Polymeric compounds and lipid compositions made using the same
Novel PEI derivatives synthesized via a split-Ugi reaction enhance mRNA delivery and transfection efficiency while reducing cytotoxicity, addressing the limitations of traditional PEI systems.
Patent Information
- Application Number
- PCT/US2025/032115
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-05
- Filing Date
- 2025-06-03
- Publication Date
- 2025-12-11
AI Technical Summary
Existing non-viral delivery systems for mRNA, such as poly(ethylene imine) (PEI), face a tradeoff between effective transfection and cytotoxicity due to high charge density, limiting their use in vivo.
Development of novel polymeric compounds through a split-Ugi reaction to modify PEI, creating a library of PEI derivatives with varied functional groups and molecular weights, forming hybrid polymer-lipid nanoparticles for enhanced mRNA delivery.
The modified PEI derivatives demonstrate a significant increase in in vivo mRNA delivery to target tissues, particularly the lungs, with improved transfection efficiency and reduced toxicity, enabling efficient gene editing.
Smart Images

Figure US2025032115_11122025_PF_FP_ABST
Abstract
Description
[0001]SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 POLYMERIC COMPOUNDS AND LIPID COMPOSITIONS MADE USING THE SAME CROSS REFERENCE TO RELATED APPLICATION This application claims the benefit of the earlier filing date of U.S. provisional patent application No.63 / 656,275, filed June 5, 2024, which is incorporated herein by reference in its entirety. INCORPORATION OF ELECTRONIC SEQUENCE LISTING The Sequence Listing is submitted as an XML file named “Sequence.xml,” created on May 13, 2025, 6,239 bytes, which is incorporated by reference herein. FIELD Disclosed herein are novel compounds, compositions comprising the compounds, and methods for making and using the compounds and compositions. BACKGROUND Rapid advances in mRNA gene therapy and vaccine development require investigation of safe and effective non-viral delivery systems to protect the mRNA molecules and facilitate their entry into target cells. These carriers need to protect the mRNA from degradation in the bloodstream, aid in its cellular uptake, and facilitate its escape from the endosome to allow the mRNA to be translated into functional proteins within the cells. Poly(ethylene imine) (PEI) has been well investigated as a cationic polymer for gene delivery applications. However, there is a tradeoff between effective transfection and cytotoxicity for higher molar mass PEIs, which limits its use in vivo. The high charge density of PEI is believed to lead to strong interactions with cellular membranes, which contributes to its cytotoxicity. However, the amine units of PEI are amenable to chemical modification. Indeed, chemical modifications or partial hydrolysis can serve to lower the charge density thus reducing toxic effects, and modulating polyplex properties, increasing transfection efficacy. For example, inclusion of hydrophobic groups onto polycations has been shown to strongly influence transfection, presumably due to strengthening self-assembly behavior of the polyplex and modulation of polyplex-cell interactions. For example, alkylation of primary amines in branched PEI with dodecyl chains was shown to improve transfection 5-fold while lowering toxicity. Modification of a low molecular weight PEI (1.8 kg mol-1) with various methylcarboxytrimethylene carbonate derivatives showed improved transfection for ethyl and SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 benzyl side chain substituents. It was found that moderate degrees of modification of branched PEI with propionic acid improved transfection, demonstrating the importance of a balance of hydrophobic moieties. A range of other promising modifications have been identified, including succination, acetylation, carbamoylation, as well as conjugation with dexamethasone, lipids, fluoroalkanes, and aromatic groups, inter alia. SUMMARY Disclosed here are aspects of a compound according to Formula I Y[-Z-Ao-X]y Formula I or a pharmaceutically acceptable salt thereof. With respect to Formula I, Y is H, C6-10aryl, 5-, 6- or 7-membered heteroaryl, or CH4-y, and y is an integer from 1 to 10, with the provisos that when Y is H, then y is 1, and when Y is CH4-y then y is 1, 2, 3, or 4, and wherein y indicated the number of - Z-Ao-X units that are each independently attached to the Y moiety. For each –[Z-Ao-X] unit independently, Z is C1-6alkyl, such as C1-4alkyl, and may be -CH2-, and X is OH, or -NH-C1-4alkyl-C6- In certain aspects, X is OH or - Additionally, or each –[Z-Ao-X] unit independently, o is an integer from 2 to 500. And each A independently is selected from is . Furthermore, each [-Z-Ao-X] unit independently contains from and from 0 to p D moieties, where m is an integer from 1 to o / 2, n is an integer from 1 to o / 2, and p is an integer from 0 to o-2, such that m + n + p = o. In some aspects, m and n are the same, but in other aspects they are different. And / or in some aspects, p is 0. With respect to moieties B, C and D, R1is H, C4-20alkyl, C6-15alkenyl with from 1 to 3 double bonds, C3-8cycloalkyl, or C6-10aryl; R2 is C4-20alkyl, C3-8cycloalkyl, -C1-4alkyl-C6-10aryl, -C1-4alkyl-N(Ra)2or -C1-4alkyl-C(O)OC1-4alkyl; and R3is C1-15alkyl, -C1-4alkyl-N(Ra)2, -C1-4alkyl-O-C1-6alkyl-O-C1-4alkyl, PEG500-PEG2k, PEtOx5-50, PMeOx5-50, poly(2-methyl-2-oxazine)5-50, poly(N- methylglycine)5-50, poly(dimethylmethacrylamide)5-50, poly(dimethylacrylamide)5-50, poly(N- SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 (2-hydroxypropyl)acrylamide)5-50, poly(N-(2-hydroxypropyl)methacrylamide)5-50, poly(N-(2- hydroxyethyl)acrylamide)5-50 or poly(N-(2-hydroxyethyl)methacrylamide)5-50. And in any aspects, each Raindependently is H or C1-6alkyl, or two Ratogether with the atom to which they are attached form a 3- to 8-membered heterocyclyl comprising 1, 2, or 3 heteroatoms independently selected from O, N or S and optionally substituted with 1, 2 or 3 C1-6alkyl; and Rbis H, -C(O)OH or -C(O)O(C1-6alkyl), such as -C(O)OMe, -C(O)OEt, - C(O)Oisopropyl or -C(O)Ot-butyl. In some aspects of Formula I, the compound has a structure according to Formula II and / or Formula III, or a pharmaceutically acceptable salt thereof . n + p is an integer between 2 and 500. In some aspects, Y is H and y is 1. In other aspects, Y is CH4-yand y is 1, 2, 3, or 4. And in further aspects, Y is phenyl and y is from 3-6. Also disclosed herein are aspects of a composition comprising one or more of the disclosed compounds. In some aspects, the composition is a nanoparticle, and may comprise an agent, such as a therapeutic agent. The agent may be a nucleic acid, small molecule drug, protein, polypeptide, antibody, peptide or a combination thereof. The nucleic acid may be a single stranded DNA, single stranded RNA, double-stranded DNA, RNA-RNA hybrid, DNA-RNA hybrid, shortmer, antagomir, antisense, ribozyme, small interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), or a combination thereof. In some aspects, the nucleic acid is mRNA. The composition may further comprise a phospholipid, a structural lipid, a polymer- conjugated lipid, or a combination thereof. In some aspects, the composition comprises a compound disclosed herein, mRNA, and lipids DSPG (1,2-Distearoyl-sn-glycero-3- phosphoglycerol), soy PC (L-α-phosphatidylcholine), cholesterol and DMG-PEG2000 lipids. Also is disclosed herein is a pharmaceutical composition comprising the composition disclosed herein, and a pharmaceutically acceptable excipient. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Further disclosed are aspects of a method for making a composition comprising a disclosed compound. The method may comprise combining a first solution comprising a disclosed compound with a second solution comprising a phospholipid, a structural lipid, a polymer- conjugated lipid, or a combination thereof. The first solution may further comprise an agent, such as a therapeutic agent. Also disclosed are aspects of a method for using the disclosed compound(s) or a composition comprising the compound(s). The method may comprise administering an effective amount of the composition to a subject, such as by an intravenous, intramuscular, or intradermal route. In some aspects, the method comprises administering the compound or composition comprising the compound to a subject’s lung and / or spleen tissue. The foregoing and other objects, features, and advantages of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1 is a schematic illustration for modification of PEI via the split-Ugi type reaction. FIG.2 provides an exemplary library of compounds useful for the split-Ugi type reaction. FIG.3 is a graph of retention volume versus RI response, illustrating the SEC chromatograms of a range of Ugi modified samples derived from the PEI35 backbone. FIG.4 is a heat map illustrating in vitro library screening of HeLa and Gal9-HEK cells treated with Fluc mRNA-loaded polyplexes. FIG.5 provides exemplary structures of U12, U 25, U40, U46, U64 and U100 polymers. Fig.6 provides in vivo screening results of grouped Fluc mRNA-loaded polyplexes, with representative IVIS images of BALB / c mice 5-6 hours following polyplexes administration. For the in vivo screening studies, results were obtained from two mice per group and each particles type in the group was injected at the dose of 10 μg Fluc mRNA / mouse. FIG.7 provides representatives images of Gal9-HEK293 cells after 24 hours incubation with mCherry RNA- loaded polyplexes from polymers of various chain length and modification. FIG.8 is a graph of Luminescence signal versus polymers’ length and modification variations, illustrating the relative luciferase expression (normalized to cell viability fluorescent signal) in HeLa cells treated with Fluc mRNA-loaded polyplexes after 24 hours incubation. FIG.9 provides the structure of an exemplary U155 Ugi modified PEI17. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 FIG.10 provides in vivo and ex vivo bioluminescent images of BALB / c mice 5-6 hours post I.V. injection of 5 μg Fluc mRNA per mouse. K- kidney, S – spleen, H – heart, LV – liver, LN – lungs. FIG.11 is a schematic diagram illustrating the formulation of lipopolymer nanoparticles (U155@lipid nanoparticles). FIG.12 is a graph of luminescence versus amount, illustrating DSPG content screening using primary trachea cells co-cultured with fibroblast and treated with U155@lipid nanoparticles with various soyPC / DSPG ratios and encapsulated Fluc mRNA. The relative luciferase expression (normalized to cell viability fluorescent signal) after 24 hours incubation with polyplexes is shown (2 biological replicates with 6 technical replicates). Fluc mRNA dose 200 ng per well. FIG.13 are in vivo bioluminescent images of BALB / c mice 5-6 h post I.V. injection of 2 μg Fluc mRNA per mouse encapsulated in U155@lipid nanoparticles with 22 mol % or 31.5 mol % DSPG. FIG.14 is a representative Cryo-TEM image of U155@lipid nanoparticles. Scale bar 50 nm. FIG.15 is a graph of total counts versus apparent zeta potential, illustrating the change in apparent zeta potential of U155 polyplexes and U155@lipid nanoparticles in 2.5 mM Tris-HCl buffer (pH 7.4). FIG.16 is a graph illustrating the normalized TNS fluorescence of nanoparticles at various pH. TNS interacts with positively charged amines and produces fluorescence signal. FIG.17 provides graphs illustrating encapsulation efficiency (EE) and recovery of mRNA after loading into U155@lipid nanoparticles (n=3) (left) and hydrodynamic diameter and PDI of produced nanoparticles in 25 mM Tris-HCl buffer (pH 7.4) (right). FIG.18 provides representative ex vivo bioluminescent images of BALB / c mice 5-6 hours post I.V. injection of 5 μg Fluc mRNA per mouse. K- kidney, S – spleen, H – heart, LV – liver, LN – lungs. FIG.19 is a graph of region of interest (ROI) versus mRNA dose, illustrating the in vivo dose response of Fluc mRNA transfection in lungs (BALB / c mice) 5-6 hours post I.V. injection. FIG.20 provides representative ex vivo images and quantification of bioluminescence in lungs 5-6 hours post I.V. injection of 10 μg Fluc mRNA per mouse. K- kidney, S – spleen, H – heart, LV – liver, LN – lungs. FIG.21 provides representative images and quantification of tissue biodistribution of DiD- labeled U155@lipid nanoparticles. K- kidney, S – spleen, H – heart, LV – liver, LN – lungs. Data SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 are presented as Mean ± SD; n = 3. S – spleen, LN – lungs. Results from controls groups were obtained from two mice per group and are presented as Mean ± SD. FIG.22 provides ex vivo images and quantification of bioluminescence in lungs and spleen 5-6 hours post i.v. injection of 5 μg Fluc mRNA (1 dose) per mouse before and after pre-treatment with blank nanoparticles (dose were adjusted by volume compared to loaded U155@lipid nanoparticles). S – spleen, LN – lungs. Results were obtained from two mice per group and are presented as Mean ± SD. FIG.23 provides representative images of paraffin-embedded lung sections 24 hours post i.v. injection of 5 μg Fluc mRNA per mouse, which were stained with H&E. Red dashed loops indicate cells infiltration and occurrence of possible micro-abscesses; scale bar 200 μm (left panel) and 20 μm (right panel). FIG.24 is a graph of nuclei number per tissue μm2versus formulation, illustrating the QuPath software quantification of the number of nuclei normalized to tissue area (n = 3 slides for PBS control and n= 8 slides for U155@lipid nanoparticles). FIG.25 are graphs providing serum cytokines concentrations for IL-1α, IL-1β, IL-6 and TNFα in lungs 24 hours post i.v. injection of 5 μg Fluc mRNA per mouse. FIG.26 provides graphs illustrating the quantification of tdTomato+ cells in the lungs in different cell types (tdTomato+ cells as a percentage of the overall population of each cell type). Data are presented as Means ± SD (n=3), (p<0.05). FIG.27 provides multiplexed immunohistochemistry (IHC) images from paraffin- embedded lung sections. Scale bar is 200 μm. FIG.28 provides representative images of paraffin-embedded lung sections, which were stained with H&E and antibodies for multiplex IHC. Scale bar is 200 μm. FIG.29 provides representative tissue images of liver stained with H&E and PAS-fast green. Black arrows show tissue damage. Scale bar is 200 μm. FIG.30 is a graph of percentage tdTom+ of total ROI area versus formulation, illustrating quantification of paraffin-embedded lung sections, which were stained with antibodies for multiplex IHC. FIG.31 is a graph of percentage reads containing indels versus formulation, illustrating the quantification of editing events in lungs by next-generation sequencing. Data are presented as Means ± SD (n=4-5 biological replicates). FIG.32 is a graph of retention volume versus RI response, illustrating the SEC chromatograms of PEtOx samples of varying molecular weights. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 FIG.33 is MALDI-ToF spectra of the PEtOx15 sample showing a narrow dispersity and expected chain end functionality. FIG.34 is a stacked1H NMR plot illustrating the1H NMR spectra in MeOD of PEI- exemplary compounds synthesized with varying quantities of the acid component. DESCRIPTION OF THE SEQUENCES The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and single letter code for amino acids, as defined in 37 C.F.R.1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing: SEQ ID No.1 is an example of an sgRNA sequence. SEQ ID Nos.2-4 are example PCR primers. DETAILED DESCRIPTION I. Terms The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. The singular forms “a,” “an,” and “the” refer to one or more than one, unless the context clearly dictates otherwise. The term “or” refers to a single element of stated alternative elements or a combination of two or more elements, unless the context clearly indicates otherwise. As used herein, “comprises” means “includes.” Thus, “comprising A or B,” means “including A, B, or A and B,” without excluding additional elements. All references, including patents and patent applications cited herein, are incorporated by reference. Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, percentages, temperatures, times, and so forth, as used in the specification or claims are to be understood as being modified by the term “about.” Accordingly, unless otherwise indicated, implicitly or explicitly, the numerical parameters set forth are approximations that may depend on the desired properties sought and / or limits of detection under standard test conditions / methods. When directly and explicitly distinguishing embodiments from discussed prior art, the embodiment numbers are not approximates unless the word “about” is expressly recited. Unless explained otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure pertains. Although methods and materials similar or equivalent to those described herein can be SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 used in the practice or testing of the present disclosure, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting. When chemical structures are depicted or described, unless explicitly stated otherwise, all carbons are assumed to include hydrogen so that each carbon conforms to a valence of four. For example, in the structure on the left-hand side of the schematic below there are nine hydrogen atoms implied. The nine hydrogen atoms are depicted in the right-hand structure. Sometimes a formula as having a hydrogen or hydrogen atoms, - . by a person of ordinary skill in the art that the aforementioned descriptive techniques are common in the chemical arts to provide brevity and simplicity to description of organic structures. If a group R is depicted as “floating” on a ring system, as for example in the group: then, unless otherwise defined, a on any atom of the fused bicyclic ringsystem, excluding the atom carrying the bond with the “ ” symbol, so long as a stable structureis formed. In the example depicted, the R group can on an atom in either the 5-membered or the 6-membered ring of the indolyl ring system. When there are more than one such depicted “floating” groups, as for example in the formulae: where there are to a parent structure; then, unless otherwise defined, the “floating” groups can reside on any atoms of the ring system, again assuming each replaces a depicted, implied, or expressly defined hydrogen on the ring system and a chemically stable compound would be formed by such an arrangement. When a group R is depicted as existing on a ring system containing saturated carbons, as for example in the formula: SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 where, in this example, y can each replaces a currently depicted, implied, or expressly then, unless otherwise defined, two R’s can reside on the same carbon. A simple example is when R is a methyl group. The depicted structure can exist as a geminal dimethyl on a carbon of the depicted ring (an “annular” carbon). In another example, two R’s on the same carbon, including that same carbon, can form a ring, thus creating a spirocyclic ring (a “spirocyclyl” group) structure. In any embodiments, any or all hydrogens present in the compound, or in a particular group or moiety within the compound, may be replaced by a deuterium or a tritium. Thus, a recitation of alkyl includes deuterated alkyl, where from one to the maximum number of hydrogens present may be replaced by deuterium. For example, ethyl may be C2H5 or C2H5 where from 1 to 5 hydrogens are replaced by deuterium, such as in C2DxH5-x. A person of ordinary skill in the art will appreciate that compounds may exhibit the phenomena of tautomerism, conformational isomerism, geometric isomerism, and / or optical isomerism. For example, certain disclosed compounds can include one or more chiral centers and / or double bonds and as a consequence can exist as stereoisomers, such as double-bond isomers (i.e., geometric isomers), enantiomers, diasteromers, and mixtures thereof, such as racemic mixtures. As another example, certain disclosed compounds can exist in several tautomeric forms, including the enol form, the keto form, and mixtures thereof. As the various compound names, formulae and compound drawings within the specification and claims can represent only one of the possible tautomeric, conformational isomeric, optical isomeric, or geometric isomeric forms, a person of ordinary skill in the art will appreciate that the disclosed compounds encompass any tautomeric, conformational isomeric, optical isomeric, and / or geometric isomeric forms of the compounds described herein, as well as mixtures of these various different isomeric forms. Any group or moiety defined herein can be connected to any other portion of a disclosed structure, such as a parent or core structure, as would be understood by a person of ordinary skill in the art, such as by considering valence rules, comparison to exemplary species, and / or considering functionality, unless the connectivity of the group or moiety to the other portion of the structure is expressly stated, or is implied by context. “Alkyl” refers to a saturated aliphatic hydrocarbyl group typically having from 1 to 25 (C1-25) or more carbon atoms, such as from 1 to 10 (C1-10) carbon atoms, from 1 to 6 (C1-6) carbon atoms, or from 2 to 22 (C2-22) carbon atoms or from 6 to 18 (C6-18) carbon atoms. An alkyl moiety may be substituted or unsubstituted. This term includes, by way of example, linear and branched SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 hydrocarbyl groups such as methyl (CH3), ethyl (-CH2CH3), n-propyl (-CH2CH2CH3), isopropyl (- CH(CH3)2), n-butyl (-CH2CH2CH2CH3), isobutyl (-CH2CH2(CH3)2), sec-butyl (- CH(CH3)(CH2CH3), t-butyl (-C(CH3)3), n-pentyl (-CH2CH2CH2CH2CH3), neopentyl (- CH2C(CH3)3), hexyl (C6H13), heptyl (C7H15), octyl (C8H17), decyl (C10H21), dodecyl (C12H25), tetradecyl (C14H29), hexadecyl (C16H33), octadecyl (C18H37) or eicosanyl (C20H41). “Alkenyl” refers to an unsaturated aliphatic hydrocarbyl group typically having from 2 to 25 (C2-25) or more carbon atoms, such as from 2 to 10 (C2-10) carbon atoms, from 2 to 6 (C2-6) carbon atoms, and at least one double bond, such as 1, 2, 3, or more double bonds. Unless otherwise stated, an alkenyl group may be substituted or unsubstituted. “Aryl” refers to an aromatic carbocyclic group of, unless specified otherwise, from 6 to 15 carbon atoms having a single ring (e.g., phenyl) or multiple condensed rings in which at least one ring is aromatic (e.g., 1,2,3,4-tetrahydroquinoline, benzodioxole, and the like) providing that the point of attachment is through an aromatic portion of the ring system. If any aromatic ring portion contains a heteroatom, the group is heteroaryl and not aryl. Aryl groups may be, for example, monocyclic, bicyclic, tricyclic or tetracyclic. Unless otherwise stated, an aryl group may be substituted or unsubstituted. “Cycloalkyl” refers to a saturated cyclic aliphatic hydrocarbyl group having from three to fifteen (C3-15) from three to ten (C3-10), from three to six (C3-6), or from three to four (C3-4) carbon atoms for a cycloalkyl group or moiety. Unless otherwise stated, a cycloalkyl group may be substituted or unsubstituted. “Heterocyclyl” refers to both aromatic and non-aromatic ring systems, and more specifically refer to a stable three- to fifteen-membered ring moiety comprising at least one carbon atom, and typically plural carbon atoms, and at least one, such as from one to five, heteroatoms. The heteroatom(s) may be nitrogen, oxygen, sulfur, phosphorus, or silicon atom(s), preferably nitrogen, oxygen, or sulfur atom(s). The heterocyclyl moiety may be a monocyclic moiety, or may comprise multiple rings, such as in a bicyclic or tricyclic ring system, provided that at least one of the rings contains a heteroatom. Such a multiple ring moiety can include fused or bridged ring systems as well as spirocyclic systems, and may include all aromatic, all non-aromatic, or both aromatic and non-aromatic rings. Also, any nitrogen, carbon, or sulfur atoms in the heterocyclyl moiety can be optionally oxidized to various oxidation states. For convenience, nitrogens, particularly, but not exclusively, those defined as annular aromatic nitrogens, are meant to include their corresponding N-oxide form, although not explicitly defined as such in a particular example. Thus, for a compound having, for example, a pyridinyl ring, the corresponding pyridinyl-N-oxide is included as another compound of the invention, unless expressly excluded or excluded by context. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 In addition, annular nitrogen atoms can be optionally quaternized. Unless otherwise stated, a heterocyclyl moiety may be substituted or unsubstituted. Heterocycle includes heteroaryl moieties, and non-aromatic heterocyclyl moieties, also called heterocycloaliphatic moieties, which may be partially or fully saturated rings. Examples of heterocyclyl groups include, but are not limited to, azetidinyl, oxetanyl, acridinyl, benzodioxolyl, benzodioxanyl, benzofuranyl, carbazoyl, cinnolinyl, dioxolanyl, indolizinyl, naphthyridinyl, perhydroazepinyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrazoyl, tetrahydroisoquinolyl, piperidinyl, piperazinyl, 2-oxopiperazinyl, 2- oxopiperidinyl, 2-oxopyrrolidinyl, 2-oxoazepinyl, azepinyl, pyrrolyl, 4-piperidonyl, pyrrolidinyl, pyrazolyl, pyrazolidinyl, imidazolyl, imidazolinyl, imidazolidinyl, dihydropyridinyl, tetrahydropyridinyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, oxazolyl, oxazolinyl, oxazolidinyl, triazolyl, isoxazolyl, isoxazolidinyl, morpholinyl, thiazolyl, thiazolinyl, thiazolidinyl, isothiazolyl, quinuclidinyl, isothiazolidinyl, indolyl, isoindolyl, indolinyl, isoindolinyl, octahydroindolyl, octahydroisoindolyl, quinolyl, isoquinolyl, decahydroisoquinolyl, benzimidazolyl, thiadiazolyl, benzopyranyl, benzothiazolyl, benzoxazolyl, furyl, diazabicycloheptane, diazapane, diazepine, tetrahydrofuryl, tetrahydropyranyl, thienyl, benzothieliyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiamorpholinyl sulfone, dioxaphospholanyl, and oxadiazolyl. “Lipid” refers to an organic compound that is readily soluble in nonpolar solvents such as hydrocarbons, but typically is sparingly or non-soluble in water, and may be poorly soluble in other polar solvents. Ionizable lipids are lipids that can be ionized, for example, with pH-dependent ionization. The lipid may be anionic and / or cationic, for example, it may form an anion and / or a cation depending on pH. In some aspects, an ionizable lipid may be positive at low pH, and may be substantially neutral at physiological or neutral pH. “Lipopolymer” refers to a polymer that is not a lipid but has parts that have lipid-like characteristics. Ionizable lipopolymer refers to a lipopolymer that can be ionized, for example, with pH-dependent ionization. The lipopolymer may be anionic and / or cationic, for example, it may form an anion and / or a cation depending on pH. In some aspects, an ionizable lipopolymer may be positive at low pH, and may be substantially neutral at physiological or neutral pH. “Nanoparticle” as used herein refers to a composition, such as a pharmaceutical formulation, having a particle size (for example, a diameter) of from 1 to 1000 nanometers, such as from 1 to 500 nanometers or from 1 to 100 nanometers, and incorporating one or more lipopolymer compounds disclosed herein. Nanoparticle compositions include, but are not limited to, lipopolymer nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 “Lipopolymer nanoparticle” (LNP) refers to a nanoparticle comprising one or more lipopolymer compounds such as the compounds disclosed herein. Typically, the lipopolymer compound(s) will be a major component of the nanoparticle. LNPs may be substantially spherical in shape. Disclosed LNPs may be positively charged in low pH and substantially neutral at physiological pH. Alternatively, the LNP may be uncharged, even if the lipopolymers themselves are charged. In some aspects, the ionizable lipopolymer is contained in the core and its charge may be shielded by other components. “Nucleic acid” refers to a polynucleotide molecule. The polynucleotide may be a naturally occurring polynucleotide or a synthetic polynucleotide. A nucleic acid may be a DNA, RNA or mixture of DNA and RNA nucleotides. Typically, the nucleic acid contains from 20 to 10,000 nucleotides or more, such as from 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, or 5000 nucleotides to 10,000 nucleotides. Exemplary nucleic acids include, but are not limited to, single stranded DNA, single stranded RNA, double stranded DNA, RNA-RNA hybrid, DNA-RNA hybrid, shortmer, antagomir, antisense, ribozyme, small interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), or a combination thereof. “Peptide” refers to a compound comprising amino acid residues connected by peptide bonds. Typically, a peptide compound has from 2 to about 50 amino acid residues. “Polypeptide” refers to a compound comprising amino acid residues connected by peptide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used. In some aspects, a polypeptide has from about 50 amino acid residues to 2000 or more amino acid residues. “Protein” refers to a molecule or complex comprising one or more polypeptides having secondary, tertiary and / or quaternary structure. The secondary, tertiary and / or quaternary structure of a protein typically is stabilized using non-covalent bonds, such as ionic bonds, hydrogen bonds, hydrophobic interactions, and / or van der Walls interactions. Additionally, or alternatively, a protein may include disulfide bonds, such as between the thiol groups of cysteine residues. “Small Molecule” refers to an organic molecule having a molecular weight of about 2000 Daltons or less. In some aspects, the term “small molecule” refers to a compound that is not a polypeptide, protein, or nucleic acid molecule. A small molecule may be a small molecule therapeutic and / or prophylactic, such as an antibiotic, anti-inflammatory, anticancer, antiviral, immunosuppressant, analgesic, antifungal, antiparasitic, anticonvulsants, antidepressant, anti- anxiety, anti-psychotic, and the like. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 “Patient” or “Subject” refers to mammals and other animals, particularly humans. Thus disclosed methods are applicable to both human therapy and veterinary applications. “Pharmaceutically acceptable excipient” refers to a substantially physiologically inert substance that is used as an additive in a pharmaceutical composition. As used herein, an excipient may be incorporated within particles of a pharmaceutical composition, or it may be physically mixed with particles of a pharmaceutical composition. An excipient can be used, for example, as a carrier, flavoring, thickener, diluent, buffer, preservative, or surface active agent and / or to modify properties of a pharmaceutical composition. Examples of excipients include, but are not limited, to polyvinylpyrrolidone (PVP), tocopheryl polyethylene glycol 1000 succinate (also known as vitamin E TPGS, or TPGS), dipalmitoyl phosphatidyl choline (DPPC), trehalose, sodium bicarbonate, glycine, sodium citrate, and lactose. “Pharmaceutically acceptable salt” refers to pharmaceutically acceptable salts of a compound that are derived from a variety of organic and inorganic counter ions as will be known to a person of ordinary skill in the art and typically include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, and the like. In particular, the disclosed compounds may form salts with a variety of pharmaceutically acceptable acids, including, without limitation, inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as organic acids such as formic acid, acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, benzene sulfonic acid, isethionic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like. (See, for example, S. M. Berge, et al., “Pharmaceutical Salts,” J. Pharm. Sci., 1977; 66:1-19 which is incorporated herein by reference.) “Effective amount” with respect to a compound or composition refer to an amount of the compound or composition sufficient to achieve a particular desired result, such as to elicit a desired biological or medical response in a tissue, system, subject or patient; to treat a specified disorder or disease; to ameliorate or eradicate one or more of its symptoms; and / or to prevent the occurrence of the disease or disorder. The amount of a compound which constitutes an “effective amount” may vary depending on the compound, the desired result, the disease state and its severity, the age of the patient to be treated, and the like. As used herein with respect to the formulas and structures, term ‘random’ indicates that the ‘B’, ‘C’, and ‘D’ moieties in Formula II, and the corresponding structures in other formulas and SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 compounds, are randomly distributed between the brackets. For example, in a moiety –[Bm-Cn-Dp]- where m, n and p are all 2, the moiety may be -[BCDBCD]-, -[BDCBCD]-, -[BCBDDC]-, -[CDBDBC]-, -[CCBDBD]-, -[DBCCBD]-, -[BBCCDD]-, -[BBCDDC]-, etc. That is, the structure between the brackets is not required to be all of the ‘B’s followed by all of the ‘C’s and then all of the ‘D’s. Nor is the structure required to be repeating units of ‘BCD’. However, examples of these types may exist within the scope of a random distribution of the B, C and D moieties, and are