Methods for detection of single-stranded DNA (SSDNA) gaps
The NTS assay addresses the inadequacies of current methods by detecting single-stranded DNA gaps to predict PARPi efficacy and resistance, enhancing patient selection and treatment strategies for BRCA1/2 mutation-like tumors.
Patent Information
- Application Number
- PCT/US2025/032512
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-05
- Filing Date
- 2025-06-05
- Publication Date
- 2025-12-11
AI Technical Summary
Current methods for identifying patients with tumors having functional deficits akin to BRCA1 or BRCA2 mutations are inadequate, particularly in predicting the efficacy of PARPi treatments, as they rely on homologous recombination as a central mechanism and do not effectively assess single-stranded DNA gaps.
A nick translation signal (NTS) assay is developed to detect single-stranded DNA gaps by permeabilizing cells, using labeled dNTPs and DNA polymerases, and quantifying incorporation to identify cells with gap suppression and repair defects, applicable to both tissue culture and fixed patient samples.
The NTS assay provides a rapid and definitive indicator of tumor sensitivity to PARPi, enabling precise patient selection and monitoring treatment resistance, and predicting synergistic effects with chemotherapy.
Smart Images

Figure 00000036_0000 
Figure 00000037_0000 
Figure 00000037_0001
Abstract
Description
[0001] Methods for Detection of single-stranded DNA (ssDNA) Gaps
[0002] CLAIM OF PRIORITY
[0003] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 656.302, filed on June 5, 2024. The entire contents of the foregoing are incorporated herein by reference.
[0004] SEQUENCE LISTING
[0005] This application contains a Sequence Listing that has been submitted electronically as an XML file named 07917-0453W01_SL_ST26.xml. The XML file, created on June 4. 2025. is 7,020 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.
[0006] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0007] This invention was made with Government support under Grant No. CA268524 and CA254037 awarded by the National Institutes of Health. The Government has certain rights in the invention.
[0008] TECHNICAL FIELD
[0009] Provided herein are nick translation signal (NTS) assays and methods of use there for identifying subjects with tumors with functional deficits akin to those in BRCA1 or BRCA2 mutations, who are candidates for treatment with a treatment designed to induce cell death by direct or indirect DNA damage, e g., poly(ADP- ribose) polymerase inhibitors (PARPi) in mono and combination therapies.
[0010] BACKGROUND
[0011] The efficacy of targeted cancer therapies hinges on precise patient selection, particularly for poly(ADP-ribose) polymerase inhibitors (PARPi). These agents are most effective in tumors with functional deficits akin to those in BRCA1 or BRCA2 mutations. i SUMMARY
[0012] Provided herein are methods of detecting a nick translation signal (NTS) in a cell. The methods comprise (a) permeabilizing the cell without losing membrane integrity (e.g., with a non-ionic detergent or enzyme such as Tween-20, saponin, Triton X-100, NP-40 (nonyl phenoxypolyethoxylethanol), Proteinase K, or streptolysin O); (b) contacting the cell with nick filling reagents comprising a polymerase (e.g.. DNA Pol I, T4, or Klenow fragment (3‘->5‘ exo-)) and dNTPs. one of which is labeled; preferably dATP, dGTP, dCTP, and BrdUTP or EdUTP; (c) maintaining the cell in contact with the nick filling reagents for a sufficient time, e.g., 3-30 minutes, e.g., 3-10 minutes, e.g., about 5 minutes for FFPE samples, or 20-60 minutes, e.g.. about 30 minutes for cell culture samples; (d) fixing the cell; and (e) detecting incorporation of the labeled dNTPs into the genome of the cell, thereby detecting an NTS in the cell.
[0013] In some embodiments, the labeled dNTP is BrdUTP or EdUTP.
[0014] In some embodiments, detecting incorporation of the labeled dNTPs into the genome comprises using a detection reagent that detects the incorporation of the labeled dNTP, optionally comprising an anti-BrdU or anti-EdU antibody, optionally wherein the anti-BrdU or anti-EdU antibody, or a secondary' antibody that binds to the anti-BrdU or anti-EdU antibody, is fluorescently labeled.
[0015] In some embodiments, the methods use a fluorescence detection method, e.g., fluorescence microscopy or FACS, to detect and optionally quantify a signal from the detection reagent.
[0016] In some embodiments, the methods further comprise quantifying a level of incorporation of the labeled dNTPs into the genome and optionally comparing the level to a reference level of incorporation, and further optionally calculating a score based on the comparison.
[0017] In some embodiments, the methods further comprise incubating the cell in the presence of a test compound before step (a), and optionally comparing the NTS in the presence of a test compound to the NTS in a cell in the absence of the test compound.
[0018] In some embodiments, the methods further comprise identifying the test compound as promoting gap suppression (GS) and repair defects when the level of incorporation in the presence of the test compound is above the level in the absence of the test compound. In some embodiments, the cell is a cancer cell. In some embodiments, the cancer cell is from a cancer in a subject, preferably a mammalian subject, preferably a human subject. In some embodiments, the cancer is breast cancer, e.g., triple negative breast cancer, or ovarian cancer.
[0019] In some embodiments, the cell is in a formalin fixed and paraffin embedded (FFPE) sample. In some embodiments, the cell is in a FFPE sample, and the methods further comprise before step (a): deparaffmizing and rehydrating the sample; and treating the sample with Proteinase K (e g., to reverse crosslinks produced by the FFPE fixation method).
[0020] In some embodiments, the methods further comprise identifying a subject who has a cancer cell with a level of NTS above a reference level, and selecting and optionally administering a treatment to the subject.
[0021] In some embodiments, the treatment comprises administering a genotoxin, optionally a PARP inhibitor, cisplatin, or carboplatin.
[0022] Also provided herein are methods of monitoring development of treatment resistance in a human subject who has cancer. The methods comprise: determining an initial NTS using the method of claim 1 in a sample from the subject, preferably obtained before or just after treatment is initiated; administering one or more doses of the treatment to the subject; determining a subsequent NTS in a sample from the subject using a method as described herein in a sample from the subject obtained after the one or more doses are administered; and comparing the subsequent NTS to the initial NTS, wherein a decrease in the subsequent NTS as compared to the initial NTS indicates that the subject is developing treatment resistance.
[0023] In some embodiments, the treatment is administering a PARP inhibitor, cisplatin, or carboplatin. In some embodiments, the treatment is a treatment designed to induce cell death by direct or indirect DNA damage, e.g., radiation therapy or chemotherapy, e.g., with a genotoxin, e.g., a PARPi, cisplatin, carboplatin, neocarzinostatin (NCS), an ataxia telangiectasia mutant (ATM) inhibitor (ATMi), Ataxia telangiectasia- mutated and Rad3-related kinase inhibitor (ATRi). a ubiquitinspecific protease 1 (USP1) inhibitor (USPli), a flap endonuclease 1 (FEN1) inhibitor (FENli), and / or 5-hydroxymethyl-2’-deoxyuridine (hMDU), or pharmaceutically acceptable salts thereof. Exemplary PARPi include olaparib, veliparib, rucaparib, niraparib, talazoparib, saruparib and pamiparib. Exemplary ATMi include AZDI 390, KU-55933, KU-60019, Wortmannin, CP-466722, M3541, Lartesertib (M4076), AZ31, AZD0156, and Mirin. Exemplary ATRi include VE-821, Dactolisib (BEZ235), Berzosertib (VE-822), AZ20, Camonsertib (RP-3500), SKLB-197, Elimusertib (BAY- 1895344), Elimusertib (BAY-1895344), Ceralasertib (AZD6738), Schisandrin B, Tuvusertib, and HAMNO. Treatments that target both ATM and ATR can also be used, e.g., Torin 2, ETP-46464, or CGK-733. Exemplary USPli include ML-323, ASN-3186. ISM3091, KSQ-4279. USP1-IN-2, and Pimozide. Exemplary FENli include LNT1, FEN1-IN-2, FEN1-IN-3, FEN1-IN-4, FEN1-IN-5, FEN1-IN-6, FEN1- IN-7, and FEN1-IN-SC13.
[0024] As used herein, “about'’ means the value plus or minus 10%.
[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety7. In case of conflict, the present specification, including definitions, will control.
[0026] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
[0027] DESCRIPTION OF DRAWINGS
[0028] FIGS. 1A-1E: Modified NT assay identified endogenous nicks induced by nickase and in cells deficient in nick repair. A) Schematic of nick translation assay used to detect the induction of nicks by Cas9-mckase. B-C) (B) Representative images and (C) quantification of BrdUTP incorporation after induction of nicks at 0, 1, 4, or 13 target sites in RPE1 WT cells. Conditions with and without Pol I was included as a control. ****p<0.0001 by Student’s T-test. D-E) (D) Representative images and (E) quantification of BrdUTP incorporation in untreated RPE1 WT. PARP1 KO, and XRCC1 KO cells to assess endogenous nicks. ****p<0.0001 by Student’s T-test.
[0029] FIGS. 2A-2E: BRCA-RAD51 pathway deficient cells displayed an elevated NTS. A-E) Representative images and quantification of BrdUTP incorporation in untreated A) RPE1 WT and BRCA1 KO cells, B) MDA-MB-436 +BRCA1 and +vector cells, C) VC8 +BRCA2 and +vector cells, D) HeLa WT and BRCA2 KO cells, and E) RAD51 + / +, + / -, and T131P cells. ****p<0.0001 by Student’s T-test.
[0030] FIGS. 3A-3E: The NTS was enhanced in BRCA1 deficient cells in response to sensitizing therapies PARPi and cisplatin. A) Schematic of PARPi and cisplatin induction of ssDNA gaps in DNA. B-C) Quantification of BrdUTP incorporation in untreated and 10 pM PARPi treatment for 4 hours in B) RPE1 WT and BRCA1 KO cells, and C) HeLa WT and BRCA2 KO cells. ****p<0.0001 by Student’s T-test. D) Omitted. E-F) Quantification of BrdUTP incorporation in untreated and 4 pM cisplatin treatment for 2 hours in E) RPE1 WT and BRCA1 KO cells, and F) HeLa WT and BRCA2 KO cells. ****p<0.0001 by Student’s T-test.
[0031] FIGS. 4 -4D: The NTS predicted PARPi resistance in unperturbed conditions. A-D) Quantification of BrdUTP incorporation in untreated A) RPE1 WT, BRCA1 KO, and BRCA1 53BP1 KO cells, B) MDA-MB-436 +BRCA1, +vector, and RR1 cells C) BR5 and BR5-R1 cells, and D) PEO1 and C4-2 cells. ****p<0.0001 by Student’s T-test.
