Modulation of syngap1 gene transcription using antisense oligonucleotides targeting regulatory rnas

Abstract

Described herein are methods of modulating SYNGAP1 gene transcription using antisense oligonucleotides (ASOs) targeting regulatory RNAs. These methods are useful for increasing expression of SYNGAP1 mRNA and protein, to thereby treat diseases and disorders.

Description

MODULATION OF SYNGAP1 GENE TRANSCRIPTION USING ANTISENSE OLIGONUCLEOTIDES TARGETING REGULATORY RNASCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 656,572, filed June 5, 2024, U.S. Provisional Application No. 63 / 656,536, filed June 5, 2024, U.S. Provisional Application No. 63 / 742,805, filed January 7, 2025, and U.S. Provisional Application No. 63 / 807,354, filed May 16, 2025, each of which are hereby incorporated in their entirety by reference.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which is hereby incorporated by reference in its entirety. Said XML copy, created on May 30, 2025, is named CTC- 038WO_SL.xml, and is 6,315,938 bytes in size.BACKGROUND

[0003] Transcription factors bind specific sequences in promoter and enhancer DNA elements to regulate gene transcription. It was recently reported that active promoters and enhancer elements are themselves transcribed, generating noncoding regulatory RNAs (regRNAs) such as promoter- associated RNAs (paRNAs) and enhancer RNAs (eRNAs) (see Sartorelli and Lauberth, Nat. Struct. Mol. Biol. (2020) 27: 521-28). Unlike coding RNAs, regRNAs are transcribed bi-directionally. Various models have been proposed for the functions of regRNAs, including nucleosome remodeling (see Mousavi et al., Mol. Cell (2013) 51(5):606-17), modulation of enhancer-promoter looping (see Lai et al., Nature (2013) 494(7438):497-501), and direct interaction with transcription regulators (see Sigova et al., Science (2015) 350, 978-81). While there is not yet a clear consensus regarding the many functions of regRNAs, regRNAs appear to play a central role in gene expression regulation.

[0004] Gene expression has been generally known as an undruggable biological process. Despite on-going efforts into understanding the biology of gene transcription and regRNAs, clinically suitable methods of modulating gene expression are limited. There remains a need for new and useful methods for treating diseases associated with aberrant gene expression.

[0005] Approximately 1-2% of all cases of intellectual disabilities are due to mutations in the SYNGAP1 gene. SYNGAP1 -related intellectual disability (SYNGAP1-ID) is a neurological disorder characterized by moderate to severe impaired intellectual development with delayed psychomotor development. Mental retardation, autosomal dominant 5 (MRD5), also known as intellectual disability autosomal; dominant 5, is a SYNGAP1-ID that is causedby an autosomal recessive mutation in the SYNGAP1 gene. SYNGAP1 -related non- syndromic intellectual disability (NSID) is a result of a heterozygous pathogenic mutation in SYNGAP1 (approximately 89% of cases) or a deletion of 6p21.3 (approximately 11% of cases). SYNGAP1 -related NSID presents as moderate to severe cognitive impairment, mild hypotonia, global developmental delay, delayed language development, disordered sleep, oral dyspraxia, inattention, impulsivity, physical aggression, mood swings, sullenness, and rigidity. In addition, 94-98% of cases of MRD5 and SYNGAP1 -related NSID also present with epilepsy. There is no cure or treatment for MRD5 or SYNGAP1 -related NSID. Patient treatment is limited to treatment of epilepsy and behavioral management. Thus, additional therapeutics are needed.SUMMARY

[0006] In one aspect, provided herein is an antisense oligonucleotide (ASO) complementary to at least 8 contiguous nucleotides of a regulatory RNA of human synaptic Ras GTPase activating protein 1 (SYNGAP1), wherein the regulatory RNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 or 2.

[0007] In some embodiments, the regulatory RNA comprises a nucleotide sequence of SEQ ID NO: 1, and the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3-779.

[0008] In some embodiments, the regulatory RNA comprises a nucleotide sequence of SEQ ID NO: 2, and the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 780-1535.

[0009] In another aspect, provided herein is an antisense oligonucleotide (ASO) complementary to a regulatory RNA of human SYNGAP1, wherein the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2856-3228.

[0010] In some embodiments of any of the foregoing ASOs, the ASO is no more than 50, 40, 30, 25, 20, or 18 nucleotides in length.

[0011] In some embodiments of any of the foregoing ASOs, one or more nucleotides of the ASO comprises one or more chemical modifications.

[0012] In some embodiments, at least 3, 4, or 5 nucleotides at the 5’ end and at least 3, 4, or 5 nucleotides at the 3’ end of the ASO comprise ribonucleotides with one or more chemical modifications.

[0013] In some embodiments, the one or more chemical modifications comprise a nucleotide sugar modification comprising one or more of 2'-0 — Ci-4alkyl, 2'-deoxy (2'-H),2'-0 — Ci-3alkyl-0 — Ci-3alkyl, 2'-fluoro, 2'-amino, 2'-arabinosyl nucleotide, 2'-F-arabinosyl nucleotide, 2'-locked nucleic acid nucleotide, 2'-amido bridge nucleic acid, 2'-unlocked nucleic acid nucleotide, a sugar in L form, 4'-thioribosyl nucleotide, constrained ethyl, 2'- fluoro-arabino, or thiomorpholino.

[0014] In some embodiments, the one or more chemical modifications comprise an internucleotide linkage modification comprising one or more of phosphorothioate, phosphoramidate, phosphonocarboxylate, thiopho sphonocarboxy late, alkylphosphonate, boranophosphonate, or phosphorodithioate.

[0015] In some embodiments, the one or more chemical modifications comprise a nucleobase modification comprising one or more of 2-thiouracil, 2-thiocytosine, 4-thiouracil,6-thioguanine, 2-aminoadenine, 2-aminopurine, pseudouracil, hypoxanthine, 7-deazaguanine,7-deaza-8-azaguanine, 7-deazaadenine, 7-deaza-8-azaadenine, 5-methylcytosine, 5- methyluracil, 5 -hydroxy methylcytosine, 5-hydroxymethyluracil, 5,6-dehydrouracil, 5- propynylcytosine, 5-propynyluracil, 5-ethynylcytosine, 5-ethynyluracil, 5-allyluracil, 5- allylcytosine, 5-aminoallyluracil, 5-aminoallyl-cytosine, an abasic nucleotide, Z base, P base, unstructured nucleic acid, isoguanine, isocytosine, a glycerol nucleic acid, or thiopho sphoramidate morpholino s.

[0016] In some embodiments, the one or more chemical modifications comprise 2'-O- methoxyethyl, 5-methyl on cytidine, locked nucleic acid, phosphodiester internucleotide bond, or phosphorothioate internucleotide bond.

[0017] In some embodiments, the ASO does not comprise 10 or more contiguous non- chemically modified nucleotides.

[0018] In some embodiments, the ASO does not comprise a deoxyribonucleotide.

[0019] In some embodiments, the ASO does not comprise an unmodified nucleotide.

[0020] In some embodiments, the length of the ASO is 5 x n + 5 nucleotides (n is an integer of 3 or greater), wherein the nucleotides at positions 5 x m are ribonucleotides modified by LNA (m is an integer from 1 to n) and the nucleotides at the remaining positions are ribonucleotides modified by 2'-O-methoxyethyl.

[0021] In some embodiments, the length of the ASO is 3 x n + 2 nucleotides (n is an integer of 6 or greater), wherein the nucleotides at positions 3 x m are ribonucleotides modified by LNA (m is an integer from 1 to n) and the nucleotides at the remaining positions are ribonucleotides modified by 2'-O-methoxyethyl.

[0022] In some embodiments, each ribonucleotide of the ASO is modified by 2'-O- methoxy ethyl.

[0023] In some embodiments, each nucleotide of the ASO is a ribonucleotide modified by 2'-O-methoxyethyl.

[0024] In some embodiments, the ASO comprises 10 or more contiguous nucleotides of unmodified DNA flanked by at least 3 nucleotides of modified ribonucleotides at each of the 5’ end and the 3’ end.

[0025] In some embodiments, each cytidine in the ASO is modified by 5-methyl.

[0026] In some embodiments, the ASO comprises a nucleotide sequence and chemical modifications set forth in any one of SEQ ID NOs: 3239-3755.

[0027] In some embodiments, the ASO comprises a nucleotide sequence and chemical modifications set forth in any one of SEQ ID NOs: 1536-2141 or 2143-2843.

[0028] In another aspect, provided herein is a pharmaceutical composition comprising an ASO disclosed herein and a pharmaceutically acceptable carrier or excipient.

[0029] In another aspect, provided herein is a method of increasing transcription of synaptic Ras GTPase activating protein 1 (SYNGAP1) in a human cell, the method comprising contacting the cell with an ASO disclosed herein or a pharmaceutical composition disclosed herein.

[0030] In some embodiments, the cell is a neuron.

[0031] In some embodiments, the method results in increased SYNGAP1 mRNA in the cell.

[0032] In some embodiments, the method results in increased SYNGAP1 protein in the cell.

[0033] In another aspect, provided herein is a method of treating a disease or disorder, the method comprising administering to a subject in need thereof an effective amount of an ASO disclosed herein or a pharmaceutical composition disclosed herein.

[0034] In some embodiments, the disease or disorder is a SYNGAP1 -related disease or disorder.

[0035] In some embodiments, the SYNGAP1 -related disease or disorder is SYNGAP1- related intellectual disability (ID), mental retardation, autosomal dominant 5 (MRD5), or SYNGAP1 -related non-syndromic intellectual disability (NSID).

[0036] In some embodiments, the disease or disorder is a central nervous system (CNS) disorder or a peripheral nervous system (PNS) disorder.

[0037] In some embodiments, the disease or disorder is an affective disorder (e.g., depression), schizophrenia, Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, an autism spectrum disorder (ASD), (e.g., Asperger’s syndrome, autistic disorder, PervasiveDevelopmental Disorder-Not Otherwise Specified (PDD-NOS)), or a CNS or PNS trauma (e.g., brain or spinal cord ischemia or trauma, stroke, or a neurological deficit associated with surgery or anesthesia).

[0038] In some embodiments, administration of the ASO or the pharmaceutical composition modulates SYNGAP1 gene expression in the subject relative to a preadministration baseline level.

[0039] In some embodiments, administration of the ASO or the pharmaceutical composition increases SYNGAP1 gene expression in the subject relative to a preadministration baseline level.

[0040] In some embodiments, administration of the ASO or the pharmaceutical composition increases SYNGAP1 gene expression in a cell of the subject relative to a preadministration baseline level. In some embodiments, the cell is a neuron.

[0041] In some embodiments, administration of the ASO or the pharmaceutical composition modulates expression of one or more isoforms of SYNGAP1 in the subject relative to a pre-administration baseline level.

[0042] In some embodiments, administration of the ASO or the pharmaceutical composition modulates expression of one or more isoforms of SYNGAP1 in a cell of the subject relative to a pre-administration baseline level. In some embodiments, the cell is a neuron.

[0043] In some embodiments, the expression of one or more isoforms of SYNGAP1 is increased after administering the ASO or the pharmaceutical composition.

[0044] In some embodiments, the one or more isoforms of SYNGAP1 comprise SYNGAP1 Aal, SYNGAP1 Aa2, SYNGAP1 A , SYNGAP1 Ay, SYNGAP1 Bal, SYNGAP1 Ba2, SYNGAP1 Bp, SYNGAP1 By, SYNGAP1 Cal, SYNGAP1 Ca2, SYNGAP1 Cp, SYNGAP1 Cy, or any combination thereof.

[0045] In some embodiments, the administering is performed via an intrathecal, intracerebral, intraventricular, intracerebroventricular, intracisternal, intraspinal, or peri- spinal route.BRIEF DESCRIPTION OF THE DRAWINGS

[0046] FIG. 1A shows an illustrative schematic of eRNA, paRNA, mRNA, and natural antisense transcript (NAT) of a gene on the chromosome. The eRNA, paRNA, and NAT are all non-coding RNAs. The eRNA is transcribed bidirectionally from an enhancer of the gene. The paRNA is transcribed from the promoter of the gene, same as the mRNA, but in theantisense direction. The NAT is transcribed from a downstream promoter of its own in the antisense direction, such that the transcript overlaps at least partially with the mRNA. FIG. IB shows an illustrative schematic of the interaction of regRNA with enhancer and promoter regions to recruit transcription factors and regulators that modulate gene expression.

[0047] FIGs. 2A and 2B show a dose-dependent upregulation of total SYNGAP1 mRNA in SK-N-AS cells after treatment with the indicated ASOs targeting SYNGAP1 regRNAs RR137 and RR138 or a non-targeting control (NTC) ASO, at the indicated concentrations.

[0048] FIG. 3 shows total SYNGAP1 mRNA fold change in glutamatergic neurons after treatment with the indicated ASOs targeting SYNGAP1 regRNAs RR137 and RR138 as compared to a chemistry-matched NTC ASOs (i.e., the gapmer NTC ASO CO- 1588 and the steric NTC ASO CO- 1589).

[0049] FIG. 4 illustrates the genomic position of SYNGAP1 regRNAs RR137 and RR138 relative to the genomic position of SYNGAP1 N-terminus isoform A, isoform B and annotated isoform Ensembl ID ENST00000682587.1 (alternative isoform transcription start sites shown).

[0050] FIG. 5A shows SYNGAP1 mRNA fold change in SK-NA-S cells following treatment with the indicated steric ASOs targeting region 1 of the SYNGAP regRNA RR93, steric non-targeting control (NTC) ASOs CO- 1589 and CO- 1929, or untreated control cells (“UTC”) . FIG. 5B shows SYNGAP1 mRNA fold change in SK-NA-S cells following treatment with the indicated steric ASOs targeting region 2 of the SYNGAP regRNA RR93, steric NTC ASOs CO- 1589 and CO- 1929, or UTC. FIG. 5C shows SYNGAP1 mRNA fold change in SK-NA-S cells following treatment with the indicated steric ASOs targeting region 3 of the SYNGAP regRNA RR93, steric NTC ASOs CO-1589 and CO-1929, or UTC.

[0051] FIG. 6A shows dose-dependent SYNGAP 1 mRNA fold changes in SK-NA-S cells after treatment with the indicated ASOs targeting region 1 of the SYNGAP regRNA RR93 as compared to cells treated with a non-targeting control (NTC) ASO. FIG. 6B shows a dose dependent SYNGAP1 mRNA fold change in SK-NA-S cells after treatment with the indicated ASOs targeting region 2 of the SYNGAP regRNA RR93 as compared to cells treated with a non-targeting control (NTC) ASO. FIG. 6C shows a dose dependent SYNGAP 1 mRNA fold change in SK-NA-S cells after treatment with the indicated ASOs targeting region 3 of the SYNGAP regRNA RR93 as compared to cells treated with a nontargeting control (NTC) ASO.

[0052] FIG. 7 shows upregulation of SYNGAP1 mRNA in human iPSC-derived neurons after treatment with the indicated steric ASOs targeting regions 1, 2 and 3 of regRNA RR93 or Steric NTC ASO CO- 1589 (control).