therefore not excluded by the term ‘random’, unless expressly excluded. II. Overview In the search for alternative non-viral vectors, multicomponent reactions have been utilized to access a diverse structural space. Multicomponent reactions involve at least three reagents and are highly suitable for preparation of combinatorial libraries, where many compounds can be prepared from a relatively small number of starting reagents. This is particularly true for polymers, where in addition to the chemical structure, variations of the polymer molecular weight, dispersity, architecture, and comonomer ratios can be simultaneously explored, rapidly leading to a vast number of possibilities. Such approaches have been studied in the synthesis of cationic polymers, particularly in the preparation of poly(β-aminoesters) combinatorial libraries, where in a recent report a highly effective poly(β-aminothioester) for gene delivery to the lungs was identified. The multicomponent polymerization of a dithiol, diamine and formaldehyde was also used to prepare a library of cationic polymers which displayed lowered toxicity compared to a standard PEI (25 kg mol-1). The Ugi multicomponent reaction is one of best known and versatile multicomponent reactions and utilizes four different reagents - an amine, aldehyde, isocyanide and carboxylic acid reagent, and has been utilized in polymer science as a step growth polymerization reaction, a post- polymerization modification tool and as a polymer coupling reaction. Herein is disclosed a use of a particular variant of the Ugi reaction, the so-called split-Ugi, to synthesize novel linear PEI derivatives optimized for delivery of an agent, such as a nucleic acid agent, for example, RNA transfection. The secondary amine units of linear PEI can only be utilized by this variant of the Ugi reaction, effectively involving two equivalents of secondary amine as opposed to one equivalent of a primary amine in the standard Ugi reaction. The split-Ugi modification is expected to yield a product with two modified repeat units, one a tertiary amine with a side chain containing the isocyanide and aldehyde substituents, and the other an amide group modified with the carboxylic acid R group (FIG.1). This introduces a convenient route to prepare novel PEI derivative libraries SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 with a mixture of large variety of functional groups to explore the effect of polymeric structure on transfection efficiency. A library of isocyanide / aldehyde / carboxylic acid reagents were selected to create a range of structures, and additionally molecular weights and modification densities of the PEIs samples were varied to further increase structural diversity (FIG.2). Having identified the lead structure through initial screening and developed hybrid polymer-lipid nanoparticles, gene delivery using this system was investigated. The results demonstrated a multiple order increase of in vivo mRNA delivery to the lungs via systemic administration compared to the gold standard in vivo-JetPEI^. Importantly, the disclosed delivery system showed efficient gene editing in lungs endothelial and T cells by delivery of Cre mRNA and CRISPR-Cas9 mRNA / guide RNA system. Research for this invention was supported by awards from the Cystic Fibrosis Foundation. III. Compounds Disclosed herein are aspects of a compound according to Formula I Y[-Z-Ao-X]y Formula I or a pharmaceutically acceptable salt thereof. With respect to Formula I, Y is H; C6-10aryl; 5-, 6- or 7-membered heteroaryl; or CH4-y where y is from 1 to 4. In certain aspects, Y is H. In other certain aspects, Y is phenyl. y is an integer from 1 to 10, such as from 1 to 6, with the provisos that when Y is H, then y is 1, and when Y is CH4-y then y is 1, 2, 3, or 4, and wherein y indicated the number of -Z-Ao-X units that are each independently directly attached to the Y moiety through their -Z- moieties. That is, the Z moiety on each separate -Z-Ao-X unit attaches directly to Y and not to an X moiety from another -Z-Ao-X unit. In some aspects when Y is C6-10aryl, or 5-, 6- or 7-membered heteroaryl then y is 1. In certain other aspects when Y is C6-10aryl 5-, 6- or 7-membered a heteroaryl, then y is from 2 to 6, such as from 3-6. For each [Z-Ao-X] unit independently: Z is C1-6alkyl such as C1-4alkyl. In some aspects, Z is -CH2-. X is OH, or -NH-C1-4alkyl-C6- In some aspects, X is OH, or -NHCH2Ph. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 o is an integer from 2 to 500. In some aspects, o is an integer from 2-100, such as from 5- 50 or from 10-25. Each A independently is selected from moieties B, C or D, wherein: n C moieties and from 0 to p from 1 to o / 2, p is an integer from 0 to 480 (that is from 0 to o-2), such that m + n + p = o. For example, if o is from 2-100 then p is from 0-98, if o is from 5-50 then p is from 0-48, and if o is from 10-25 then p is from 0 to 23, such that m + n + p = o. In some aspects, m and n are the same, but in other aspects, m and n are different. In some aspects, p is 0 and m + n = o. In some aspects where y is greater than 1, each [Z-Ao-X] unit is the same with respect to Z, X, and the number and nature of B, C and D, although the arrangement of B, C and D may vary within each [Z-Ao-X] unit. However, in other aspects where y is greater than 1, Z, X, and / or the number and / or nature of B, C and D may vary between different [Z-Ao-X] units. R1 is H, C4-20alkyl, C6-15alkenyl with from 1 to 3 double bonds, C3-8cycloalkyl, or C6-10aryl. In some aspects, R1 is H, C4-15alkyl, C6-12alkenyl with from 1 to 3 double bonds, C5-8cycloalkyl, or C6aryl, such as H, C5-12alkyl, C8-12alkenyl with from 1 to 2 double bonds, C5-6cycloalkyl, or C6aryl. In certain aspects, R1 is H, C5-12alkyl, C8-10alkenyl with from 2 double bonds, C6cycloalkyl, or C6aryl. R2is C4-20alkyl, C3-8cycloalkyl, -C1-4alkyl-C6-10aryl, -C1-4alkyl-N(Ra)2or -C1-4alkyl- C(O)OC1-4alkyl. In some aspects, R2 is C4-15alkyl, C5-8cycloalkyl, -C1-2alkyl-C6-10aryl, -C1-4alkyl- N(Ra)2or -C1-2alkyl-C(O)OC1-4alkyl, such as C8-12alkyl, C5-6cycloalkyl, -C1-2alkyl-C6aryl, -C2-4alkyl-N(Ra)2 or -C1-2alkyl-C(O)OC1-4alkyl. And in certain aspects of R2, N(Ra)2 is a 3- to 8- membered heterocyclyl comprising 1, 2, or 3 heteroatoms independently selected from O, N or S and optionally substituted with 1, 2 or 3 C1-6alkyl, such as a 6-membered heterocyclyl comprising N and optionally a further heteroatom selected from N or O and optionally substituted with 1, 2 or 3 C1-4alkyl. In certain aspects, N(Ra)2 is morpholinyl or piperidinyl. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 R3is C1-15alkyl, -C1-4alkyl-N(Ra)2, -C1-4alkyl-O-C1-6alkyl-O-C1-4alkyl, polyethylene glycolcontaining from 500 to 2,000 ethylene oxide moieties ( where w is 500 to 2,000;PEG500-PEG2k), poly(2-ethyl-2-oxazoline)5-50 (PEtOx5-where w is 5-50), W w poly(2-methyl-2-oxazoline)5-50 (PMeOx5- where w is 5-50), poly(2-methyl-2-oxazine) , poly(N-methylglycine) each R’ independentlyis H, -C1-6alkyl, or -C1- poly where w is 5-50), poly(dimethylmethacrylamide) , poly(N-(2-hydroxypropyl) , poly(N-(2-hydroxypropyl) , SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025poly(N-(2-hydroxyethyl)methacrylamide) or poly(N-(2-hydroxyethyl)acrylamide) .W is H, C1-6alkyl (for butyl, tert-butyl, iso-butyl, etc.), C2-4alkenyl, C2-4alkynyl (for , or . PEG500-PEG1500, PEtOx5-50, PMeOx5-50,poly(2-methyl-2-oxazine)5-50, poly(N-methylglycine)5-50, poly(dimethylacrylamide)5-50, poly(dimethylmethacrylamide)5-50, poly(N-(2- hydroxypropyl)acrylamide)5-50, poly(N-(2-hydroxypropyl)methacrylamide)5-50, poly(N-(2- hydroxyethyl)acrylamide)5-50 or poly(N-(2-hydroxyethyl)methacrylamide)5-50. In some aspects, R3is C1-10alkyl, -C2-4alkyl-N(Ra)2, or -C1-2alkyl-O-C2-4alkyl-O-C1-2alkyl. And in other aspects, R3is PEG750-PEG1250, PEtOx5-50, PMeOx5-50, poly(2-methyl-2-oxazine)5-50, poly(N-methylglycine)5- 50, poly(dimethylacrylamide)5-50, poly(dimethylmethacrylamide)5-50, poly(N-(2- hydroxypropyl)acrylamide)5-50, poly(N-(2-hydroxypropyl)methacrylamide)5-50, poly(N-(2- hydroxyethyl)acrylamide)5-50 or poly(N-(2-hydroxyethyl)methacrylamide)5-50. Each Raindependently is H or C1-6alkyl, or two Ratogether with the atom to which they are attached form a 3- to 8-membered heterocyclyl comprising 1, 2, or 3 heteroatoms independently selected from O, N or S and optionally substituted with 1, 2 or 3 C1-6alkyl. In some aspects, each Raindependently is H or C1-6alkyl, such as C1-4alkyl, and may be methyl or ethyl. In other aspects, two Ratogether with the atom to which they are attached form a 3- to 8- membered heterocyclyl comprising 1, 2, or 3 heteroatoms independently selected from O, N or S and optionally substituted with 1, 2 or 3 C1-6alkyl, such as a 6-membered heterocyclyl comprising N and optionally a further heteroatom selected from N or O and optionally substituted with 1, 2 or 3 C1-6alkyl and / or -C(O)OC1-6alkyl, and may be morpholinyl, piperidinyl, or N-methyl piperazinyl. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Rbis H, -C(O)OH or -C(O)O(C1-6alkyl), such as -C(O)OMe, -C(O)OEt, -C(O)Oisopropyl or -C(O)Ot-butyl. , In some aspects, Y is C6-10aryl and y is 1, and in certain aspects, Y is phenyl, Z is -CH2- and y is 1. In some aspects, Y is C6-10aryl, such as phenyl, and y is from 3 to 6. In a particular aspect, y is 4. In some aspects, the compound has a structure according to Formulas II or III SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 or a pharmaceutically acceptable salt thereof. With respect to Formulas II or III, B, C, D, Y, R1, R2, R3, X and y are as previously defined for Formula I, and m, n and p are selected such that m + n + p is an integer between 2 and 500, as previously defined for m, n, p and o in Formula I. In some aspects, Y-C1-4alkyl- is Y-CH2-. With respect to the formulas and structures disclosed herein, term ‘random’ indicates that the ‘B’, ‘C’, and ‘D’ moieties in Formula II (and the corresponding structures in other formulas) are randomly distributed between the brackets. (This conforms with Formula I, where each A in the Ao moiety is independently selected from the B, C or D moieties.) That is, the structure between the brackets is not required to be all of the ‘B’s followed by all of the ‘C’s and then all of the ‘D’s. Nor is the structure required to be repeating units of ‘BCD’. However, examples of these types may exist within the scope of a random distribution of the B, C and D moieties, and are therefore not excluded by the term ‘random’, unless expressly excluded by other claim limitations. In certain aspects, the [Bm-Cn-Dp] moiety does not consist of repeating units of BCD. In certain aspects, the [Bm-Cn-Dp] moiety is not [(all ‘B’s)–(all ‘C’s)–(all ‘D’s)]. In some aspects of Formulas I, II and III the compound has a structure according to one of Formulas IV, V or VI. 1- With respect to Formulas IV, V and VI, R1, R2, R3, and X are as previously defined for Formulas I, II and III, and m, n and p are selected such that m + n + p is an integer between 2 and 500, as previously defined for Formulas I, II and III. In some aspects of Formulas IV, V and VI, the -C1- 4alkyl- moiety is -CH2-. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 In some aspects, the compound has a structure according to one or the following formulas, or a pharmaceutically acceptable salt thereof. . 2 to 500 as previously defined for Formula I. Certain exemplary compounds are shown below. However, it is understood that the arrangement of the various B, C and D moieties shown below is for example only, and within any structure, the various B, C and D moieties may be arranged in any order. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 , IV. Synthesis The disclosed compounds were synthesized using a split-Ugi reaction. In some aspects, a linear poly(ethyleneimine) (PEI) is treated with an aldehyde, an acid and an isocyanide in a suitable solvent to facilitate the reaction. In some aspects, the solvent is water, an alcohol (for example, methanol, ethanol, propanol, isopropanol, etc.), or a mixture of water and the alcohol. In some aspects, the solvent is a water / alcohol mixture having a ratio of water:alcohol of from 1:1 to 1:20, such as from 1:5 to 1:15, from 1:7 to 1:12, and in certain aspects, the mixture has a ratio of 1:9 water:alcohol. In some aspects, the reactants are provided in relative amounts selected to provide a compound as disclosed herein having the desired level of modification, for example, 25%, 50% or 100% modification. For example, to produce a 25% target modification, in some aspects, 0.125 eq. aldehyde, 0.125 eq. isocyanide with respect to the secondary amine unit of PEI, and 1 eq. carboxylic acid are used. For a 50% target modification, 0.25 eq. aldehyde, 0.25 eq. isocyanide, and 1 eq. carboxylic acid are used. And for a 100% target modification, 0.5 eq. aldehyde, 0.5 eq. isocyanide, and 1 eq. carboxylic acid are used. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 V. Applications The disclosed compounds are useful for facilitating the delivery of molecules, such as nucleic acids, peptides, polypeptides, and / or small molecules, into cells, enabling numerous applications in research and clinical settings. Unlike currently known ionizable lipids, which have a strong avidity to be taken up by the liver, the disclosed lipopolymer compounds primarily transfect in the lung. The ability to achieve targeted transfection in specific organs holds immense potential for various applications, such as gene therapy and targeted drug delivery. In some aspects, the disclosed compounds are useful to make lipopolymer nanoparticle compositions that are useful for delivering molecules, such as therapeutic or prophylactic agents. Lipopolymer nanoparticle (LNP) compositions may include one or more lipopolymer components, such as the disclosed compounds, and one or more agents, such as a nucleic acid molecule, that may be associated and / or encapsulated by the lipopolymer components. A nanoparticle composition may be designed for one or more specific applications, targets, and / or diseases. The elements of the nanoparticle composition may be selected based on a particular application or target and / or based on the efficacy, toxicity, expense, ease of use, availability, synthetic pathways, or other properties. In some aspects, the nanoparticles comprise five components (although any component may be a mixture of components, for example, the phospholipid may be a mixture of phospholipids): 1) an agent, such as a nucleic acid (e.g., mRNA), 2) a PEI compounds disclosed herein, 3) phospholipid, 4) structural lipid, and 5) polymer-conjugated lipid. Exemplary phospholipids, structural lipids, and polymer-conjugated lipids suitable for use in the disclosed nanoparticle compositions are disclosed herein. The chemical structures and quantities of the constituents may influence gene delivery efficacy, particle stability, and toxicity to the cells, and may be adjusted depending on the applications or targets. In general, the quantities of the components may be described by the molar ratios between the comprising components. A. Nanoparticle Preparation Various mixing methods and protocols may be used to produce the formulations. Specifically, lipopolymer nanoparticles can be made by any suitable mixing processes such as, but not limited to, pipet mixing, syringe mixing, T-junction mixing, or microfluidic mixing of two or more solutions and / or suspensions, one of which contains one or more nucleic acids and the other has lipid and / or lipopolymer components. Additional chemical compounds may be introduced in either or both of the fluid volumes or streams depending on their solubility. In certain aspects, the nucleic acid solution includes an aqueous buffer, such as a citrate or acetate buffer, typically 5-100 mM, to maintain the solution at acidic pH, such as at a pH of from less than 7, for example, 2, 3, 4, SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 5, or 6. In certain aspects, the lipids and / or lipopolymer compounds are dissolved in alcohol, such as ethanol. The volumes of the fluids, the flow rate of the fluid streams, may be adjusted or optimized depending on the amount of the agent, such as a nucleic acid, target nanoparticle size, polydispersity, encapsulation efficiency, and other features. A volumetric ratio between nucleic acid solution and lipid and / or lipopolymer solution may vary from about 1:1 to 20:1, such as 2: 1, 3:1.5:1, 10:1, 15:1, 20:1 or as necessary. In some aspects, the total flow rate may be from about 5 ml / min to 50 ml / min. The lipid solution contains different components including ionizable lipopolymers, phospholipids, structural lipids and polymer conjugated lipids. The amount of ionizable lipopolymer used in the