[0032] FIGS. 5A-5D: NTS for analysis of fixed breast cancer tumor samples. A) Representative images and B) quantification of BrdUTP incorporation with and without Pol I included in the reaction in MDA-MB-436 +BRCA1 tumor sections treated with DNase 1 for 10 minutes. Statistical analysis by two-tailed Mann-Whitney test. C) Representative images and D) quantification of BrdUTP incorporation with and without Pol I included in the reaction in MDA-MB-436 +BRCA1 and +Vector tumor sections. The tumor sections were from injection of the MDA-MB-436 cells (IxlO6) into the mammary fat pad of NOD scid mice. Tumors were excised, embedded in paraffin, and FFPE blocks w ere sectioned for use in the NTS assay. ****p<0.0001 by Kruskal-Wallis with Dunn’s multiple comparison test.
[0033] FIGS. 6A-6H: The NTS was enhanced in BRCA1 deficient cells in response to a range of drugs and can detect synergies between drugs. A-G) Quantification of BrdUTP incorporation in RPE1 WT and BRCA1 KO cells after treatment with A) neocarzinostatin (NCS); B) ATMi (AZD1390); C) ATRi; D) hydrogen peroxide; E) Uspli; F) Fenli; or G) hMDU as compared to the untreated condition. All treatments were for 1 hour unless otherwise noted and concentrations of drugs are as indicated. H) Quantification of BrdUTP incorporation in RPE1 WT and BRCA1 KO cells showing the synergistic interaction between PARPi and hMDU. ****p<0.0001 by Student’s T-test.
[0034] FIGS. 7 -7C: Exemplary flowcharts for methods described herein. A) Nick translation in cell culture, version 1; B) Nick translation in cell culture, version 2; and C) Nick translation in FFPE samples.
[0035] FIGS. 8A-8T: NTS assay is a tool that can identify the mechanism of inherent gaps in BRCA1 deficient cells. A) Quantification of BrdUTP incorporation in RPE1 WT and BRCA1 KO cells after treatment with DMSO, APH [2 uM ], and HU [2 mM] for 1 hour. B) Following APH and HU treatment for 1 hour, 10 pM EdU was added for 30 minutes, followed by Click-it to quantify replicating cells. C) Quantification of BrdUTP incorporation in MDA-MB-436 +BRCA1 and +Vector cells after treatment with DMSO, APH [2 pM], and HU [2 mM] for 1 hour. D) Following APH and HU treatment for 1 hour, 10 pM EdU was added for 30 minutes, followed by Click-it to assess replicating cells. E) A representative western blot analysis with indicated antibodies of lysates from RPE1 WT and BRCA1 KO cells expressing small interfering RNA (siRNA) against control (Ctrl) and PrimPol. F) Quantification of BrdUTP incorporation in RPE1 WT and BRCA1 KO cells expressing siCtrl and siPrimPol. G) A representative western blot analysis with indicated antibodies of lysates from MDA-MB-436 +BRCA1 and +Vector cells expressing si Ctrl and siPrimPol. H) Quantification of BrdUTP incorporation in MDA- MB-436 +BRCA1 and +Vector cells expressing siCtrl and siPrimPol. I) A representative western blot analysis with indicated antibodies of lysates from RPE1 WT and BRCA1 KO cells expressing siCtrl and siMrel l. J) Quantification of BrdUYP incorporation in RPE1 WT and BRCA1 KO cells expressing siCtrl and siMrel l. K) A representative western blot analysis with indicated antibodies of lysates from MDA-MB-436 +BRCA1 and +Vector cells expressing siCtrl and siMrel 1. L) Quantification of BrdUTP incorporation in MDA-MB-436 +BRCA1 and +Vector cells expressing siCtrl and siMrel 1. M) A representative western blot analysis with indicated antibodies of lysates from RPE1 WT and BRCA1 KO cells expressing siCtrl and siExol. N) Quantification of BrdUTP incorporation in RPE1 WT and BRCA1 KO cells expressing siCtrl and siExol. O) A representative western blot analysis with indicated antibodies of lysates from MDA-MB-436 +BRCA1 and +Vector cells expressing siCtrl and siExol. P) Quantification of BrdUTP incorporation in MDA-MB-436 +BRCA1 and +Vector cells expressing siCtrl and siExol. Q) A representative western blot analysis with indicated antibodies of lysates from RPE1 WT and BRCA1 KO cells expressing siCtrl and siSmugl. R) Quantification of BrdUTP incorporation in RPE1 WT and BRCA1 KO cells expressing siCtrl and siSmugl . S) A representative western blot analysis with indicated antibodies of lysates from MDA-MB-436 +BRCA1 and +Vector cells expressing siCtrl and siSmugl . T) Quantification of BrdUTP incorporation in MDA- MB-436 +BRCA1 and +Vector cells expressing siCtrl and siSmugl. ****P<0.0001 by Kruskal-Wallis with Dunn's multiple comparison test Data represent mean ±SEM of at least three biological replicates.
[0036] FIG. 9: NTS assay can determine the mechanism of drug induced gaps in BRCA1 deficient cells. Quantification of BrdUTP incorporation in RPE BRCA1 KO cells expressing shNSC and shPrimPol after treatment with DMSO or cisplatin [4 pM] for 2 hours. ***P<0.001 and ****P<0.0001 by Kruskal-Wallis with Dunn’s multiple comparison test Data represent mean ±SEM of at least three biological replicates.
[0037] FIGS. 10A-10C: A) Quantification of BrdUTP incorporation after induction of nicks at 0 or 100 target sites and gaps (Cas9-D10A fused on a T7 exonuclease) at 100 target sites in RPE1 WT cells. Conditions with and without Pol I was included as a control. ****p<0.0001 by Student’s T-test.
[0038] FIGS. 11A-11B: A-B) Representative images and quantification of BrdUTP incorporation in untreated A) RPE1 WT and BRCA1 KO cells and B) DLD1 +BRCA2 and +Vector cells. ****p<0.0001 by Student’s T-test.
[0039] FIGS. 12A-12F: A-C) Quantification of BrdUTP incorporation in untreated and 10 pM PARPi treatment for 4 hours in A) RPE1 WT and BRCA1 KO cells, B) VC8 +BRCA2 and +Vector cells, and C) RAD51 + / +, + / -, and T131P cells.
[0040] ****pO .0001 by Student's T-test. D-F) Quantification of BrdUTP incorporation in untreated and 4 pM cisplatin treatment for 2 hours in D) RPE1 WT and BRCA1 KO cells, E) VC8 +BRCA2 and +Vector cells, and F) Rad51 + / +, + / -, and T131P cells. ****p<0.0001 by Student’s T-test.
[0041] FIGS. 13A-13N: A) A representative western blot analysis with indicated antibodies of lysates from RPE1 WT cells expressing shRNA against non-silencing control (NSC) and PrimPol. B) Quantification of BrdUTP incorporation in RPE WT cells expressing shNSC and shPrimPol. C) A representative western blot analysis with indicated antibodies of lysates from RPE1 BRCA1 KO cells expressing shNSC and shPrimPol. D) Quantification of BrdUTP incorporation in RPE BRCA1 KO cells expressing shNSC and shPrimPol. E) A representative western blot analysis with indicated antibodies of lysates from MDA-MB-436 +BRCA1 and +Vector cells expressing shNSC and shPrimPol. F) Quantification of BrdUTP incorporation in MDA-MB-436 +BRCA1 and +Vector cells expressing shNSC and shPrimPol. G-H) Quantification of BrdUTP incorporation after treatment with Mirin [50 pM] for 1 hour in G) RPE1 WT and BRCA1 KO cells and H) MDA-MB-436 +BRCA1 and +Vector cells. I-J) Quantification of BrdUTP incorporation after treatment with Dna2i [50 pM] for 1 hour in I) RPE1 WT and BRCA1 KO cells and J) MDA-MB-436 +BRCA1 and +Vector cells. K-N) Following Mirin [50 pM] or Dna2i [50 pM] for 1 hour, 10 pM EdU was added for 30 minutes, followed by Click-it to assess replicating cells. ****P<0.001 by Kruskal-Wallis with Dunn’s multiple comparison test Data represent mean ±SEM of at least three biological replicates.
[0042] DETAILED DESCRIPTION
[0043] Current strategies for identifying patients who have tumors with functional deficits akin to those in BRCA1 or BRCA2 mutations include comprehensive multipanel tests that evaluate a growing repertoire of DNA repair genes and assess genomic instability — often termed "genomic scarring" — as a proxy for homologous recombination deficiency (HRD), quantified using an 'HRD-score'. To refine the realtime assessment of HRD, assays such as RAD51 foci formation have been developed, which potentially offer better predictive value than mere genomic snapshots. Nevertheless, these methods still rely on homologous recombination (HR) as a central mechanism in the tumor's response to therapy. Proposed herein is the use of singlestranded DNA (ssDNA) gaps as a marker; ssDNA gaps may not only be a more definitive indicator of a tumor's sensitivity to PARPi but may also elucidate the observed synergistic effects of PARPi when combined with chemotherapy, even in the absence of detectable DNA repair anomalies. A thorough understanding of the vulnerabilities that render cancer cells sensitive to PARPi is vital, as DNA repair competence continues to be a key criterion for patient inclusion in clinical trials. Described herein is a robust biomarker based on the presence of singlestranded DNA (ssDNA) gaps, which was significantly upregulated in cells deficient in BRCA genes, indicating a native susceptibility to gap formation. Thus, the ssDNA gap biomarker has predictive potential, expanding uniquely in cancer cells when exposed to therapeutic agents that enhance their sensitivity7.
[0044] The integrity of DNA can be assessed by single molecule analysis of DNA fibers, a process that is not trivial but nevertheless can be applied to tumors (Cong et al., 2021; Panzarino et al., 2020), patient-derived organoids or circulating tumor cells (Hill et al., 2018; Yazinski et al., 2017). However, the current assays rely on treating samples with drugs such as PARPi to assess whether replication quality was perturbed. Alternatively, tumor avatars have been created to test drug efficacy on tumors implanted in mice prior to testing on patients, time being the key limitation. By contrast, the NTS provides a rapid determinant of inherent BRCAness without treatment required or time for assessing differential survival. The assays described herein are clinically useful to monitor the "‘BRCAness’" of tumors and guide the use of PARPi in mono and combination therapies.
[0045] We introduce a robust biomarker uniquely' recognizing SSBs (nicks and gaps) but not DSBs, which was significantly upregulated in cells deficient in BRCA genes, indicating a native susceptibility to SSB formation.