[0053] FIG. 8 is a bar graph showing the change in occupancy of Polymerase II at the SYNGAP1 promoter, and the occupancy of Polymerase II at the promoters of the housekeeping genes B2M (“Ctrl_l”) and GAPDH (“Ctrl_2”) following treatment with the SYNGAP1 regRNA-targeting ASO CO-9437.

[0054] FIG. 9 is a bar graph showing a dose-dependent upregulation of human SYNGAP1 protein levels in the cortex, hippocampus, and midbrain regions of homozygous human SYNGAP transgenic mice following treatment with a SYNGAP1 regRNA-targeting steric ASO. (* p < 0.05; ** p < 0.01; **** p < 0.0001).

[0055] FIG. 10 is a bar graph showing human SYNGAP1 mRNA expression in SYNGAP 1 haploinsufficient patient iPSC-derived neurons (“SYNGAP Patient”) and wildtype familial iPSC-derived neurons (“Familial Control”) following treatment with a steric non-targeting control CO- 1589 (“NTC”), as well as human SYNGAP1 mRNA expression in SYNGAP 1 haploinsufficient patient iPSC-derived neurons following treatment with the SYNGAP1 regRNA-targeting ASOs CO-9438 (“ASO-7”) and CO- 19781 (“ASO- 9”).

[0056] FIGs. 11A and 11B are graphs showing the dose-dependent upregulation of human SYNGAP 1 mRNA levels in SK-N-AS and human glutamatergic-enriched neurons derived from induced pluripotent stem cells following treatment with either a SYNGAP1 regRNA-targeting steric ASO (squares in FIG. 11 A, and circles in FIG. 11B) or a nontargeting control ASO (circles in FIG. 11A, and squares in FIG. 11B).

[0057] FIG. 12 is a bar graph showing the levels of SYNGAP1 protein in humanized heterozygous haploinsufficient SYNGAP1 mice (“Haploinsufficient”) treated with either 25, 50 or 100 pg of a SYNGAP1 regRNA-targeting steric ASO, or vehicle control (aCSF) or homozygous humanized SYNGAP1 littermate mice (“Homozygous Control”). *** = p<0.001; **** = p<0.0001; ns = not significant.

[0058] FIGs. 13A, 13B and 13C are boxplot showing the average latency to fall in an accelerating rotarod test (FIG. 13A), the percentage of time of novel arm exploration in a Y- maze memory task (FIG. 13B), and the distance travelled in a gait analysis test (FIG. 13C) in humanized heterozygous haploinsufficient SYNGAP1 mice that were administered either SYNGAP 1 regRNA-targeting steric ASO (“HET ASO”) or aCSF (vehicle control; “HET aCSF”) or in humanized homozygous SYNGAP1 mice that were administered aCSF (“HOMaCSF”). * = p<0.05; ** =p<0.01; *** = p<0.001; ns = not significant. FIG. 13D shows the fold change in SYNGAP1 protein levels in the indicated tissues.DETAILED DESCRIPTION

[0059] The present disclosure provides antisense oligonucleotides (ASOs) targeting regulatory RNAs and methods using these ASOs to regulate gene expression. These methods are useful for modulating the levels of gene products, for example, modulating expression levels of SYNGAP1, to thereby treat SYNGAP1 -related disorder (e.g., diseases associated with SYNGAP1 mutations), such as mental retardation, autosomal dominant 5 (MRD5) and SYNGAP1 -related non-syndromic intellectual disability (NSID) or other disease or disorders.

[0060] Various aspects of the compositions and methods described in the present application are set forth in the sections below.I. Definitions

[0061] To facilitate an understanding of the present application, a number of terms and phrases are defined below.

[0062] The terms “a” and “an” as used herein mean “one or more” and include the plural unless the context is inappropriate.

[0063] As used herein, the terms “SYNGAP1” or “synaptic Ras GTPase activating protein 1” refer to the gene of NCBI Gene ID: 8831 or Hugo Gene Nomenclature Committee (HGNC) ID: 11497 when used in reference to the human gene, or the protein of UniProt Accession No. Q96PV0 (human) when used in reference to a human version of the protein, and to the gene of NCBI Gene ID: 240057 when used in reference to the mouse gene, or to the protein of UniProt Accession No. J3QQ18 (mouse), when used in reference to a mouse version of the protein, and related isoforms and orthologs of the foregoing. SYNGAP1 is a protein of the post-synaptic density (PSD) of glutamatergic neurons that interacts with PSD95 and SAP102, and is capable of positively or negatively regulating the density of N-methyl-D- aspartic acid (NMD A) and a-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors at the glutamatergic synapses, and also negatively regulates small G protein signaling downstream of glutamate receptor activation (see, e.g., Jeyabalan et al. (2016) Front. Cell Neurosci. 10: 32, incorporated herein by reference). In some embodiments, a SYNGAP1 protein comprises an isoform of SYNGAP1 (e.g., an N-terminus isoform A, B, and C and / or a C-terminus isoform alphal (al), alpha2 (a2), beta (P), or gamma (y) of human SYNGAP1). In some embodiments, a SYNGAP1 protein comprises an isoform selected from SYNGAP1 Aal, SYNGAP1 Aa2, SYNGAP1 Ap, SYNGAP1 Ay, SYNGAP1 Bal,SYNGAP1 Ba2, SYNGAP1 Bp, SYNGAP1 By, SYNGAP1 Cal, SYNGAP1 Ca2, SYNGAP1 Cp, SYNGAP1 Cy, or any combination of the foregoing isoforms. Identification and descriptions of human SYNGAP1 isoforms can be found, e.g., in Gamache et al. J. Neurosci. 40(8): 1596-1605 (2020), Araki et al. eLife 9: e56273 (2020) (isoform C), and McMahon et al. Nat. Commun. 3: 900 (2012) (N-terminus isoforms), each of the foregoing are hereby incorporated by reference in their entirety.

[0064] As used herein, the terms “regulatory RNA” and “regRNA” are used interchangeably to refer to a noncoding RNA transcribed from a regulatory element of a gene (e.g., a protein-coding gene), wherein the gene is not the noncoding RNA itself. Exemplary regulatory elements include but are not limited to promoters, enhancers, super-enhancers, and natural antisense transcripts. A noncoding RNA transcribed from a promoter, in the antisense direction, is also called “promoter RNA” or “paRNA.” A noncoding RNA transcribed from an enhancer or super-enhancer, in either the sense direction or the anti- sense direction, is also called “enhancer RNA” or “eRNA.”

[0065] As used herein, the term “nascent RNA” refers to an RNA that is still being transcribed or has just been transcribed by RNA polymerase and remains tethered to the DNA from which it is transcribed. An RNA that has dissociated from the DNA from which it is transcribed is also called an “untethered RNA.”

[0066] As used herein, the term “antisense oligonucleotide” or “ASO” refers to a singlestranded oligonucleotide having a nucleotide sequence that hybridizes with a target nucleic acid under suitable conditions or a conjugate comprising such single-stranded oligonucleotide. In some embodiments, the disclosure encompasses pharmaceutically acceptable salts of any of the ASOs described herein. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In some embodiments, the ASOs provided herein are lyophilized and isolated as salts (e.g., sodium salts).

[0067] As used herein, in some embodiments, the stability of a regRNA is reversely correlated with the degradation rate of the regRNA. In some embodiments, the ASO increases the amount and / or the stability of a target regRNA (e.g., in a cell or in a cell of the subject). In some embodiments, where an ASO increases the stability of a regRNA, it reduces the degradation rate of the regRNA. In some embodiments, where an ASO decreases the stability of a regRNA, it increases the degradation rate of the regRNA. In some embodiments, the degradation rate of a regRNA can be measured by blocking synthesis of new regRNA and assessing the half-life of the existing regRNA.

[0068] As used herein, the terms “subject” and “patient” refer to an organism to be treated by the methods and compositions described herein. Such organisms preferably include, but are not limited to, mammals (e.g., rodents (e.g., mice), primates, simians, equines, bovines, porcines, canines, felines, and the like), and more preferably include humans.

[0069] As used herein, the term “effective amount” refers to the amount of a compound (e.g., a compound of the present application) sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route. As used herein, the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.

[0070] As used herein, the term “pharmaceutical composition” refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo.

[0071] As used herein, the term “pharmaceutically acceptable carrier or excipient” refers to any of the standard pharmaceutical carriers or excipients, such as a phosphate buffered saline solution, artificial cerebrospinal fluid (aCSF), water, emulsions (e.g., such as an oil / water or water / oil emulsions), and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see e.g., Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, PA (1975).

[0072] Throughout the description, where compositions are described as having, including, or comprising specific components, or where processes and methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are compositions described in the present application that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present application that consist essentially of, or consist of, the recited processing steps.

[0073] As a general matter, compositions specifying a percentage are by weight unless otherwise specified. Further, if a variable is not accompanied by a definition, then the previous definition of the variable controls.II. Antisense Oligonucleotides

[0074] In some embodiments, the antisense oligonucleotides (ASO) disclosed herein hybridize with or target a regRNA (e.g., an eRNA, a paRNA, or a NAT) transcribed from a regulatory element of a SYNGAP1 gene, also referred to herein as a “SYNGAP1 regRNA”. It is understood that NATs, eRNAs, and paRNAs are regRNAs modulating (e.g., facilitating or upregulating) gene expression (FIG. 1). In some embodiments, the SYNGAP1 regRNA is a human SYNGAP1 regRNA. In certain embodiments, the SYNGAP1 regRNA is an eRNA. In certain embodiments, the SYNGAP1 regRNA is a paRNA. In certain embodiments, the SYNGAP1 regRNA is a NAT. In certain embodiments, the SYNGAP1 regRNA is not a polyadenylated RNA.

[0075] eRNAs can be identified using methods known in the art, such as Assay for Transposase- Accessible Chromatin using sequencing (ATAC-seq), global run-on sequencing, precision run-on sequencing, cap analysis gene expression, and histone modification analysis (see, e.g., Sartorelli & Lauberth, Nat. Struct. Mol. Biol. (2020) 27:521-28; PCT Application Publication No. WO2013 / 177248). paRNAs are RNAs transcribed from promoters of target genes in the antisense direction (transcripts in the sense direction are mRNAs of the target genes). They can be identified by similar methods, taking into account of their specific location and orientation. The nucleotide sequences of target human SYNGAP1 regRNAs of the disclosure are provided in Table 1 below. Any of these human SYNGAP1 regRNAs are contemplated as a target regRNA of an ASO disclosed herein.Table 1. Exemplary regRNAs

[0076] The present disclosure describes ASOs that may be used to increase expression of the target gene SYNGAP1 (e.g., human SYNGAP / ). Without wishing to be bound by theory, this increased gene expression may be due to increasing the amount or stability of the targeted SYNGAP1 regRNA, or interference with regRNA-associated repressors that inhibit the expression of the gene to thereby increase SYNGAP1 gene expression. These ASOs are different from the ASOs previously described that were designed to inhibit eRNAs (see, e.g., PCT Application Publication Nos. WO2013 / 177248 and W02017 / 075406). Without wishing to be bound by theory, it is hypothesized that the ASOs’ ability to upregulate SYNGAP1 gene expression is attributable to the selection of a target sequence in the regRNA and / or the chemical modifications of the ASOs.

[0077] In some aspects, provided herein are means for binding to a SYNGAP1 regRNA provided in SEQ ID NO: 1, 2, 2844, or 2845. In some embodiments, the means for binding to a SYNGAP 1 regRNA comprises an antisense oligonucleotide (ASO) provided herein. In some embodiments, a SYNGAP 1 ASO or equivalent thereof comprises means for binding a SYNGAP1 regRNA, optionally binding a human SYNGAP1 regRNA in the region(s) of human SYNGAP 1 regRNA bound by an ASO (e.g., an ASO as described in the Examples below). In some embodiments, the means binds a SYNGAP1 regRNA. In some embodiments, the means binds a human SYNGAP1 regRNA (e.g., the SYNGAP1 regRNA of SEQ ID NO: 1, 2, 2844, or 2845). In some embodiments, the means is an ASO comprising means for binding a SYNGAP 1 regRNA. In some embodiments, the means for binding a SYNGAP 1 regRNA includes the ASOs thereof described herein.

[0078] Increased SYNGAP1 gene expression can be at least about 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 125%,130%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 190%,195%, 200%, 205%, 210%, 215%, 220%, 225%, 230%, 235%, 240%, 245%, 250%, 255%,260%, 265%, 270%, 275%, 280%, 285%, 290%, 295%, 300%, 350%, 400%, 450%, 500%,550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000% or more increase in expression as compared to baseline gene expression, gene expression prior to treatment, or gene expression after treatment with a control ASO. Increased SYNGAP1 gene expression can be at least about 0.1-fold, 0.5-fold, 1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4- fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5- fold, 10-fold or more increase in expression as compared to baseline gene expression, gene expression prior to treatment, or gene expression after treatment with a control ASO.

[0079] ASOs that hybridize to (e.g., are complementary to) a portion of any of the regulatory RNAs provided herein (e.g., as described in Table 1 above), are contemplated by the present disclosure. In some embodiments, the regulatory RNA has a nucleotide sequence of any one of SEQ ID NO: 1, 2, 2844, or 2845.Sequences of ASOs

[0080] In certain embodiments, an ASO disclosed herein is complementary to a sequence in a SYNGAP1 regRNA (e.g., a SYNGAP1 regRNA provided in Table 1). In some embodiments, the ASO is complementary to a sequence of a SYNGAP1 regRNA that is no more than 300, 250, 200, 150, 100, 50, 40, 30, 20, 10, 8, 5, or 1 nucleotide(s) from the 5’ or 3’ end of the SYNGAP1 regRNA. In certain embodiments, the ASO disclosed herein is complementary to a sequence in the SYNGAP1 regRNA that is no more than 300, 250, 200, 150, 100, 50, 40, 30, 20, or 10 nucleotides from the 5’ end of the SYNGAP1 regRNA (z.e., the 5’ most nucleotide of the regRNA sequence forming a duplex with the ASO is no more than 300, 250, 200, 150, 100, 50, 40, 30, 20, 10, 8, 5, or 1 nucleotide(s) from the 5’ end of the SYNGAP1 regRNA). In certain embodiments, the ASO disclosed herein is complementary to a sequence in the SYNGAP1 regRNA that is no more than 300, 250, 200, 150, 100, 50, 40, 30, 20, 10, 8, 5, or 1 nucleotide(s) nucleotides from the 3’ end of the SYNGAP1 regRNA (z.e., the 3’ most nucleotide of the regRNA sequence forming a duplex with the ASO is no more than 300, 250, 200, 150, 100, 50, 40, 30, 20, or 10 nucleotides from the 3’ end of the SYNGAP1 regRNA). In some embodiments, provided herein are ASOs comprising a nucleotide sequence that is complementary to at least 8 nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides) of a portion of a SYNGAP1 regRNA provided herein (e.g., a regRNA comprising or consisting a portion of or the full length nucleotide sequence provided in anyone of SEQ ID NOs: 1, 2, 2844, or 2845). In some embodiments, provided herein are ASOs comprising or consisting of a nucleotide sequence that is complementary to at least 8 nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides) of a SYNGAP1 regRNA identified herein as RR137, RR138, RR93_vl, or RR93_v2 (e.g., SEQ ID NO: 1, 2, 2844, or 2845, respectively).

