Pharma Co., Ltd.], and methacrylic acid copolymer S [Eudragit S (trade name), Rohm Pharma Co., Ltd.]; and natural products such as shellac. Examples of sustained-release film coating bases include cellulose-based polymers such as ethyl cellulose; and acrylic acid-based polymers such as aminoalkyl methacrylate copolymer RS ​​[Eudragit RS (trade name), Rohm Pharma Co., Ltd.] and ethyl acrylate-methyl methacrylate copolymer suspension [Eudragit NE (trade name), Rohm Pharma Co., Ltd.]. Two or more of the above-mentioned coating bases may be mixed in an appropriate ratio. In addition, a light-shielding agent such as titanium oxide or iron sesquioxide may be used during coating.

[0073] (Method for treating autoimmune disease) The present invention also relates to a method for treating autoimmune disease, comprising the step of administering to the subject at least one selected from the group consisting of the agent according to the first aspect, the therapeutic agent according to the second aspect, and the pharmaceutical composition according to the third aspect. The autoimmune disease is preferably ulcerative colitis or primary sclerosing cholangitis. The administration to the subject may be via, for example, oral, intramuscular, intravenous, transdermal, nasal, or inhalation (transbronchial) routes. The administration route can be appropriately selected by a person skilled in the art. The dosage, frequency of administration, duration of administration, etc. can also be appropriately determined by a person skilled in the art based on the type, sex, age, symptoms, etc. of the subject.

[0074] The present invention will be described in more detail below using examples, but the present invention is not limited to these examples.

[0075] Preparation Example 1. Establishment of Monoclonal Anti-integrin αvβ6 Antibodies 1. Establishment of Monoclonal Antibodies Monoclonal anti-integrin αvβ6 antibodies were established from peripheral blood of human patients with ulcerative colitis (UC) using standard methods. Briefly, peripheral blood was obtained from the UC patient and immortalized by infection with EB virus, and a clone producing an anti-integrin αvβ6 antibody was selected. The IgG DNA sequence of the clone was decoded by sequencing, and the DNA sequence was introduced into a plasmid and then transfected into Chinese Hamster Ovary cells (hereinafter referred to as "CHO ​​cells") to establish a monoclonal anti-integrin αvβ6 antibody. As a result, of the monoclonal anti-integrin αvβ6 antibodies established from the UC patient, the following two monoclonal anti-integrin αvβ6 antibodies (referred to as UC Antibody 1 and UC Antibody 5, respectively) were used in subsequent studies.

[0076] Sequence analysis of the obtained monoclonal antibodies revealed that they contained an RGD motif or an RGD-like sequence in the heavy chain CDR3 or CDR2 sequences, respectively. Another group also reported that the heavy chain CDR3 of monoclonal antibodies derived from UC patients contained, in addition to the RGD motif, sequences similar to RGD, such as RED, KGD, or SGD, and that antibodies containing these sequences had high binding ability to integrin αvβ6 (Nature Medicine volume 28, 766-779 (2022), J Exp Med (2023) 220 (4): e20220538.).

[0077] The CDR sequences of the heavy and light chains of the obtained monoclonal antibody are shown below. The amino acid and nucleotide sequences of the variable region sequences are also shown. In the amino acid sequences of the variable regions, the CDR sequences are underlined and in bold.

[0078]

[0079]

[0080]

[0081] UC antibody 1: Heavy chain variable region CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 25) Light chain variable region GATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAACCTCCTGCATAGTAATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCCGGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAA (SEQ ID NO: 26)

[0082] UC antibody 5: Heavy chain variable region CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTCACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 27) Light chain variable region GTGCTGACGCAGCCGCCCTCAGTGTCCGTGTCCCCAGGACAGACAGCCAGCATCACCTGCTCTGGAGATAAATTGGGGGATAAATATGCTTGCTGGTACCAGCAGAAGTCAGGCCAGGCCCCTGTATTGGTCATCTATCAAGATAGCAAGCGGCCCTCAGG GATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACAGCCACTCTGACCATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCGCTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 28)

[0083] 2. Binding Affinity Analysis Next, the binding affinity of the obtained anti-integrin αvβ6 monoclonal antibody derived from a UC patient was determined. KD values ​​were measured by biolayer interferometry using Octet RED96 (Sartorius). 20 mM Tris, 150 mM NaCl, 1 mM CaCl ２ , 1 mM MgCl ２A 100 nM antibody solution and a biotinylated integrin αvβ6 protein solution serially diluted over the range of 200 to 6.25 nM were prepared using 0.1% human serum albumin (014-27604; Fujifilm Wako Pure Chemical Industries, Ltd.) and 0.02% Tween 20 (1610781; Bio-Rad) buffer. 200 μL / well of these solutions were added to a 96-well plate (Greiner; 655209). Biotinylated integrin αvβ6 was allowed to bind to a biosensor (18-5136; Sartorius) soaked in the buffer for 5 minutes. After washing, the biosensor was immersed in each antibody solution for 5 minutes (binding reaction). The sensor was then immersed in the buffer solution for 1 minute (dissociation reaction). The binding dissociation constant (KD value) between "integrin αvβ6 and each monoclonal antibody" was determined using the analytical software (Octet BLI Analysis) attached to the instrument. The results are shown in Table 4.