[0046] The assays and techniques we use are applicable to both tissue culture and human fixed patient samples. The combined and complimentary use of both TC and primary7patient tissue will provide insight into the generalizable changes in cancer and the basis for building tools aimed toward biomarker innovation.
[0047] By establishing that the presence of SSBs can forecast anti-cancer response and cancer onset in BRCA mutation carriers, the present methods can be used in disease prevention and intervention.
[0048] NTS assays
[0049] The general steps of the NTS assay are shown in FIG. 1A. In the first step, a cell, e.g., a cancer cell, is permeabilized without losing membrane integrity' (e.g., with a non-ionic detergent or enzy me such as Tween-20, saponin, TritonX-100, NP40, Proteinase K, or streptolysin O), and then contacted with nick filling reagents comprising a DNA polymerase (e.g., Pol I, T4, or Klenow fragment (3’->5’ exo-)) and dNTPs, one of w hich is labeled; preferably dA, dG, dC, and BrdUTP or EdUTP are used. The variety of DNA polymerases amendable to NTS allows for the detection of distinct substrates that inform biological features. In the standard assay, DNA Pol I allows for detection of nicks and polymerizes a BrdU-labeled region of DNA with a high level signal generation. The KI enow fragment (3 ’-5’ exo-) generates a greater signal compared to DNA pol I when nicks or gaps in DNA are in close proximity to each other such as in the lagging strand due to the inability of the enzyme to degrade 5’ DNA. Finally, the T4 polymerase is limited to filling gaps in DNA, generating a signal that informs solely on the gap load of a cells, allowing for information on how different genetic systems influence replication and repair or how chemotherapies damage the genome. As shown in FIG. 1A, DNA pol 1 removes the nucleotide at the 5’ end of the nick, degrades the DNA, and incorporates the dNTPs including the labeled dNTP. After a sufficient time, e.g., 20-60 minutes, e.g., about 30 minutes, the cells are fixed and a detection reagent that detects the incorporation of the labeled dNTP is added to the cells; preferably, where the labeled dNTP is BrdUTP, an anti- BrdUTP antibody is used where the labeled dNTP is EdUTP, an anti-EdU antibody is used. The presence of the detection reagent is then evaluated; for example, after unbound anti-BrdU / EdU antibody is removed a fluorescently secondary antibody that binds to the anti-BrdU / EdU antibody is added to the cells and fluorescence detected, e.g., using fluorescence microscopy; other detection methods including calorimetric or nanoparticle labeling methods can be used. The methods can include quantifying binding of the detection reaction and optionally comparing the binding to binding in a control reaction, e.g., a control reaction in which no polymerase is added and further optionally calculating a score based on the comparison.
[0050] The NTS assay was further optimized for application with fixed patient tumor samples. The modified assay can include the following. The cells are first permeabilized and fixed, e.g., with ethanol: acetic acid at a 3: 1 ratio respectively. Then the same fill in reaction is done as above, but can be performed only for 3-10 minutes, e.g., 5 minutes, as this method is more sensitive. The following steps are identical to those above. The alternate fixation method allows for the fill in to be performed after fixation making it amenable to be used on fixed patient tumor samples. The assay was then further optimized for fixed patient samples by adding several steps to the FFPE (formalin fixed and paraffin embedded) tumor samples. First the samples w ere deparaffinized and rehydrated. The crosslinks produced by the FFPE fixation method were then reversed, e.g., using Proteinase K. The crosslinks should be reversed so as not to impede the fill in reaction by Pol I. The samples were then permeabilized using TritonX-100 and proceeded to the same fill in reaction, e.g., for 5 minutes, and the following NTS assay steps as outlined previously.
[0051] FIGS. 7A-7C provide flow charts showing steps for exemplary methods of using nick translation in cell culture, version 1 (FIG. 7A) and version 2 (FIG. 7B) and nick translation in FFPE samples (FIG. 7C).
[0052] Cells
[0053] Cells useful in the present methods can be obtained from a variety of tissues including cancers including carcinomas and sarcomas, including metastatic cancers, or hematopoietic neoplastic disorders, e.g., leukemias. The term “carcinoma” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas (e.g., tracheal, lung, and bronchial cancer), gastrointestinal system carcinomas (e.g.. colorectal, esophageal, anal, and pancreatic cancer), genitourinary system carcinomas (e.g., adrenal, prostate, penile bladder, testicular, and kidney cancers), reproductive sy sterna carcinomas (e.g., ovary, fallopian tube, and peritoneal cancers), breast carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the disease is triple negative breast cancer. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues, and adenocarcinomas, which are a type of carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures, and includes adenocarcinomas of breast, lung, esophagus, stomach, colon, small bowel, rectum, pancreas, prostate, parotid gland, appendix, and uterus.
[0054] The term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation, including soft tissue sarcoma and osteosarcoma. In some embodiments, a cancer cell of the present disclosure is a breast cancer cell, an ovarian cancer cell, a pancreatic cancer cell, and / or a prostate cancer cell.
[0055] Cells useful in the present methods can be a cancer cell isolated from a tumor. Methods of collecting tumor cells are known in the art and suitable for use herein (see, e.g.. Chemecky & Berger, LABORATORY TESTS AND DIAGNOSTIC PROCEDURES (6ed.) Elsevier Health Sciences, 2012). In some embodiments, a cancer cell (e.g., a tumor cell) is deficient for the BRCA1 gene, the BRCA2 gene, or both. In some embodiments, a cancer cell (e.g., a tumor cell) comprises at genetic mutation in the BRCA1 gene, the BRCA2 gene, or both. In some embodiments, a cancer cell (e.g., a tumor cell) comprises at least one loss-of-function mutation in the BRCA1 gene, the BRCA2 gene, or both.
[0056] Treatment and Monitoring Development of Resistance
[0057] The assays as described herein can be used to detect nick translation signal (NTS), which is a biomarker of cellular genome- w ide ssDNA gaps, ssDNA breaks or nicks. The presence of an NTS above a reference level indicates that the cells have gap suppression and repair defects, and thus can be used to identify cancers that would be sensitive to treatment with genotoxic agents (such as PARPi or cisplatin). The reference level can be a level of NTS in a control cell. In some embodiments, the control cell is a cell in a control reaction, e.g., a control reaction in which the Cas nickase and / or gRNA is missing or altered to have no activity. In some embodiments, the reference level represents a level determined in a cohort of cells that do not have gap suppression and repair defects, e.g., cells that are resistant to treatment with PARPi and other genotoxins.
[0058] A subject who has a cancer with a NTS above the reference level can be treated, e.g., with a treatment designed to induce cell death by direct or indirect DNA damage, e.g., radiation therapy or chemotherapy, e g., with a genotoxin, e.g., a PARPi, cisplatin, carboplatin, neocarzinostatin (NCS), an ataxia telangiectasia mutant (ATM) inhibitor (ATMi), Ataxia telangiectasia- mutated and Rad3 -related kinase inhibitor (ATRi). a ubiquitin-specific protease 1 (USP1) inhibitor (USPli), a flap endonuclease 1 (FEN1) inhibitor (FENli), and / or 5-hydroxymethyl-2’-deoxyuridine (hMDU), or pharmaceutically acceptable salts thereof. Exemplary PARPi include olaparib, veliparib, rucaparib, niraparib, talazoparib, saruparib and pamiparib. Exemplary ATMi include AZD1390, KU-55933, KU-60019, Wortmannin, CP- 466722, M3541, Lartesertib (M4076), AZ31, AZD0156, and Mirin. Exemplary ATRi include VE-821, Dactolisib (BEZ235), Berzosertib (VE-822), AZ20, Camonsertib (RP-3500), SKLB-197, Elimusertib (BAY- 1895344), Elimusertib (BAY-1895344), Ceralasertib (AZD6738), Schisandrin B. Tuvusertib, and HAMNO. Treatments that target both ATM and ATR can also be used, e.g., Torin 2. ETP-46464, or CGK-733. Exemplary USPli include ML-323, ASN-3186, ISM3091, KSQ-4279, USP1-IN-2, and Pimozide. Exemplary' FENli include LNT1, FEN1-IN-2, FEN1-IN-3, FEN1-IN- 4, FEN1-IN-5, FEN1-IN-6, FEN1-IN-7. and FEN1-IN-SC13. These are available commercially, e.g., from Selleck Chemicals. Radiation therapy protocols are known in the art.
[0059] Provided herein are methods of administering an anti-cancer treatment to as subject having a cancer (e.g., a tumor). The methods provided by this disclosure can be used to treat an individual having any type of cancer (e.g., an individual diagnosed as having a cancer). In some embodiments, a subject can have or can be suspected of having cancer, a tumor, or any combination thereof. In some embodiments, a subject can have or can be suspected of having one or more primary' tumors, one or more metastatic tumors such as solid tumors or any combination thereof. Cancers to be treated contemplated herein can include solid or non-solid tumors such as cancers of the blood. Non-limiting examples of blood cancers include leukemia, lymphoma, multiple myeloma, myeloproliferative neoplasms (MPNs), and myelodysplastic syndromes (MDS). Solid cancerous tumors can form in various parts of the body, including but not limited to, breast, pancreatic, brain, mesothelioma, lung, thyroid, stomach, liver, kidney, ovarian, and prostate. Non-limiting examples of cancers derived from organs and / or tissues (i.e., not blood cancers) that may be treated by the provided methods include: adenocarcinoma, angiosarcoma, astrocytoma, basal cell carcinoma, bile duct carcinoma, bladder carcinoma, brain cancer, breast cancer, bronchogenic carcinoma, cervical cancer, chondrosarcoma, chordoma, choriocarcinoma, colon cancer, colon carcinoma, craniophary ngioma, cystadenocarcinoma, embryonal carcinoma, endotheliosarcoma, ependymoma, epithelial carcinoma. Ewing's tumor, glioma, hepatoma, large cell carcinoma, leiomyosarcoma, liposarcoma, lung cancer, lung carcinoma, medullary carcinoma, medulloblastoma, neuroblastoma, oligodendroglioma, osteogenic sarcoma, ovarian cancer, pancreatic cancer, papillary' adenocarcinomas, papillary carcinoma, pinealoma, prostate cancer, rhabdomyosarcoma, renal cell carcinoma, retinoblastoma, schwannoma, sebaceous gland carcinoma, seminoma, small cell lung carcinoma, squamous cell carcinoma, sweat gland carcinoma, synovioma, testicular cancer, uterine cancer, and Wilm's tumor. Preferably, a cancer to be treated by the provided methods is breast cancer, ovarian cancer, pancreatic cancer, and / or prostate cancer. Where a subject is predicted to respond to an anti-cancer treatment comprising a genotoxic agent (e.g., PARPi or cisplatin) according to the methods disclosed herein, the method can further comprise administering an effective amount of an anticancer treatment comprising a genotoxic agent (e.g., PARPi or cisplatin). Where a subj ect is predicted to not respond to an anti-cancer treatment comprising a genotoxic agent (e.g., PARPi or cisplatin) according to these methods, the method can further comprise administering an effective amount of an anti-cancer treatment that does not comprise a genotoxic agent (e.g., PARPi or cisplatin). In some embodiments, where a subject is predicted to not respond to an anti-cancer treatment comprising a PARPi according to these methods, the method can further comprise administering PARPi in combination with one or more agents known in the art to increase PARPi sensitivity (see, e.g., Yalon et al., PLoS One. 2016 May 19; 11 (5):e0155711 ; Hinchcliff et al., Curr Opin Obstet Gynecol. 2021 Feb 1 ;33(1): 19-25).