[0081] In certain embodiments, the ASO is no more than 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,40, 50, 60, 70, 80, 90, or 100 nucleotides in length. In certain embodiments, the ASO is at least 8, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length. In certain embodiments, the ASO is at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In certain embodiments, the ASO is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0082] In certain embodiments, the ASO is designed to lack a stable secondary structure formed within itself or between each other, thereby increasing the amount of the ASO in a single- stranded form ready to hybridize with the SYNGAP1 regRNA. Methods to predict secondary structures are known in the art (see, e.g., Seetin and Mathews, Methods Mol. Biol. (2012) 905:99-122; Zhao et al., PLoS Comput. Biol. (2021) 17(8):el009291) and web-based programs (e.g., RNAfold) are available to public users.

[0083] For example, ASOs have been designed to target a human SYNGAP1 regRNA (e.g., an eRNA, a NAT or a paRNA). The nucleotide sequences of some of these ASOs are provided in Table 2 below. In some embodiments, an ASO of the disclosure comprises or consists of a nucleotide sequence and / or chemical modification provided in any one of Tables 2-7. In some embodiments, an ASO of the disclosure comprises or consists of a nucleotide sequence and / or a chemistry modification as provided in any one of Tables 2-7. Any chemical modification or combination of chemical modifications described herein can be applied to any ASO sequence provided herein (e.g., in Table 2, 3, 4, 5, 6 or 7). In some embodiments, an ASO comprises or consists of a nucleotide sequence and / or a chemistry modification of any one of SEQ ID NOs: 3-1535. In some embodiments, an ASO comprises or consists of a nucleotide sequence and / or a chemistry modification of any one of SEQ ID NOs: 3-2141 or 2143-2819. In some embodiments, an ASO comprises or consists of a nucleotide sequence and / or a chemistry modification of any one of SEQ ID NOs: 2846-3228 or 3229-3755.Table 2. Exemplary SYNGAP1 regRNA-targeting ASO sequencesTable 4. Exemplary ASOs with chemical modifications that target regRNA RR137Table 5. Exemplary ASOs with chemical modifications that target regRNA RR138Table 6. Exemplary ASOs with chemical modifications that target regRNA, RR138Table 7. Exemplary SYNGAP1 regRNA-targeting ASO sequences and descriptions of chemical modifications

[0084] In some embodiments, an ASO provided herein comprises 16, 17, 18, 19, 20, 21, 22,23, 24, 26, or 26 of the nucleotide sequence of an ASO provided herein, e.g., in Tables 2-7. For example, an ASO can comprise the first (from 5’ to 3’) 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides of any one of SEQ ID NOs: 3-1535 or 2846-3228, e.g., nucleotides at positions 1 to any one of positions 16, 17, 18, 19, 21, 22, 23, 24, 25, or 26 of any one of SEQ ID NOs: 3- 1535 or 2846-3228. Alternatively, an ASO can comprise the last 16, 17, 18, 19, 20, 21, 22, 23,24, or 25 nucleotides of any one of SEQ ID NOs: 3-1535 or 2846-3228, e.g., nucleotides at positions 2, 3, 4, 5, 6, 7, 8, 9, or 10 to positions 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 of any one of SEQ ID NOs: 3-1535 or 2846-3228. For example, an ASO provided herein comprises the nucleotide sequence of nucleotides at positions 1 to 16, 1 to 17, 1 to 18, 1 to 19, 1 to 20, 1 to 21,1 to 22, 1 to 23, 1 to 24, 1 to 25, 1 to 26, 2 to 17, 2 to 18, 2 to 19, 2 to 20, 2 to 21, 2 to 22, 2 to 23, 2 to 24, 2 to 25, 2 to 26, 3 to 18, 3 to 19, 3 to 20, 3 to 21, 3 to 22, 3 to 23, 3 to 24, 3 to 25, 3 to 26, 4 to 19, 4 to 20, 4 to 21, 4 to 22, 4 to 23, 4 to 24, 4 to 25, 4 to 26, 5 to 20, 5 to 21, 5 to 22, 5 to 23, 5 to 24, 5 to 25, 5 to 26, 6 to 21, 6 to 22, 6 to 23, 6 to 24, 6 to 25, 6 to 26, 7 to 22, 7 to 23, 7 to 24, 7 to 25, 7 to 26, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 9 to 24, 9 to 25, 9 to 26, 10 to 25, or 10 to 26 of any one of SEQ ID NOs: 3-1535 or 2846-3228. In some embodiments, an ASO provided herein comprises the nucleotide sequence of nucleotides at positions 1 to 16, 2 to 17, 3 to 18, 4 to 19, 5 to 20, 6 to 21, 7 to 23, 8 to 24, 9 to 25, or 10-26 of any one of SEQ ID NOs: 3- 1535 or 2846-3228. In such embodiments, the ASO is at least 16, 17, 18, 19, 20, 21, 22, 23, 24,25, or 26 nucleotides in length.

[0085] In some aspects, an ASO provided herein comprises the nucleotide sequence of any one of SEQ ID NOs: 3-1535 or 2846-3228, plus up to four additional nucleotides at the 5’ end of said nucleotide sequence that are complementary to the target SYNGAP1 regRNA. For example, the ASO can comprise one, two, three, or four additional nucleotides at the 5’ end of any one of SEQ ID NOs: 3-1535 or 2846-3228 that are complementary to the human SYNGAP1 regRNA (e.g., any one of the regRNAs described in Table 1, including RR137 (SEQ ID NO: 1), RR138 (SEQ ID NO: 2), RR93_vl (SEQ ID NO: 2844), or RR93_v2 (SEQ ID NO: 2845). In some embodiments, if the ASO includes up to four (e.g., 1, 2, 3, or 4) additional nucleotides at the 5’ end of the nucleotide sequence any one of SEQ ID NOs: 3-1535 or 2846-3228 that are complementary to the target SYNGAP1 regRNA, the ASO also can exclude up to four (e.g., 1, 2,3 or 4) nucleotides from the 3’ end of the nucleotide sequence of any one of SEQ ID NOs: 3- 1535 or 2846-3228. For example, the ASO can exclude one, two, three, or four 3’ end nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 3-1535 or 2846-3228 if it includes one, two, three or four 5’ nucleotides that are complementary to the target SYNGAP1 regRNA.

[0086] In some aspects, an ASO provided herein comprises the nucleotide sequence of any one of SEQ ID NOs: 3-1535 or 2846-3228, plus up to four additional nucleotides at the 3’ end of said nucleotide sequence that are complementary to the target SYNGAP1 regRNA. For example, the ASO can comprise one, two, three, or four additional nucleotides at the 3’ end of any one of SEQ ID NOs: 3-1535 or 2846-3228 that are complementary to the target SYNGAP1 regRNA (e.g., any one of the regRNAs described in Table 1, including RR137 (SEQ ID NO: 1), RR138 (SEQ ID NO: 2), RR93_vl (SEQ ID NO: 2844), or RR93_v2 (SEQ ID NO: 2845). In some embodiments, if the ASO includes up to four (e.g., 1, 2, 3, or 4) additional nucleotides at the 3’ end of the nucleotide sequence of any one of SEQ ID NOs: 3-1535 or 2846-3228 that are complementary to the target SYNGAP1 regRNA, the ASO also can exclude up to four (e.g., 1, 2, 3, or 4) nucleotides from the 5’ end of the nucleotide sequence any one of SEQ ID NOs: 3-1535 or 2846-3228. For example, the ASO can exclude one, two, three, or four 5’ end nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 3-1535 or 2846-3228 if it includes one, two, three or four 3’ nucleotides that are complementary to the target SYNGAP1 regRNA.

[0087] In some embodiments, the regulatory RNA has a nucleotide sequence of SEQ ID NO: 1, and the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3-779. In some embodiments, the regulatory RNA has a nucleotide sequence of SEQ ID NO: 1, and the ASO comprises a sequence and chemistry modification selected from the group consisting of SEQ ID NOs: 1536-2141, 2143-2188, and 2820-2832.

[0088] Exemplary ASOs that are complementary to the target SYNGAP1 regRNA RR137 (SEQ ID NO: 1) with steric ASO chemistries are provided in SEQ ID NOs: 1536-1705, 2150, 2161, 2172, and 2185. In some embodiments, the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1536-1705, 2150, 2161, 2172, or 2185. Exemplary ASOs that are complementary to the target SYNGAP1 regRNA RR137 (SEQ ID NO: 1) with gapmer ASO chemistries are provided in SEQ ID NOs: 1706-2141, 2143-2149, 2151-2160, 2162-2171, 2173-2184, 2186-2188, and 2820-2833. In some embodiments, the ASO comprises anucleotide sequence and / or chemical modification selected from the group consisting of SEQ ID NOs: 1706-2141, 2143-2149, 2151-2160, 2162-2171, 2173-2184, 2186-2188, and 2820-2833.

[0089] In some embodiments, the regulatory RNA comprises a nucleotide sequence of SEQ ID NO: 2, and the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 780-1535. In some embodiments, the regulatory RNA comprises a nucleotide sequence of SEQ ID NO: 2, and the ASO comprises a sequence and chemistry modification selected from the group consisting of SEQ ID NOs: 2189-2819 or 2833-2843.

[0090] Exemplary ASOs that are complementary to the target SYNGAP1 regRNA RR138 (SEQ ID NO: 2) with steric ASO chemistries are provided in SEQ ID NOs: 2189-2703, 2804, and 2833-2843. In some embodiments, the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2189-2703 and 2833-2843. Exemplary ASOs that are complementary to the target SYNGAP1 regRNA RR138 (SEQ ID NO: 2) with gapmer ASO chemistries are provided in SEQ ID NOs: 2704-2803 and 2805-2819. In some embodiments, the ASO comprises a nucleotide sequence and / or chemical modification selected from the group consisting of SEQ ID NOs: 2704-2819.

[0091] In some embodiments, the regulatory RNA has a nucleotide sequence of SEQ ID NO: 2844 or 2845, and the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2846-3228. In some embodiments, the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3229-3755. In some embodiments, the regulatory RNA comprises a nucleotide sequence of SEQ ID NO: 2844 or 2845, and the ASO comprises a sequence and / or chemical modification selected from the group consisting of SEQ ID NOs: 3229-3755. In some embodiments, the ASO comprises a sequence and / or chemical modification selected from the group consisting of SEQ ID NOs: 3229-3755.

[0092] In some embodiments, an ASO provided herein comprises a sequence and / or chemical modification of an ASO provided herein, e.g., in any of Tables 2-7.Hybridization and AG

[0093] The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described interms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions Tm, is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy AG° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by AG°=-RTIn(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. AG° is the free energy associated with a reaction where aqueous concentrations are IM, the pH is 7, and the temperature is 37° C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero. AG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem, Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements. AG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Aced Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34: 11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. To have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present disclosure hybridize to a target nucleic acid with estimated AG° values below -10 kcal / mol for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy AG°. The oligonucleotides may hybridize to a target nucleic acid with estimated AG° values below the range of -10 kcal / mol, such as below -15 kcal / mol, such as below -20 kcal / mol and such as below -25 kcal / mol for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated AG° value of -10 to -60 kcal / mol, such as -12 to -40 kcal / mol, -15 to -30 kcal / mol, -16 to -27 kcal / mol, or -18 to -25 kcal / mol.Duplex Region

[0094] The phrase “duplex region” refers to the region in two complementary or substantially complementary polynucleotides that form base pairs with one another, either by Watson-Crick base pairing or any other manner that allows for a stabilized duplex betweenpolynucleotide strands that are complementary or substantially complementary. For example, a polynucleotide strand having 21 nucleotide units can base pair with another polynucleotide of 21 nucleotide units, yet only 19 bases on each strand are complementary or substantially complementary, such that the “duplex region” has 19 base pairs. The remaining bases may, for example, exist as 5' and 3' overhangs. Further, within the duplex region, 100% complementarity is not required; substantial complementarity is allowable within a duplex region. Substantial complementarity refers to 70% or greater complementarity. For example, a mismatch in a duplex region consisting of 19 base pairs results in 94.7% complementarity, rendering the duplex region substantially complementary. Duplex regions can be formed by two separate oligonucleotide strands, as well as by single oligonucleotide strands that can form hairpin structures comprising a duplex region.