[0084]

[0085] The KD values ​​of UC antibodies 1 and 5 are 1 x 10 －９ Since the binding affinities were on the order of M, it was found that these antibodies had high binding affinity to integrin αvβ6.

[0086] Preparation Example 2 Preparation of anti-integrin αvβ6 antibody-expressing HEK-293T cells A membrane-type human IgG heavy chain expression plasmid and a human IgG light chain expression plasmid were prepared from the gene for UC antibody 5, an anti-integrin αvβ6 antibody (IgG: immunoglobulin G) derived from a UC patient, and these were transfected into human fetal kidney-derived HEK-293T cells (HEK-293T(WT)) using lentivirus. An anti-human IgG heavy chain antibody (BD Biosciences, APC Mouse Anti-Human IgG, 550931) and an anti-human IgG light chain antibody (BD Biosciences, FITC Mouse Anti-Human Lambda Light Chain, 346600) were added to the transfected cells, and human antibody-expressing cells were sorted by flow cytometry.

[0087] The sorted cells were transfected with human CD79A and B (GenBank Accession Numbers NP_001783 and NP_001039933) expression plasmids using lentivirus. Using anti-human CD79B antibody (BD Biosciences, PerCP-Cy5.5 Mouse Anti-Human CD79B, 656644), biotinylated integrin αvβ6 (ACROBiosystems, IT6-H82E4), and phycoerythrin (PE)-labeled NeutrAvidin (Thermo Fischer Scientific, A2660), cells (HEK-293T(G5)) expressing anti-integrin αvβ6 antibody and CD79A and B on the cell surface were selected and sorted by flow cytometry. The results are shown in Figure 1.

[0088] Example 1 Preparation of Human Integrin αvβ6-Anti-CD3 Antibody Complex (Preparation of Human Integrin αvβ6-Anti-CD3 Antibody Complex) The anti-CD3 antibody recognition domain used a sequence derived from tebentafusp or blinatumomab. An integrin αv-anti-CD3 antibody expression plasmid was prepared by inserting a sequence (SEQ ID NO: 29 when the anti-CD3 antibody recognition domain was derived from tebentafusp, or SEQ ID NO: 30 when the anti-CD3 antibody recognition domain was derived from blinatumomab) into the pcDNA3.4 TOPO vector (Invitrogen, A14697) in which a linker (GGGGGS: SEQ ID NO: 10), the anti-CD3 antibody recognition domain, and a His tag were linked to the C-terminus of the integrin αv fragment. The integrin αv fragment contains Phe31-Asp625 (GenBank Accession Number NP_002201.2 (SEQ ID NO: 1)) which constitutes the βPropeller and Thigh domains, and an amino acid mutation of Met430Cys was introduced to form a heterodimer with the β6 subunit.

[0089] The integrin β6 subunit expression plasmid was prepared by inserting a sequence (SEQ ID NO: 31) in which a FLAG tag (DYKDDDDK: SEQ ID NO: 32), a linker (GGGS: SEQ ID NO: 33), and an AVI tag (GLNDIFEAQKIEWHE: SEQ ID NO: 34) were linked to the C-terminus of the integrin β6 fragment into the pcDNA3.4TOPO vector. The integrin β6 fragment contains Gly22-Glu491 (GenBank Accession Number NP_000879.2 (SEQ ID NO: 2)), which constitutes all or part of the PSI, Hybrid, βI, and I-EGF1 domains, and an Ile287Cys mutation was introduced to allow for heterodimer formation with the αv subunit.

[0090] When both expression plasmids were transfected into CHO cells, the human integrin αvβ6-anti-CD3 antibody complex was secreted into the culture supernatant. The complex was primarily purified using a carrier for purifying histagged proteins (Cytiva, 17371201), and then further purified using a carrier for purifying FLAG-tagged proteins (Medical and Biological Laboratories, 3326R) or a gel filtration chromatography column (Cytiva, 28990944).