[0060] In addition, the methods can be used to monitor development of resistance in subjects receiving treatment, e g., treatment with radiation or chemotherapy, e.g.. with a PARPi, cisplatin, or carboplatin; in these methods, a baseline NTS is determined in cells obtained from the cancer, e.g., by biopsy or resection, preferably before treatment is initiated. Then one or more subsequent NTS are determined in cells obtained from the cancer after administration of one or more doses of the treatment. An increase in NTS over time can indicate that the cancer is becoming resistant to the treatment. In subjects who have an increase in NTS over time, treatment can be changed to a different drug or modality.
[0061] The methods disclosed herein can be used to identify synergy between anticancer treatments. In some embodiments, where a NTS is greater for the two anticancer treatments when compared to the NTS of either of the two anti-cancer treatment alone, a synergistic interaction is detected between the two anti-cancer treatments. In some embodiments, where NTS identifies a synergistic interaction between two the two anti-cancer treatments, the methods herein can be predictive of a subj ecfs response to co-administration of two anti-cancer treatments.
[0062] In some embodiments, the NTS assay used according to the methods disclosed herein can identify an inherent gap phenotype in a cell (e.g., a cancer cell, a BRCA1 deficient cell). In some embodiments, the NTS assay used according to the methods disclosed herein can identify a drug-induced gap phenotype in a cell (e.g., a cancer cell, a BRCA1 deficient cell). In some embodiments, the NTS assay used according to the methods disclosed herein can identify a gap phenotype of a cell that was caused by administration of one or more anti-cancer treatments (e.g., a genotoxic agent, e.g., PARPi or cisplatin).
[0063] EXAMPLES
[0064] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0065] Materials and Methods
[0066] The following materials and methods were used in the Examples described herein.
[0067] Cell lines. Human RPEl-hTERT, PEO1, C4-2, VC8, and HeLa cell lines were grown in DMEM supplemented with 10% FBS and penicillin / streptomycin (100 U / ml). MDA-MB-436 cell lines were grown in RPMI supplemented with 10% FBS and 1% Pen Strep (lOOU / mL). BR5 mouse cell lines were grown in DMEM (Coming Cellgro, 15-017-CV) supplemented with 10% FBS, penicillin and streptomycin (100 U / ml each), and 1% L-glutamine (200mM stock). Rad51 FA patient derived cells were grown in DMEM supplemented with l-% FBS, penicillin / streptomycin (100 U / ml), 1% MEM NEAA (100X stock), and 1% sodium pyruvate (lOOmM stock). The generation of RPEl-hTERT TP53 BRCA1 KO cells was described elsewhere (Noordermeer et al., 2018). The generation of RPE1 PARPI KO and XRCC1 KO cells was described elsewhere (Hanzlikova et al., 2017). PEO1 and C4-2 cell lines were described elsewhere (Sakai et al., 2009). The generation of the MDA-MB-436 cells lines was described elsewhere (Johnson et al., 2013; Nacson et al., 2018). Generation of BR5 and BR5-R1 cell lines w as described elsewhere (Yazinski et al., 2017). Generation of VC8 cell lines was described elsewhere (Schlacher et al., 2011). The generation of RAD51 cell lines was described elsewhere (Wang et al., 2015). Cells were validated by w estern blot and / or Cell-Titer-Glo2.0 or clonogenic survival assays.
[0068] Chemicals'. The following chemicals were used in this study: PARP inhibitor olaparib (AZD-2281, SelleckChem).cisplatin (P4394, Millipore Sigma), neocarzinostatin (NCS) (Millipore Sigma, N9162), ATMi (AZD1839) (Selleckchem, S8680), ATRi (VE-821) (Selleckchem, S8007), hydrogen peroxide (Sigma, H1009), Uspli (ML-323) (Medchem Express, HY-17543), Fenli (LNT1) (Tocns, 6510), hMDU ((5-hydroxymethyl-2' -deoxy uridine) (Cayman Chemical Company, 23381),hydroxyurea (Sigma, H8627-5G), aphi dicolin (Sigma, A0781), mirin (Millipore Sigma, M9948), and Dna2i C5 (Aobious, AOB9082). sgRNAs: sgRNAs were ordered through IDT (Alt-R CRISPR-Cas9 sgRNA). sgRNAs targeting 4 and 13 sites were described in (van den Berg et al.. 2018). sgRNA targeting 1 site (AAVS1) and 100 sites (CAG) were generated by the Brodsky Lab AAVS1 5- GTCCCCTCCACCCCACAGTG-3 (SEQ ID NO: 1); HS4 5- TGGACTGCAGTACACAATCA-3 (SEQ ID NO: 2); HS13 5- AGAAAAACATTAAACACAGT-3 (SEQ ID NO: 3); CAG 5- AGCAGCAGCAGCAGCAGCAGCAG-3 (SEQ ID NO: 4).
[0069] Lipofectamine Cas9 Transfection'. ThermoFisher Lipofectamine CRISPRMAX Cas9 transfection reagent (CMAX00003) was used for transfecting spCas9 (Wolfe Lab) into RPE1 cell lines and Cas9-D10A (IDT) into all cell lines. Transfections were performed in 6-well dishes with 400,000 cells seeded in Pen Strep free media. Each reaction contained 6250 ng of Cas9 nuclease and 1200ng of the appropriate sgRNA. A control was performed that contained all the buffers and reagents except the Cas9 and sgRNA. Cells were incubated at 37°C for 24 hours prior to setting nick translation assay.
[0070] Lipofectamine 3000 Transfection'. ThermoFisher Lipofectamine 3000 transfection reagent (L3000008) was used for transfecting sgRNA and plasmid containing Cas9-T7 exonuclease fusion construct (generated by mutating D10A on a plasmid provided by Wolfe Lab containing Cas9-exonuclease fusion) into RPE1 cell lines. Transfections were performed in 6-well dishes with 400,000 cells seeded in penicillin / streptomycin-free media. Each reaction contained 1.25 pg of Cas9- exonuclease plasmid and 1.25 pg of the appropriate sgRNA. A control was performed that contained all the buffers and reagents except the Cas9-exonuclease plasmid and sgRNA. Cells were incubated at 37°C for 24 hours prior to setting up nick translation assay.
[0071] Nick Translation in cell culture-Version 1: Cells were grown on coverslips in 6-well plates overnight and were washed with PBS. Cells were put on ice and preextracted with ice cold PBS+0.5% TritonX-100 on ice for 5 minutes. Cells were washed 3x with PBST (PBS + 0.01% Tween-20). 80 pL filling reaction added to cells. The filling reaction contained 8 pL NEB buffer 2, 2.4 pL 10 mM dNTPs (dATP, dGTP, dCTP, and BrdUTP), 2.4 L DNA Pol I (24U), and 67.2 pL sterile distilled water. Cells were put in a humidified incubator at 37°C and 5% CO2 for 30 minutes. Cells were washed 3x with PBST. Cells were fixed for 15 minutes at room temperature with 3% paraformaldehyde (PF A) with 2% sucrose in PBS as pH 7. Cells were washed lx with 100 mM glycine then incubated in 100 mM glycine for 5 minutes at room temperature. Cells were washed 3x with PBST. Denaturing was done with 2.5 M HC1 for 1 hour at room temperature. Cells w ere w ashed 3x with PBST then blocked with 3% BSA in PBST for 1 hour at room temperature. Cells were washed 3x with PBST then incubated with primary antibody (Rat-anti-BrdU Ab6326 at 1: 100 in 3% BSA in PBST) for 1 hour at 37°C. Cells were washed 3x with PBST then incubated with secondary antibody (Goat-anti-rat AF594 at 1 :200 dilution in 3% BSA in PBST) for 1 hour at room temperature. Cells were washed 2x with PBST then DNA stained with Hoechst 33342 (ThermoFisher 62249: 1 :500 dilution in PBS) for 30 minutes at room temperature. Coverslips were mounted to slides with Prolong (Invitrogen, P36930) and edges were sealed. Images were collected by fluorescent microscopy (Axioplan 2 imaging and Axio Observer, Zeiss) at a constant exposure time in each experiment. Mean intensity of immunofluorescence for each nucleus w as measured with Cell Profiler software from the Broad Institute. At least three independent experiments are represented with the mean ± SEM.
[0072] Nick Translation in cell culture-Version 2: Cells were grown on coverslips in 6-well plates overnight and w ere washed with PBS. Cells were fixed and permeabilized with 3: 1 ratio of ethanol: acetic acid for 15 minutes. Cells were w ashed 3x with PBST (PBS + 0.01% Tween-20). 80 pL filling reaction was added to cells as described in Version 1. Cells were put in a humidified incubator at 37°C and 5% CO2 for 5 minutes. Cells were washed 3x with PBST. Denaturing with 2.5M HC1 for 1 hour at room temperature at room temperature. Cells were w ashed 3x with PBST then blocked with 3% BSA in PBST for 30 minutes at room temperature. Continuation of Version 1 methods for antibody staining and imaging.