lipopolymer nanoparticle (LNP) formulation ranges from 20 mol% or less to 100 mol% of the total amount of lipopolymer(s) and lipids in the nanoparticle, such as from 20% w / w or less to 100% w / w ratio of nucleic acid to be encapsulated. In certain aspects, after addition, the mixture is isolated, or purified from unincorporated components. The LNPs may be directly buffer exchanged by using physiological buffer at a 1:1 to 1:10 v / v dilution ratio or they can be dialyzed once or multiple times at 4 ºC or room temperature, if needed, using neutral (pH 7.4) buffers such as phosphate-buffered saline, tris-HCl or HEPES. After the purification is complete, the nanoparticles may be concentrated, for example, in a centrifuge. Phospholipids Typically, the amount of phospholipid used in the lipopolymer nanoparticle is from 0 to 30 45 mol% of the total lipids and lipopolymers, such as from greater than zero to 45 mol%. The phospholipid may be any phospholipid suitable to form the nanoparticles, such as, but not limited to, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC),1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn- glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2- dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn- glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1- glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1- stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), L-α-phosphatidylcholine (Soy-PC), 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium salt) (DSPG), or a combination thereof. Structural lipids The amount of structural lipid used is from 0 to 50 mol% of the total amount of lipids and lipopolymers, such as from greater than zero to 50 mol%. The structural lipid used is any suitable structural lipid, such as, but not limited to, cholesterol, beta-sitosterol, cholestanol, fucosterol, campesterol, stigmastanol, brassicasterol, ergosterol or stigmasterol. Polymer-conjugated lipids The amount of polymer-conjugated lipid (PEG-lipid) used is from 0 to 10 mol% of the total amount of lipids and lipopolymers, such as from greater than zero to 10 mol%. The PEG lipid is any suitable PEG lipid, such as, but not limited to, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified phosphoethanolamine, PEG-modified ceramides (PEG-CER), PEG-modified dialkylamines, PEG-modified diacylglycerols (PEG-DAG), PEG- modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be14:0 PEG2000 PE, PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, a PEG-DSPE lipid or PEG-lipid derivatives, such as, but not limited to that contain carboxylic acid, maleimide, amine, azides, thiols or active esters at the PEG terminal. The molecular weight of PEG-lipid ranges from 200-40,000 daltons or more. In a particular aspect, DMG-PEG2000 was used. B. Properties The mean size of a nanoparticle composition may be from 10’s of nm to 100’s of nm. In some aspects, the nanoparticle composition have an average diameter of from 50 nm to 200 nm, SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 such as from 75 nm to 175 nm, as determined by dynamic light scattering. For non-spherical nanoparticles, the diameter is determined as the largest (longest) dimension of the nanoparticle. Formulations of 200 nm or less typically are relevant to physical and biochemical targeting through intravenous injections. Nanoparticles larger than 200 nm often activate the complement system and so are rapidly eliminated from systemic circulation. A nanoparticle composition disclosed herein may be relatively homogenous as indicated by a polydispersity index (PDI) which may vary from 0 to 1, such as from greater than zero to 0.7, from greater than zero to 0.5, from greater than zero to 0.4, from greater than zero to 0.3, or from greater than zero to 0.2. A lower PDI indicates a narrower particle size distribution which may be preferrable in some aspects. In certain aspects, the nanoparticle composition has a PDI of from greater than zero to 0.3 or from greater than zero to 0.2. The PDI of the disclosed formulations is determined by dynamic light scattering. Zeta potential of a composition may be used to indicate electrokinetic potentials of the composition. For example, the zeta potential may describe the surface charge of a composition and can indicate whether the particle is anionic, cationic, or neutral. In some aspects, the polyplexes disclosed herein were positively charged to neutral and had a positive zeta potential (positive charge), such as a zeta potential of from greater than zero to 65 mV, or from 20 mV to 60 mV. And in some aspects, the formulations, such as nanoparticles comprising the lipopolymer compounds disclosed herein were positively charged to neutral and had a zeta potential of +20 mV or less, such as from less than +20 mV to 0 mV (neutral charge). In some aspects, the disclosed formulations exhibited high encapsulation efficiency of nucleic acids such as mRNA. In some aspects, the encapsulation efficiency of the disclosed formulations is greater than 80%, such as 85% or more, or 90% or more. Nucleic acid encapsulation efficiency is determined using Quant-iT RiboGreen RNA assay or different fluorescent based assay. C. Agent cargo The agent present in the nanoparticle may be a nucleic acid, small molecule drug, protein, polypeptide, antibody, peptide or a combination thereof. The nucleic acid maybe any type of nucleic acid. The nucleic acid may be described as a therapeutic and / or prophylactic nucleic acid. Nucleic acid can be any single stranded DNA or RNA, either double-stranded DNA or the RNA- RNA or DNA-RNA hybrids; shortmers, antagomirs, antisense, ribozymes, small interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 mixtures thereof. In certain aspects, the nucleic acid is a plasmid DNA (pDNA), genomic DNA (gDNA), complementary DNA (cDNA), antisense DNA, chloroplast DNA (ctDNA or cpDNA), microsatellite DNA, mitochondrial DNA (mtDNA or mDNA), kinetoplast DNA (kDNA), provirus, lysogen, repetitive DNA, satellite DNA, viral DNA, circular RNA (circRNA), precursor messenger RNA (pre-mRNA), microRNA (miRNA), guide RNA (gRNA), antisense RNA (asRNA), heterogeneous nuclear RNA (hnRNA), coding RNA, non-coding RNA (ncRNA), long non-coding RNA (long ncRNA or lncRNA), satellite RNA, viral satellite RNA, signal recognition particle RNA, small cytoplasmic RNA, small nuclear RNA (snRNA), ribosomal RNA (rRNA), Piwi- interacting RNA (piRNA), polyinosinic acid, ribozyme, flexizyme, small nucleolar RNA (snoRNA), spliced leader RNA, viral RNA, viral satellite RNA, or a combination thereof. Double-stranded DNA may include, but are not limited to, genes of interest for protein production (antigen protein), genome editing component (such as Cas9 and prime editors), and mobile genetic elements. Double-stranded RNA may include, but are not limited to, small- interfering RNA (siRNA) and other RNA-interference (RNAi) molecules. And single-stranded nucleic acids include, but are not limited to, messenger RNA, antisense oligonucleotides (ASO), and microRNA (miRNA). Examples of messenger RNA suitable for use in the disclosed lipopolymer nanoparticles include, but are not limited to, Firefly luciferase (Fluc), Nanoluciferase (Nluc), Green Fluorescent Protein (GFP), Cre recombinase, Transposase, Cas9 endonuclease, Cas13 endonuclease, Prime editor, Base editor, Spike protein of SARS-CoV-2, Human soluble angiotensin-converting enzyme 2 (ACE2), Human erythropoietin (EPO), Human alpha-galactosidase, Human Factor IX (FIX), Human Factor XI (FXI), Human cystic fibrosis transmembrane conductance regulator (CFTR), Human epithelial sodium channel (ENaC), Human interleukins (ILs), Human Bone Morphogenic Factor (BMP), Human Growth Factors (HGFs), Growth Differentiation Factor (GDF), Human transcription factor EB (TFEB), or a combination thereof. The nucleic acid optionally may have one or more modifications that confer stability to the nucleic acid (e.g., compared to a wild-type or native version of the nucleic acid), one or more modification that reduce side-effect of nucleic acid, and / or may also comprise one or more modifications relative to the wild-type which correct a defect implicated in the disease-associated, aberrant expression of the protein. The weight ratio between ionizable lipopolymer and nucleic acid may vary from about 1:1 to about 30:1, such as 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. This ratio may include every charged group in a molecule. Similarly, the wt / wt ratio of total lipid / lipopolymer component to a therapeutic and / or prophylactic SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 nucleic acid may be from about 2:1 to about 60:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. VI. In vivo transfection In some aspects, the effectiveness of a particular lipopolymer nanoparticle may be measured by any suitable metric, such as, but not limited to, polypeptide or protein translation (indicated by polypeptide or protein expression). The various amounts of nanoparticles and / or associated nucleic acid introduced may produce various levels of polypeptide or protein expression depending on the dose (the amount of the nanoparticle and / or associated nucleic acid introduced to the cells). Additionally, a lipopolymer nanoparticle composition and / or associated nucleic acid may induce cytotoxicity, or noticeable extent of cell injury and death upon exposure to the nanoparticle and / or associated nucleic acid. In some aspects, a desirable cell viability is at least 50%. In some aspects, polyplexes are formed from the disclosed compounds and nucleic acid molecules, such as mRNA. Cells are treated with the polyplexes and cell viability and luciferase expression data are collected post-treatment. VII. In vivo studies To evaluate how effectively various lipopolymer nanoparticle compositions deliver therapeutic and / or prophylactic nucleic acids to target cells, different nanoparticle compositions are prepared and administered to rodents. In certain aspects, mice receive a single dose of LNPs via intravenous, intramuscular, intradermal, or other administration routes. Dose sizes usually range from 0.05 mg / kg to 10 mg / kg or more, where 10 mg / kg describes a dose including 10 mg of a nucleic acid in a nanoparticle for each 1 kg of body mass of the mouse. Upon administration of lipopolymer nanoparticle compositions to mice, dose delivery profiles and dose responses are measured by bioluminescence imaging. VIII. Methods of Using the Composition Nanoparticles comprising one or more of the disclosed compounds may be used to deliver a desired nucleic acid to a subject, such as a human or animal subject. The amount of the lipopolymer nanoparticle administered to the subject can be determined by a person of ordinary skill in the art and may depend on the amount of the nucleic acid to be delivered and the ratio of nucleic acid to lipid / lipopolymer, as described herein. The exact amount of a compound required to achieve an effective amount will vary from subject to subject, depending, for example, on SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 species, age, and general condition of a subject, severity of the side effects or disorder, identity of the particular compound, mode of administration, and the like. In some aspects, an effective amount is included in a single dose (e.g., single oral dose) or multiple doses (e.g., multiple oral doses). In certain aspects, when multiple doses are administered to a subject or applied to a tissue or cell, any two doses of the multiple doses include different or substantially the same amounts of a compound described herein. In certain aspects, when multiple doses are administered to a subject or applied to a tissue or cell, the frequency of administering the multiple doses to the subject or applying the multiple doses to the tissue or cell is three doses a day, two doses a day, one dose a day, one dose every other day, one dose every third day, one dose every week, one dose every two weeks, one dose every three weeks, or one dose every four weeks. Dose sizes may range from 0.05 mg / kg to 10 mg / kg or more, where 10 mg / kg describes a dose including 10 mg of a nucleic acid in a nanoparticle for each 1 kg of body mass of the subject. Exemplary administration routes include any route suitable to administer the nanoparticle to subject, such as intravenous, intramuscular, intradermal, subcutaneous, intravitreous, subretinal, inhalation or a combination thereof. The nanoparticles are provided in physiological buffers, for example, phosphate buffered saline (PBS), and Hank’s balanced salt solution (HBSS), at pH 7.0 – 7.6. Lipopolymer nanoparticle formulations may also contain additional pharmaceutical excipients including, but not limited to, diluents, binders, and stabilizers of natural, semisynthetic, and / or synthetic origin. Some examples of these excipients include sugars, such as lactose, sucrose, trehalose, glucose, dextrin; naturally occurring polymers and starches, such as cellulose, chitosan, and derivatives; and synthetic polymers, such as polyethylene glycols, poloxamers, and polyamides. IX. Exemplary Aspects The following numbered paragraphs illustrate exemplary aspects of the disclosed technology. Paragraph 1. A compound according to Formula I Y[-Z-Ao-X]y Formula I or a pharmaceutically acceptable salt thereof, wherein: Y is H, C6-10aryl, 5-, 6- or 7-membered heteroaryl, or CH4-y; SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 y is an integer from 1 to 10, with the provisos that when Y is H, then y is 1, and when Y is CH4-ythen y is 1, 2, 3, or 4, and wherein y indicated the number of -Z-Ao-X units that are each independently attached to the Y moiety; Z is C1-6alkyl; X is OH, or -NH-C1-4alkyl-C6- , , or -C(O)OC1-6alkyl; o is an integer from 2 to 500; each A independently is selected moieties and from 0 to p D moieties, where m is an integer from 1 to o / 2, n is an integer from 1 to o / 2, p is an integer from 0 to 500, and m + n + p = o; R1 is H, C4-20alkyl, C6-15alkenyl with from 1 to 3 double bonds, C3-8cycloalkyl, or C6-10aryl; R2is C4-20alkyl, C3-8cycloalkyl, -C1-4alkyl-C6-10aryl, -C1-4alkyl-N(Ra)2or -C1-4alkyl- C(O)OC1-4alkyl; R3is C1-15alkyl, -C1-4alkyl-N(Ra)2, -C1-4alkyl-O-C1-6alkyl-O-C1-4alkyl, PEG500-PEG2k, PEtOx5-50, PMeOx5-50, poly(2-methyl-2-oxazine)5-50, poly(N-methylglycine)5-50, poly(dimethylacrylamide)5-50, poly(dimethylmethacrylamide)5-50, poly(N-(2- hydroxypropyl)acrylamide)5-50, poly(N-(2-hydroxypropyl)methacrylamide)5-50, poly(N-(2- hydroxyethyl)acrylamide)5-50 or poly(N-(2-hydroxyethyl)methacrylamide)5-50; each Raindependently is H or C1-6alkyl, or two Ratogether with the atom to which they are attached form a 3- to 8-membered heterocyclyl comprising 1, 2, or 3 heteroatoms independently selected from O, N or S and optionally substituted with 1, 2 or 3 C1-6alkyl; and Rbis H, -C(O)OH or -C(O)O(C1-6alkyl), such as -C(O)OMe, -C(O)OEt, -C(O)Oisopropyl or -C(O)Ot-butyl. Paragraph 2. The compound of paragraph 1, wherein the compound has a structure according to Formula II or Formula III, or a pharmaceutically acceptable salt thereof SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 ; and 500. and y is 1. Paragraph 4. The compound of paragraph 1 or paragraph 2, wherein Y is CH4-yand y is 1, 2, 3, or 4. Paragraph 5. The compound of paragraph 1 or paragraph 2, wherein Y is phenyl and y is from 3-6. Paragraph 6. The compound of any one of paragraphs 1-5, wherein the compound has a structure according to Formula IV, Formula V, or Formula VI, or a pharmaceutically acceptable salt thereof wherein: with respect to Formula V, y is 1, 2, 3, or 4; and with respect to Formula VI, y is an integer from 3-6. Paragraph 7. The compound of any one of paragraphs 1-6, wherein X is OH or - NHCH2Ph. Paragraph 8. The compound of any one of paragraphs 1-7, wherein m and n are the same. Paragraph 9. The compound of any one of paragraphs 1-7, wherein m and n are different. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Paragraph 10. The compound of any one of paragraphs 1-9, wherein p is 0. Paragraph 11. The compound of any one of paragraphs 1-10, wherein R1is H, C4-15alkyl, C6-12alkenyl with from 1 to 3 double bonds, C5-8cycloalkyl, or C6aryl. Paragraph 12. The compound of any one of paragraphs 1-11, wherein R1is H, C5-12alkyl, C8-10alkenyl with from 2 double bonds, C6cycloalkyl, or C6aryl. Paragraph 13. The compound of any one of paragraphs 1-12, wherein R2is C4-15alkyl, C5-8cycloalkyl, -C1-2alkyl-C6-10aryl, -C1-4alkyl-N(Ra)2 or -C1-2alkyl-C(O)OC1-4alkyl. Paragraph 14. The compound of paragraph 13, wherein N(Ra)2is morpholinyl or piperidinyl. Paragraph 15. The compound of any one of paragraphs 1-14, wherein R3is C1-10alkyl, -C2-4alkyl-N(Ra)2, or -C1-2alkyl-O-C2-4alkyl-O-C1-2alkyl. Paragraph 16. The compound of any one of paragraphs 1-14, wherein R3 is PEG750- PEG1250, PEtOx5-50, PMeOx5-50, poly(2-methyl-2-oxazine)5-50, poly(N-methylglycine)5-50, poly(dimethylacrylamide)5-50, poly(dimethylmethacrylamide)5-50, poly(N-(2- hydroxypropyl)acrylamide)5-50, poly(N-(2-hydroxypropyl)methacrylamide)5-50, poly(N-(2- hydroxyethyl)acrylamide)5-50 or poly(N-(2-hydroxyethyl)methacrylamide)5-50. Paragraph 17. The compound of any one of paragraphs 1-16, wherein B is selected from 8 , , SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Paragraph 19. The compound of any one of paragraphs 1-18, wherein X . Paragraph 20. The compound of any one of paragraphs 1-18, wherein Paragraph 21. The compound of any one of paragraphs 6-20, wherein - is -CH2-. Paragraph 22. The compound of any one of paragraphs 1-21, wherein the compound has a structure according to one or the following formulas, or a pharmaceutically acceptable salt thereof ; Paragraph 23. The compound of any one of paragraphs 1-22, selected from SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 , of paragraphs 1-23. Paragraph 25. The composition of paragraph 24, wherein the composition is a nanoparticle. Paragraph 26. The composition of paragraph 24 or paragraph 25 wherein the composition further comprises an agent. Paragraph 27. The composition of paragraph 26, wherein the agent is a nucleic acid, small molecule drug, protein, polypeptide, antibody, peptide or a combination thereof. Paragraph 28. The composition of paragraph 26 or paragraph 27, wherein the agent is a nucleic acid. Paragraph 29. The composition of any one of paragraphs 27-28, wherein the nucleic acid is a single stranded DNA, single stranded RNA, double-stranded DNA, RNA-RNA hybrid, DNA- RNA hybrid, shortmer, antagomir, antisense, ribozyme, small interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), or a combination thereof. Paragraph 30. The composition of paragraph 28, wherein the nucleic acid is mRNA. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Paragraph 31. The composition of any one of paragraphs 27-30, wherein the nucleic acid is not covalently attached to the compound. Paragraph 32. The composition of any one of paragraphs 24-31, wherein the composition further comprises a phospholipid, a structural lipid, a polymer-conjugated lipid, or a combination thereof. Paragraph 33. The composition of paragraph 32, wherein the phospholipid is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC),1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn- glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2- dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn- glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1- glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1- stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, or lysophosphatidylethanolamine (LPE), L-α-phosphatidylcholine (Soy- PC), 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium salt) (DSPG), or a combination thereof. Paragraph 34. The composition of paragraph 32 or paragraph 33, wherein the structural lipid is selected from cholesterol, beta-sitosterol, cholestanol, fucosterol, campesterol, stigmastanol, brassicasterol, ergosterol or stigmasterol. Paragraph 35. The composition of any one of paragraphs 32-34, wherein the polymer- conjugated lipid is selected from a PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified phosphoethanolamine, PEG-modified ceramide (PEG-CER), SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 PEG-modified dialkylamine, PEG-modified diacylglycerol (PEG-DAG), PEG-modified dialkylglycerol, or a combination thereof. Paragraph 36. The composition of any one of paragraphs 32-35, wherein the polymer- conjugated lipid has a molecular weight of from 200 to 40,000 daltons. Paragraph 37. The composition of any one of paragraphs 24-36, wherein the composition comprises the compound, mRNA, and lipids DSPG (1,2-Distearoyl-sn-glycero-3-phosphoglycerol), soy PC (L-α-phosphatidylcholine), cholesterol and DMG-PEG2000. Paragraph 38. A pharmaceutical composition comprising the composition of any one of paragraphs 24-37, and a pharmaceutically acceptable excipient. Paragraph 39. A method for making a composition according to any one of paragraphs 24- 37, the method comprising combining a first solution comprising a compound according to any one paragraphs 1-23 with a second solution comprising a phospholipid, a structural lipid, a polymer- conjugated lipid, or a combination thereof. Paragraph 40. The method of paragraph 39, wherein the method further comprises combining the compound with an agent to form the first solution. Paragraph 41. The method of paragraph 39 or paragraph 40, wherein the agent comprises a nucleic acid, small molecule drug, protein, polypeptide, antibody, peptide, or a combination thereof. Paragraph 42. A method of using a composition according to any one of paragraphs 24-38, comprising administering an effective amount of the composition to a subject. Paragraph 43. The method of paragraph 42, wherein administering the nanoparticle comprises administration by an intravenous, intramuscular, or intradermal route. Paragraph 44. The method of paragraph 42 or paragraph 43, wherein administering to the subject comprises administering to lung and / or spleen tissue. Paragraph 45. The method of paragraph 44, wherein administering to the subject comprises administering to lung tissue. Paragraph 46. Use of a compound of any one of paragraphs 1-23 or a composition according to any one of paragraphs 24-38 in the preparation of a medicament for administration to a subject. X. Examples Materials and methods Octylamine, decylamine, dodecylamine, cyclohexanecarboxaldehyde, octanal, decanal, benzylamine and trans,cis-2,6-nonadienal were obtained from TCI Chemicals and used as received. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Ethyl formate, hexanal, dodecanal, formaldehyde (37 % in H2O), acetic acid, hexanoic acid, 3- (dimethylamino)propionic acid hydrochloride, cyclohexylisocyanide, ethyl isocyanoacetate and 2- morpholinoethyl isocyanide, cholesterol, 30% hydrogen peroxide solution, citric buffer (10x) antigen retriever were obtained from Sigma Aldrich and used as received. L-α-phosphatidylcholine (Soy-PC), 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium salt) (DSPG) were purchased from AvantiPolarLipids.1,2-Dimyristoyl-rac-glycero-3-methylpolyoxyethylene (DMG- PEG2000) was obtained from NOF American Corporation. AMEC Red Substrate Kit, Peroxidase (HRP) (SK-4285) was obtained from Vector Laboratories. Acetonitrile (ACN), benzonitrile, benzylbromide, methyl triflate and 2-ethyl-2-oxazoline were obtained from Sigma Aldrich and dried over CaH, then purified by distillation before use. NMR spectra were recorded on a Bruker Ultrashield 500 MHz Plus system at 25 °C using deuterated solvents obtained from Sigma-Aldrich. MALDI-ToF-MS was performed on a Shimadzu Axima Performance instrument in or positive- reflector mode. Trans-2-[3-(4-tert-Butylphenyl)-2-methyl-2-propenylidene]malononitrile (DCTB) (100 mg mL-1in ACN) was used as the matrix without further purification (Sigma-Aldrich). NaTFA salt was used as the ionization agent (1 mg mL-1in MeOH). Matrix, polymer, and salt solutions were mixed in a 1:1:0.5 volume ratio and then 1 μL of the mixture was deposited onto a ground steel target plate before insertion into the ion source chamber. The instrument was calibrated against a poly(ethylene glycol) methyl ether standard (MW = 2,000 g mol-1) prepared under the same conditions with DCTB matrix. SEC-RI chromatography Poly(ethyloxazoline) samples were analysed with the Agilent 1260 Infinity II chromatography system with Stryagels HR2, HR4 and HT5 columns and Agilent 1260 infinity RI detector was used for the SEC studies. DMF + 0.1% LiBr was used as an eluent. The flow rate was 0.8 mL / min. The column was thermostated at 40 ⁰C. Example 1 Synthesis of benzylisocyanide benzylamine (5 g, 46.7 mmol) was dissolved in ethyl formate (11.3 ml, 140 mmol) in a round SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 bottom flask and refluxed for 3 hours at an oil bath temperature of 65 ⁰C. The reaction mixture was concentrated under reduced pressure. The formate intermediate was dissolved in DCM (30 ml) under nitrogen atmosphere, triethylamine (32.5 ml, 233 mmol) was added, cooled with an ice water bath followed by dropwise addition of a solution of phosphorus oxychloride (4.56 ml, 49 mmol) in DCM (5 ml). The reaction mixture was stirred for 2 hours and allowed to warm to room temperature, and then purified directly by column chromatography over silica. Diethyl ether was initially used as the mobile phase, switching to a 50 % DCM mixture. The product fractions were combined, concentrated and then purified by distillation under vacuum to yield a pale-yellow oil (yield = 2.3 g, 42 %). Structure was confirmed by1H NMR.1H NMR (500 MHz, CDCl3) δ 7.41 (m, 5H, C5H5), 4.67 (2H, s, CH2). Example 2 Synthesis of alkylisocyanides The same protocol described above for benzylisocyanide was employed using 5 g of the alkylamine reagent, modifying quantities of the other reagents accordingly. For column chromatography a hexane / ethyl acetate (9:1 to 4:1) mixture was used. Only octylisocyanide was further purified by distillation. Octylisocyanide. Yield = 3 g, 56 %. Distilled at 60 ⁰C, 0.2 mbar.1H NMR (500 MHz, CDCl3) δ 3.40 (tt, 2H, J = 1.9 Hz, 6.7 Hz, CH2NC), 1.70 (2H, m, CH2CH2NC), 1.45 (2H, m, CH2(CH2)2NC) 1.32 (8H, m, CH3(CH2)4) 0.91 (3H, t, J = 7.0 Hz, CH3). Decylisoycanide Yield = 4.1g, 77 %.1H NMR (500 MHz, CDCl3) δ 3.40 (tt, 2H, J = 1.9 Hz, 6.7 Hz, CH2NC), 1.70 (2H, m, CH2CH2NC), 1.45 (2H, m, CH2(CH2)2NC) 1.33 (12H, m, CH3(CH2)6) 0.91 (3H, t, J = 6.9 Hz, CH3). Dodecylisocyanide Yield = 3.8 g, 72 %.1H NMR (500 MHz, CDCl3) δ 3.40 (m, 2H, CH2NC), 1.70 (2H, m, CH2CH2NC), 1.46 (2H, m, CH2(CH2)2NC) 1.32 (16H, m, CH3(CH2)8) 0.91 (3H, t, J = 6.9 Hz, CH3). Structures were confirmed by1H NMR. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Example 3 Synthesis of poly(ethylene imine)s 1. BzCNO 80 ⁰C, 4h 4M HClReflux H N n N H g, , and methyl triflate (MeOTf) (0.69 – 4.32 mmol) were added to a dry Schlenk flask under inert atmosphere, and then stirred at 80 ⁰C for 4 hours. Molar equivalents of methyl triflate were altered accordingly to target degrees of polymerization of 35, 85 and 220. The reaction mixture was cooled to 40 ⁰C, terminated by addition of benzylamine (10 eq. with respect to MeOTf) and left to stir overnight. The polymer was precipitated three times from diethyl ether and dried under vacuum to yield a colorless powder. For the preparation of the lowest degree of polymerization PEtOx15, the initiator benzyl bromide was used in acetonitrile and the termination carried out with 1M KOH solution instead. SEC and MALD-ToF results are presented in FIGS.32 and 33, and in Table 1. Table 1. Analytical data of the PEtOx polymers Mn theo Mn SEC Sample Initiator DPNMRa(kg mol-1) (kg mol-1)bĐ ppm) compared to the polymer side chain ethyl units (ppm). b – SEC performed in DMF + 0.1% LiBr eluent. Hydrolysis of poly(2-ethyl-2-oxazoline) Poly(2-ethly-2-oxazoline) was dissolved in 3M HCl (75 ml) in a round bottom flask fitted with a stir bar and refluxed overnight for 18 hours. The mixture was cooled to room temperature, then adjusted to pH 10 by addition of 4 M NaOH causing precipitation of the polymer. The solid SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 was collected by centrifugation and washed five times with distilled water collecting again by centrifugation between washes. The solid was dried under vacuum to yield a colorless powder. Structure was confirmed by1H NMR.1H NMR (500 MHz, CDCl3) Example 4 Ugi modification of poly(ethyleneimine) the reaction forms the split-Ugi product whereby 2 molar equivalents of PEI secondary amines are required with respect to the other reagents. The quantities of reagent were calculated as follows taking the repeat unit of PEI as 1 eq: 25% target modification: 0.125 eq. aldehyde, 0.125 eq. isocyanide, 1 eq. carboxylic acid. 50% target modification: 0.25 eq. aldehyde, 0.25 eq. isocyanide, 1 eq. carboxylic acid. 100% target modification: 0.5 eq. aldehyde, 0.5 eq. isocyanide, 1 eq. carboxylic acid. PEI was dissolved in EtOH / H2O (9 / 1) at a concentration of 50 g / L polymer, and stirred with heating at 50 ⁰C. When targeting the highest modification density, the concentration was lowered to 25 g / L polymer to ensure sufficient solubility. The aldehyde reagent was added to the PEI solution and stirred for 30 minutes, followed by addition of the isocyanide and then the acid. The mixture was stirred overnight with continued heating of 50 ⁰C, then cooled to room temperature, diluted with ethanol, and transferred to a dialysis membrane (MWCO = 1 kDa). Dialysis was performed first once against ethanol, and then twice against deionized water exchanging solvents every 24 hours. The solution was freeze dried to yield the product, typically as a pale orange solid / oil. Alternatively, in early batches of samples (U1 – U11) the polymers were purified by precipitating three times into ice cold diethyl ether, resolubilizing in ethanol between steps. This procedure was unreliable, however, for the more hydrophobic derivatives which showed some degree of solubility in diethyl ether or hexane and thus dialysis was selected as the purification method of choice. Results were confirmed by1H NMR (FIG.34) and in Table 2. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Table 2. Reaction conditions and obtained modification as determined by NMR for Ugi reactions with varying equivalents of the carboxylic acid component Isocyanide Exp. Eq. Acid Acid modified units modified units um before analysis. A trend of higher functionalization of cyclohexyl units with higher equivalents of acid used in the reaction was observed. For entry A, where no acid reagent is used, the Ugi reaction fails and no isocyanide units are successfully reacted, likely only imine formation with the aldehyde occurs under these conditions. The equivalents of acid were calculated taking the PEI repeat unit as 1 eq. A total modification of 50 % was targeted, meaning an expected functionalization of 25 % for the acid and aldehyde / isocyanide units respectively. A ratio of reagents 1 : 0.25 : 0.25 : X (PEI : aldehyde : isocyanide : acid) was used, where X is shown in table 2. Entry B uses the minimum stoichiometry of acid needed for the Ugi, however, this leads to sub-quantitative functionalization. This presumably arises from ionic interactions of the acid with excess secondary amine units of the PEI backbone, reducing the reaction rate. Increasing the acid to a slight excess (entry C) leads to a significant increase in modification, and further modest increase is seen using higher amounts (entries D / E). As there was no apparent downside of using the highest acid concentration, this was selected as the standard condition for further library synthesis. Example 5 Polyplex preparation For in vitro and in vivo screening polyplexes were formulated from the synthesized PEI- derivatives (lipopolymers) library via ethanol injection method. Briefly, a solution of the lipopolymer in ethanol (2 g / L) was combined with an aqueous phase containing mRNA (28.6 g / L) in an acetate buffer (25 mM, pH 5, IS 154 mM) at the ratio water to ethanol 7 / 1 (v / v), resulting in a 10 / 1 (wt:wt) lipopolymer to mRNA ratio. The mixture was then left to incubate for 30 minutes, allowing the polyplexes to form. Finally, the polyplexes were neutralized using Tris-HCl buffer (25 SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 mM, pH 7.4, IS 154 mM). For in vivo studies polyplexes were dialyzed against Tris-HCl buffer (25 mM, pH 7.4) for 2 hours at room temperature. Size distribution and polydispersity indexes (PDI) of polyplexes were determined with dynamic light scattering using Stunner (Unchained Labs, US) or Zetasizer Nano ZSP (Malvern Instruments, UK). Concentration of RNA in final formulation was assumed to be 100% yield. Example 6 Hybrid lipopolymer nanoparticle preparation Hybrid nanoparticles were formulated in two steps. Before formulating, all lipids with specified molar ratios were dissolved and mixed in ethanol to form a complete lipid mix solution. Separately, lipopolymer was dissolved in ethanol and mRNA was diluted in 25 mM acetate buffer (pH 5). Then, the ethanol lipopolymer solution was rapidly mixed by vortexing with the aqueous buffer solution containing Fluc mRNA at a ratio of 20 / 1 (aqueous / ethanol, v / v) to achieve a final weight ratio of 10 / 1 (total lipopolymer / mRNA, wt / wt). The resulting mixture was then left to incubate for 30 minutes, allowing the polyplexes to form. Next, the aqueous solution of polyplexes was combined with ethanol phase, containing DSPG (1,2-Distearoyl-sn-glycero-3-phosphoglycerol), soy PC (L-α-phosphatidylcholine), cholesterol and DMG-PEG2000 lipids in molar ratio 22 / 23 / 50 / 5, by microfluidic mixing using NanoAssemblr Ignite+ (Precision Nanosystems). Lipopolymer to lipids ratio was 2 / 1 / (wt / wt). Final hybrid nanoparticles were dialyzed 3-4 hours against Tris-HCl buffer (25 mM, pH 7.4) and concentrated with 10-kDa Amicon Ultra centrifuge filters (Millipore, Burlington, MA). Size distribution and PDI of polyplexes were determined with dynamic light scattering using Stunner (Unchained Labs, US) or Zetasizer Nano ZSP (Malvern Instruments, UK). RNA concentration in final formulation was measured with RiboGreen kit according to the manufacturer’s protocol with some modifications. Samples were diluted to 100 µg / L in 1× TE buffer with 2 g / L heparin (Sigma-Aldrich, U.K.). Standard solutions from the corresponding RNA stock were also prepared in a 1× TE buffer with 2 g / L heparin to account for any variation in fluorescence. RiboGreen reagent was diluted 2000-fold in 1× TE buffer. RNA encapsulation of samples was determined by comparing the signal of the RNA-binding fluorescent dye RiboGreen in the absence and presence of a detergent (2 % Triton X-100). All samples were incubated 15 minutes at 37 °C before addition of reagent. In the absence of detergent, the signal comes only from unencapsulated RNA. In the presence of detergent, the nanoparticles were disrupted so that the measured signal comes from the total. Fluorescence was measured at λex = 485 nm and λem = 530 nm. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 To evaluate nanoparticles in vivo biodistribution, DiD dye was added to lipids mixture at 0.1% molar of total lipids concentration. For pretreatment studies, blank nanoparticles were prepared according to the protocol without mRNA in acetate buffer. Example 7 Cryo-transmission electron microscopy (TEM) Cryo-TEM images were captured with Falcon III and K3 Summit cameras with DED at 300 kV. The Vitrobot Mark IV system (FEI) was used to plunge-freeze a copper lacey carbon film- coated grid (Quantifoil, R1.2 / 1.3300 Cu mesh). U155@lipid nanoparticles (10 µL) was dispensed onto the glow discharged grids in the Vitrobot chamber maintained at a temperature of 23 °C and a relative humidity of 100% to freeze the samples. The sample was incubated for 30 seconds before being blotted with filter paper for 3 seconds before being submerged in liquid ethane cooled by liquid nitrogen. The frozen grids were clipped. The images were taken at an electron dose of 15-20 e − / Å2using 45,000 nominal magnifications with 1.5 binning then processed and analyzed using ImageJ (Fiji ImageJ2 version: 2.9.0 / 1.53t). Example 8 TNS Assay TNS assay was performed as described previously by Sabnis et al. Molecular Therapy 2018, 26, 1509. Briefly, the McIlvaine citric-phosphate buffer was used to prepare buffers at various pH values between about 3 and 9 for determining apparent pKa. Then a stock of 300 μM 6- (p-toluidino)-2-naphthalenesulfonic acid sodium salt (TNS reagent) in DMSO was prepared. Buffer solution (90 μL) of was added to wells. Then 3.3 μL of U155 polyplexes or U155@lipid nanoparticles sample and 2 μL of 300 μM TNS reagent solution were added. Each well was then carefully mixed, and fluorescence was measured. With the resulting fluorescence values, a sigmoidal plot of fluorescence versus buffer pH was created. Example 9 In vivo-JetPEI^formulation Complexes of mRNA with In vivo-JetPEI^(Polyplus-transfection) were prepared according to the manufacturer’s instructions. Fluc mRNA (40 µg) and 6.4 µl In vivo-JetPEI^(N / P = 8) were each diluted in 200 µL of 5% sterile D-glucose. Both solutions were mixed, followed by a 10- minute incubation at room temperature. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Example 10 In vitro transfection efficacy screening HeLa cells were plated in white, clear-bottom 384-well plates (2000 cells per well in 50 µL of complete DMEM media) and allowed to adhere overnight. Then, cells were treated with polyplexes loaded with FLuc mRNA (100 ng per well). Cell viability results (CellTiter-Fluor, Promega), and luciferase expression data (ONE-Glo Luciferase Assay, Promega) were collected 24 hours post-treatment using a microplate reader. Luminescent readout (in relative luminescence units) was normalized by cell counts commensurate with fluorescence (relative fluorescence units, RFU). Example 11 Endosomal escape studies HEK293T / 17 Gal9-GFP reporter cells (Gal9-HEK293) were seeded (10,000 cells per well) in complete DMEM media in 96-wells black with clear-bottom plate. After overnight incubation, polyplexes loaded with mCherry RNA were added at a dose of 100 ng mRNA per well and incubated for 24 hours. After incubation, media was gently aspirated, cells were then washed twice with PBS and fixed with 4% paraformaldehyde in PBS for 10 minutes at room temperature. Once cells were fixed, wells were gently washed with PBS two more times and DAPI (Thermo Fisher, Federal Way, WA) was then added at 1:1000 in PBS for nuclear staining. Following DAPI staining, cells were washed again two times and left in PBS. Reporter cells were imaged for GFP-positive puncta with a Fluorescent EVOS microscope with objective at 20× to report maximum intensity projections. Images were processed using ImageJ (Fiji ImageJ2 version: 2.9.0 / 1.53t). Example 12 In vivo bioluminescence imaging Fluc mRNA encapsulated in particles at a certain dose was injected via tail vein to female BALB / c mice aged 5–8 weeks. For bioluminescence imaging, mice received d-luciferin substrate (150 mg / kg) intraperitoneally and were imaged according to the manufacturer’s protocol. Image acquisition and analysis were performed using the IVIS Lumina XRMS and the manufacturer’s software (PerkinElmer). Mice were anesthetized by isoflurane inhalation during the procedure. For ex-vivo imaging, mice were sacrificed. Different organs were harvested, mocked in 1.5 g / L d- luciferin solution and analyzed. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Example 13 In vivo particles biodistribution DiD-labeled nanoparticles were injected via tail vein to female BALB / c mice aged 5–8 weeks at the dose 5 µg of Fluc mRNA per animal. Mice were sacrificed 4 hours post-treatment, organs were harvested and imaged using the IVIS Lumina XRMS (λex / λem = 640 nm / 670 nm). DiD concentration in formulation was measured in methanol and estimated using ε640 nm = 2.45x105cm-1M-1. Control solution was prepared using DiD dye in DMSO, which was then diluted with DPBS to achieve final concentration of 1 % (v / v) DMSO. Example 14 In vivo gene editing For gene editing in mouse lungs with Cas9 mRNA / sgRNA in U155@lipid nanoparticles, 8- week-old Ai9 mice were injected with 100 μL of particles at dose total 19 μg per mouse (0.8 mg / kg; total RNA 1 / 1 mRNA / sgAi9, wt / wt). Animals were sacrificed on day 9 post-treatment, part of lungs was used for NGS analysis, another part of lungs was formalin-fixed, paraffin-embedded and analyzed with multiplex IHC. All animal care and experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC, protocol # IP00001707) of Oregon Health and Sciences University. In the sgRNA sequence, the asterisks and bold italics font indicate the phosphorothioate bond and 2′-O-methyl ribonucleotides, respectively. A*A*G*UAAAACCUCUACAAAUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*U*U*U(SEQ ID NO: 1) Example 15 Flow cytometry studies To study the biodistribution and cell type transfection by mRNA, mice were intravenously injected with 10 µg Cre mRNA loaded into U155@lipid nanoparticles. On day 3 post-injection mice were sacrificed, lungs, spleen and liver were harvested and then dissociated. Single cells were generated with the organ dissociation standard protocol. Briefly, mouse organs were perfused with PBS and placed in a well of 12-wells plate with 0.5 ml of Click’s buffer on ice. Then 50 µl of collagenase IV and DNAse I mixture was added, and tissue was minced using tweezers and incubated for 30 minutes at 37 °C in 5% CO2incubator, and then treated with 50 mM EDTA in DPBS for another 5 minutes at 37 °C in 5% CO2 incubator. Subsequently, the digested tissue was SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 filtered through a 70 µm nylon mesh strainer to collect single cells. Cells were washed using flow wash buffer (PBS containing 2 mM EDTA and 0.5% BSA) and collected by centrifugation at 450 x g for 5 min at 4 °C. The pelleted cells were resuspended in 100-200 µl of ACK lysis buffer for 5 min at room temperature and quenched with the addition of equal volume of 5 mM EDTA in PBS. After washing, cells were stained with live dead cell staining dye NIR and then incubated with Fc block (BioLegend). Cells were further stained with the following fluorochrome-conjugated antibodies: CD45-BUV395 (BD Horizon, #565967), B220-BUV805 (BD Horizon, #569199), CD31-BV605 (BD Horizon, #740356), TcrB-AF700 (BD Horizon, #560705). The stained cells were analyzed using Cytek Aurora. Example 16 Multiplex Immunohistochemistry For immunohistochemistry (IHC) studies, formalin-fixed, paraffin-embedded mouse lung samples were sectioned at 4 μm, deparaffinized and antigen retrieved with 10 mM citrate buffer for 20 min at 110 °C. Slides were then incubated 10 minutes in 3% peroxide in methanol, washed in TBS-tween buffer. Next, lungs sections were cyclically stained with antibodies in the following order: cycle 1 Rabbit RFP polyclonal antibodies (Biotium, 1:600 dilution, 1 hour), cycle 2 Rabbit E-Cadherin (Cell Signaling, 24E10 #3195, dilution 1:200, 1 h), cycle 3 Rabbit CD31 (Abcam, ab182981, dilution 1:200, 1 h), cycle 4 Rabbit CD45 (Abcam, ab10558, dilution 1:200, 1 h), cycle 5 Rabbit Lyve1 (Abcam, ab33682, dilution 1:200, 1 h). Visualization was performed using the AMEC Red Substrate Kit, Peroxidase (HRP) (SK-4285) as instructed by the manufacturer. Digital scanning was performed using Aperio ImageScope AT2 (Leica Biosystems) at 20× magnification. Images were processed with ImageScopex64, QuPath and ImageJ (Fiji ImageJ2 version: 2.9.0 / 1.53t). Between each cycle tissue sections were treated with 95% ethanol for 10 minutes to wash blue protein staining and then 1% SDS, 25 mM glycine solution (pH 2-3) at 70 °C for 1 hour. Example 17 Hematoxylin and Eosin Staining (H&E) Formalin-fixed, paraffin-embedded mouse lung and liver samples were sectioned at 4 μm. Lungs and liver tissues were first stained with hematoxylin for 30 seconds at room temperature and then rinsed in tap water. Then, tissue sections were decolorized in acid alcohol (10% acetic acid and 85% ethanol in water), followed by water washing. Next, sections were immersed in a saturated sodium bicarbonate solution, washed in water, and then immersed in 95% alcohol. Finally, staining was performed with Eosin-Phloxine for 10 seconds, followed by a dehydration SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 step and cover slipping. Digital scanning was performed using Aperio ImageScope AT2 (Leica Biosystems) at 20× magnification. Images were processed with QuPath and ImageJ (Fiji ImageJ2 version: 2.9.0 / 1.53t). Example 18 PAS-fast green staining Formalin-fixed, paraffin-embedded mouse liver samples were sectioned at 4 μm, deparaffinized and hydrated to water. Then sections were oxidized in 0.5% periodic acid solution for 10 minutes and washed with water. Next, sections were placed in Schiff’s reagent for 30 minutes and wash in warm tap water for 5 minutes. To stain PAS-negative background elements tissue samples were incubate in Fast green (0.02% solution) for 30 seconds, following washing with water, dehydration with 95% and absolute alcohols, and cover-slipping. Digital scanning was performed using Aperio ImageScope AT2 (Leica Biosystems) at 20× magnification. Images were processed with QuPath and ImageJ (Fiji ImageJ2 version: 2.9.0 / 1.53t). Example 19 Serum cytokines screening Blood serum from female BALB / c mice 24 hours post injection with 5 µg Fluc mRNA, loaded in U155@lipid nanoparticles, via tail vein injection was collected and analyzed by IDEXX BioAnalytics. Samples were tested on the Milliplex MAP Mouse Cytokine / Chemokine Magnetic Bead Panel (Millipore, Cat No. MCYTOMAG-70K-PMX) according to the kit protocol as qualified. Data were collected by xPONENT® 4.3 (Luminex) and data analysis was completed using BELYSA® 1.1.0 software. The data collected by the instrument software are expressed as Median Fluorescence Intensity (MFI). MFI values for each analyte are collected per each individual sample well. Analyte standards, quality controls, and sample MFI values were adjusted for background. Example 20 Next generation sequencing (NGS) NGS was performed via a two-step PCR as described previously in M. Gautam et al. Nat. Commun 2023, 14, 6468. Briefly, genomic DNA (gDNA) was harvested from lung and spleen tissues using the Qiagen DNeasy Blood & Tissue kit (Qiagen, #69506) according to the manufacturer’s instructions. Genomic regions of interest were amplified using two primer sets SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 specific to the first or second / third stop codon of the Ai9 loxp-stop-loxp cassette (Table 3), and specific thermocycling conditions (Table 4). Table 3. Guide RNA, primers, and cycling conditions used for editing studies S.N. Primer Name Sequence (5’ -> 3’) SEQ ID No. 1 Ai9_NGS_F1_F ACACTCTTTCCCTACACGACGCTCTTCCGATC 2 . 1stPCR 2ndPCR Step Temperature Time Temperature Time A second PCR was performed to add the necessary sequences to bind the amplicon to the Illumina flow cell (Table 4). The samples were then run on a gel, excised, pooled together, and harvested. The pooled library DNA concentration was quantified via qPCR using the KAPA Quantification Kit (Roche, #07960140001). After quantification the library was prepared for NGS using Illumina’s standard denature and dilute protocol. The NGS library was run on an Illumina MiniSeq using a 300-cycle mid output kit (Illumina, FC-420-1004). Editing was quantified using CRISPResso2 in standard mode, using the indel count in the “CRISPResso_quantification_of_editing_frequency.txt” file. The insertions and deletions were added together before being normalized to the number of reads, resulting in a % of reads containing indels. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Example 21 Results and Discussion from Examples 1-20 i) Synthesis of modified PEI for mRNA delivery The split-Ugi reaction is a known but sparingly employed version of the four component Ugi reaction that -to the best of the inventors’ knowledge- has never been utilized for polymer- analogue modification. Therefore, the split-Ugi reaction was initially assessed for its ability to yield PEI derivatives with a range of reagents and of different modification densities. A linear PEI35 was reacted with formaldehyde (A1), acetic acid (C1) and four different isocyanides (B1, B5, B6and B7) (FIG.2) by heating in methanol / water targeting a total modification of 50 % of the secondary amine repeat units (4:1:1:1 molar ratio of amine:aldehyde:isocyanide:acid).1H-NMR and13C-NMR spectroscopic analysis showed the isocyanide functionality was conjugated onto the polymer in all cases (however, the degree of incorporation based on1H NMR integration varied and was lower than expected. In typical Ugi reactions a 1:1 molar ratio of amine to carboxylic acid component is used (or 2:1 for a split-Ugi), whereas here a partial conversion of the amine was desired, meaning an excess of amine with respect to carboxylic acid. It was hypothesized that the excess of amine may lower the reactivity of the acid in the Ugi by formation of ion pairs. To optimize the procedure, it was found that using larger quantities of the carboxylic acid up to an equimolar quantity with respect to the amine resulted in higher incorporation of all reagents onto the polymer for a test system using A1 / B1 / C1reagents (FIG.1). With this, NMR analysis showed modification percentages closely matching those targeted for all the aldehyde and isocyanide, and therefore this procedure was selected for further derivative synthesis. A library of 148 split-Ugi modified polymers were synthesized by this combinatorial approach, comprising modified PEI of three different molecular weights (1.6, 3.8 and 9.6 kg mol-1), in addition to a 4 arm-star PEI sample, and at two targeted modification degrees (25 % and 50 %) combining a range of aldehydes, isocyanides and carboxylic acids (FIG.2). Linear PEIs were chosen for modification, as these can be readily synthesized with low dispersity and controlled molar masses using cationic ring opening polymerization of 2-oxazoline monomers. Additionally, they are easier to characterize without the complication of mixed primary / secondary / tertiary amine species found in hyperbranched PEIs, which are otherwise known to display the highest transfection. Products were characterized by1H NMR, and demonstrated successful incorporation of the aldehyde / isocyanide functional groups in all cases to a degree matching the targeted modification density. However, the carboxylic acid reagent showed variable conjugation efficiency across samples, in some cases low as about 40 % of the expected amide group formation. Without being SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 bound to a particular theory, this may lead to a larger fraction of unreacted PEI units on the resulting polymer, although formation of other side products cannot be completely ruled out. Lowered amide group formation suggested the imino-anhydride intermediate was not always attacked by the secondary amine as expected in the modified Mumm rearrangement step but may react with another nucleophile in the system instead such as the solvents (ethanol / water). This reaction has been reported when using methanol as the Ugi reaction solvent, and also the interception by water is known to occur in the 3 component-Ugi reaction, although this typically requires another catalyst species and is unlikely to occur in the system here. While a range of carboxylic acid reagents was still explored, due to the lowered incorporation of this reagent onto the polymer it was not considered to be of such importance for structural variation. Additionally early screening of acetic acid derivatives showed promising transfection and therefore acetic acid was used for most of the library. Size-exclusion chromatography (SEC) analysis indicated molecular weights in the expected range and monomodal distributions suggesting the modification otherwise proceeded smoothly (FIG.3). Thus, a library of PEI derivatives was generated by combinatorial chemical synthesis. The materials were synthesized using the Ugi reaction, targeting a total modification of 50%, which was achieved by adding an excess of secondary amine PEI units compared to the other reagents, unlike typical Ugi reactions wherein equimolar quantities are used. ii) Degree of polymerization and length of carbon tail chain effects mRNA delivery Polyplexes are a promising non-viral type of gene delivery system, which provides protection of mRNA and facilitates the endosomal escape. Therefore, for an initial screening polyplexes were formulated from the synthesized PEI-derivatives library via an ethanol injection method. Briefly, a solution of the polymer in ethanol was combined and vortexed with an aqueous phase containing mRNA in an acetate buffer (25 mM, pH 5). The resulting mixture was then left to incubate for 30 minutes, allowing the polyplexes to form. Finally, the polyplexes were neutralized using Tris-HCl buffer (25 mM, pH 7.4). For in vitro studies a library of polyplexes with mRNA encoding Firefly luciferase (Fluc) was screened in HeLa cells to identify the mRNA transfection possibility. Polyplexes with mCherry RNA were tested in Gal9-HEK293 cells to evaluate the endosomal escape efficacy. The endosome damage results in redistribution of Gal9 and is visualized as GFP puncta in the Gal9-GFP reporter cells. In the in vitro library screening, HeLa cells were treated with Fluc mRNA-loaded polyplexes. The relative luciferase expression (normalized to cell viability fluorescent signal) after 24 hours incubation with polyplexes was shown on the heat map (n=6-8). Gal9-HEK293 cells were treated SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 with mCherry RNA- loaded polyplexes. The percent of cells with endosomal escape (EndEsc) cases after 24 hours incubation with polyplexes was presented on the heat map (n=40-150). Data are presented as Mean, and representative images of Gal9-HEK293 cells after treatment are shown in FIG.4. Based on in vitro screening (FIG.4), several trends were observed: first, the more hydrophobic samples appeared to perform better (e.g., U12, U15, U22, U46 (more hydrophobic) compared to U1-U8 (less hydrophobic)). Hydrophobicity of the polymers was varied with a combination of alkyl chain bearing isocyanide and aldehyde reagents. Such functionalities result in a polymer repeat unit with a tertiary amine unit in the backbone and two alkyl chain groups attached. The position of hydrophobic chain also may affect the transfection rates as well. Thus, variation of carboxylic acid substitutions showed that the shortest alkyl chain (acetic acid) was the most efficient of the investigated ones. Additionally, the lower molar mass polymers and the higher modification density showed better performance. For PEI homopolymers, higher molar mass show higher transfection, however, this trend did not appear to apply for the hydrophobic derivatives in the present library. The addition of hydrophobic interactions was expected to strengthen interactions of the polyplex assembly, possibly leading to more stable particles for even the low molar mass derivatives. Next, a selection of these polyplexes was screened in vivo. Polyplexes made using polymers U15 and U22 were injected (i.v.), which produced stable formulations at high concentrations and showed in vivo activity, at dose 10 µg Fluc mRNA per mouse. Both formulations showed weak transfection signal. Notably, U15 with longer acyl chain of isocyanide substitute (CN-C12H25) compared to U22 (CN-C8H17) showed evident accumulation and Fluc mRNA transfection in lungs while U22 polyplex distributed Fluc mRNA mostly to the lymph nodes and spleen (FIG.6). It was assumed that this could be due to higher hydrophobicity of U15 and, as a result, better stability of particles, which prevents polyplexes from aggregation or dissociation in the presence of negatively charged blood components. The hit structure of U15 was selected to be used as the starting point to improve the polymer structure. The in vitro screening of the initial library revealed that most of polymers facilitate the endosomal escape, but not mRNA transfection (FIG.4). The reason for low transfection rates with such type of materials could be a limited cargo release after endosomal escape. Therefore, the polymeric library was expanded with U15 analogs with a lower molar mass PEI (880 g mol-1), while targeting higher modifications of 66% (U154) and 100 % (U155), in an attempt to improve the performance of polyplexes in vivo. In vitro screening (FIGS.7 and 8) of new small group of polymers showed the following patterns: the mRNA cargo release was reduced with increasing SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 molar mass of the polymer (U15-U16-U17), due to their elevated stability and profound interactions with mRNA. At the same time, as the length of polymer was reduced significantly (U154 compared to U15), transfection was reduced as well due to lower particles stability. The preference of higher modification density (U155 compared to U154) may suggest a reduction in charge density is beneficial, due to the larger number of non-ionizable amide repeat units introduced. Alternatively, the addition of sufficient hydrophobic groups may be useful for particle stability and optimal transfection. The split-Ugi not only transforms one secondary amine to an amide, it also transforms one secondary amine into a tertiary amine. Thus, a new lead polymer (lipopolymer) with promising transfection performance was identified (U155), synthesized by modification of a PEI17with decanal, dodecylisocyanide and acetic acid reagents as split-Ugi (P5, A5, B4, C1) (FIG.9). The targeted 100 % modification should yield a polymer with 50% tertiary amine repeat units featuring a lipid-like tail, and by1H NMR a functionalization of 47 % was obtained. However, the number of methyl amide repeat units formed was substantially lower at 19 % (target 50 %), meaning a significant portion of secondary amine PEI units remain despite targeting full conversion. U155 showed high batch-to-batch reproducibility and unimodal molar mass distributions. The capability of the selected polymer for in vivo Fluc mRNA delivery was explored. Formulated by vortexing, polyplexes exhibited a diameter of 201±41 nm (PDI 0.20±0.05) and the zeta potential of 57±6 mV, as was characterized by dynamic light scattering (DLS). Injected (i.v.) Fluc mRNA encapsulated into U155 polyplexes showed strong bioluminescent signal and the preferential Fluc protein expression in lungs and spleen (FIG.10). Notably, the gold standard in vivo JetPEI®did not show transfection activity at the same dose (5 µg mRNA per mouse). One of the possible way of lungs accumulation is through opsonization of proteins like vitronectin or when highly charged cationic particles interact with cellular blood components, especially with erythrocytes, producing small aggregates which firstly infiltrate in fine lung capillaries and then translocate to the spleen and liver. Additionally, biodistribution to the lungs and spleen has been found to be highly dependent on particles size. Due to the high hydrophobicity of the polymer, U155 polyplexes were prone to aggregation during the concentration process, which resulted in the formation of particles in the range of >400 nm. This characteristic increased their endocytosis by splenocytes. Overall, the highly positively charged U155 polyplexes were rapidly eliminated from the circulation within 24 hours. To prevent the described processes, it was assumed that a reduction of the particle charge and particles surface protection could be beneficial. SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 iii) Lipopolymer nanoparticles outperformed in vivo JetPEI® in mRNA delivery to the lung To decrease the zeta-potential of resulting lipopolymer nanoparticles negatively charged phosphatidyl glycerol (PG) lipid can be added. PG is a major negatively charged lipid in bacterial and plant membranes, characterized by the presence of a single charged phosphate group. Roy Pattipeiluhu et al. (Advanced Materials 2022, 34, DOI 10.1002 / adma.202201095, 15 pages) previously used 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG) in LNPs to manipulate distribution of particles after i.v. injections. Inclusion of anionic lipid into LNPs reduces accumulation of particles in liver, while mean positive zeta-potential leads to lungs accumulation. However, anionic LNPs have a rather low RNA loading efficiency, due to the charge repulsion against mRNA molecules. To overcome this limitation lipopolyplexes particles were formed via two-step technique. Lipopolyplexes are synthesized by the following steps: firstly, cationic polyplex formation followed by addition of anionic lipid membrane or polymer shell. Such composition improves stability of particles and can reduce toxicity. Accordingly, using U155, hybrid lipopolymer nanoparticles were formulated (FIG.11). Briefly, a solution of the lipopolymer in ethanol was combined with an aqueous phase containing mRNA in an acetate buffer (25 mM, pH 5). The resulting mixture was then left to incubate for 30 minutes, allowing the polyplexes to form. The polyplexes were mixed (2 / 1 w / w) with ethanol phase containing DSPG, soy PC, cholesterol and DMG-PEG2000 (molar ratio 22 / 23 / 50 / 5) using microfluidic mixing. The final formulation was dialyzed against Tris-HCl buffer (25 mM, pH 7.4) for 3-4 hours at room temperature. Cholesterol plays a useful role in enhancing the stability of liposomes and lipopolymer nanoparticles (LNPs), which, in turn, affects their blood clearance. Additionally, cholesterol has been found to enhance the transfection efficiency of RNA. Studies have indicated that an optimal molar content of cholesterol in liposomes or LNPs is typically in the range of 38.5-50%.50% of cholesterol was used from the total lipid amount of liposomal membrane, aligned with reports in literature. The optimal molar concentration of PEG-lipid in liposomes can vary depending on the specific application. To evade the body's immune system and extend liposomes circulation time it was shown that 5% molar PEG-lipid is optimal. Moreover, it has been shown that inclusion of 2-5 mol % of C18-PEG2000 in hybrid polymer-lipid nanoparticles may be efficient for lung-targeting. Addition of DSPG showed improved in vitro mRNA transfection (FIGS.12 and 13). An increase in DSPG from 22 mol% to 31.5 mol% resulted in a dramatic reduction of mRNA transfection in the lung after i.v. injection (FIG.13). This reduction was due to lower nanoparticles stability, as the negatively charged head groups of DSPG are in close proximity and repel each other, destabilizing the bilayer. Cryo-TEM images showed a rather irregular structure of hybrid SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 nanoparticles (FIG.14). Notably, the polyplex core had a multilamellar structure due to the presence of hydrophobic and hydrophilic chains of polymer. Covering of U155 polyplex with lipid bilayer significantly decreased the total particle zeta-potential to 11.4±7.7 mV (FIG.15). Titration with fluorescent dye TNS at various pH values showed a slowly falling trend line, which suggest multiple overlapping pKa values in the system (FIG.16). Encapsulation efficiency of produced nanoparticles was above 98% with a good recovery (> 75%), mean diameter 120 nm with PDI<0.2 (FIG.17). While Cryo-TEM showed some clear variability of particle morphology, DLS suggested a rather low dispersity. Next, a produced U155@lipid nanoparticle formulation was used to study efficiency of mRNA delivery of lead polymer U155 to the lung. The lipid shell increased nanoparticles tropism for the lungs 5-fold compared to bare U155 polyplexes (compare FIG.18 and FIG.19). Overall, the optimized particle demonstrated superior effectiveness compared to the commercially available in vivo JetPEI^across multiple doses, particularly showing a 300-fold higher efficacy at 10 µg of Fluc mRNA per mouse (FIG.20). Interestingly, U155@lipid particles showed a non-linear dose response in lungs (FIG.19). Such effect has been reported in some cases of various non-liver targeted nanoparticles, in particular polymeric ones. For example, in a tumor model, increased target tissue and cell accumulation of nanoparticles was shown through reduction of uptake by phagocytic cells such as macrophages and dendritic cells in the liver and spleen. Multiple strategies exist to deplete macrophages, such as pre-injection of clodronate and other agents or blank particles of the same composition as ones with active molecule. As the formulation disclosed herein contains lipids which have tropism to the liver, the actual biodistribution of U155@lipid nanoparticles was first checked by labeling them with fluorescent dye DiD. In situ, produced particles were stable in 50% serum at 37 °C for at least 4 hours. Mice were injected via tail vein with 5 µg Fluc mRNA nanoparticles with 0.1 mol % DiD and U155@lipid nanoparticles preferentially accumulated in the lungs, to a lesser extent in the spleen and liver (FIG.21). Without being bound to a particular theory, the low liver tropism may be due to phagocytosis of these lipids by macrophages that are targeted then towards the liver and differentiate into Kupfer cells. To test this, blank U155@ lipid nanoparticles were injected 12 hours prior to administration of 5 µg Fluc mRNA nanoparticles (FIG.22). The blank particles were prepared using the same method as the mRNA-loaded particles, and their concentration was adjusted to match the 5 µg dose of loaded particles by volume. The pretreatment increased the luciferase expression in the lungs about 2-fold compared to standard scheme (FIG.23). In contrast, co-injection of a mixture of blank particles with Fluc mRNA loaded ones did not affect particles distribution and accumulation. Interestingly, a similar effect was observed after multiple dosages of U155@lipid nanoparticles loaded with Fluc mRNA. Since luciferase expression is cleared from the SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 body within 24-48 hours after 5 µg Fluc mRNA administration, a second dose of the same formulation was injected 48 hours after first administration. A 2-fold increase in protein expression was observed after the second dose. These data suggest that through saturation of macrophages one can redirect these nanoparticles to the lungs. Importantly, these data further suggest that these nanoparticles can enable multiple dosage of mRNA without compromising transfection efficiency. Additionally, the possibility of lungs inflammation was assessed after 1 dose injection, which could affect the particles accumulation. Lungs histological samples did not reveal cells infiltration or tissue destructions 24 hours post-treatment with U155@lipid nanoparticles (FIGS.23 and 24). No cytokines, involved in acute inflammation, such