[0091] (In vitro test of cytotoxicity of anti-integrin αvβ6 antibody-expressing cells by integrin αvβ6-antibody complex) 50,000 HEK-293T (WT) or HEK-293T (G5) cells expressing anti-integrin αvβ6 antibody on the cell membrane were seeded into each well of a 24-well plate. HEK-293T cells were cultured overnight in a volume of 500 μL / well in Dulbecco's modified Eagle's medium (DMEM; Fujifilm Wako Pure Chemical Industries, Ltd., 044-29765) containing 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco 15140122). The next day, 200,000 human monocyte-derived T cells were seeded into each well, and the following additives were added: solvent alone (control group), 4 μg / mL of anti-CD3 antibody (CD3 group), and 3 or 6 μg / mL of an integrin αvβ6-anti-CD3 antibody complex containing the anti-CD3 antibody recognition domain derived from tebentafusp or blinatumomab (tebentafusp group or blinatumomab group). As monoculture groups, a 200,000 human monocyte-derived T cell culture group (T cell group) and a 50,000 HEK-293T cell culture group (HEK-293T(WT) group or HEK-293T(G5) group) were set up.

[0092] After two days of co-culture, a luminescence assay (Promega G7571) was performed to determine the number of viable cells in each well. The results are shown in Figure 2. Furthermore, to determine the number of viable HEK-293T cells in each group, the reduction rate of viable HEK-293T cells (cytotoxic activity against target cells) relative to each control group was calculated. The results are shown in Figure 3. Furthermore, the concentration of granzyme B secreted into the culture supernatant of each sample was quantified (Proteintech KE00121). The results are shown in Figure 4.

[0093] As is clear from the results shown in Figure 2, the number of viable cells decreased in the tebentafusp or blinatumomab group of HEK-293T (G5) cells. In the tebentafusp and blinatumomab groups, it is presumed that the anti-CD3 antibody recognition domain derived from tebentafusp or blinatumomab in the complex recruited T cells and damaged HEK-293T (G5) cells.

[0094] Furthermore, as is clear from the results shown in Figure 3, the viable cell reduction rates in the tebentafusp group and the blinatumomab group of HEK-293T (WT) were 13.1% and 16.1%, respectively, whereas in HEK-293T (G5) expressing the anti-integrin αvβ6 antibody, the viable cell reduction rates in the tebentafusp group and the blinatumomab group were 46% and 50%, respectively.

[0095] Furthermore, as is clear from the results shown in Figure 4, the concentrations in the tebentafusp and blinatumomab groups of HEK-293T(WT) were 1,387 and 1,534 pg / mL, respectively, whereas the concentrations in the tebentafusp and blinatumomab groups of HEK-293T(G5) were 7,317 and 8,537 pg / mL, respectively. In the tebentafusp and blinatumomab groups, it is believed that T cells and target cells were brought into close proximity via the complex, and that HEK-293T(G5) cells were killed by granzyme B secreted from activated T cells. The results shown in Figures 2 to 4 above demonstrate that T cells are activated and exert cytotoxic activity in the presence of integrin αvβ6-anti-CD3 antibody complexes and anti-integrin αvβ6 antibody-expressing cells.

[0096] Preparation Example 3: Preparation of anti-integrin αvβ6 antibody-expressing HEK-293T cells (UC antibody 1) Mouse CD79A, mouse CD79B, and firefly luciferase expression plasmids were prepared and transfected into wild-type HEK-293T cells (Riken BRC, product number RCB2202) using Lipofectamine 3000 (Thermo Fisher Scientific, product number L3000008). After one week, the transfected cells were stained with an anti-mouse CD79B antibody (Bio Legend, FITC anti-mouse CD79b (Igβ) Antibody, product number 132805), and mouse CD79B-positive cells were collected and cultured for an additional five days. Similar flow cytometry was performed again, and the positive cells were recovered by single-cell sorting and cultured in 96-well plates for an additional 10 days. Clones from the expanded wells were transferred to 24-well plates, and a luciferase assay (Promega, product number E2610) was performed using 20,000 cells. The clone that showed the highest RLU (relative luminescence unit) value was designated as mouse CD79A-positive, mouse CD79B-positive, and firefly luciferase-positive cells (hereinafter simply referred to as "HEK-L79"). Membrane-type mouse IgG2a heavy chain expression plasmid and mouse IgK light chain expression plasmid were constructed incorporating the gene sequences of the heavy and light chain variable regions of UC antibody 1, an anti-integrin αvβ6 antibody derived from a UC patient, and transfected into the above-mentioned HEK-L79 cells using Lipofectamine 3000. To detect cells expressing UC antibody 1 on the membrane by flow cytometry, 0.5 μL of AlexaFluor 647-labeled anti-His antibody (Medical and Biological Laboratories, product number D291-A64) was mixed with 1 μg of integrin αvβ6-anti-CD3 antibody complex, and the mixture was used to detect HEK-L79 cells expressing UC antibody 1. Single cell cloning was performed in the same manner as above to obtain cells positive for membrane-expressed anti-integrin αvβ6 antibody (mIgG2a-G1), mouse CD79A, mouse CD79B, and firefly luciferase (hereinafter simply referred to as "HEK-G1"). The results are shown in Figure 5.