[0073] Nick Translaiion-FFPE (formalin fixed and paraffin embedded) tumor samples’. Samples were deparaffinized by immersing slides in fresh xylene in a Coplin jar for 5 minutes at room temperature for a total of 2 w ashes. Samples were then washed in 100% ethanol for 5 minutes followed by rehydration of samples by sequentially immersing the slides through graded ethanol washes (100%, 85%, 70%, and 50%) for 3 minutes each. Samples were washed in 0.85% NaCl for 5 minutes and then lx PBS for 5 minutes. Fixation was then done with 4% paraformaldehyde for 15 minutes followed by two IxPBS washes for 5 minutes each. Crosslinks were then reversed by adding 100 pL of 10 pg / mL Proteinase K for 20 minutes at 37° C followed by 10 minutes at room temperature. Samples were then washed twice with lx PBS for 5 minutes each. Permeabilization was done with 0.4% TritonX-100 in PBST (0.01% Tween-20) for 10 minutes at room temperature. Then samples were washed once with PBST for 3 minutes. A second permeabilization was then done for 10 minutes and washed two times with PBST for 5 minutes each. For positive control samples 100 pL of a 1:00 dilution of DNase 1 (ThermoFisher, EN0521) in DNase buffer was added for 10 minutes at room temperature. The samples were washed twice with PBST for 5 minutes each. For all samples, 80 pL filling reaction added to cells as described in Version 1. Samples were put in a humidified incubator at 37°C and 5% CO2 for 5 minutes. Samples were washed 3x with PBST. Denaturing with 2.5 M HC1 for 1 hour at room temperature at room temperature. Samples were washed 3x with PBST then blocked with 3% BSA in PBST for 1 hour at room temperature. Samples were w ashed with 3x with PBST then incubated with primary' antibody (Rat-anti-BrdU Ab6326 at 1 : 100 in 3% BSA in PBST) overnight at 4°C followed by 37C for 45 minutes. Samples w ere washed 3x with PBST then incubated with secondary antibody (Goat-anti-rat AF594 at 1 :200 dilution in 3% BSA in PBST) for 1 hour at room temperature. Samples w ere washed 2x w ith PBST then DNA stained with Hoechst (ThermoFisher 62249: 1 :500 dilution in PBS) for 30 minutes at room temperature. Coverslips mounted to slides with Prolong (Invitrogen, P36930) and edges sealed. Images were collected by fluorescent microscopy (Axioplan 2 imaging and Axio Observer, Zeiss) at a constant exposure time in each experiment.
[0074] Edu Click-It immunofluorescence: Cells were grown on coverslips and 10 pM EdU was added for 30 min at 37 °C. Cells were pre-extracted with PBS + 0.25% Triton on ice for 1 min, washed with PBS. fixed with 4% paraformaldehyde for 15 min, pre-extracted with PBS + 0.5% Triton on ice for 1 min, washed with PBS and blocked with 3% BSA in PBS for 30 min at room temperature. Cells were washed twice w ith PBS-T, and EdU labeling was performed using Click-It EdU Alexa Fluor 488 Imaging Kit (Invitrogen, C10337) according to the manufacturer's instructions. After two PBS washes, cells were incubated with Hoechst stain (ThermoFisher, 62249, 1 :500 dilution in PBS) for 30 min at room temperature and mounted with Prolong (Invitrogen, P36930). As described previously, images were collected by fluorescence microscopy (Axioplan 2 imaging and Axio Observer. Zeiss) at a constant exposure time in each experiment. Mean intensity of immunofluorescence for each nucleus were measured with Cell Profiler software from the Broad Institute. At least three independent experiments are represented with the mean ± SEM.
[0075] RNA interference: Stably transduced cells were generated by infection with pLKO. 1 vectors containing shRNAs against non-silencing control or one of the shRNAs against PRIMPOL (Dharmacon) as follows: PRIMPOL-12 5’- TTCAGCATAGGTTGTCACAAG -3?(SEQ ID NO: 5) and PRIMPOL-68 5'- TAAAGTATCTGAGAACCTGAC -3’ (SEQ ID NO: 6). The information was obtained from the Dharmacon website (https: / / horizondiscovery.com), and shRNAs were obtained from the UMass Chan Medical School shRNA core faci li ty. Cells were selected by puromycin for 3 to 5 days. As described previously. RPE1 cells were transfected using Dharmafect Reagent (Horizon Discovery, T-200I-03) with siRNAs. The information was obtained from the Dharmacon website (horizondiscovery.com).
[0076] • siPrimPol: 5’ GAGGAAACCGUUGUCCUCAGUGUAU 3’ (SEQ ID NO: 7). (Custom siRNA from Qiunet et al. 2020 ordered through Horizon Discovery)
[0077] • siMrel l : D-009271-02-0005 and D-009271-03-0005
[0078] • siExol : D-013120-01-0005
[0079] • siSmugl : D-012838-01-0005 and D-012838-02-0005
[0080] Immunoblotting and antibodies: Cells were harvested, lysed in R1PA buffer and processed for western blot analysis. Proteins were separated using SDS-PAGE and electrotransferred to nitrocellulose membranes. Membranes were blocked in 5% not- fat dry milk PBS-T and incubated with primary antibodies overnight at 4°C. Antibodies for western blot analysis included anti- -actin (Sigma, A5441), anti- Vinculin (abeam ab91459, 1 : 1000), anti-PrimPol (Proteintech 29824-1-AP, 1: 1000), anti-Mrel l (Novus Biologicals NB100-142, 1 : 1000), anti-Exol (abeam ab95068, 1 :500), and anti-Smugl (abeam abl92240, 1 :500). Membranes were washed, incubated with corresponding horseradish peroxidase-linked secondary antibodies (Amersham, GE Healthcare) for 1 h at room temperature and detected by chemiluminescence imaging system (Bio-Rad).
[0081] Tumor formation in mice: MDA-MB-436 +BRCA1 and +Vector cells were used for tumor formation in mice experiments. NOD scid mice (strain: NOD.Cg- Prkdc<scid > / J, stock #1303) were purchased from The Jackson Laboratory’. The mice were housed on ventilated racks with an automated watering system, 12-h light / 12-h dark light cycle, at 20°C to 26°C and humidity' between 30% and 70%; 6 female 5- to 6-week-old mice were injected unilaterally with 1 x 106cells in 35 pl 50:50 Matrigel / Collagen I into the mammary fat pad. One group of three mice received MDA-MB-436 +BRCA1 cells, whereas the other three received MDA-MB-436 +Vector cells. Tumor onset was determined by palpation of the injection site. Tumor grow th was measured twice a week with calipers using the formula (length x width2) / 2. Weight was monitored once per week, and changes in animal health and well-being via body conditioning score were recorded, as well activity, fur condition, animal posture and breathing. In vivo experiments were conducted according to the UMass Chan Institutional Animal Care and Use Committee regulation and guidelines animal license protocol #202000145. The maximal tumor size permitted by the ethics committee was 1,000 mm3. Tumor samples were excised and embedded in paraffin and FFPE blocks were sectioned.
[0082] Example 1. Modified NT assay identified endogenous nicks induced by nickase and in cells deficient in nick repair
[0083] Single stranded DNA (ssDNA) stemming from defective replication processing is a major determinant of therapy response (Panzarino et al., 2020; Peng et al., 2018). However, detecting replication associated ssDNA is cumbersome and not clinically feasible for directing anti-cancer treatment options. Thus, w e sought to identify a tractable biomarker of cellular genome-wide ssDNA gaps, ssDNA breaks or nicks. In this effort, we modified the nick translation protocol, such that it is immunofluorescence based; available DNA 3 ’-ends are labelled with nucleotide analogues that can be subsequently detected with fluorescent antibodies (FIG. 1A). To test its applicability to detect genome wide nicks, we employed a Cas9-D10A nickase that was directed to a single or multiple target sites with selective RNA guides as a positive control. After nick induction and cell permeabilization, we incubated cells with DNA polymerase 1 (Pol I) and deoxyribonucleotides (dNTPs) including the analog BrdUTP. DNA Pol I degrades DNA in a 5’ to 3’ direction while incorporating dNTPs on the 3’ end (Kelly et al., 1970; Rigby et al., 1977). After denaturing DNA, the BrdUTP analog was detected with anti-BrdU antibodies. With increasing Cas9- D10A target sites, we found that the nick translation signal (NTS) also increased selectively in the cells including DNA Pol I (FIGS. 1B-1C). The NTS was titratable with increasing nick target sites, which demonstrated that the NTS reported information on the nick threshold. Importantly, as compared to Cas9 induced nicks, Cas9 induced DSBs did not show an NTS pointing to the specificity of the assay for ssDNA breaks rather than DSBs (FIGS. 10A-10B). Additionally, we observed that with a Cas9-nickase fused with the T7 exonuclease NTS was induced, although lower than following the nickase (FIG. IOC). As ssDNA binding proteins, such as replication protein A (RPA), would be able to bind regions with sufficient ssDNA (Fan and Pavletich, 2012; Fanning et al., 2006; Iftode et al., 1999), its binding could block DNA Pol I and limit the NTS. Alternatively, secondary structures could form with sufficient ssDNA and contribute to blocking DNA Pol I and limit the NTS.
[0084] To determine if endogenous nicks were detected by the nick translation assay, we utilized PARP1 KO or XRCC1 KO RPE1 cells that are deficient in nick repair (Caldecott et al., 1996; Ray Chaudhuri and Nussenzweig, 2017) and are expected to have enhanced genome-wide nicks. As compared to WT cells, both KO cell lines showed a significant increase in the NTS signal (FIGS. ID- IE), suggesting that our modified nick translation protocol detects nicks stemming from both exogenous and endogenous sources.
[0085] Example 2. BRCA-Rad51 pathway deficient cells had an inherent gap vulnerability
[0086] Next, we sought to determine whether as compared to WT cells, a NTS would be greater in BRCA-Rad51 deficient cells that have gap suppression (GS) and repair defects (Cong and Cantor, 2022). Indeed, our observations across two different retinal pigment epithelial (RPE) cell line systems (Clairmont and D'Andrea, 2021; Noordermeer et al., 2018) revealed an increased NTS in BRCA-deficient cells in comparison to BRCA-proficient RPE cells (FIGS. 2A, 11A). Findings correlated with sensitivity and resistance to PARP inhibitors (PARPi), respectively (Noordermeer et al., 2018). This biomarker of gaps extended to BRCA1 deficient MDA-MB-436 breast cancer cells (Nacson et al., 2018), as well as BRCA2 mutant VC8 hamster cells (Schlacher et al., 2011) and BRCA2 KO, DLD1 colorectal cancer and HeLa cells (Thakar et al., 2022). Overall, a greater NTS was observed in the BRCA1 or BRCA2 deficient PARPi sensitive cell lines, as compared to their respective WT complemented or WT control lines (FIGS. 2B-2D, 11B).