as IL-1, IL-6 or TNFα were detected in the serum samples taken before the lungs were removed (FIG.25). In light of the observed results, which demonstrate the delivery and transfection of Fluc mRNA in multiple organs by the disclosed platform, molecular lung targeting was excluded as, for example, in the case of lipidoid 06-N16B, which showed particles accumulation in the lung, liver and spleen, but protein expression was detected only in the lung. This could potentially be elucidated as ‘passive’ organ-selective delivery, a process that enhances targeting toward the lungs by the electrostatic attraction of positively charged nanoparticles and negatively charged blood components (proteins, cells). This effect is likely due to the high local blood flux and the extensive surface area of pulmonary endothelium, facilitating delivery and uptake of mRNA molecules in the lungs. iv) Lipopolymer nanoparticles enable gene editing in lungs and T cells To identify the potential applications of the U155@lipid nanoparticles (lipopolymer nanoparticles) for gene editing, the cell populations within the lungs that express the mRNA product were determined using the Ai9 mouse strain. Upon administration and functional expression of Cre-recombinase, the stop codon was excised, and cells expressed tdTomato protein. First, the organ distribution of tdTomato protein was checked. Lungs, spleen and liver were collected and the number of tdTomato positive cells was identified using flow cytometry (data not shown). The lungs were the primary organ that showed significant transfection (FIG.26), while the spleen and liver exhibited Cre mRNA transfection to a lower degree (data not shown). These observed results further supported the hypothesis of ‘passive’ tissue targeting mechanism by lipopolymer nanoparticles. The majority of tdTomato+ cells in the lungs transfected by lipopolymer nanoparticles were identified as CD31+ endothelial cells, CD45+ immune cells (FIG.26). CD31+ cells can be further divided into CD45- / CD31+ and CD45+ / CD31+ subpopulations. It was found that less than 30% of tdTomato+ cells are CD45- / CD31+ endothelial and more than 50% of them are CD45+ / CD31+ hematopoietic cells or endothelial precursor (FIG.26). SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 Considering that immune cells survive the process of tissue digestion and staining better than others cell types, to further support the data and show tissue localization of populations detected by flow cytometry, formalin fixed paraffin embedded tissue samples were stained with key markers (CD31, CD45 and E-cadherin) for multiplex immunohistochemistry (IHC) (FIG.27). Processing of IHC images of tdTomato+ stained tissue revealed higher transfection rates (FIG.27) compared to flow cytometry (FIG.26). Multiplex IHC images showed colocalization of tdTomato signal with endothelial and immune cells (FIG.28), but CD45- / CD31+ / tdTomato+ subpopulation evidently prevails. Notably, based on tissue morphology, U155@lipid nanoparticles not only reach blood vessels, but also Lyve1+ lymphatic vessels (FIG.28). Positively charged nanoparticles have been reported to extravasate out of the blood vessel into lymphatics through fenestrations in the endothelium or through transcellular transport through increased interaction and adsorption to the negatively charged cell membranes of endothelial cells. Some rare colocalizations with E- cadherin+ epithelial cells were also observed, while no transfection of large airways was found (FIG.28). Among CD45+ / tdTomato+ immune cells a portion of T cell receptor positive (TCRb+) (∼5%) and B220+ cells (∼1%) were transfected. T cell lymphocytes are important regulators and effectors of adaptive immune response, and their transfection in vivo offers unique opportunities to advance cancer immunotherapy, autoimmune diseases treatment or vaccine development. Also, small portion of TCRb+ / tdTomato+ cells (∼0.4%) was detected in spleen tissue. Activation of T cells could be associated with inflammation, however, H&E of lung (FIG.28) and liver (FIG.29) tissues 3 days post Cre mRNA injection did not reveal any signs of inflammation or tissue damage. Periodic Acid-Schiff (PAS) staining combined with Fast Green counterstaining, which is sensitive to liver function, also did not show evidence of toxicity (FIG.29). After demonstrating a high lungs tropism upon i.v. delivery and achieving successful transfection in endothelial and T cells with in vivo tolerability, the potential of employing U155@lipid nanoparticles for efficient delivery of CRISPR-Cas9 complexes to the lungs in the Ai9 mouse strain was investigated. Delivered Cas9 / sgRNA system introduces insertions or deletions in tdTomato STOP cassettes, negating the STOP codon and resulting in protein expression. U155@lipid nanoparticles encapsulating Cas9 mRNA+sgRNA (1 / 1 wt / wt) were injected via tail vein at dose of 19 µg total RNA and quantified gene editing on the 9 days post injection. Multiplex IHC of lung tissue revealed editing only in CD31+ endothelial cells (FIG.28). As Cre- recombinase editing was at least 15-fold more efficient than the CRISPR-Cas9 complex (FIG.27 and FIG.30), concentration of potentially edited CD45+ cells detected by IHC was expected to be lower. To prove that tdTomato expression was caused by indels of three STOP codons, next- generation sequencing analysis of DNA extracted from lungs was used. Editing was quantified as SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 sum of the insertions and deletions, normalized to the number of reads, resulting in a % of reads containing indels. It was found that treated mice displayed 5.6 ± 2.4 % of editing (FIG.31). The results demonstrated that the disclosed novel hybrid system delivered mRNA to the lungs with minimal distribution to undesirable organs like liver and spleen after i.v. administration. The results also demonstrated that pre-treatment injections with blank nanoparticles can increase gene delivery to the lungs. These results demonstrated the promising potential of the disclosed delivery system for enabling CRISPR Cas9 gene editing in the lung endothelial and immune cells for a variety of therapeutic contexts such as cancer immunotherapy and treatment of lungs autoimmune diseases. v) Conclusion The results herein demonstrated that the inventors have successfully implemented a highly efficient method for synthesizing cationic PEI-based polymers utilizing the split-Ugi reaction. Using a two-step approach, hybrid polymer-lipid nanoparticles were produced. These nanoparticles selectively delivered and induced effective mRNA expression in lung endothelium and immune cells, including T and B cells, with minimal in vivo toxicity. Remarkably, U155@lipid nanoparticles demonstrated nearly 300-fold higher potency in systemic mRNA delivery to the lungs compared to in vivo-JetPEI^. It was also demonstrated that U155@lipid nanoparticle accumulation in the lungs could potentially be elucidated as ‘passive’ organ-selective delivery. And pre-injection of blank nanoparticles decreased the liver accumulation, thereby improving U155@lipid nanoparticle mRNA delivery to the lungs. Moreover, U155@lipid nanoparticles demonstrated the efficient delivery of CRISPR-Cas9 complexes to the lungs, resulting in significant gene editing within tissues. These findings underscore the tremendous potential of the disclosed synthetic approach and the resulting molecules for systemic mRNA delivery and gene editing in the lungs, holding promise for a wide range of therapeutic applications, including, but not limited to, cystic fibrosis, COPD, PCD, lung cancer, asthma, rare genetic disorders of the lung, pulmonary arterial hypertension, and pulmonary fibrosis. In view of the many possible aspects to which the principles of the disclosed technology may be applied, it should be recognized that the illustrated aspects are only preferred examples of the disclosure and should not be taken as limiting the scope of the disclosure. Rather, the scope of the disclosure is defined by the following claims. We therefore claim as the technology all that comes within the scope and spirit of these claims.
Claims
SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 We claim:
1. A compound according to Formula I Y[-Z-Ao-X]yFormula I or a pharmaceutically acceptable salt thereof, wherein: Y is H, C6-10aryl, 5-, 6- or 7-membered heteroaryl, or CH4-y; y is an integer from 1 to 10, with the provisos that when Y is H, then y is 1, and when Y is CH4-y then y is 1, 2, 3, or 4, and wherein y indicated the number of -Z-Ao-X units that are each independently attached to the Y moiety; and for each [-Z-Ao-X] unit independently Z is C1-6alkyl; X is OH, or -NH-C1-4alkyl-C6-- 6alkyl;o is an integer from 2 to 500; each A independently is selected from moieties B, C or D, wheren C moieties and from 0 to p D moieties, where m is an integer from 1 to o / 2, n is an integer from 1 to o / 2, p is an integer from 0 to o-2, and m + n + p = o; R1is H, C4-20alkyl, C6-15alkenyl with from 1 to 3 double bonds, C3-8cycloalkyl, or C6-10aryl; R2 is C4-20alkyl, C3-8cycloalkyl, -C1-4alkyl-C6-10aryl, -C1-4alkyl-N(Ra)2 or -C1-4alkyl- C(O)OC1-4alkyl; R3 is C1-15alkyl, -C1-4alkyl-N(Ra)2, -C1-4alkyl-O-C1-6alkyl-O-C1-4alkyl, PEG500- PEG2k, PEtOx5-50, PMeOx5-50, poly(2-methyl-2-oxazine)5-50, poly(N-methylglycine)5-50, poly(dimethylacrylamide)5-50, poly(dimethylmethacrylamide)5-50, poly(N-(2- hydroxypropyl)acrylamide)5-50, poly(N-(2-hydroxypropyl)methacrylamide)5-50, poly(N- (2-hydroxyethyl)acrylamide)5-50 or poly(N-(2-hydroxyethyl)methacrylamide)5-50;SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 each Raindependently is H or C1-6alkyl, or two Ratogether with the atom to which they are attached form a 3- to 8-membered heterocyclyl comprising 1, 2, or 3 heteroatoms independently selected from O, N or S and optionally substituted with 1, 2 or 3 C1-6alkyl; and Rbis H, -C(O)OH or -C(O)O(C1-6alkyl), such as -C(O)OMe, -C(O)OEt, - C(O)Oisopropyl or -C(O)Ot-butyl.
2. The compound of claim 1, wherein the compound has a structure according to Formula II or Formula III, or a pharmaceutically acceptable salt thereof ; and 500.
3. The compound of claim 1, wherein Y is H and y is 1.
4. The compound of claim 1, wherein Y is CH4-yand y is 1, 2, 3, or 4.
5. The compound of claim 1, wherein Y is phenyl and y is from 3-6.
6. The compound of claim 1, wherein the compound has a structure according to Formula IV, Formula V, or Formula VI, or a pharmaceutically acceptable salt thereofSJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 , ;with respect to Formula V, y is 1, 2, 3, or 4; and with respect to Formula VI, y is an integer from 3-6.
7. The compound of claim 1, wherein X is OH or -NHCH2Ph.
8. The compound of claim 1, wherein m and n are the same.
9. The compound of claim 1, wherein m and n are different.
10. The compound of claim 1, wherein p is 0.
11. The compound of claim 1, wherein R1 is H, C4-15alkyl, C6-12alkenyl with from 1 to 3 double bonds, C5-8cycloalkyl, or C6aryl.
12. The compound of claim 1, wherein R1is H, C5-12alkyl, C8-10alkenyl with from 2 double bonds, C6cycloalkyl, or C6aryl.
13. The compound of claim 1, wherein R2 is C4-15alkyl, C5-8cycloalkyl, -C1-2alkyl-C6-10aryl, -C1-4alkyl-N(Ra)2or -C1-2alkyl-C(O)OC1-4alkyl.
14. The compound of claim 13, wherein N(Ra)2 is morpholinyl or piperidinyl.
15. The compound of claim 1, wherein R3 is C1-10alkyl, -C2-4alkyl-N(Ra)2, or -C1-2alkyl- O-C2-4alkyl-O-C1-2alkyl.
16. The compound of claim 1, wherein R3is PEG750-PEG1250, PEtOx5-50, PMeOx5-50,poly(2-methyl-2-oxazine)5-50, poly(N-methylglycine)5-50, poly(dimethylacrylamide)5-50,SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 poly(dimethylmethacrylamide)5-50, poly(N-(2-hydroxypropyl)acrylamide)5-50, poly(N-(2- hydroxypropyl)methacrylamide)5-50, poly(N-(2-hydroxyethyl)acrylamide)5-50 or poly(N-(2- hydroxyethyl)methacrylamide)5-50. ,19. The compound of claim 1, wherein X .
20. The compound of claim 1, wherein X is OH.
21. The compound of claim 6, wherein the -C1-4alkyl- moiety is -CH2-.SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 22. The compound of claim 1, wherein the compound has a structure according to one or the following formulas, or a pharmaceutically acceptable salt thereof ;23. The compound of claim 1, selected from ,SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 or24. A composition comprising a compound according to any one of claims 1-23.
25. The composition of claim 24, wherein the composition is a nanoparticle.
26. The composition of claim 24, wherein the composition further comprises an agent.
27. The composition of claim 26, wherein the agent is a nucleic acid, small molecule drug, protein, polypeptide, antibody, peptide or a combination thereof.
28. The composition of claim 26, wherein the agent is a nucleic acid.
29. The composition of claim 28, wherein the nucleic acid is a single stranded DNA, single stranded RNA, double-stranded DNA, RNA-RNA hybrid, DNA-RNA hybrid, shortmer, antagomir, antisense, ribozyme, small interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), or a combination thereof.
30. The composition of claim 28, wherein the nucleic acid is mRNA.
31. The composition of claim 28, wherein the nucleic acid is not covalently attached to the compound.SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 32. The composition of claim 24, wherein the composition further comprises a phospholipid, a structural lipid, a polymer-conjugated lipid, or a combination thereof.
33. The composition of claim 32, wherein the phospholipid is selected from 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC),1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero- phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn- glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1- palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1- glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1- stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, or lysophosphatidylethanolamine (LPE), L-α-phosphatidylcholine (Soy- PC), 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium salt) (DSPG), or a combination thereof.
34. The composition of claim 32, wherein the structural lipid is selected from cholesterol, beta-sitosterol, cholestanol, fucosterol, campesterol, stigmastanol, brassicasterol, ergosterol or stigmasterol.
35. The composition of claim 32, wherein the polymer-conjugated lipid is selected from a PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modifiedSJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 phosphoethanolamine, PEG-modified ceramide (PEG-CER), PEG-modified dialkylamine, PEG- modified diacylglycerol (PEG-DAG), PEG-modified dialkylglycerol, or a combination thereof.
36. The composition of claim 32, wherein the polymer-conjugated lipid has a molecular weight of from 200 to 40,000 daltons.
37. The composition of claim 24, wherein the composition comprises the compound, mRNA, and lipids DSPG (1,2-Distearoyl-sn-glycero-3-phosphoglycerol), soy PC (L-α- phosphatidylcholine), cholesterol and DMG-PEG2000.
38. A pharmaceutical composition comprising the composition of any one of claims 24- 37, and a pharmaceutically acceptable excipient.
39. A method for making a composition according to any one of claims 24-37, the method comprising combining a first solution comprising a compound according to any one claims 1-23 with a second solution comprising a phospholipid, a structural lipid, a polymer-conjugated lipid, or a combination thereof.
40. The method of claim 39, wherein the method further comprises combining the compound with an agent to form the first solution.
41. The method of claim 39, wherein the agent comprises a nucleic acid, small molecule drug, protein, polypeptide, antibody, peptide, or a combination thereof.
42. A method of using a composition according to any one of claims 24-38, comprising administering an effective amount of the composition to a subject.
43. The method of claim 42, wherein administering the nanoparticle comprises administration by an intravenous, intramuscular, or intradermal route.
44. The method of claim 42, wherein administering to the subject comprises administering to lung and / or spleen tissue.SJB 245-111627-02 OSU-23-48 FILED ELECTRONICALLY ON June 3, 2025 45. The method of claim 44, wherein administering to the subject comprises administering to lung tissue.
46. Use of a compound of any one of claims 1-23 or a composition according to any one of claims 24-38 in the preparation of a medicament for administration to a subject.
Citation Information
Patent Citations
Compositions for introducing RNA into cells
US20170021036A1
Thiophene-based lipids
WO2023049493A1
Cited By
Dihydroxy vitamin D metabolite pretreatment kit and sample pretreatment method
CN122109397A