[0095] A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of a SYNGAP1 regRNA, such as an eRNA or paRNA. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides. Generally, the duplex structure is between 5 and 50 base pairs in length, e.g., between 5-50, 5-49, 5-48, 5-47, 5-46, 5-45, 5-44, 5-43, 5-42, 5-41, 5-40, 5-39, 5-38,5-37, 5-36, 5-35, 5-34, 5-33, 5-32, 5-31, 5-30, 5-29, 5-28, 5-27, 5-26, 5-25, 5-24, 5-23, 5-22, 5- 21, 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5-8, 5-7, 5-6, 6-50, 6-49,6-48, 6-47, 6-46, 6-45, 6-44, 6-43, 6-42, 6-41, 6-40, 6-39, 6-38, 6-37, 6-36, 6-35, 6-34, 6-33, 6- 32, 6-31, 6-30, 6-29, 6-28, 6-27, 6-26, 6-25, 6-24, 6-23, 6-22, 6-21, 6-20, 6-19, 6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 8-50, 8-49, 8-48, 8-47, 8-46, 8-45, 8-44, 8-43, 8- 42, 8-41, 8-40, 8-39, 8-38, 8-37, 8-36, 8-35, 8-34, 8-33, 8-32, 8-31, 8-30, 8-29, 8-28, 8-27, 8-26, 8-25, 8-24, 8-23, 8-22, 8-21, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9, 10-50, 10-49, 10-48, 10-47, 10-46, 10-45, 10-44, 10-43, 10-42, 10-41, 10-40, 10-39, 10-38, 10- 37, 10-36, 10-35, 10-34, 10-33, 10-32, 10-31, 10-30, 10-29, 10-28, 10-27, 10-26, 10-25, 10-24,10-23, 10-22, 10-21, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 10- 10, 10-9, 12-50, 12-49, 12-48, 12-47, 12-46, 12-45, 12-44, 12-43, 12-42, 12-41, 12-40, 12-39, 12-38, 12-37, 12-36, 12-35, 12-34, 12-33, 12-32, 12-31, 12-30, 12-29, 12-28, 12-27, 12-26, 12- 25, 12-24, 12-23, 12-22, 12-21, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-1315-50, 15-49, 15-48, 15-47, 15-46, 15-45, 15-44, 15-43, 15-42, 15-41, 15-40, 15-39, 15-38, 15-37, 15- 36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-50, 18-49, 18-48, 18-47, 18-46, 18-45, 18-44, 18- 43, 18-42, 18-41, 18-40, 18-39, 18-38, 18-37, 18-36, 18-35, 18-34, 18-33, 18-32, 18-31, 18-30,18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18- 21, 18-20, 19-50, 19-49, 19- 48, 19-47, 19-46, 19-45, 19-44, 19-43, 19-42, 19-41, 19-40, 19-39, 19-38, 19-37, 19-36, 19-35,19-34, 19-33, 19-32, 19-31, 19-30, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19- 22, 19-21, 19-20, 20-50, 20-49, 20-48, 20-47, 20-46, 20-45, 20-44, 20-43, 20-42, 20-41, 20-40,20-39, 20-38, 20-37, 20-36, 20-35, 20-34, 20-33, 20-32, 20-31, 20-30, 20-30, 20-29, 20-28, 20- 27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-50, 21-49, 21-48, 21-47, 21-46, 21-45, 21-44,21-43, 21-42, 21-41, 21-40, 21-39, 21-38, 21-37, 21-36, 21-35, 21-34, 21-33, 21-32, 21-31, 21- 30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, 21-22, 22-50, 22-49, 22-48, 22-47, 22-46,22-45, 22-44, 22-43, 22-42, 22-41, 22-40, 22-39, 22-38, 22-37, 22-36, 22-35, 22-34, 22-33, 22-32, 22-31, 22-30, 22-29, 22-28, 22-27, 22-26, 22-25, 22-24, 22-23, 23-50, 23-49, 23-48, 23-47,23-46, 23-45, 23-44, 23-43, 23-42, 23-41, 23-40, 23-39, 23-38, 23-37, 23-36, 23-35, 23-34, 23-33, 23-32, 23-31, 23-30, 23-29, 23-28, 23-27, 23-26, 23-25, or 23-24 base pairs in length.Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0096] Similarly, the region of complementarity to the target sequence can be between 5 and 50 nucleotides in length, e.g., between 5-50, 5-49, 5-48, 5-47, 5-46, 5-45, 5-44, 5-43, 5-42, 5-41,5-40, 5-39, 5-38, 5-37, 5-36, 5-35, 5-34, 5-33, 5-32, 5-31, 5-30, 5-29, 5-28, 5-27, 5-26, 5-25, 5- 24, 5-23, 5-22, 5-21, 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5-8, 5- 7, 5-6, 6-50, 6-49, 6-48, 6-47, 6-46, 6-45, 6-44, 6-43, 6-42, 6-41, 6-40, 6-39, 6-38, 6-37, 6-36, 6- 35, 6-34, 6-33, 6-32, 6-31, 6-30, 6-29, 6-28, 6-27, 6-26, 6-25, 6-24, 6-23, 6-22, 6-21, 6-20, 6-19,6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 8-50, 8-49, 8-48, 8-47, 8-46, 8- 45, 8-44, 8-43, 8-42, 8-41, 8-40, 8-39, 8-38, 8-37, 8-36, 8-35, 8-34, 8-33, 8-32, 8-31, 8-30, 8-29, 8-28, 8-27, 8-26, 8-25, 8-24, 8-23, 8-22, 8-21, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9, 10-50, 10-49, 10-48, 10-47, 10-46, 10-45, 10-44, 10-43, 10-42, 10-41, 10-40, 10-39, 10-38, 10-37, 10-36, 10-35, 10-34, 10-33, 10-32, 10-31, 10-30, 10-29, 10-28, 10-27, 10-26, 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 10-10, 10-9, 12-50, 12-49, 12-48, 12-47, 12-46, 12-45, 12-44, 12-43, 12-42, 12-41, 12-40, 12-39, 12-38, 12-37, 12-36, 12-35, 12-34, 12-33, 12-32, 12-31, 12-30, 12-29, 12-28, 12-27, 12-26, 12-25, 12-24, 12-23, 12-22, 12-21, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 15-50, 15-49, 15-48, 15-47, 15-46, 15-45, 15-44, 15-43, 15-42, 15-41, 15-40, 15-39, 15- 38, 15-37, 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-50, 18-49, 18-48, 18-47, 18-46, 18- 45, 18-44, 18-43, 18-42, 18-41, 18-40, 18-39, 18-38, 18-37, 18-36, 18-35, 18-34, 18-33, 18-32,18-31, 18-30, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18- 21, 18-20, 19- 50, 19-49, 19-48, 19-47, 19-46, 19-45, 19-44, 19-43, 19-42, 19-41, 19-40, 19-39, 19-38, 19-37,19-36, 19-35, 19-34, 19-33, 19-32, 19-31, 19-30, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19- 24, 19-23, 19-22, 19-21, 19-20, 20-50, 20-49, 20-48, 20-47, 20-46, 20-45, 20-44, 20-43, 20-42,20-41, 20-40, 20-39, 20-38, 20-37, 20-36, 20-35, 20-34, 20-33, 20-32, 20-31, 20-30, 20-30, 20- 29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-50, 21-49, 21-48, 21-47, 21-46,21-45, 21-44, 21-43, 21-42, 21-41, 21-40, 21-39, 21-38, 21-37, 21-36, 21-35, 21-34, 21-33, 21- 32, 21-31, 21-30, 21- 29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, 21-22, 22-50, 22-49, 22-48,22-47, 22-46, 22-45, 22-44, 22-43, 22-42, 22-41, 22-40, 22-39, 22-38, 22-37, 22-36, 22-35, 22-34, 22-33, 22-32, 22-31, 22-30, 22-29, 22-28, 22-27, 22-26, 22-25, 22-24, 22-23, 23-50, 23-49,23-48, 23-47, 23-46, 23-45, 23-44, 23-43, 23-42, 23-41, 23-40, 23-39, 23-38, 23-37, 23-36, 23-35, 23-34, 23-33, 23-32, 23-31, 23-30, 23-29, 23-28, 23-27, 23-26, 23-25, or 23-24 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.Chemical Modifications of ASOs

[0097] In certain embodiments, the ASO does not consist of only DNA. In certain embodiments, the ASO comprises at least one chemical modification relative to a natural nucleotide (e.g., ribonucleotide, e.g., 2'-deoxy-2'-ribonucleotide). Various chemical modifications can be included in the ASOs of the present disclosure. The modifications can include one or more modifications in a sugar group (e.g., ribose) group, one or more modifications in a phosphate group, one or more modifications in a nucleobase, one or moreterminal modifications, or a combination thereof. In some embodiments, an exemplary ASO comprising or consisting of a nucleotide sequence targeting a regRNA as shown in any one of Tables 2-7 is chemically modified. Such modifications can be, but are not limited to, 2'-O-(2- methoxyethyl) (2'-M0E), locked nucleic acid (LNA), 5-methyl on the cytidine, constrained ethyl (cET), phosphorothioate (PS) linkage, and / or a phosphodiester (PO) linkage, or any combination thereof. Chemical modifications of RNA are known in the art and described in, for example, PCT Application Publication No. WO2013 / 177248, incorporated herein by reference. In certain embodiments, each cytidine in an ASO provided herein is modified by 5-methyl.

[0098] Various chemical modifications for use with ASOs of the present disclosure include, but are not limited to: 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, unlocked nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl- modified nucleotides, 2'- hydroxyl-modified nucleotides, 2' -methoxy ethyl modified nucleotides, 2'-O-alkyl- modified nucleotides, morpholino nucleotides, phosphoramidates, non-natural base comprising nucleotides, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides comprising a phosphorothioate group, nucleotides comprising a methylphosphonate group, nucleotides comprising a 5 '- phosphate, and nucleotides comprising a 5 '-phosphate mimic.

[0099] In certain embodiments, the ASO comprises an RNA polynucleotide chemically modified to be resistant to one or more nucleases (e.g., nuclear RNases (e.g., the exosome complex or RNaseH)). In some embodiments, all nucleotide bases are modified in the ASO. In certain embodiments, the chemical modifications comprises P-D-ribonucleotides, 2'-modified nucleotides (e.g., 2'-O-(2-Methoxyethyl) (2’ -MOE), 2'-O-CH3, or 2'-fluoro-arabino (FANA)), bicyclic sugar modified nucleotides (e.g., having a constrained ethyl or locked nucleic acid (LNA)), and / or one or more modified internucleotide bonds (e.g., phosphorothioate (PS) internucleotide linkage or phosphodiester (PO) internucleotide linkage). In certain embodiments, the chemical modification comprises 2’ -MOE and a phosphorothioate (PS) internucleotide bond. In certain embodiments, the chemical modification comprises 2’ -MOE and a phosphodiester (PO) internucleotide bond. In certain embodiments, at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 or more consecutive nucleotides of the ASO are modified by2’ -MOE. In certain embodiments, each nucleotide of the ASO is modified by 2’ -MOE. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 or more consecutive internucleotide bonds of the ASO are phosphorothioate (PS) internucleotide bonds. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 or more consecutive internucleotide bonds of the ASO are phosphodiester (PO) internucleotide bonds. In certain embodiments, each internucleotide bond of the ASO is a phosphorothioate (PS) internucleotide bond. In certain embodiments, each internucleotide bond of the ASO is a phosphodiester (PO) internucleotide bond.

[0100] Internucleotide linkage modifications that can be used with the ASOs of the present disclosure include, but are not limited to, phosphorothioate “PS” (P(S)), phosphodiester (PO), phosphoramidate (P(NRiR2)such as dimethylaminophosphoramidate(P(N(CH3)2)), phosphonocarboxylate (P(CH2)nCOOR) such as phosphonoacetate “PACE” (P(CH2COO-)), thiophosphonocarboxylate ((S)P(CH2)nCOOR) such as thiophosphonoacetate “thioPACE” ((S)P(CH2COO-)), alkylphosphonate (P(Ci-3alkyl) such as methylphosphonate — P(CH3), boranophosphonate (P(BH3)), and phosphorodithioate (P(S)2).

[0101] In some embodiments, an ASO provided herein comprises at least 1, 2, 3, 4, 5, 6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more PO bonds or linkages. In some embodiments, all internucleotide bonds of an ASO provided herein are PO internucleotide bonds. In some embodiments, an ASO provided herein does not include PO internucleotide bonds. In some embodiments, an ASO provided herein does not include any PO internucleotide bonds between the 5’ or the 3’ terminal nucleotides of the ASO and their respective immediate proximal nucleotides. In some embodiments, an ASO provided herein includes a PS internucleotide bond joining the 5’ terminal nucleotide of the ASO and its immediate proximal nucleotide. In some embodiments and ASO provided herein includes PS internucleotide bond joining the 3’ terminal nucleotide of the ASO and its immediate proximal nucleotide. In some embodiments, an ASO provided herein includes a PS internucleotide bond joining each of the 5’ and 3’ terminal nucleotides of the ASO with their immediate proximal nucleotides and the ASO further includes at least 1, 2, 3, 4, 5, 6, 7 or 8 PO internucleotide bonds joining any two or more nucleotides of the ASO on both or either the 5’ and 3’ ends of the ASO. In some embodiments, aligand is linked to a 5’ terminal or 3’ terminal nucleotide of an ASO provided herein via a PS internucleotide linkage. In some embodiments, a ligand is linked to a 5’ terminal or 3’ terminal nucleotide of an ASO provided herein via a PO internucleotide linkage.

[0102] In some embodiments, an ASO provided herein comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more PS internucleotide bonds. In some embodiments, all internucleotide bonds of an ASO provided herein are PS bonds. In some embodiments, an ASO provided herein does not comprise PS internucleotide bonds.

[0103] In certain embodiments, the ASO comprises one or more chemical modifications at the 5’ end, the 3’ end, or both. Without wishing to be bound by theory, chemical modifications at one or both termini of a polynucleotide (e.g., polyribonucleotide) may stabilize the polynucleotide. In certain embodiments, the ASO comprises one or more chemical modifications in at least 1, 2, 3, 4, or 5 nucleotides at the 5’ end of the ASO. In certain embodiments, the ASO comprises one or more chemical modifications in at least 1, 2, 3, 4, or 5 nucleotides at the 3’ end of the ASO. In certain embodiments, the ASO comprises one or more chemical modifications in at least 1, 2, 3, 4, or 5 nucleotides at the 5’ end of the ASO and one or more chemical modifications in at least 1, 2, 3, 4, or 5 nucleotides at the 3’ end of the ASO.

[0104] The chemical structures can also be described in writing. In such cases, ‘M’ indicates MOE; ‘d’ indicates DNA, ‘L’ indicates LNA, “m” indicates 2' OMethyl, ‘=’ indicates a phosphorothioate (PS) linkage, indicates a phosphodiester (PO) linkage, or ‘5C’ indicates 5-MethylCytosine, ‘A’ indicates FANA, “BioTeg” indicates Biotin, “Palm” indicates Palmitic acid, and “Cl 8” indicates a Spacer 18 moiety.

[0105] To avoid ambiguity, this LNA has the formula:wherein B is the particular designated base.

[0106] Exemplary ASOs with chemical modifications are provided in Tables 3, 4, 5, 6, and 7. In some embodiments, an ASO provided herein comprises a nucleotide sequence and / or a chemical modification any one of the ASOs provided in in Tables 3, 4, 5, 6 and 7.

[0107] In some embodiments, an ASO comprises a sequence selected from the group consisting of SEQ ID NOs: 3-1535 or 2846-3228. In some embodiments, an ASO comprises a sequence and / or chemical modifications provided in any one of SEQ ID NOs: 1536-2141, 2143- 2819, or 3229-3755.

[0108] In some embodiments, an ASO provided herein comprises a nucleotide sequence of any one of the ASOs provided herein, e.g., in Tables 2-7. In some embodiments, the ASO comprises a sequence and / or chemical modification provided in any one of SEQ ID NOs: 1536- 2141, 2143-2819, 2846-3228, or 3229-3755. In some embodiments, the ASO comprising a sequence selected from the group consisting of SEQ ID NOs: 3-2141, 2143-2819, or 2846-3228 further comprises any chemical modification(s) as disclosed herein.

[0109] One of skill in the art would further understand that any regRNA and / or ASO sequence shown as comprising a thymidine nucleotide may instead comprise a corresponding uracil nucleotide if the relevant nucleobase is an RNA nucleobase, e.g., the sequence provided as CCCCTCCCTTCAGGAATTCA (SEQ ID NO: 3) may also be indicated as CCCCUCCCUUCAGGAAUUCA (SEQ ID NO: 3756) as needed, or GGGTCTCTGAGTTGTCCATC (SEQ ID NO: 2848) may also be indicated as GGGUCUCUGAGUUGUCCAUC (SEQ ID NO: 3757) as needed.High Affinity Modified Nucleotides

[0110] A high affinity modified nucleotide is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleotide of the present disclosure preferably result in an increase in melting temperature between +0.5 to +12° C, such as between +1.5 to +10° C or +3 to +8° C per modified nucleotide. Numerous high affinity modified nucleotides are known in the art and include for example, many 2' substituted nucleotides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann (1997) Nucl. Acid Res., 25, 4429-4443 and Uhlmann (2000) Curr. Opinion in Drug Development, 3(2), 293-213), each of which are hereby incorporated by reference.Sugar Modifications

[0111] The ASOs described herein may comprise one or more nucleotides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA. Numerous nucleotides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance. Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleotides include, for example, bicyclohexose nucleic acids (PCT Application Publication No. WO 2011 / 017521) or tricyclic nucleic acids (PCT Application Publication No. WO 2013 / 154798), both of which are hereby incorporated by reference. Modified nucleotides also include nucleotides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.