[0087] To further test the generality of this NTS to loss of the BRCA-RAD51 pathway, we utilized the Fanconi Anemia (FA) patient fibroblast cells. These cells maintain one mutated and one WT allele and are sensitive to PARPi as well as DNA interstrand crosslinking agents such as cisplatin (Wang et al., 2015). We also previously discovered that the RAD51 mutant line had replication gaps and PARPi sensitivity' that was not suppressed by restoration of fork protection, suggesting that gaps not fork protection was relevant to therapy response (Cong et al., 2021). The mutant RAD51 T131P / + cell line as well as the RAD51 + / - cell line, where the mutant allele was fully deleted, had a higher NTS compared to the WT RAD51 + / + cells (FIG. 2E). Collectively these data indicated that nicks were a unique feature of BRCA-RAD51 pathway deficient cells.
[0088] Example 3. The NTS was enhanced in BRCA deficient cells in response to sensitizing therapies PARPi and cisplatin
[0089] Our findings indicated that in the absence of a functional BRCA-Rad51 pathway, the NTS was elevated as compared to cells in which these proteins are functional and suppress gaps. The question remained as to whether the NTS would be further increased in all cells or uniquely in BRCA-RAD51 deficient cells when treated with sensitizing drugs such as PARPi and cisplatin (FIG. 3A). To address this question, the two distinct RPE cell line systems were treated with 10 pM PARPi for 4 hours. While both the WT and BRCA1 KO cells had an increased NTS signal after treatment, the NTS in the BRCA1 KO cells was significantly higher (FIGS. 3A, 12A). Similar results were observed in HeLa and VC8 BRCA2 deficient cell lines and the FA RAD51 mutant cell lines in which the deficient lines had a greater PARPi induced NTS (FIGS. 3B, 12B-12C). Additionally, following the treatment with 4 pM cisplatin for 2 hours, the NTS was higher in the BRCA-RAD51 deficient cells as compared to the proficient (FIGS. 3D-3E, 12D-12F). Moreover, in response to PARPi. the RAD51 T131P / + cell line had a greater induction of NTS as compared to the RAD51 + / - cell line, that also reflected that the mutant line was more sensitive to this drug (FIG. 12F)(Cong et al., 2021). In conclusion these data indicated that the nick translation assay predicted sensitivity in BRCA-RAD51 pathway cells and could serve as a robust biomarker.
[0090] Example 4. The NTS predicted PARPi resistance in unperturbed conditions
[0091] For the NTS to serve as a biomarker, it would have to discriminate in unchallenged conditions between cells that share BRCA mutant status but have a different response to therapy. For example, BRCA1 deficiency is similar between BRCA1 KO cells and BRCA1 and 53BP1 (double knockout) DKO cells, however the latter are resistant to PARPi similar to WT cells (Noordermeer et al., 2018). As before, we observed a greater NTS in the BRCA1 KO cells as compared to WT. By contrast, the BRCA1 53BP1 DKO cells resembled WT with a relatively low NTS (FIG. 4A), consistent with the NTS serving as a biomarker of response in unchallenged conditions.
[0092] Next, we analyzed the NTS in the MDA-MB-436 breast cancer cell line and in the derived MDA-MB-436-R1 line in which PARPi resistance had evolved (Johnson et al., 2013; Nacson et al., 2018). Similar to the WT complemented cells (where WT BRCA1 was put back into the cells), we found that the R1 line maintained a lower NTS than the parental cell line with vector (FIG. 4B). again consistent with the NTS capturing the drug response of these cells in unchallenged conditions.
[0093] Similar findings extended to BRCA1 or BRCA2 mutant ovarian cancer cells. Specifically, we employed the BRC Al -deficient mouse ovarian tumor PARPi sensitive cell line, BR5, and its PARPi resistant derived line BR5-R1 was tested (Yazinski et al., 2017). We observed that the BR5-R1 cells exhibited significantly lower NTS than the sensitive BR5 cells (FIG. 4C).
[0094] Finally, we utilized the BRCA2 mutant PEO1 PARPi sensitive and revertant C4-2 PARPi resistant ovarian cancer cells (Sakai et al., 2009). Consistent with the BRCA1 results, in unperturbed conditions the resistant C4-2 cells exhibited significantly lower NTS than the sensitive PEO1 cells (FIG. 4D). In conclusion these data indicated that the NTS could serve as a biomarker to robustly detect PARPi resistant cells.
[0095] Example 5. NTS for analysis of fixed breast cancer tumor samples
[0096] Our ultimate goal was to accurately identify tumors that respond to treatment, thereby avoiding the administration of ineffective therapies to patients. For NTS to serve as a clinically applicable biomarker, the assay was modified to detect ssDNA gaps in patient tumor samples. The assay was optimized for FFPE (formalin fixed and paraffin embedded) tumor samples. To obtain tumor samples, we utilized MDA-MB- 436 +BRCA1 and +Vector human breast cancer cell lines that can form tumors when injected into mice. We injected the cells into the mammary7fat pad of NOD scid mice and closely monitored the tumor formation and growth. After tumor formation the tumors were excised, embedded in paraffin, and the FFPE blocks were sectioned. This allowed us to directly compare the +BRCA1 and PARPi resistant tumors versus the +Vector and PARPi sensitive tumors in the NTS assay. First, the samples were deparaffmized and rehydrated. The crosslinks produced by the FFPE fixation method were then reversed using Proteinase K. It was imperative that the crosslinks are reversed such to not impede the fill in reaction by Pol I. The samples were then permeabilized using TritonX-100 and this step was optimized to allow the NTS assay to be amenable for the denser tissue regions. Then the same fill in reaction as used herein was performed for 5 minutes, with the following NTS assay steps as outlined previously. As a positive control, DNasel was added as outlined in the methods section. We confirmed that the NTS assay was successfully adapted for use in FFPE tumors, by comparing the + / - Pol I samples after treatment with DNasel (FIGS. 5A- 5B). When comparing the +BRCA1 PARPi resistant tumors versus the +Vector PARPi sensitive tumors in the NTS assay, a robust NTS signal was observed in the +Vector samples as compared to the +BRCA1 samples (FIGS. 5C-5D).
[0097] Example 6. The NTS was enhanced in BRCA1 deficient cells in response to a range of drugs and could detect synergies between drugs
[0098] The NTS assay provides an unprecedented ability to detect an inherent ssDNA gap vulnerability7that is predictive of therapy response, that can be in turn visualized by an increase in the NTS upon treatment with these therapies, and critically identifies synergy between therapies by a combined NTS that is greater than either alone. For example, neocarzinostatin (NCS), the ATM inhibitor AZD1390, the ATR inhibitor VE-821, hydrogen peroxide, the USP1 inhibitor ML-323, the FEN1 inhibitor LNT’, and hMDU all greatly increased the NTS in BRCA1 KO cells (FIGS. 6A-6G). Additionally. 5-hydroxymethyl-2’-deoxyuridine (hMDU) and PARPi combined exhibited a synergistic increase in the NTS (FIG. 6H). Example 7. NTS assay is a tool that can identify the mechanism of inherent gaps in BRCA deficient cells
[0099] Multiple mechanisms contribute to ssDNA gap formation as part of the DNA damage tolerance and replication stress response. These include uncoupling of leading and lagging strand synthesis, lagging strand Okazaki fragment processing (OFP) defects, PrimPol-dependent repriming downstream of lesions, nuclease-mediated processing of stalled forks, and effects of specific DNA lesions like abasic sites that impede normal synthesis. Cells normally regulate these processes to minimize gap prevalence, and any gaps that do form are usually repaired post-replicative via translesion synthesis (TLS) or homologous recombination-mediated mechanisms. In wild-type cells, the accumulation of ssDNA gaps is limited. By contrast, BRCA deficient cells often accumulate excessive ssDNA gaps that are not efficiently repaired. We sought to determine if our NTS assay could identify these various mechanisms of inherent gaps in BRCA deficient cells.
[0100] We utilized two drugs to impair replication, hydroxyurea (HU) and aphidicolin (APH), which limited nucleotide pools and stalls polymerases, respectively. Although gaps naturally occur during lagging strand synthesis, BRCA deficient cells exhibited a defect in OFP, exacerbating gaps (Cong et al., 2020). Upon replication inhibition, there was a significant decrease in NTS in the RPE1 BRCA1 KO cells, while in WT there was no significant change (FIG. 8A). To confirm that replication was impaired, we used EdU incorporation and observed a significant decrease in replicating cells in both WT and BRCA1 KO cells (FIG. 8B). The results were validated in the MDA-MB-436 +BRCA1 and +Vector cells (FIGS. 8C-8D). These results support growing evidence that BRCA1 KO cells have increased replication dependent gaps.
[0101] During replication, gaps can also arise through PrimPol mediated repriming dow nstream of lesions blocking replication (Mouron et al., 2013). In BRCA deficient cells, there is an increase in PrimPol mediated repriming upon treatment with cisplatin, resulting in increased gaps (Quinet et al., 2020). To address the role of PrimPol mediated gaps in the inherent gap signal in BRCA1 deficient cells, we used small interfering RNA (siRNA) depletion of PrimPol and observed a significant decrease in NTS in the RPE1 BRCA1 deficient cells, not observed in WT cells (FIGS. 8E-8F). The results were validated in the MDA-MB-436 +BRCA1 and +Vector cells (FIGS. 8G-8H). Along with siRNA depletion of PrimPol, we further validated these findings using stably transduced cell lines expressing small hairpin RNA (shRNA) against non-silencing control (NSC) and PrimPol in both the RPE1 and MDA-MB-436 cell line systems. Similar to the results for siPrimPol, there was significant decrease in NTS after shPrimPol in the BRCA1 deficient cell lines (FIGS. 13A-13F). This result was consistent with BRCA1 contributing to gap suppression through limiting PrimPol mediated repriming.
[0102] Processing DNA at active, stalled or regressed replication forks by nucleases can generate or enlarge ssDNA gaps. In WT cells, when a replication fork stalls, fork reversal can occur. If this reversed fork is not properly protected, it can be degraded by nucleases. Mrel 1 (part of the MRN complex) is a key nuclease in this context. BRCA1 and BRCA2 normally protect reversed forks and limit excessive degradation by Mrel 1. Without BRCA1 / 2, Mrel 1 degrades the DNA and subsequently Exol and Dna2 can further extend the resection at the fork resulting in an enlarged ssDNA gap (Lemacon et al. 2017; Schlacher et al.. 2012; Vallerga et al., 2015; Thangavel et al., 2015; Mijic et al., 2017). In addition, BRCA1 / 2 help to restrict gap resection by Mrel 1 in G2 phase in order to facilitate gap filling by TLS (Tirman et al., 2021).