[0097] Figure 5A shows an outline of the detection of anti-integrin αvβ6 antibody-expressing HEK-293T cells, and Figure 5B shows the results of the production of anti-integrin αvβ6 antibody-expressing HEK-293T cells. As is clear from the flow cytometry results shown in Figure 5B, the production of anti-integrin αvβ6 antibody-expressing HEK-293T cells was confirmed.

[0098] Example 3 In Vitro Test of Cytotoxicity of Anti-integrin αvβ6 Antibody-Expressing Cells (HEK-G1 Cells) by Integrin αvβ6-Anti-CD3 Antibody Conjugates 10,000 HEK-L79 cells or HEK-G1 cells expressing anti-integrin αvβ6 antibody on the cell membrane were seeded onto a 96-well plate. Each cell was cultured overnight at a volume of 100 μL / well in DMEM (Fujifilm Wako Pure Chemical Industries, Ltd., Product No. 044-29765) containing 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco, Product No. 15140122). The following day, 20,000, 40,000, and 80,000 human monocyte-derived T cells were seeded into each well, and either solvent alone or an integrin αvβ6-anti-CD3 antibody complex containing the anti-CD3 antibody recognition domain derived from blinatumomab was added at 0.03, 0.3, or 3 μg / mL. As control groups, wells were set up in which 10,000 HEK cells were cultured alone. Sixteen to 20 hours after drug addition, a luminescence assay (Promega, Product No. E2610) was performed to quantify the number of surviving luciferase-expressing HEK cells. The number of HEK-G1 cells was significantly reduced. The results are shown in Figure 6.

[0099] Figure 6A shows the results of a HEK-G1 cytotoxicity test using a human integrin αvβ6-anti-CD3 antibody complex, and Figure 6B shows the results of a HEK-L79 cytotoxicity test using a human integrin αvβ6-anti-CD3 antibody complex. In Figure 6, the ET ratio indicates the ratio of effector cells (T cells) to target cells. This is also true for Figure 9, which will be described later. The percentage reduction in viable cells (cytotoxic activity against target cells) relative to each control group was calculated, and as is clear from the results shown in Figure 6B, the maximum reduction was 18.4% for HEK-L79, whereas the maximum reduction was 69.8% for HEK-G1, as is clear from the results shown in Figure 6A. Furthermore, the concentration of granzyme B secreted into the culture supernatant of each sample was quantified (Proteintech, Product No. KE00121). As shown in Figure 6B, the maximum concentration for HEK-L79 was 5,931 pg / mL, whereas the maximum concentration for HEK-G1 was 39,848 pg / mL, as shown in Figure 6A. As shown in Figures 6A and 6B, the cytotoxicity rate and granzyme B production increased with increasing numbers of T cells used in coculture and with increasing concentrations of integrin αvβ6-anti-CD3 antibody complexes. These results suggest that the integrin αvβ6-anti-CD3 antibody complexes act cooperatively with T cells to damage anti-integrin αvβ6 antibody-expressing cells.

[0100] Preparation Example 4: Preparation of anti-integrin αvβ6 antibody-expressing A20 cells (UC antibody 1) Wild-type A20 cells (Riken BRC, product number RCB2745) were transfected with a firefly luciferase expression plasmid using Lipofectamine 3000 (Thermo Fisher Scientific, product number L3000008). Two weeks later, the transfected cells were stained with an anti-mouse CD79B antibody (Bio Legend, FITC anti-mouse CD79b (Igβ) Antibody, product number 132805), and single-cell sorting of the positive cells was performed by flow cytometry. After 10 days of culture in an ultra-low attachment 96-well plate (Corning, product number 3474), the cells were transferred to an ultra-low attachment 24-well plate (Corning, product number 3473). A luciferase assay (Promega, product number E2610) was performed using 20,000 cells from each clone, and the clone exhibiting the highest RLU value was designated as a firefly luciferase-positive cell (hereinafter, also referred to simply as "A20-Luc"). The A20-Luc cells were transfected using Lipofectamine 3000 with a membrane-type mouse IgG2a heavy chain expression plasmid for UC antibody 1, an anti-integrin αvβ6 antibody derived from a UC patient, a secreted mouse IgG2a heavy chain expression plasmid, a mouse IgK light chain expression plasmid, mouse CD79A, and mouse CD79B. To detect cells expressing UC antibody 1 on the membrane by flow cytometry, 0.5 μL of AlexaFluor 647-labeled anti-His antibody (Medical and Biological Laboratories, product number D291-A64) was mixed with 1 μg of integrin αvβ6-anti-CD3 antibody complex, and the mixture was used to detect HEK-L79 cells expressing UC antibody 1. Single cell cloning was performed in the same manner as above to obtain cells positive for membrane-expressed and secreted anti-integrin αvβ6 antibody (mIgG2a-G1), mouse CD79A, mouse CD79B, and firefly luciferase (hereinafter simply referred to as "A20-G1"). The results are shown in Figure 7.