[0112] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in RNA nucleotides. Substituents may, for example be introduced at the 2', 3', 4' or 5' positions.

[0113] In some embodiments, oligonucleotides comprise modified sugar moieties, such as any one of a 2’-O-methyl (2’0Me) moiety, a 2'-O-methoxyethyl moeity, a bicyclic sugar moeity, PNA (e.g., an oligonucleotide comprising one or more A-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), locked nucleotide (LNA) (e.g., an oligonucleotide comprising one or more locked ribose, and can be a mixture of 2'-deoxy nucleotides or 2'0Me nucleotides), cET (e.g., an oligonucleotide comprising one or more cET sugars), cMOE (e.g., an oligonucleotide comprising one or more cMOE sugar), morpholino oligomer (e.g., an oligonucleotide comprising a backbone comprising one or more phosphorodiamidate morpholiono oligomers), 2’-deoxy-2'-fluoro nucleotide (e.g., an oligonucleotide comprising one or more 2'-fluoro-P-D-arabinonucleotide), tcDNA (e.g., an oligonucleotide comprising one or more tcDNA modified sugar), constrained ethyl 2’ -4’ -bridged nucleic acid (cEt), 5-cEt, ethylene bridged nucleic acid (ENA) (e.g., an oligonucleotide comprising one or more ENA modified sugar), hexitol nucleic acids (HNA)(e.g., an oligonucleotide comprising one or more HNA modified sugar), or tricyclic analog (tcDNA) (e.g., an oligonucleotide comprising one or more tcDNA modified sugar).

[0114] In some embodiments, oligonucleotides comprise nucleobase modifications selected from the group consisting of 2-thiouracil (“2-thioU”), 2-thiocytosine (“2-thioC”), 4-thiouracil (“4-thioU”), 6-thioguanine (“6-thioG”), 2-aminoadenine (“2-aminoA”), 2-aminopurine, pseudouracil, hypoxanthine, 7-deazaguanine, 7-deaza-8-azaguanine, 7-deazaadenine, 7-deaza-8- azaadenine, 5 -methylcytosine (“5-methylC”), 5 -methyluracil (“5-methylU”), 5- hydroxymethylcytosine, 5-hydroxymethyluracil, 5,6-dehydrouracil, 5-propynylcytosine, 5- propynyluracil, 5-ethynylcytosine, 5-ethynyluracil, 5-allyluracil (“5-allylU”), 5 -allylcytosine (“5- allylC”), 5-aminoallyluracil (“5-aminoallylU”), 5-aminoallyl-cytosine (“5-aminoallylC”), an abasic nucleotide, Z base, P base, Unstructured Nucleic Acid (“UNA”), isoguanine (“isoG”), and isocytosine (“isoC”), glycerol nucleic acid (GNA), thiomorpholino (C4H9NS) or thiophosphoramidate morpholinos (TMOs). Synthesis of glycerol nucleic acid (GNA) (also known as glycol nucleic acids) is described in Zhang et al. (2010) Curr. Protoc. Nucleic Acid Chem. 42: 4.40.1-4.40.18, hereby incorporated by reference. Synthesis of thiophosphoramidate Morpholino Oligonucleotides is described in Langer et al. (2020) J. Am. Chem. Soc. 142(38): 16240-53.2' Sugar Modified Nucleotides

[0115] A 2' sugar modified nucleotide is a nucleotide which has a substituent other than H or -OH at the 2' position (2' substituted nucleotide) or comprises a 2' linked biradical capable of forming a bridge between the 2' carbon and a second carbon in the ribose ring, such as LNA (2'- 4' biradical bridged) nucleotides.

[0116] Without wishing to be bound by theory, the 2' modified sugar may provide enhanced binding affinity and / or increased nuclease resistance to the oligonucleotide. Examples of 2' substituted modified nucleotides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O- methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA, and 2'-F-ANA nucleotide. For further examples, see e.g. Freier & Altmann (1997) Nucl. Acid Res., 25, 4429-4443 and Uhlmann (2000) Curr. Opinion in Drug Development, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937, each of which are hereby incorporated by reference.Locked Nucleic Acid Nucleotides (LNA Nucleotide)

[0117] A “LNA nucleotide” is a 2'-sugar modified nucleotide which comprises a biradical linking the C2' and C4' of the ribose sugar ring of said nucleotide (also referred to as a “2'-4' bridge”), which restricts or locks the conformation of the ribose ring. In other words, a locked nucleotide is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleotides to oligonucleotides has been shown to increase oligonucleotide stability in serum, and to reduce off-target effects (Grunweller, A. et al., (2003) Nucleic Acids Research 31 (12):3185-3193). These nucleotides are also sometimes termed bridged nucleic acid or bicyclic nucleic acid (BNA). The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide with complementarity to an RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complement duplex. Exemplary LNA nucleotides include beta-D-oxy-LNA, 6'-methyl-beta-D-oxy LNA such as (S)- 6'-methyl-beta-D-oxy-LNA (ScET) and ENA.

[0118] Examples of bicyclic nucleotides for use in the polynucleotides of the disclosure include without limitation nucleotides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the polynucleotide agents of the disclosure include one or more bicyclic nucleotides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleotides, include but are not limited to 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'- CH(CH2OCH3)-O-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)- 0-2' (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4'-CH2-N(OCH3)-2' (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4'-CH2-O-N(CH3)2-2' (see, e.g., U.S. Patent Publication No. 2004 / 0171570); 4'-CH2-N(R)-O-2', wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74: 118-134); and 4'-CH2-C(=CH2)-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0119] Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S.Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, the entire contents of each of which are hereby incorporated herein by reference.

[0120] Any of the foregoing bicyclic nucleotides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and P-D- ribofuranose (see International Publication No. WO 99 / 14226, contents of which are incorporated by reference herein).

[0121] An oligonucleotide of the disclosure can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-O-2' bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as "5- cEt."

[0122] An oligonucleotide of the disclosure may also include one or more "conformationally restricted nucleotides" ("CRN"). CRN are nucleotide analogs with a linker connecting the C2' and C4' carbons of ribose or the C3 and -C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to an RNA (e.g., a regRNA or a mRNA). The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

[0123] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013 / 0190383; and PCT Publication WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference.

[0124] In some embodiments, an oligonucleotide of the disclosure comprises one or more monomers that are UNA (unlocked nucleotide) nucleotides. UNA is unlocked acyclic nucleotide, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between Cl'-C4' have been removed (i.e., the covalent carbon-oxygen-carbon bond between the Cl' and C4' carbons). In another example, the C2'-C3' bond (i.e., the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133- 134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

[0125] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013 / 0096289;2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0126] The ribose molecule may also be modified with a cyclopropane ring to produce a tricyclodeoxynucleic acid (tricyclo DNA). The ribose moiety may be substituted for another sugar such as 1,5,-anhydrohexitol, threose to produce a threose nucleotide (TNA), or arabinose to produce an arabino nucleotide. The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleotide or glycol to produce glycol nucleotides.

[0127] Potentially stabilizing modifications to the ends of nucleotide molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861.

[0128] Other alternatives chemistries of an oligonucleotide of the disclosure include a 5' phosphate or 5' phosphate mimic, e.g., a 5'-terminal phosphate or phosphate mimic of an oligonucleotide. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.

[0129] Additional non- limiting, exemplary LNA nucleotides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12: 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59: 9645-9667, each of which are hereby incorporated by reference.

[0130] In some embodiments, the length of the ASO is 5 x n + 5 nucleotides (n is an integer of 3 or greater), wherein the nucleotides at positions 5 x m are ribonucleotides modified by LNA (m is an integer from 1 to n) and the nucleotides at the remaining positions are ribonucleotides modified by 2'-O-methoxyethyl.

[0131] In some embodiments, the nucleotide sugar modification is 2'-0 — C i ralky 1 such as 2'-O-methyl (2'-OMe), 2'-deoxy (2'-H), 2'-0 — Ci-3alkyl-0 — Ci aalkyl such as 2'-methoxyethyl (“2'-MOE”), 2'-fluoro (“2'-F”), 2'-amino (“2'-NH2”), 2'-arabinosyl (“2'-arabino”) nucleotide, 2'- F-arabinosyl (“2'-F-arabino”) nucleotide, 2'-locked nucleic acid (“LNA”) nucleotide, 2'-amido bridge nucleic acid (AmNA), 2'-unlocked nucleic acid (“UFNA”) nucleotide, a sugar in L form (“F-sugar”), or 4'-thioribosyl nucleotide.Mixmers and Gapmers

[0132] The ASO can have a steric structure, for example, in a pattern disclosed, e.g., in an ASO of Tables 3, 5, or 7.

[0133] The ASO can have a mixmer and / or gapmer structure, for example, in a pattern disclosed, e.g., in an ASO of Tables 4 or 6.

[0134] In certain embodiments, the ASO is a mixmer. As used herein, the term “mixmer” refers to an oligonucleotide comprising an alternating composition of DNA monomers and nucleotide analogue monomers across at least a portion of the oligonucleotide sequence. In certain embodiments, the ASO is a mixmer based on the gapmer structure, comprising a mixture of DNA nucleotides and 2’-M0E nucleotides in the gap, flanked by RNA sequences (e.g., 2’- modified RNA sequences) in the wings. Mixmers may be designed to comprise a mixture of affinity enhancing nucleotide analogues, such as in non-limiting example 2'-O-alkyl-RNA monomers, 2'-amino-DNA monomers, 2'-fluoro-DNA monomers, LNA monomers, arabino nucleic acid (ANA) monomers, 2'-fluoro-ANA monomers, HNA monomers, INA monomers, 2'- MOE-RNA (2'-O-methoxyethyl-RNA), 2'Fluoro-DNA, and LNA. In some embodiments, the mixmer is incapable of recruiting RNase H. In some embodiments, the mixmer comprises one type of affinity enhancing nucleotide analogue together with DNA and / or RNA.

[0135] Multiple different modifications can be interspaced in a mixmer. For example, the ASO can comprise LNA modification in a plurality of nucleotides and a different modification in some or all of the rest of the nucleotides. In some embodiments, any two adjacent LNA- modified nucleotides are separated by at least 1, 2, 3, 4, or 5 nucleotides. Throughout the ASO, the distance between adjacent LNA-modified nucleotides can either be constant (e.g., any two adjacent LNA-modified nucleotides are separated by 1, 2, 3, 4, or 5 nucleotides) or variable. In some embodiments, the length of the ASO is 3 x n, 3 x n - l, or 3 x n - 2 nucleotides (n is an integer of 6 or greater), wherein (a) (i) the nucleotides at positions 3 x m - 2 (m is an integerfrom 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g., LNA), (ii) the nucleotides at positions 3 x m - 1 (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g., LNA), or (iii) the nucleotides at positions 3 x m (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides)comprising a first modification (e.g., LNA); and (b) the nucleotides at the remaining positions comprise a second, different modification (e.g., 2'-O-methoxyethyl). In some embodiments, the length of the ASO is 2 x n or 2 x n - 1 nucleotides (n is an integer of 9 or greater), wherein (a) (i) the nucleotides at positions 2 x m - 1 (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g., LNA), or (ii) the nucleotides at positions 2 x m (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g., LNA); and (b) the nucleotides at the remaining positions comprise a second, different modification (e.g., 2'-O-methoxyethyl). Similar modification patterns, for example, where the first modification is repeated very 4, 5, or more nucleotides, are also contemplated. In some embodiments, the length of the ASO is 4 x n, 4 x n - 1, or 4 x n - 2 nucleotides (n is an integer of 6 or greater), wherein (a) (i) the nucleotides at positions 4 x m - 2 (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g., LNA), (ii) the nucleotides at positions 4 x m - 1 (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides)comprising a first modification (e.g., LNA), or (iii) the nucleotides at positions 3 x m (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g., LNA); and (b) the nucleotides at the remaining positions comprise a second, different modification (e.g., 2'-O-methoxyethyl). In some embodiments, the length of the ASO is 5 x n, 5 x n - l, or 5 x n - 2 nucleotides (n is an integer of 6 or greater), wherein (a) (i) the nucleotides at positions 5 x m - 2 (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g., LNA), (ii) the nucleotides at positions 5 x m - 1 (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g., LNA), or (iii) the nucleotides at positions 5 x m (m is an integer from 1 to n) are nucleotides (e.g., ribonucleotides or deoxyribonucleotides) comprising a first modification (e.g.,LNA); and (b) the nucleotides at the remaining positions comprise a second, different modification (e.g., 2'-O-methoxyethyl).

[0136] In some embodiments, the ASO further comprises a targeting moiety conjugated at the 5’ or 3’ end of the ASO.

[0137] In certain embodiments, the ASO comprises a DNA sequence (e.g., having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides of unmodified DNA) flanked on both sides by RNA sequences. Such structure is known as “gapmer,” in which the DNA region is referred to as the “gap” and the RNA regions is referred to as the “wings” (see, e.g., PCT Application Publication No. WO2013 / 177248). Gapmers were known to facilitate degradation of the target RNA by recruiting nucleases (e.g., nuclear RNAses (e.g., RNase H)). Surprisingly, in some embodiments of the present disclosure, it has been discovered that a gapmer that binds to a regRNA having the same sequence as a parent ASO but having different chemical modifications, can also increase target gene expression. In certain embodiments, the ASO comprises a DNA sequence flanked by RNA sequences and does not induce RNAse- or RNAse H-mediated degradation.

[0138] In some embodiments, a gapmer ASO includes three regions: a 5’-wing, a gap, and a 3 ’-wing) which form a contiguous sequence of nucleotides and may be described as “X-Y-Z”, wherein “X” represents the 5 ’-wing, “Y” represents the gap and Z represents the 3 ’-wing. In some embodiments, a gapmer ASO described as “X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5 ’-wing and the 3 ’-wing, and no intervening nucleotides exist between the 5 ’-wing and the gap, or the gap and the 3 ’-wing. In some embodiments, X and Z are of the same length. In some embodiments X and Z are of different lengths.

[0139] In some embodiments, the ASO gapmer comprises an internal DNA region flanked by two external “wings” (e.g., a 5’-wing and a 3’-wing). For example, the internal gap can comprise at least 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s), while each of the external wing(s) (e.g., a 5’-wing and a 3’-wing) can independently comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nucleotides. Exemplary gapmer structures (X-Y-Z) include, but are not limited toa 1-10-9, 2-10-8, 3-10-7, 4-10-6, 6-10-4, 7-10-3, 8-10-2, 9-10-1, 1-18-1, 2-16-2, 3-14-3, 4-12-4, 5-10-5, 6-8-6, 7-6-7, 8-5-7, 7-5-8, 8-4-8, or 9-2-9 structure, where the first and third number indicate the number of external wing (e.g., 5’-wing and 3’-wing) nucleotides and the second number indicates the number of internal gap nucleotides.