[0103] To assess the role of nucleases on the inherent gap phenotype in BRCA1 deficient cells, we sought to deplete or inhibit each of the nuclease. After siRNA depletion of Mrel 1 we observed a significant decrease in NTS in the RPE1 BRCA1 deficient cells (FIGS. 8I-8J). The results were validated in the MDA-MB-436 +BRCA1 and +Vector cells (FIGS. 8K-8L). Along with siRNA depletion of Mrell, we further validated these findings using Mirin, an inhibitor of Mrel l. Similar to the results for siMrel 1 there was significant decrease in NTS with Mirin in the BRCA1 deficient cell lines, not observed in the WT cells (FIGS. 13G-13H). To assess the role of Dna2, we used the C5 Dna2 inhibitor and also observed a significant decrease in NTS after Dna2i (Aobious) treatment in the BRCA1 -deficient cell lines specifically (FIGs. 131- 13J). We confirmed these inhibitors did not impact DNA replication by verifying EdU incorporation during inhibitor treatment (FIGS. 13K-13N), a critical control since reduced replication also limited ssDNA gaps. Along with Dna2, Exol can contribute to extensive resection leading the ssDNA gaps. To address the role of Exol, we depleted Exol using siRNA and observed a significant decrease in NTS in the RPE1 BRCA1 deficient cells, but not the WT cells (FIGS. 8M-8N). The results were validated in the MDA-MB-436 +BRCA1 and +Vector cells (FIGS. 8O-8P).
[0104] Abasic sites can arise spontaneously or via base excision repair of damaged bases. Replicative DNA polymerases cannot replicate an abasic site, leading to a stall. As a result, the cell has two primary ways to cope: TLS to insert a base opposite the abasic site or skip over the abasic site and reprime downstream resulting in a gap opposite the abasic site. Elevated levels of abasic sites are observed in BRCA deficient cells due to increased oxidative and replication stress. The elevated level of abasic sites allows for a greater opportunity of ssDNA gap formation in BRCA deficient cells (Hanthi et al., 2024). Smugl is a DNA glycosylase enzyme in the BER pathway. Smugl removes uracil and other oxidized or deaminated pyrimidines from DNA and creates an abasic site that promotes gaps in BRCA deficient cells (Taglialatela et al., 2021). To address the role of abasic sites in the inherent gap phenotype of BRCA1 deficient cells, we knocked down Smugl using siRNAs. After siRNA depletion of Smugl we observed a significant decrease in NTS in the RPE1 BRCA1 deficient cells (FIGS. 8Q-8R). The results were validated in the MDA-MB- 436 +BRCA1 and +Vector cells (FIGS. 8S-8T).
[0105] Example 8. NTS assay can determine the mechanism of drug induced gaps in BRCA1 deficient cells
[0106] We have established that the NTS assay can identify the inherent gap phenotype in BRCA1 deficient cells (FIGS. 8A-8T). Additionally, we observed an increase in NTS in BRCA1 deficient cells after treatment with a range of sensitizing drugs (FIGS. 3A-3E, 6A-6H). We next sought to determine if the NTS assay can determine the mechanism of drug induced gaps in BRCA1 deficient cells. This would be useful for determining the mechanism of action of novel drug developments. We utilized cisplatin as the mechanism of increased gaps in BRCA1 deficient cells. In BRCA deficient cells, there is an increase in PrimPol mediated repriming upon treatment with cisplatin, resulting in increased gaps (Quinet et al., 2020). We used small interfering RNA (siRNA) depletion of PrimPol and assessed the NTS after treatment with DMSO and cisplatin. As expected, there was an increase in NTS in the BRCA1 KO shNSC cells after treatment with cisplatin (FIG. 9). This cisplatin induced increase in NTS was reduced with the depletion of PrimPol using two shRNAs to PrimPol as expected since PrimPol is used to reprime over the lesions caused by cisplatin (FIG. 9).
[0107] References:
[0108] Caldecott, K.W., Aoufouchi, S„ Johnson, P„ and Shall, S. (1996). XRCC1 polypeptide interacts with DNA polymerase beta and possibly poly (ADP-ribose) polymerase, and DNA ligase Ill is a novel molecular 'nick-sensor' in vitro. Nucleic Acids Res 24, 4387-4394.
[0109] Clairmont, C.S., and D'Andrea, A.D. (2021). REV7 directs DNA repair pathway choice. Trends Cell Biol 31, 965-978.
[0110] Cong, K._ and Cantor, S.B. (2022). Exploiting replication gaps for cancer therapy. Mol Cell 82, 2363-2369.
[0111] Cong, K , Peng, M., Kousholt, A.N., Lee, W.T.C., Lee, S., Nayak, S., Krais, J., VanderVere-Carozza, P.S., Pawelczak, K.S., Calvo, J., et al. (2021). Replication gaps are a key determinant of P ARP inhibitor synthetic 1 ethal i ty with BRC A deficiency. Mol Cell.
[0112] Fan, J., and Pavletich, N.P. (2012). Structure and conformational change of a replication protein A heterotrimer bound to ssDNA. Genes Dev 26, 2337-2347.
[0113] Fanning, E., Klimovich, V., and Nager, A.R. (2006). A dynamic model for replication protein A (RPA) function in DNA processing pathways. Nucleic Acids Res 34. 4126-4137.
[0114] Hanthi, Y. W., Ramirez-Otero. M. A., Appleby, R., De Antoni, A., Joudeh, L., Sannino, V., Waked, S., Ardizzoia, A., Barra, V., Fachinetti, D., Pellegrini, L., & Costanzo, V. (2024). RAD51 protects abasic sites to prevent replication fork breakage. Molecular cell 54(16), 3026-3043. el l.
[0115] Hanzlikova, H., Gittens, W., Krejcikova, K , Zeng, Z., and Caldecott, K.W. (2017). Overlapping roles for PARP1 and PARP2 in the recruitment of endogenous XRCC1 and PNKP into oxidized chromatin. Nucleic Acids Res 45, 2546-2557.
[0116] Hill, S.J., Decker, B., Roberts, E.A., Horowitz, N.S., Muto, M.G., Worley, M.J., Jr., Feltmate, C.M., Nucci, M.R., Swisher, E.M., Nguyen, H., et al. (2018). Prediction of DNA Repair Inhibitor Response in Short-Term Patient-Derived Ovarian Cancer Organoids. Cancer Discov 8, 1404-1421.
[0117] Iftode, C., Daniely, Y., and Borowiec, J.A. (1999). Replication protein A (RPA): the eukaryotic SSB. Crit Rev Biochem Mol Biol 34, 141-180.
[0118] Johnson, N., Johnson, S.F.. Yao, W.. Li, Y.C.. Choi. Y.E., Bemhardy, A.J..
[0119] Wang, Y., Capelletti, M., Sarosiek, K.A., Moreau, L.A., et al. (2013). Stabilization of mutant BRCA1 protein confers PARP inhibitor and platinum resistance. Proc Natl Acad Sci U S A 110, 17041-17046.
[0120] Lemayon. D., Jackson, J., Quinet, A., Brickner, J. R., Li, S., Yazinski, S., You, Z., Ira, G., Zou, L.. Mosammaparast, N., & Vindigni, A. (2017). MRE11 and EXO1 nucleases degrade reversed forks and elicit MUS 81 -dependent fork rescue in BRCA2- deficient cells. Nature communications 5(1), 860.
[0121] Mijic, S., Zellweger, R., Chappidi, N., Berti, M., Jacobs, K., Mutreja, K., Ursich, S., Ray Chaudhuri, A., Nussenzweig, A., Janscak, P., & Lopes, M. (2017). Replication fork reversal triggers fork degradation in BRCA2-defective cells. Nature communications 5(1), 859.
[0122] Mouron, S., Rodriguez-Acebes, S., Martinez-Jimenez. M. I., Garcia-Gomez, S., Chocron, S., Blanco, L., & Mendez, J. (2013). Repriming of DNA synthesis at stalled replication forks by human PrimPol. Nature structural & molecular biology’ 20(12), 1383-1389.
[0123] Nacson, J., Krais, J.J., Bemhardy, A.J., Clausen, E., Feng, W., Wang, Y., Nicolas, E., Cai, K.Q., Tricarico, R.. Hua, X., et al. (2018). BRCA1 Mutation-Specific Responses to 53BP1 Loss-Induced Homologous Recombination and PARP Inhibitor Resistance. Cell Rep 24, 3513-3527 e3517.
[0124] Noordermeer, S.M., Adam, S., Setiaputra, D., Barazas, M., Pettitt, S.J., Ling, A.K., Olivieri, M., Alvarez-Quilon, A., Moatti, N., Zimmermann, M., et al. (2018). The shieldin complex mediates 53BP1 -dependent DNA repair. Nature 560. 117-121.
[0125] Panzarino, N.J., Krais, J.J., Cong, K., Peng, M., Mosqueda, M., Nayak, S.U., Bond, S.M., Calvo, J. A., Doshi, M.B., Bere, M., et al. (2020). Replication Gaps Underlie BRCA-deficiency and Therapy Response. Cancer Res.
[0126] Peng, M., Cong, K., Panzarino, N.J., Nayak, S., Calvo, J., Deng, B., Zhu, L.J., Morocz, M., Hegedus. L., Haracska. L.. et al. (2018). Opposing Roles of FANCJ and HLTF Protect Forks and Restrain Replication during Stress. Cell Rep 24, 3251-3261.
[0127] Quinet, A., Tirman, S., Jackson, J., Svikovic, S., Lemacon. D., Carvajal- Maldonado, D., Gonzalez-Acosta, D., Vessoni, A. T., Cybulla, E., Wood, M., Tavis, S„ Batista, L. F. Z , Mendez, J., Sale, J. E„ & Vindigni, A. (2020). PRIMPOL- Mediated Adaptive Response Suppresses Replication Fork Reversal in BRCA- Deficient Cells. Molecular cell 77(3), 461-474. e9.
[0128] Ray Chaudhuri, A., and Nussenzweig, A. (2017). The multifaceted roles of PARP1 in DNA repair and chromatin remodelling. Nat Rev Mol Cell Biol 18, 610- 621.
[0129] Rigby, P.W., Dieckmann, M., Rhodes, C., and Berg, P. (1977). Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J Mol Biol 113, 237-251.
[0130] Sakai, W., Swisher, E.M., Jacquemont, C., Chandramohan, K.V., Couch, F.J., Langdon, S.P., Wurz, K., Higgins, J., Villegas, E., and Taniguchi, T. (2009). Functional restoration of BRCA2 protein by secondary BRCA2 mutations in BRCA2- mutated ovarian carcinoma. Cancer Res 69, 6381-6386.