[0101] Figure 7A shows the results of preparation of the A20-Luc, and Figure 7B shows the results of preparation of anti-integrin αvβ6 antibody-expressing A20 cells (A20-G1 cells). As is clear from the flow cytometry results shown in Figure 7B, the production of anti-integrin αvβ6 antibody-expressing A20 cells (A20-G1 cells) was confirmed.

[0102] Reference Example 1. Anti-integrin αvβ6 antibody (G1) concentration in A20-G1 culture supernatant. A20-G1 was subcultured every three days in 6-well plates (Corning, Product No. 3471) using RPMI-1640 (Fujifilm Wako Pure Chemical Industries, Ltd., Product No. 189-02025) medium containing 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco, Product No. 15140122). The culture supernatant was collected after each subculture, and the anti-integrin αvβ6 antibody concentration in the supernatant was quantified by ELISA. A 96-well microtiter plate was coated overnight at 4°C with 100 μL / well of 2 μg / mL human integrin αvβ6 (ACROBiosystems, Product No. IT6-H52E1). After blocking, 100-fold diluted A20 culture supernatant was incubated at room temperature (25°C) for 60 minutes. After washing, HRP (horseradish peroxidase)-labeled anti-mouse IgG antibody (1:30,000 dilution; product number A28177; Thermo Fisher Scientific) was added and incubated at room temperature for 60 minutes. After washing, the plate was incubated with 3,3',5,5'-tetramethylbenzidine for 5 minutes, and the absorbance at 450 nm was measured to detect the anti-integrin αvβ6 antibody bound to the solid phase. A mouse hybridoma-derived anti-integrin αvβ6 antibody (prepared by the Department of Gastroenterology, Kyoto University) was used to prepare a calibration curve for converting antibody concentrations. The assay was performed using MgCl ２ (1 mM) and CaCl ２ The experiment was carried out in the presence of 1 mM of riboflavin. The results are shown in Figure 8.

[0103] Fig. 8 shows the concentration of anti-integrin αvβ6 antibody (G1) in the A20-G1 culture supernatant. As is clear from the results shown in Fig. 8, the average concentration of anti-integrin αvβ6 antibody in the culture supernatant samples from the 10th passage was 241±62 ng / mL.

[0104] Example 4. Cytotoxicity test of anti-integrin αvβ6 antibody-expressing cells (A20-G1) by integrin αvβ6-anti-CD3 antibody complex. A20-G1 cells expressing A20-Luc or anti-integrin αvβ6 antibody on the cell membrane were seeded into a 96-well plate at a volume of 10,000 cells / 100 μL / well in RPMI-1640 (Fujifilm Wako Pure Chemical Industries, Ltd., Product No. 189-02025) containing 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco, Product No. 15140122). After 2 hours, the plate was centrifuged at 200 g for 3 minutes, and 50 μL was removed from each well. 5,000, 10,000, 20,000, and 40,000 human monocyte-derived T cells were seeded into each well of the plate at a volume of 40 μL / well. Furthermore, either solvent alone or an integrin αvβ6-anti-CD3 antibody complex containing the anti-CD3 antibody recognition domain derived from blinatumomab was added at a volume of 10 μL / well to a final concentration of 3, 30, or 300 ng / mL. As control groups, wells were set up in which 10,000 cells of each A20 cell line were cultured alone. A luminescence assay (Promega, Product No. E2610) was performed 16 to 20 hours after drug addition to quantify the number of viable luciferase-expressing A20 cells. A significant decrease in the number of A20-G1 cells was observed. The results are shown in Figure 9.