[0140] The ASO can also be a mixmer comprising one DNA region linked to one RNA region. In some embodiments, the mixmer comprises at least 10 DNA nucleotides linked to at least 10 RNA nucleotides, wherein the DNA nucleotides are at the 5' end of the mixmer or the 3' end of the mixmer. In some embodiments, the mixmer comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 DNA nucleotide(s) linked to at least 49, 48, 47, 46, 45,44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19,18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 RNA nucleotide(s), wherein the DNA nucleotides are at the 5' end of the mixmer or the 3' end of the mixmer. In some embodiment, the RNA regions of the gapmer or mixmer can comprise any additional chemical modification as disclosed herein.

[0141] In certain embodiments, the ASO (e.g., the gapmer or mixmer) is about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nucleotides in length. In certain embodiments, the gap is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or more nucleotides in length. In certain embodiments, one or both wings are about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 or more nucleotides in length. In certain embodiments, one or both wings (e.g., a 5’-wing or 3’-wing) includes at least one (e.g., one, two, three, four, five, six or more) modified nucleotide, for example, P-D-ribonucleotides, 2'-modified nucleotides (e.g., 2'-O-(2-Methoxyethyl) (2'-M0E), 2'-O-CH3, or 2'-fluoro-arabino (FANA)), and bicyclic sugar modified nucleotides (e.g., having a constrained ethyl or locked nucleic acid (LNA), or any other modified nucleotide described herein).

[0142] In some embodiments, the gap of a gapmer ASO provided herein includes at least one (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 modified nucleotide(s) (e.g., a 5-methylcytosine, 2’ -deoxynucleotide, or any other modified nucleotide described herein).

[0143] In some embodiments, a gapmer ASO provided herein includes one or more modified internucleotide linkages or bonds. In some embodiments, a gapmer ASO provided herein includes one or more phosphorothioate (PS) internucleotide linkages. In some embodiments, a gapmer ASO provided herein does not include any PS internucleotide linkages. In some embodiments, a gapmer ASO provided herein includes one or more phosphodiester (PO) internucleotide linkages. In some embodiments, a gapmer ASO provided herein does not include any PO internucleotide linkages. In some embodiments, all of the nucleotides of a gapmer ASO are linked via PS internucleotide linkages. In some embodiments, each nucleotide of a 5 ’-wing of a gapmer ASO provided herein are linked via a PS internucleotide linkage and / or each nucleotide of a 3 ’-wing of a gapmer ASO provided herein are linked via a PS internucleotide linkage. In some embodiments, the nucleotides of the 5 ’-wing and / or the 3’ wing of a gapmer ASO provided are linked via a combination of PO internucleotide linkages and PS internucleotide linkages, and nucleotides of the gap of the gapmer ASO are linked to each other via PS internucleotide linkages. In some embodiments, all of the nucleotides of the gap of a gapmer ASO provided herein are linked to each other via PS internucleotide linkages, and nucleotides of the 5 ’-wing and / or the 3 ’-wing of the gapmer ASO are linked via PS internucleotide linkages, an optionally the 5’-wing or the 3’wing includes 1-Xnphosphodiester (PO) internucleotide linkages, where n is the number of nucleotides in the wing minus 1. In some embodiments, of a gapmer ASO provided herein a PS internucleotide linkage joins the 5’ terminal nucleotide of the gapmer ASO to its immediate proximal nucleotide and / or a PS internucleotide linkage joins the 3’ terminal nucleotide of the gapmer ASO to its immediate proximal nucleotide. In some embodiments, the 5’ wing and the 3’ wing of a gapmer ASO include the same number of PO internucleotide linkages. In some embodiments, the 5’ wing and the 3’ wing of a gapmer ASO include a different number of PO internucleotide linkages. In some embodiments, the 5 ’-wing and the 3’- wing of a gapmer ASO provided herein each independently include 0, 1, 2, 3, 4, 5, 6, 7, or 8 PO internucleotide linkages.

[0144] In certain embodiments, each ribonucleotide in the mixmer or gapmer is modified by 2'-M0E. In certain embodiments, the mixmer or gapmer comprises one or more modified internucleotide bonds, e.g., phosphorothioate (PS) internucleotide linkage. In certain embodiments, each two adjacent nucleotides in the mixmer or gapmer are linked by a phosphorothioate internucleotide bond.

[0145] In certain embodiments, the ASO does not comprise 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, or 45 or more contiguous nucleotides of unmodified DNA. In some embodiments, such a DNA sequence is disrupted by modified (e.g., 2'-MOE modified) ribonucleotides every 2, 3, 4, 5, or more nucleotides. In some embodiments, the ASO comprises only ribonucleotides and no deoxyribonucleotides.

[0146] The structural features of mixmer and gapmer can be combined. In certain embodiments, the ASO has a structure similar to that of a mixmer disclosed herein (e.g., one having interspaced modifications), except that the second modification in the gap is changed to a third modification (e.g., deoxyribonucleotide). In certain embodiments, the ASO has a structure similar to that of a gapmer disclosed herein, except that in the gap the nucleotides are modified in a mixmer pattern.

[0147] In certain embodiments, the ligand moiety comprises biotin. In certain embodiments, the ligand moiety comprises palmitic acid. In certain embodiments, the ligand moiety comprises a Spacer 18 moiety (Cl 8).III. Pharmaceutical Compositions

[0148] In certain embodiments, an ASOs disclosed herein can be present in pharmaceutical compositions. The pharmaceutical composition can be formulated for use in a variety of drug delivery systems. One or more pharmaceutically acceptable excipients or carriers can also be included in the composition for proper formulation. In some embodiments, the pharmaceutical acceptable carrier comprises sterile saline, sterile water, sterile phosphate buffered saline (PBS), or sterile artificial cerebrospinal fluid. Suitable formulations for use in the present disclosure are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (1990) Science 249:1527-1533.

[0149] Exemplary carriers and pharmaceutical formulations suitable for delivering nucleic acids are described in Durymanov and Reineke (2018) Front. Pharmacol. 9:971; Barba et al. (2019) Pharmaceutics 11(8): 360; Ni et al. (2019) Life (Basel) 9(3): 59, each of which is incorporated herein by reference. It is understood that the presence of a ligand moietyconjugated to the ASO may circumvent the need for a carrier for delivery to a tissue or organ targeted by the ligand moiety.

[0150] The delivery of an oligonucleotide of the disclosure to a cell e.g., a cell within a subject, such as a human subject e.g., a subject in need thereof, such as a subject having or at risk of developing a SYNGAP1 related disorder can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an oligonucleotide of the disclosure either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an oligonucleotide to a subject. These alternatives are discussed further below.

[0151] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an oligonucleotide of the disclosure (see e.g., Akhtar S. and Julian R L., (1992) Trends Cell. Biol. 2(5): 139-144 and WO 94 / 02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an oligonucleotide molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an oligonucleotide can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the oligonucleotide molecule to be administered.

[0152] For administering an oligonucleotide systemically for the treatment of a disease, the oligonucleotide can include alternative nucleobases, alternative sugar moieties, and / or alternative internucleotide linkages, or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the oligonucleotide by endo- and exo-nucleases in vivo. Modification of the oligonucleotide or the pharmaceutical carrier can also permit targeting of the oligonucleotide composition to the target tissue and avoid undesirable off-target effects. Oligonucleotide molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the oligonucleotide can be delivered using drug delivery systems such as a nanoparticle, a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, a dendrimer, a polymer,liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an oligonucleotide molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an oligonucleotide by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an oligonucleotide, or induced to form a vesicle or micelle that encases an oligonucleotide. The formation of vesicles or micelles further prevents degradation of the oligonucleotide when administered systemically. In general, any methods of delivery of nucleic acids known in the art may be adaptable to the delivery of the oligonucleotides of the disclosure. Methods for making and administering cationic oligonucleotide complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9: 1291-1300; Arnold, A S et al., (2007) J. Hypertens. 25: 197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of oligonucleotides include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T S. et al., (2006) Nature 441: 111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26: 1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16: 1799-1804). In some embodiments, an oligonucleotide forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of oligonucleotides and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety. In some embodiments the oligonucleotides of the disclosure are delivered by polyplex or lipoplex nanoparticles. Methods for administration and pharmaceutical compositions of oligonucleotides and polyplex nanoparticles and lipoplex nanoparticles can be found in U.S. Patent Application Nos. 2017 / 0121454; 2016 / 0369269; 2016 / 0279256; 2016 / 0251478; 2016 / 0230189;2015 / 0335764; 2015 / 0307554; 2015 / 0174549; 2014 / 0342003; 2014 / 0135376; and 2013 / 0317086, which are herein incorporated by reference in their entirety.

[0153] In some embodiments, the compounds described herein may be administered in combination with additional therapeutics (e.g., using a simultaneous or alternating regimen).Examples of additional therapeutics include an anti-epileptic agent such as quinidine and / or sodium channel blockers, an anti-convulsant, a cholinesterase inhibitor, a dopamine agonist, levodopa, a dopamine reuptake inhibitor (SSRI), a selective serotonin reuptake inhibitor (NRI), a norepinephrine-dopamine reuptake inhibitor (NDRI), a serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI). Additionally, the compounds described herein may be administered in combination with recommended lifestyle changes.Membranous Molecular Assembly Delivery Methods

[0154] Oligonucleotides of the disclosure can also be delivered using a variety of membranous molecular assembly delivery methods including polymeric, biodegradable microparticle, or microcapsule delivery devices known in the art. For example, a colloidal dispersion system may be used for targeted delivery of an oligonucleotide agent described herein. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 pm can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the oligonucleotide are delivered into the cell where the oligonucleotide can specifically bind to a target RNA. In some cases, the liposomes are also specifically targeted, e.g., to direct the oligonucleotide to particular cell types. The composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.

[0155] A liposome containing an oligonucleotide can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate,and lauroyl sarcosine. The oligonucleotide preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the oligonucleotide and condense around the oligonucleotide to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of oligonucleotide.

[0156] If necessary, a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to favor condensation.

[0157] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide / cationic lipid complex as a structural component of the delivery vehicle, are further described in, e.g., WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; Bangham et al., (1965) M. Mol. Biol. 23:238; Olson et al., (1979) Biochim. Biophys. Acta 557:9; Szoka et al., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775: 169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga et al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161. Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169). These methods are readily adapted to packaging oligonucleotide preparations into liposomes.

[0158] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid / liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).

[0159] Liposomes, which are pH-sensitive or negatively charged, entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrappedwithin the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).

[0160] One major type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and / or phosphatidylcholine and / or cholesterol.

[0161] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No. 5,171,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Feigner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90: 11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11:417.

[0162] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising NOVASOME™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and NOVASOME™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin- A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) S.T.P.Pharma. Sci., 4(6):466).

[0163] Liposomes may also be sterically stabilized liposomes, comprising one or more specialized lipids that result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GMI, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, itis thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).

[0164] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., (1987), 507:64) reported the ability of monosialoganglio side GM1, galactocerebroside sulfate, and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., (1988), 85:6949). U.S. Pat. No. 4,837,028 and WO 88 / 04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside GMI or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1 ,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97 / 13499 (Lim et al).

[0165] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver oligonucleotides to macrophages.

[0166] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated oligonucleotides in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

[0167] A positively charged synthetic cationic lipid, N-[l-(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of oligonucleotide (see, e.g., Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

[0168] A DOTMA analogue, l,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles.LIPOFECTIN™ (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, l,2-bis(oleoyloxy)-3,3- (trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

[0169] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide ("DOGS") (TRANSFECT AMINE, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide ("DPPES") (see, e.g. U.S. Pat. No. 5,171,678).

[0170] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol ("DC-Chol") which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.

[0171] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced sideeffects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer oligonucleotide into the skin. In some implementations, liposomes are used for delivering oligonucleotide to epidermal cells and also to enhance the penetration of oligonucleotide into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., (1992) Journal of Drug Targeting, vol. 2,405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, R. J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. et al. (1987) Meth. Enzymol. 149:157-176; Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. Y. and Huang, L., (1987) Proc. Natl. Acad. Sci. USA 84:7851-7855).

[0172] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising NOVASOME I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and NOVASOME II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with oligonucleotides are useful for treating a dermatological disorder.

[0173] The targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Additional methods are known in the art and are described, for example in U.S. Patent Application Publication No. 2006 / 0058255, the linking groups of which are herein incorporated by reference.

[0174] Liposomes that include oligonucleotides can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomescan be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include oligonucleotides can be delivered, for example, subcutaneously by infection in order to deliver oligonucleotides to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transfersomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0175] Other formulations amenable to the present disclosure are described in PCT Publication Nos. WO 2009 / 088891, WO 2009 / 132131, and WO 2008 / 042973, which are hereby incorporated by reference in their entirety.

[0176] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile / lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0177] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general, their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxy lated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0178] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such assoaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[0179] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[0180] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N- alkylbetaines, and phosphatides.

[0181] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0182] The oligonucleotides for use in the methods of the disclosure can also be provided as micellar formulations. Micelles are a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.Lipid Nanoparticle-Based Delivery Methods

[0183] Oligonucleotides in the disclosure may be fully encapsulated in a lipid formulation, e.g., a lipid nanoparticle (LNP), or other nucleic acid-lipid particle. LNPs are useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site).LNPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00 / 03683. The particles of the present disclosure typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present disclosure are resistant in aqueous solution to degradation witha nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010 / 0324120 and PCT Publication No. WO 96 / 40964.

[0184] Non-limiting examples of cationic lipids include N,N-dioleyl-N,N- dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N— (I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N— (I- (2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3- dioleyloxy)propylamine (DODMA), 1 ,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2- Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1 ,2-Dilinoleyoxy-3- (dimethylamino) acetoxypropane (DLin-DAC), 1 ,2-Dilinoley oxy-3 -morpholinopropane (DLin- MA), l,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), l,2-Dilinoleylthio-3- dimethylaminopropane (DLin-S-DMA), l-Linoleoyl-2-linoleyloxy-3 -dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy- 3 -trimethylaminopropane chloride salt (DLin-TMA.Cl), 1 ,2-Dilinoleoy 1-3 -trimethylaminopropane chloride salt (DLin-TAP.Cl), l,2-Dilinoleyloxy-3-(N- methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-l,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)- 1 ,2-propanedio (DOAP), 1 ,2-Dilinoleyloxo-3-(2-N,N- dimethylamino)ethoxypropane (DLin-EG-DMA), 1 ,2-Dilinolenyloxy-N,N- dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[l ,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12- dienyetetrahydro— 3aH-cyclopenta[d][l,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu- tanoate (MC3), 1 , l'-(2-(4-(2-((2- (bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami- no)ethyl)piperazin- 1 - yeethylazanediyedidodecan-2-ol (Tech Gl), or a mixture thereof. The cationic lipid can comprise, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0185] The ionizable / non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE),dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane- 1 -carboxylate (DOPE- mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-0-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, l-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 60 mol % if cholesterol is included, of the total lipid present in the particle.