[0131] Schlacher, K., Christ, N., Siaud, N., Egashira, A., Wu, H., and Jasin, M. (2011). Double-strand break repair-independent role for BRCA2 in blocking stalled replication fork degradation by MRE11. Cell 145, 529-542.
[0132] Thakar, T., Dhoonmoon, A., Straka, J., Schleicher, E.M., Nicolae, C.M., and Moldovan, G.L. (2022). Lagging strand gap suppression connects BRCA-mediated fork protection to nucleosome assembly through PCNA-dependent CAF-1 recycling. Nature communications 13, 5323.
[0133] Thangavel, S., Berti, M., Levikova, M., Pinto, C., Gomathinayagam, S., Vujanovic, M., Zellweger, R., Moore, H., Lee, E. H., Hendrickson, E. A., Cejka, P., Stewart, S.. Lopes, M., & Vindigni, A. (2015). DNA2 drives processing and restart of reversed replication forks in human cells. The Journal of cell biology 208(5), 545- 562. Tirman, S., Quinet, A., Wood, M., Meroni, A., Cybulla, E., Jackson, J., Pegoraro, S., Simoneau, A., Zou, L., & Vindigni, A. (2021). Temporally distinct post- replicative repair mechanisms fill PRIMPOL-dependent ssDNA gaps in human cells. Molecular cell 57(19), 4026-4040.e8.
[0134] Vallerga. M. B., Mansilla, S. F., Federico. M. B., Bertolin, A. P., & Gottifredi, V. (2015). Rad51 recombinase prevents Mrel l nuclease-dependent degradation and excessive PrimPol-mediated elongation of nascent DNA after UV irradiation. Proceedings of the National Academy of Sciences of the United States of America 772(48), E6624-E6633. van den Berg, J., A, G.M., Kielbassa, K., Feringa, F.M.. Freire, R., and Medema, R.H. (2018). A limited number of double-strand DNA breaks is sufficient to delay cell cycle progression. Nucleic Acids Res 46, 10132-10144.
[0135] Wang, A T., Kim, T., Wagner, J.E., Conti, B.A.. Lach, F.P.. Huang. A.L.. Molina, H., Sanborn, E.M., Zierhut, H., Comes, B.K., et al. (2015). A Dominant Mutation in Human RAD51 Reveals Its Function in DNA Interstrand Crosslink Repair Independent of Homologous Recombination. Mol Cell 59, 478-490.
[0136] Yazinski, S.A., Comaills, V., Buisson, R., Genois, M.M., Nguyen, H.D., Ho, C.K., Todorova Kwan, T., Morris, R., Lauffer, S., Nussenzweig, A., et al. (2017). ATR inhibition disrupts rewired homologous recombination and fork protection pathways in PARP inhibitor-resistant BRCA-deficient cancer cells. Genes Dev 31, 318-332.
[0137] Rigby, P.W., Dieckmann, M., Rhodes. C., and Berg, P. (1977). Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J Mol Biol 113, 237-251.
[0138] Kelly, R.B., Cozzarelli, N.R., Deutscher, M.P., Lehman, I.R., and Kornberg, A. (1970). Enzymatic synthesis of deoxyribonucleic acid. XXXII. Replication of duplex deoxyribonucleic acid by polymerase at a single strand break. J Biol Chem 245, 39-45.
[0139] Chesselet MF, MacKenzie L, Hoang T. Detection of DNA damage in tissue sections by in situ nick translation. Curr Protoc Neurosci. 2001 Nov;Chapter l:Unit 1.9. doi: 10.1002 / 0471 142301 ,ns0109sl6. PMID: 18428455.
[0140] Maehara Y, Anai H, Kusumoto T, Sakaguchi Y, Sugimachi K. Nick translation detection in situ of cellular DNA strand break induced by radiation. Am J Pathol. 1989 Jan;134(l):7-10. PMID: 2643885; PMCID: PMC1879553.
[0141] Snyder RD, Matheson DW. Nick translation-a new assay for monitoring DNA damage and repair in cultured human fibroblasts. Environ Mutagen. 1985:7(3):267-79. doi: 10.1002 / em.2860070304. PMID: 3899625.
[0142] Nose K, Okamoto H. Detection of carcinogen-induced DNA breaks by nick translation in permeable cells. Biochem Biophys Res Commun. 1983 Mar 16;111(2):383-9. doi: 10.1016 / 0006-291x(83)90317-0. PMID: 6188463.
[0143] Gorczyca W, Gong J, Darzynkiewicz Z. Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays. Cancer Res. 1993 Apr 15;53(8): 1945-51. PMID: 8467513.
[0144] Shibata S, Asanuma Y, Koyama K, Saito K. Detection of beta cell-specific DNA damage in streptozotocin-treated rats by in situ nick translation with immunostaining of alpha cells. Pancreas. 1995 May; 10(4): 354-9. doi: 10.1097 / 00006676-199505000-00006. PMID: 7792291.
[0145] OTHER EMBODIMENTS
[0146] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
WHAT IS CLAIMED IS:1 . A method of detecting a nick translation signal (NTS) in a cell, the method comprising:(a) permeabilizing the cell without losing membrane integrity, optionally contacting the cell with a non-ionic detergent and / or enzyme selected from the group consisting of Tween-20, saponin, Triton X-100, NP-40, Proteinase K, and streptolysin O;(b) contacting the cell with nick filling reagents comprising (i) a polymerase, optionally DNA Pol I, T4, or KI enow fragment (3 '->5’ exo-), and (ii) dNTPs. one of which is labeled; optionally wherein the dNTPs comprise dATP, dGTP, dCTP, BrdUTP, EdUTP or any combination thereof;(c) maintaining the cell in contact with the nick filling reagents for a sufficient time, optionally 20-60 minutes, further optionally about 30 minutes;(d) fixing the cell; and(e) detecting incorporation of the labeled dNTPs into the genome of the cell, thereby detecting an NTS in the cell.
2. The method of claim 1, wherein the labeled dNTP is BrdUTP or EdUTP.
3. The method of claim 2, wherein the detecting incorporation of the labeled dNTPs into the genome comprises using a detection reagent that detects the incorporation of the labeled dNTP, optionally an anti-BrdU or an anti-EdU antibody, further optionally wherein the anti-BrdU or anti-EdU antibody, or a secondary antibody that binds to the anti-BrdU or anti-EdU antibody, is fluorescently labeled.
4. The method of claim 3, wherein the method uses a fluorescence detection method, optionally fluorescence microscopy and / or FACS (fluorescence activated cell sorting), to detect and, optionally, quantify, a signal from the detection reagent.
5. The method of claim 1, further comprising quantifying a level of incorporation of the labeled dNTPs into the genome and optionally comparing the level to a reference level of incorporation, and further optionally calculating a score based on the comparison.
6. The method of claim 5, further comprising incubating the cell in the presence of a test compound before step (a), and optionally comparing the NTS in the presence of a test compound to the NTS in a cell in the absence of the test compound.
7. The method of claim 6, further comprising identifying the test compound as promoting gap suppression (GS) and repair defects when the level of incorporation in the presence of the test compound is above the level in the absence of the test compound.
8. The method of any one of claims 1-7, wherein the cell is a cancer cell.
9. The method of claim 8, wherein the cancer cell is from a cancer in a subject, preferably a mammalian subject, preferably a human subject.
10. The method of claim 8 or 9, wherein the cancer is breast cancer, optionally triple negative breast cancer, or ovarian cancer.
11. The method of any one of claims 8-10, wherein the cell is in a formalin fixed and paraffin embedded (FFPE) sample.
12. The method of claim 11, wherein the method further comprises, before step (a): deparaffinizing and rehydrating the sample; and treating the sample with Proteinase K.
13. The method of any one of claims 8-12, further comprising identifying a subject who has a cancer cell with a level of NTS above a reference level and selecting, and optionally administering a treatment to, the subject.
14. The method of claim 13, wherein the treatment comprises administering a genotoxin, optionally a PARP inhibitor, cisplatin, or carboplatin.
15. A method of monitoring development of treatment resistance in a human subject who has cancer, the method comprising: determining an initial NTS using the method of claim 1 in a sample from the subject, preferably obtained before or just after treatment is initiated; administering one or more doses of the treatment to the subject; determining a subsequent NTS in a sample from the subject using the methodof claim 1 in a sample from the subject obtained after the one or more doses are administered: and comparing the subsequent NTS to the initial NTS, wherein a decrease in the subsequent NTS as compared to the initial NTS indicates that the subject is developing treatment resistance.
16. The method of claim 15, wherein the treatment is administering a treatment designed to induce cell death by direct or indirect DNA damage, optionally radiation therapy or chemotherapy, optionally with a genotoxin, optionally a PARPi, cisplatin, carboplatin, neocarzinostatin (NCS), an ataxia telangiectasia mutant (ATM) inhibitor (ATMi). an Ataxia telangiectasia-mutated and Rad3- related kinase inhibitor (ATRi), a ubiquitin-specific protease 1 (USP1) inhibitor (USPli), a flap endonuclease 1 (FEN1) inhibitor (FENli), and / or 5- hy droxymethy 1-2’ -deoxyuri dine (hMDU), or pharmaceutically acceptable salts thereof.
17. The method of claim 16, wherein the PARPi is selected from the group consisting of olaparib, veliparib, rucaparib, niraparib. talazoparib, saruparib and pamiparib.
18. The method of claim 16, wherein the ATMi is selected from the group consisting of AZD1390, KU-55933, KU-60019, Wortmannin, CP-466722, M3541, Lartesertib (M4076), AZ31, AZD0156, and Mirin.
19. The method of claim 16, wherein the ATRi is selected from the group consisting of VE-821, Dactolisib (BEZ235), Berzosertib (VE-822), AZ20, Camonsertib (RP- 3500), SKLB-197, Elimusertib (BAY-1895344), Elimusertib (BAY-1895344), Ceralasertib (AZD6738). Schisandrin B. Tuvusertib, and HAMNO.
20. The method of claim 16, wherein the treatment is administering an agent that targets both ATM and ATR, optionally Torin 2, ETP-46464, or CGK-733.
21. The method of claim 16, wherein USPli is selected from the group consisting of ML-323, ASN-3186, ISM3091, KSQ-4279, USP1-IN-2, and Pimozide.
2. The method of claim 16, wherein the FENli is selected from the group consisting of LNT1. FEN1-IN-2, FEN1-IN-3, FEN1-IN-4, FEN1-IN-5, FEN1-IN-6. FEN1- IN-7, and FEN1-IN-SC13.
Citation Information
Patent Citations
Method of detection of DNA end(s) and its use
US20200255884A1
Prediction of cancer therapy efficacy
US20220275458A1