[0105] Figure 9A shows the results of an A20-G1 cytotoxicity test using a human integrin αvβ6-anti-CD3 antibody complex, and Figure 9B shows the results of an A20-Luc cytotoxicity test using a human integrin αvβ6-anti-CD3 antibody complex. The percentage reduction in viable cells (cytotoxic activity against target cells) relative to each control group was determined. As shown in Figure 9B, A20-Luc increased cells in all samples, whereas HEK-G1 showed a maximum reduction of 82%. Furthermore, when the concentration of granzyme B secreted into the supernatant of each sample was quantified (Proteintech, Product No. KE00121), as shown in Figure 9B, the maximum concentration for A20-Luc was 763 pg / mL, whereas the maximum concentration for A20-G1 was 6,455 pg / mL. 9A and 9B, the cytotoxicity rate and granzyme B production increased with increasing numbers of T cells used in co-culture and with increasing concentrations of integrin αvβ6-anti-CD3 antibody complexes. These results confirmed that the cytotoxic effect of integrin αvβ6-anti-CD3 antibody complexes on anti-integrin αvβ6 antibody-expressing cells was also observed in A20 cells derived from mouse B cells.

[0106] <Example 5. Preparation of Integrin αvβ6-Mouse IgG2a-Fc Complex> (Preparation of Integrin αvβ6-Mouse IgG2a-Fc Complex) An expression plasmid for a sequence (SEQ ID NO: 35) in which the hinge region and Fc region of mouse IgG2a (Pro98-Gly328, Protein Accession Number P01865.3), a linker (KGGGGGSAS: SEQ ID NO: 36), and a FLAG tag sequence (DYKDDDDK: SEQ ID NO: 32) are linked to the C-terminus of the extracellular region of human integrin αv (Phe31-Val992 in SEQ ID NO: 1, GenBank Accession Number NP_002201.2) was used. An expression plasmid was prepared by linking the hinge and Fc regions of mouse IgG2a (Pro98-Gly328, Protein Accession Number P01865.3), a linker (KGGGGGSAS: SEQ ID NO: 36), and a His tag sequence (SEQ ID NO: 37) to the C-terminal side of human integrin αvβ6 (Protein Accession Number NP_000879.2). Both expression plasmids were transfected into CHO cells, and the resulting human integrin αvβ6-mouse IgG2a-Fc complex was purified using Protein A.

[0107] (Test 1 to confirm binding of integrin αvβ6-mouse IgG2a-Fc complex to UC antibody 1) The prepared integrin αvβ6-mouse IgG2a-Fc complex was adjusted to 0.1 to 10 μg / mL and added to a microtiter plate at 100 μL / well. The plate was coated overnight at 4°C, followed by washing and blocking. After washing, UC antibody 1, an anti-integrin αvβ6 antibody derived from a UC patient, was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, HRP-labeled anti-human IgG antibody (Abcam, Goat F(ab')2 Anti-Human IgG(Fab')2, product number Ab98535) was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, 100 μL / well of 3,3′,5,5′-tetramethylbenzidine was added, and the absorbance density (OD value) at 450 nm was measured to detect the anti-integrin αvβ6 antibody bound to the human integrin αvβ6-mouse IgG2a-Fc complex. The results are shown in FIG.

[0108] As is clear from the results shown in Figure 10, the absorbance at 450 nm (OD value) increased in proportion to the concentration of the human integrin αvβ6-mouse IgG2a-Fc complex, indicating that the anti-integrin αvβ6 antibody bound to the complex in proportion to the concentration of the human integrin αvβ6-mouse IgG2a-Fc complex.

[0109] (Test 2 to confirm binding of integrin αvβ6-mouse IgG2a-Fc complex to UC antibody 5) The prepared integrin αvβ6-mouse IgG2a-Fc complex was adjusted to 0.25 to 4 μg / mL and added to a microtiter plate at 100 μL / well. The plate was coated overnight at 4°C, then washed and blocked. After washing, UC antibody 5, an anti-integrin αvβ6 antibody derived from a UC patient, was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, HRP-labeled anti-human IgG antibody (Abcam, Goat F(ab')2 Anti-Human IgG(Fab')2, product number Ab98535) was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, 100 μL / well of 3,3′,5,5′-tetramethylbenzidine was added, and the absorbance density (OD value) at 450 nm was measured to detect UC antibody 5 bound to the human integrin αvβ6-mouse IgG2a-Fc complex. ２ (1 mM) and CaCl ２ The experiment was carried out in the presence of 1 mM of ATP. The results are shown in Figure 11.

[0110] Figure 11 shows the results of Test 2 to confirm the binding of the integrin αvβ6-mouse IgG2a-Fc complex to UC antibody 5. As is clear from the results shown in Figure 11, the absorbance at 450 nm (OD value) increased in proportion to the concentration of the human integrin αvβ6-mouse IgG2a-Fc complex, indicating that the anti-integrin αvβ6 antibody bound to the complex in proportion to the concentration of the human integrin αvβ6-mouse IgG2a-Fc complex.