[0186] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (C12), a PEG- dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16), or a PEG-distearyloxypropyl (Cis). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

[0187] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.

[0188] The ASO may also be delivered in a lipidoid. The synthesis of lipidoids has been extensively described and formulations containing these compounds are particularly suited for delivery of modified nucleic acid molecules or ASOs (see Mahon et al, Bioconjug Chem. 2010 21 : 1448-1454; Schroeder et al, J Intern Med. 2010 267:9-21; Akinc et al, Nat Biotechnol. 2008 26:561- 569; Love et al, Proc Natl Acad Sci U S A. 2010 107: 1864-1869; Siegwart et al, Proc Natl Acad Sci U S A. 2011 108: 12996-3001 ; all of which are incorporated herein in their entireties).

[0189] Lipid compositions for RNA delivery are disclosed in W02012170930A1 , WO2013149141A1, and WO2014152211A1, each of which are hereby incorporated by reference.IV. Therapeutic Applications

[0190] The present disclosure provides methods for treating or preventing diseases and disorders of the central nervous system (CNS) and peripheral nervous system (PNS) in a subject in need thereof, including SYNGAP1 -related disorders (e.g., associated with SYNGAP1mutations), such as SYNGAP1 -related intellectual disability (ID), mental retardation, autosomal dominant 5 (MRD5), or SYNGAP1 -related non-syndromic intellectual disability (NSID)), affective disorders (e.g., depression), schizophrenia, Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, an autism spectrum disorder (ASD) (e.g., Asperger’s syndrome, autistic disorder, and Pervasive Developmental Disorder-Not Otherwise Specified (PDD-NOS)).Subjects having a CNS or PNS trauma (e.g., brain or spinal cord ischemia or trauma, stroke, or a neurological deficit associated with surgery or anesthesia) may also be treated in accordance with the methods provided herein. The methods include administering an ASO provided herein or a pharmaceutical composition comprising the ASO to the subject. While not wishing to be bound by theory, the ASOs provided herein are believed to exert their desirable effects through their ability to modulate (e.g., increase or decrease) the levels of SYNGAP1 protein, SYNGAP1 mRNA, and / or SYNGAP1 activity within a cell of a subject, e.g., by increasing the level of the SYNGAP1 protein in a cell of the subject (e.g., a human, a mouse, a hamster, a non-human primate (e.g., a monkey)).

[0191] Another aspect of the present disclosure includes methods of modulating (e.g., increasing or decreasing) expression of SYNGAP1 in a cell of a subject, comprising contacting the cell with an ASO of the disclosure (or a pharmaceutical composition including the ASO), thereby treating a disease or disorder in the subject (e.g., a disease or disorder provided herein).

[0192] Another aspect of the disclosure includes methods of modulating (e.g., increasing or reducing) the level of SYNGAP1 mRNA or protein in a cell of a subject identified as having a disease or disorder provided herein (e.g., a SYNGAP1 -related disorder).

[0193] In some embodiments, the subject has a KI 185X mutation in the SYNGAP1 gene (e.g. a heterozygous KI 185X mutation). In some embodiments, the subject is SYNGAP1 haploinsufficient. In some embodiments, the subject is SYNGAP1 heterozygous haploinsufficient.

[0194] Still another aspect includes methods of modulating (e.g., increasing or reducing) expression of a SYNGAP1 gene in a cell (e.g., in vivo, ex vivo, or in vitro) including contacting the cell with an ASO of the disclosure (or a pharmaceutical composition including the ASO), thereby increasing the expression of a SYNGAP1 gene in the cell. In some embodiments, the cell is a mammalian cell (e.g., a human cell such as a human neuron). The methods may include contacting a cell with an ASO of the disclosure (or a pharmaceutical composition including theASO), in an amount effective to increase expression of a SYNGAP1 gene in the cell, thereby increasing expression of a SYNGAP1 gene in the cell. In some embodiments, contacting the cell with the ASO (or a pharmaceutical composition including the ASO) modulates (e.g., increases) the amount of SYNGAP1 mRNA in the cell. In some embodiments, contacting the cell with the ASO (or a pharmaceutical composition including the ASO) modulates (e.g., increases or decreases) the amount of SYNGAP1 protein in the cell. In some embodiments, contacting the cell with the ASO (or a pharmaceutical composition including the ASO) modulates (e.g., increases or decreases) the amount of SYNGAP1 activity in the cell.

[0195] In yet another aspect, the disclosure provides an ASO of the disclosure (or a pharmaceutical composition including the ASO) for use as a medicament. Further, the disclosure provides for an ASO of the disclosure (or a pharmaceutical composition including the ASO) for use in therapy.

[0196] Contacting of a cell with an ASO may be performed in vitro, ex vivo, or in vivo. Contacting a cell in vivo with the oligonucleotide includes contacting a cell or group of cells within a subject, e.g., a human subject, with the ASO. Combinations of in vitro, ex vivo, and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, or any other ligand that directs the oligonucleotide to a site of interest. In some embodiments, the cell is a neuron (e.g., a granular neuron, a dopaminergic neuron, a GABAergic neuron, a cholinergic neuron, a glutamatergic neuron, a serotonergic neuron, or a pyramidal neuron), an astrocyte, an oligodendrocyte, a glial cell (e.g., microglia), a neural progenitor cell, or a ciliated cell. For example, the neuron can be a neuron from the CNS, prefrontal cortex, motor cortex, occipital cortex, temporal cortex, putamen, parietal cortex, amygdala, or hippocampus. In some embodiments, the neuron is a glutamatergic neuron. In some embodiments, the ASO is administered with one or more agents capable of promoting penetration of the ASO across the blood-brain barrier. For example, in some embodiments, the ASO is coupled to a composition that promotes penetration or transportation of the ASO across the blood-brain barrier, e.g., a viral vector or an antibody to transferrin receptor.

[0197] Administration of an ASOs or pharmaceutical compositions disclosed herein to a subject can be intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, trans-dermal, intrapleural, intrathecal, intracerebral, intraventricular, intracerebroventricular, intracisternal, intraspinal, peri-spinal, intracavitary, by perfusion through a catheter or by direct intralesional injection. In certain embodiments, the ASO or pharmaceutical composition is administered using an intracranial or intravertebral needle or catheter. In certain embodiments, the ASO or pharmaceutical composition is administered systemically. In certain embodiments, the ASO or pharmaceutical composition is administered by a parenteral route. For example, in certain embodiments, the ASO or pharmaceutical composition is administered intravenously (e.g., by intravenous infusion), for example, with a prefilled bag, a prefilled pen, or a prefilled syringe. In other embodiments, the ASO or pharmaceutical composition is administered locally to an organ or tissue in which an increase in the target gene expression is desirable (e.g., neuronal cells or a specific brain region (e.g., prefrontal cortex, motor cortex, occipital cortex, temporal cortex, putamen, parietal cortex, amygdala, or hippocampus).

[0198] In some embodiments, the ASO is administered to a subject such that the ASO is delivered to a specific site within the subject. Such targeted delivery can be achieved by either systemic administration or local administration. The increase of expression of SYNGAP1 may be assessed by measuring the level or change in the level of SYNGAP1 mRNA or SYNGAP1 protein in a sample (e.g., blood, tissue (e.g., neurological tissue), a neuron cell sample (e.g., hippocampal cells, motor cortex cells, or prefrontal cortex cells), or neurological fluid (e.g., cerebrospinal fluid (CSF)) derived from a specific site within the subject. In certain embodiments, the methods include a clinically relevant increase of expression of SYNGAP1, e.g., as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of SYNGAP1.

[0199] In some embodiments, the methods provided herein may ameliorate or prevent the onset of one or more symptoms or conditions associated with a disease or disorder described herein (e.g. a SYNGAP1 -related disorder), including epilepsy, cognitive impairment (e.g., moderate to severe cognitive impairment), hypotonia (e.g., mild hypotonia), global developmental delay, delayed language development, disordered sleep, oral dyspraxia, inattention, impulsivity, physical aggression, mood swings, sullenness, and rigidity. In some embodiments of the methods provided herein, an ASO provided herein (or a pharmaceutical composition including the ASO) is administered in an amount and for a time effective to result in reduction or improvement (e.g., by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%)of one or more symptoms associated with a disease or disorder described herein (e.g., a SYNGAP1 -related disorder).Modulation of SYNG API expression level

[0200] In some aspects, the therapeutic methods disclosed herein, using an ASO that targets a SYNGAP1 regRNA, result in modulated (e.g., increased or decreased) SYNGAP1 gene expression levels in a subject. Modulated expression of a SYNGAP1 gene includes any level of modulating of a SYNGAP1 gene, e.g., at least partial modulation of the expression of a SYNGAP1 gene. Modulated SYNGAP1 gene expression (e.g., increased or decreased) may be assessed by determining absolute or relative levels of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell (e.g., a neuron (e.g., a granular neuron, a dopaminergic neuron, a GABAergic neuron, a cholinergic neuron, a glutamatergic neuron, a serotonergic neuron, or a pyramidal neuron), an astrocyte, an oligodendrocyte, a glial cell (e.g., microglia), a neural progenitor cell, or a ciliated cell), or sample that is untreated or treated with a control (such as, e.g., buffer only (vehicle) control or inactive agent control). In certain embodiments, the methods provided herein result a clinically relevant modulation (e.g., an increase or decrease) of expression of SYNGAP1 gene, e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to modulate (e.g., increase) the expression of SYNGAP1.

[0201] In certain embodiments, the methods disclosed herein result in increased SYNGAP1 gene expression in a cell (e.g., a neuron (e.g., a granular neuron, a dopaminergic neuron, a GABAergic neuron, a cholinergic neuron, a glutamatergic neuron, a serotonergic neuron, or a pyramidal neuron), an astrocyte, an oligodendrocyte, a glial cell (e.g., microglia), a neural progenitor cell, or a ciliated cell), tissue (e.g., neurological tissue), a neuron cell sample (e.g., hippocampal cells, motor cortex cells, occipital cortex cells, temporal cortex cells, putamen cells, parietal cortex cells, amygdala cells, hippocampus cells, or prefrontal cortex cells), or sample (e.g., neurological fluid (e.g., cerebrospinal fluid (CSF)) of a subject by at least about 1%, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at leastabout 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, relative to the predose, pre-administration, or pre-exposure baseline level. In certain embodiments, the methods disclosed herein increases SYNGAP1 gene expression by at least 2-fold, at least 3-fold, at least 4-fold, at least 5 -fold, at least 6-fold, at least-7 fold, at least 8-fold, at least 9-fold, or at least 10- fold relative to the pre-dose baseline level. In certain embodiments, the subject has a deficiency in SYNGAP1 expression, and the method disclosed herein restores the SYNGAP1 expression level (e.g., SYNGAP1 protein level or SYNGAP1 mRNA level) or SYNGAP1 protein activity to at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of the average SYNGAP1 expression level (e.g., SYNGAP1 protein level or SYNGAP1 mRNA level) or SYNGAP1 protein activity in similar cells, tissues or subjects (e.g., of the same species, of the like age and / or of the same sex) that do not have a deficiency in SYNGAP1 expression.

[0202] In some embodiments, an ASO of the disclosure may enhance the production of SYNGAP1 mRNA (e.g., in a cell or in a cell, tissue, or sample of a subject) by at least about 1%, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900% or more, relative to the pre-dose, preadministration, or pre-exposure baseline level. In some embodiments, an ASO of the disclosure may enhance the production of SYNGAP1 mRNA (e.g., in a cell or in a cell, tissue, or sample of a subject) by at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold or more, relative to the pre-dose, pre-administration, or pre-exposure baseline level. In some embodiments, the SYNGAP1 mRNA is of an isoform annotated as any one of Gencode Transcript Nos.ENST00000646630.1, ENST00000682587.1, and ENST00000428982.4.

[0203] In certain embodiments, the methods disclosed herein result in decreased SYNGAP1 gene expression in a cell (e.g., a neuron (e.g., a granular neuron, a dopaminergic neuron, a GABAergic neuron, a cholinergic neuron, a glutamatergic neuron, a serotonergic neuron, or a pyramidal neuron), an astrocyte, an oligodendrocyte, a glial cell (e.g., microglia), a neural progenitor cell, or a ciliated cell), tissue (e.g., neurological tissue), a neuron cell sample (e.g., hippocampal cells, motor cortex cells, occipital cortex cells, temporal cortex cells, putamen cells, parietal cortex cells, amygdala cells, hippocampus cells, or prefrontal cortex cells), or sample (e.g., neurological fluid (e.g., cerebrospinal fluid (CSF)) of a subject by at least about 1%, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, relative to the predose, pre-administration, or pre-exposure baseline level. In certain embodiments, the methods disclosed herein result in decreased SYNGAP1 gene expression by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least-7 fold, at least 8-fold, at least 9-fold, or at least 10-fold relative to the pre-dose baseline level.

[0204] In some embodiments, an ASO of the disclosure may reduce the production of SYNGAP1 mRNA (e.g., in a cell or in a cell, tissue, or sample of a subject) by at least about 1%, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900% or more, relative to the pre-dose, preadministration, or pre-exposure baseline level. In some embodiments, an ASO of the disclosure may reduce the production of SYNGAP1 mRNA (e.g., in a cell or in a cell, tissue, or sample of asubject) by at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6- fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold or more, relative to the predose, pre-administration, or pre-exposure baseline level.

[0205] In some embodiments, the expression of SYNGAP1 protein (e.g., one or more isoforms of SYNGAP1 protein, e.g., SYNGAP1 Aal, SYNGAP1 Aa2, SYNGAP1 Ap, SYNGAP1 Ay, SYNGAP1 Bal, SYNGAP1 Ba2, SYNGAP1 Bp, SYNGAP1 By, SYNGAP1 Cal, SYNGAP1 Ca2, SYNGAP1 CP, SYNGAP1 Cy, or any combination thereof) is modulated (e.g., increased or decreased) following treatment with, or administration of, an ASO of the disclosure. In some embodiments, the expression of SYNGAP1 protein (e.g., in a cell, tissue, or sample of a subject (e.g., a neuron, neurological tissue or neurological fluid (e.g., cerebrospinal fluid (CSF))) is modulated (e.g., increased or decreased) by at least about 1%, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900% or more, relative to the pre-dose, pre-administration, or pre-exposure baseline level. In some embodiments, the expression of SYNGAP1 protein (e.g., in a cell, tissue, or sample of a subject (e.g., a neuron, neurological tissue or neurological fluid (e.g., cerebrospinal fluid (CSF))) is increased by at least 1-fold, at least 2-fold, at least 3 -fold, at least 4-fold, at least 5 -fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10- fold or more, relative to the pre-dose, pre-administration, or pre-exposure baseline level.