[0111] (Test for Confirmation of Fcγ Receptor Binding of Integrin αvβ6-Mouse IgG2a-Fc Complex) Mouse Fcγ receptor III (Shino Biological Corporation, Mouse CD16 / FCGR3 Protein, Product No. 50326-M08H) or mouse Fcγ receptor IV (Shino Biological Corporation, Mouse CD16-2 / FCGR4 gamma RIV Protein, Product No. 50036-M27H) was prepared at 4 μg / mL or 2 μg / mL, respectively, and added at 100 μL / well to a microtiter plate. After coating overnight at 4°C, the plate was washed and blocked. After washing, 100 μL / well of integrin αvβ6-mouse IgG2a-Fc complex prepared at 0.25 to 8 μg / mL was added, and the plate was incubated at room temperature for 60 minutes. After washing, HRP-labeled anti-mouse IgG Fc antibody (NOVUS BIOLOGICALS, Goat F(ab') ２ Anti-Mouse IgG Fc (product number NB120-5879) was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, 100 μL / well of 3,3',5,5'-tetramethylbenzidine was added, and the absorbance density (OD value) at 450 nm was measured to detect the human integrin αvβ6-mouse IgG2a-Fc complex bound to each mouse Fcγ receptor. The assay was performed using MgCl ２ (1 mM) and CaCl ２ The experiment was carried out in the presence of 1 mM of ATP. The results are shown in Figure 12.

[0112] Fig. 12 shows the results of a test to confirm the binding ability of the integrin αvβ6-mouse IgG2a-Fc complex to Fcγ receptors. As shown in Fig. 12, the absorbance at 450 nm (OD value) increased in proportion to the concentration of the human integrin αvβ6-mouse IgG2a-Fc complex, suggesting that the human integrin αvβ6-mouse IgG2a-Fc complex has the ability to bind to mouse Fcγ receptors (binding to both Fcγ receptor III and Fcγ receptor IV).

[0113] Example 6. In vivo pharmacokinetic study of integrin αvβ6-mouse IgG2a-Fc complex. 50, 100, or 200 μg of integrin αvβ6-mouse IgG2a-Fc complex was intraperitoneally administered to two 8-week-old male mice (C57BL / 6NJcl). Blood was collected at 1, 3, 7, and 14 days, and plasma was obtained. The integrin αvβ6-mouse IgG2a-Fc complex content in the plasma samples was quantified by ELISA. An anti-integrin αv antibody (R&D SYSTEMS, Human / Mouse / Rat Integrin alpha V / CD51 Antibody, Product No. AF1219) prepared at 2 μg / mL was added to a microtiter plate at 100 μL / well and coated overnight at 4°C. After washing and blocking, 100 μL / well of a mouse plasma sample diluted 100-fold was added and incubated at room temperature for 60 minutes. After washing, HRP-labeled anti-mouse IgG Fc antibody (NOVUS BIOLOGICALS, Goat F(ab') ２ Anti-Mouse IgG Fc (product number NB120-5879) was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, 100 μL / well of 3,3',5,5'-tetramethylbenzidine was added, and the absorbance density (OD value) at 450 nm was measured to detect the human integrin αvβ6-mouse IgG2a-Fc complex bound to the anti-integrin αv antibody. Figure 13 shows a calibration curve of the concentration of the integrin αvβ6-mouse IgG2a-Fc complex contained in mouse plasma at an absorbance of 450 nm. A similar assay was performed using integrin αvβ6-mouse IgG2a-Fc complex prepared at 0.0005-0.5 μg / mL, and the calibration curve shown in Figure 13 was prepared, from which the concentration of the complex contained in plasma was calculated. Note that these assays were performed without MgCl ２ (1 mM) and CaCl ２ The experiment was carried out in the presence of 1 mM of riboflavin. The results are shown in Figure 14.

[0114] Figure 14 shows the in vivo pharmacokinetics of the integrin αvβ6-mouse IgG2a-Fc complex. As shown in Figure 14, the initial blood concentration of the human integrin αvβ6-mouse IgG2a-Fc complex increased in proportion to the dose, but was subsequently eliminated at a constant rate.

[0115] <Example 7. In vivo confirmation test of the ability of the integrin αvβ6-mouse IgG2a-Fc complex to remove anti-integrin αvβ6 antibodies from the blood> Eight-week-old male mice (C57BL / 6NJcl) were immunized with 50 μg of integrin αvβ6 (a custom-made product manufactured by MBL) together with an adjuvant [BD's CFA (Freund's Complete Adjuvant, 263810) or IFA (Freund's Incomplete Adjuvant, 263910)] (day 0), and then immunized on days 14 and 28 (immunization group), or similarly immunized and administered 200 μg of integrin αvβ6-mouse IgG2a-Fc complex every seven days starting from day 0 (immunization + Fc complex administration group), each consisting of six mice. Blood samples were taken from the mice on days 0, 14, 28, and 42, and anti-integrin αvβ6 antibodies in the plasma samples were quantified by ELISA. Because one mouse from each group died before day 42, plasma from five mice from each group was analyzed on day 42 only. Human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1) prepared at 2 μg / mL was added to a microtiter plate at 100 μL / well and coated overnight at 4°C. After washing and blocking, 100-fold diluted mouse plasma samples were added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, 100 μL / well of HRP-labeled anti-mouse IgG Fc antibody (Abcam, Goat Anti-Mouse IgG H&L, product number ab6789) was added and incubated at room temperature for 60 minutes. After washing, 100 μL / well of 3,3',5,5'-tetramethylbenzidine was added and the absorbance density (OD value) at 450 nm was measured to detect anti-integrin αvβ6 antibody in mouse plasma. The assay was performed using MgCl ２ (1 mM) and CaCl２ The experiments were carried out in the presence of 1 mM ATP. The results are shown in Figure 15.

[0116] 15 shows the results of an in vivo test to confirm the ability of the integrin αvβ6-mouse IgG2a-Fc complex to remove anti-integrin αvβ6 antibodies from the blood in integrin αvβ6-immunized mice. As shown in FIG. 15, the absorbance (antibody titer) of the immunization + Fc complex administration group remained lower than that of the immunization group from Day 28 onwards, suggesting that administration of the integrin αvβ6-mouse IgG2a-Fc complex contributed to a decrease in anti-integrin αvβ6 antibodies in vivo.

[0117] Example 8 Preparation of Integrin αvβ6-MMAE Conjugate Preparation of Integrin αvβ6-MMAE Conjugate Monomethyl auristatin E (MMAE) was covalently bound to the thiol group of human integrin αvβ6 (IT6-H52E1, manufactured by ACROBiosystems) via a linker containing maleimide, caproyl spacer, valine, citrulline, and a p-aminobenzyloxycarbonyl group as components to prepare an integrin αvβ6-MMAE conjugate.

[0118] Example 9 Preparation of Integrin αvβ6-Anti-CD20 Antibody Conjugate (Preparation of Integrin αvβ6-Anti-CD20 Antibody Conjugate) The C-terminus of the αv extracellular domain of human integrin αvβ6 (IT6-H52E1, manufactured by ACROBiosystems) and the C-terminus of the heavy chain of the anti-CD20 antibody rituximab (MAB9575, manufactured by R&D Systems) were covalently linked using a flexible PEG linker (T3198, manufactured by Tokyo Chemical Industry Co., Ltd.) to construct an integrin αvβ6-anti-CD20 antibody conjugate.

Claims

1. An agent for damaging and / or removing cells expressing a B cell receptor (BCR), comprising a substance having a group that selectively binds to at least one selected from the group consisting of a BCR that recognizes an autoantigen and an antibody that recognizes the autoantigen, and a cytotoxic group.

2. The agent of claim 1, wherein the group that selectively binds to at least one selected from the group comprises an antigenic fragment or full-length of the autoantigen.

3. The agent of claim 1, wherein the cytotoxic group comprises at least one group selected from the group consisting of a cytotoxic drug group, an anti-CD3 antibody group, a B-cell inhibitory agent group, and a phagocytic marker group.

4. The agent according to claim 3, wherein the cytotoxic drug group is a group comprising at least one selected from the group consisting of monomethyl auristatin E (MMAE), deruxtecan, calicheamicin, MX-DTPA, emtansine, ozogamicin, camptothecin, saratarocan sodium, exatecan, mertansine, and SN-38; the B cell inhibitory group is a group comprising at least one selected from the group consisting of anti-CD20 antibodies, anti-CD19 antibodies, and B cell activating factor (BAFF) receptor inhibitors; and / or the phagocytosis marker group is a group comprising at least one selected from the group consisting of the Fc region of IgG, phosphatidylserine, and phosphatidylcholine.

5. The agent of claim 1, wherein the substance comprises a conjugate in which a group that selectively binds to the B cell receptor and / or the antibody is bound to the cytotoxic group directly or via a linking group.

6. The agent according to claim 5, wherein the group that selectively binds to the B cell receptor and / or the antibody is bound directly or via a linking group to at least one group selected from the group consisting of a cytotoxic drug group, an anti-CD3 antibody group, an anti-CD20 antibody group, and a phagocytosis marker group.

7. The agent according to claim 1, wherein the autoantigen is integrin αvβ6 protein.

8. A therapeutic agent for an autoimmune disease comprising the agent according to claim 1.

9. A pharmaceutical composition comprising the agent according to claim 8.

Images