[0206] The expression of a SYNGAP1 gene may be assessed based on the level of any variable associated with SYNGAP1 gene expression, e.g., SYNGAP1 mRNA level or SYNGAP1 protein level. In certain embodiments, the expression level or activity of SYNGAP1 herein refers to the average expression level or activity of SYNGAP1 in the brain (e.g., in neuronal cells of a mammal or human subject).

[0207] In certain embodiments, surrogate markers can be used to detect modulation (e.g., an increase or decrease) of SYNGAP1 expression level or SYNGAP1 activity. For example, effective treatment of a disease or disorder provided herein (e.g., a SYNGAP1 -related disorder), as demonstrated by acceptable diagnostic and monitoring criteria with an agent to increase SYNGAP1 expression can be understood to demonstrate a clinically relevant increase in SYNGAP1.

[0208] Increased expression of SYNGAP1 gene may be manifested by an increase of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a SYNGAP1 gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an oligonucleotide of the disclosure, or by administering an oligonucleotide of the disclosure to a subject in which the cells are or were present) such that the expression of a SYNGAP1 gene is increased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an oligonucleotide or not treated with an oligonucleotide targeted to the gene of interest). Decreased expression of SYNGAP1 gene may be manifested by a decrease of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a SYNGAP1 gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an oligonucleotide of the disclosure, or by administering an oligonucleotide of the disclosure to a subject in which the cells are or were present) such that the expression of a SYNGAP1 gene is decreased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an oligonucleotide or not treated with an oligonucleotide targeted to the gene of interest).

[0209] In other embodiments, an increase or decrease in the expression of a SYNGAP1 gene may be assessed in terms of an increase of a parameter that is functionally linked to SYNGAP1 gene expression, e.g., SYNGAP1 protein expression or SYNGAP1 activity. An increase or decrease in SYNGAP1 protein levels, mRNA levels or activity may be determined in any cell expressing SYNGAP1, either endogenous or heterologous from an expression construct, and using any assay known in the art.

[0210] An increase or decrease of SYNGAP1 expression may be manifested by an increase or decrease in the level of the SYNGAP1 protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject), relative to a control cell or a control group of cells. An increase or decrease of SYNGAP1 expression may also be manifested by an increase in the level of the SYNGAP1 mRNA level in a treated cell or group of cells, relative to a control cell or a control group of cells.

[0211] A control cell or group of cells that may be used to assess the increase or decrease of the expression of a SYNGAP1 gene includes a cell or group of cells that has not yet been contacted with an oligonucleotide of the disclosure. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an oligonucleotide.

[0212] The level of SYNGAP1 mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of SYNGAP1 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the SYNGAP1 gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNEASY™ RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating SYNGAP1 mRNA may be detected using methods the described in PCT Publication WO 2012 / 177906, the entire contents of which are hereby incorporated herein by reference. In some embodiments, the level of expression of SYNGAP1 is determined using a nucleic acid probe. The term "probe," as used herein, refers to any molecule that is capable of selectively binding to a specific SYNGAP1 sequence, e.g. to an mRNA or polypeptide. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0213] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses, and probe arrays. One method for the determination of mRNA levels involves contacting theisolated mRNA with a nucleic acid molecule (probe) that can hybridize to SYNGAP1 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an AFFYMETRIX gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of SYNGAP1 mRNA.

[0214] An alternative method for determining the level of expression of SYNGAP1 in a sample involves the process of nucleic acid amplification and / or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio / Technology 6: 1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the disclosure, the level of expression of SYNGAP1 is determined by quantitative Anorogenic RT-PCR (i.e., the TaqMan™ System) or the DUAL- GLO® Luciferase assay.

[0215] The expression levels of SYNGAP1 mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722; 5,874,219; 5,744,305; 5,677,195; and 5,445,934, which are incorporated herein by reference. The determination of SYNGAP1 expression level may also comprise using nucleic acid probes in solution.

[0216] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays, quantitative PCR (qPCR), real-time quantitative PCR (RT-qPCR), multiplex qPCR or RT-qPCR, RNA-seq, or microarray analysis. Such methods can also be used for the detection of SYNGAP1 nucleic acids.

[0217] The level of SYNGAP1 protein expression, including the levels of specific SYGAP1 isoforms, may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, FACS, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, Luminex, MSD, FISH, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of SYNGAP1 proteins.EXAMPLES

[0218] Below are examples of specific embodiments for carrying out the present disclosure. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present disclosure in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0219] The practice of the present disclosure will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rdEd. (Plenum Press) Vols A and B(1992).Example 1: Modulation of SYNGAP1 expression using SYNGAP1 RR137 and RR138 regRNA-targeting ASOsTwo human SYNGAP1 regRNAs were identified (RR137 and RR138). To assess the ability of ASOs targeting these regRNAs to modulate the expression of SYNGAP1, 188 ASOs targeting these human SYNGAP1 regRNAs were synthesized and initially assessed in the humanneuroblastoma cell line SK-N-AS via transfection at 100 nM. Of this initial set, 94 ASOs were gapmer ASOs and 94 ASOs were steric ASOs. Briefly, cells were reverse transfected using Lipofectamine™ RNAiMAX transfection reagent (Invitrogen™, as instructed by manufacturer) Day 0 with 100 nM of each ASO. Cells were collected on Day 2 for mRNA quantification via quantitate real-time PCR (qPCR). As control, cells were not transfected with ASOs or were transfected with either a gapmer non-targeting control ASO (CO- 1588) or a steric non-targeting control ASO (CO-1589). Table 8 provides the total SYNGAP1 mRNA fold changes as compared to the chemistry-matched NTC ASO. Relative SYNGAP1 mRNA was normalized to mRNA from cells treated with the chemistry-matched NTC ASO.

[0220] Table 8. SYNGAP1 mRNA fold changes

[0221] SYNG-328g, SYNG- 1468g , SYNG-569g, SYNG-444g, SYNG-26g, SYNG-344s, SYNG-1204g, SYNG-1226s, SYNG-863s, SYNG-1186s, and SYNG-1524s induced upregulation of SYNGAP1 mRNA levels more than 1.4 fold as compared to chemistry-matched NTC ASOs, and were further tested. Briefly, SK-N-AS cells were reverse transfected using Lipofectamine™ RNAiMAX transfection reagent (Invitrogen™, as instructed by manufacturer) at Day 0 with either 200 nM, 150 nM, 100 nM, 50 nM, 25 nM, or 12.5 nM of each ASO). As control, cells were not transfected with ASOs or were transfected with either a gapmer nontargeting control ASO (CO- 1588) or a steric non-targeting control ASO (CO- 1589). Cells were collected on Day 2 for mRNA quantification via qPCR. Relative SYNGAP1 mRNA levels were normalized to mRNA levels from cells treated with the transfected dose of a chemistry-matched NTC ASO (CO- 1588 for gapmer ASOs or CO- 1589 for steric ASOs).

[0222] As shown in FIG. 2A and FIG. 2B a dose-depdendent increase of total SYNGAP1 mRNA was observed after treatment with the ASOs SYNG-328g, SYNG- 1468g , SYNG-569g, SYNG-444g, SYNG-26g, SYNG-344s, SYNG-1204g, SYNG-1226s, SYNG-863s, SYNG- 1186s, and SYNG- 1524s, as compared to NTC ASOs.

[0223] To demonstrate these ASO’s abilities to upregulate SYNGAP1 mRNA in a CNS translational model, the following experiment was performed using human induced pluripotent stem cell (iPSC)-derived cortical glutamatergic neurons. Briefly, cortical glutamatergic neurons (FUJIFILM Cellular Dynamics, Catalog No. R1061) were plated on poly-D-lysine coated plates in BrainPhys™ neuronal media (StemCell Technologies; Catalog No. 05790) supplemented with iCell Neural Supplement B (FUJIFILM Cellular Dynamics, Catalog No. M1029) and iCell Nervous System Supplement (FUJIFILM Cellular Dynamics, Catalog No. M1031), and allowed to mature for 14 days prior to ASO treatment. On day 14 in culture, neurons were forward transfected with either 30 nM or 100 nM of ASO SYNG-328g, SYNG-444g, SYNG-26g, SYNG-344s, SYNG- 1204g, and SYNG- 1186s. As a control, cells were not transfected with ASOs or were transfected with either a gapmer non-targeting control ASO (CO- 1588) or a stericnon-targeting control ASO (CO-1589). Cells were collected on day 21, 7 days following transfection, for mRNA quantification via qPCR. Relative SYNGAP1 mRNA levels were normalized to mRNA levels from cells treated with the transfected dose of a chemistry-matched NTC ASO (CO- 1588 for gapmer ASOs or CO- 1589 for steric ASOs). FIG. 3 shows the upregulation of total SYNGAP1 mRNA after treatment with the SYNGAP1 regRNA-targeting ASOs, as compared to chemistry-matched NTC ASOs CO-1588 and CO-1589.Example 2: Differential isoform expression through regRNA-targeting ASOs

[0224] To determine whether ASOs targeting SYNGAP1 regRNAs RR137 and RR138 modulated the expression of distinct isoforms of SYNGAP1, the following experiment was performed. The genomic position of SYNGAP1 regRNAs RR137 and RR138 relative to the genomic position of SYNGAP1 N-terminus isoform A, isoform B and annotated isoform Ensembl ID ENST00000682587.1 is shown in FIG. 4.

[0225] Briefly, ASOs SYNG-328g, SYNG-444g, SYNG-26g, SYNG-344s, SYNG- 1204g, and SYNG- 1186s were tested in SK-N-AS cells via transfection at 200 nM. Briefly, cells were reverse transfected at Day 0 using Lipofectamine RNAiMAX transfection reagent (as instructed by manufacturer) with 200 nM of the selected ASO. Cells were collected on Day 2 for mRNA quantification via qPCR. mRNA measurement of total SYNGAP1 mRNA was detected through qPCR (Invitrogen; Assay ID Hs00405348_ml) which detects exon 10-11 of the full length SYNGAP1 mRNA and captures all canonical N- and C- isoform variants. SYNGAP1 isoform A transcription strate site (TSS) usage was measured using an Invitrogen TaqMan® probe (Assay ID Hs01006394_ml) which detects exon 2-3 of SYNGAP1 full length mRNA, which are exclusive to SYNGAP1 isoform A TSS usage (isoform A through a2 C-terminus usage is described as Gencode Transcript ENST00000646630.1). N-terminus TSS usage for the isoform having Gencode transcript no. ENST00000682587.1 was detected using a custom qPCR TaqMan probe (forward primer: 5’-GGGAGTTATGAATACCACTTGGG-3’ (SEQ ID NO: 3758), reverse primer: 5’-TCCATGCTGTACTGCTTCCC-3’ (SEQ ID NO: 3759), and probe: CGCTCGAGG / ZEN / AGGAAGAGTGTCCCAGGG (SEQ ID NO: 3760)). SYNGAP1 isoform B TSS usage (isoform B through a2 C-terminus usage is described as Gencode Transcript ENST00000428982.4) was measured using a custom qPCR TaqMan probe (forward primer: 5’- TTTCCGGGGGAATACCACTTG-3’ (SEQ ID NO: 3761), reverse primer: 5’- TCCATGCTGTACTGCTTCCC-3’ (SEQ ID NO: 3759), and probe:CGCTCGAGG / ZEN / AGGAAGAGTGTCCCAGGG (SEQ ID NO: 3760)). Relative SYNGAP1 mRNA was normalized to mRNA from cells treated with the chemistry-matched NTC ASO (CO- 1588 for gapmer ASOs or CO- 1589 for steric ASOs).

[0226] Table 9 provides the total SYNGAP1, isoform A, isoform ENST00000682587.1, and isoform B mRNA fold changes as compared to the chemistry-matched NTC ASOs. SYNG- 1517g, SYNG-1204g, SYNG-1186s and SYNG-1524s induced upregulation of the mRNA of all 3 isoforms to a similar degree. In contrast, SYNG- 1468g, SYNG-569g, SYNG-26g, and SYNG- 863 s appear to preferentially induce upregulation of isoform B mRNA, as compared to the other2 tested isoforms.

[0227] Table 9.Example 3: Modulation of SYNGAP1 expression using SYNGAP1 RR93 regRNA-targeting ASOs

[0228] 43 steric ASOs targeting regions of human SYNGAP1 regRNA RR93 (SEQ ID NOs:2844 and 2845) were synthesized and their ability to modulate the expression of SYNGAP1 assessed in the human neuroblastoma SK-N-AS cell line via transfection at 100 nM. Briefly, cells were reverse transfected using Lipofectamine™ RNAiMAX transfection reagent (Invitrogen™, as instructed by manufacturer) on Day 0 with 100 nM of each ASO. Cells were collected on Day 2 for mRNA quantification via qPCR. As a control, cells were not treated with ASOs or were treated with either of the steric non targeting control (NTC) ASOs CO- 1589 orCO- 1929. mRNA was normalized to mRNA from cells treated with steric NTC AS Os CO- 1589 and CO- 1929.

[0229] Table 10 provides the total human SYNGAP1 mRNA fold changes for each of the ASOs tested.Table 10.

[0230] Three regions of RR93 were identified that when targeted using an ASO modulated SYNGAP1 mRNA expression. FIG. 5A, FIG. 5B, and FIG. 5C show SYNGAP1 mRNA fold change across multiple steric ASOs targeting three distinct regions of RR93, identified in the figures as regions 1, 2 and 3.

[0231] Selected ASOs from each of the three identified regions were selected for a dose response experiments. Briefly, SK-N-AS cells were reverse transfected using Lipofectamine™ RNAiMAX transfection reagent (Invitrogen™, as instructed by manufacturer) at DO with either 200 nM, 150 nM, 100 nM, 50 nM, 25 nM, or 12.5 nM of each ASO. Cells were collected onDay 2 for mRNA quantification via qPCR. mRNA was normalized to mRNA from cells treated with steric NTC ASOs CO-1589 and CO-1929, at each matching dose.

[0232] FIG. 6A, FIG. 6B, and FIG. 6C show dose-dependent upregulation of SYNGAP1 mRNA after treatment with selected ASOs covering the identified regRNA regions 1, 2 and 3.

[0233] The initial 43 steric ASOs were transfected into human induced pluripotent stem cell (iPSC)-derived neurons. Briefly, human induced pluripotent stem cells (iPSCs) were differentiated into neurons by overexpression of transcription factor neurogenin-2 through viral transduction as described in Zhang et al. (2013) Neuron 78(5): 785-98, incorporated herein by reference.

[0234] iPSC neurons were plated on poly-D-lysine coated plates and allowed to mature for 14 days prior to ASO treatment. The differentiated neurons were allowed to mature in culture for 7 days, and transfected using Lipofectamine™ 2000 (INVITROGEN, as instructed by manufacturer) on day 7 with either 100 nM of an regRNA RR93 targeting steric ASO or a steric NTC ASO, CO-1589. Cells were collected on day 10, 3 days following transfection, for SYNGAP1 mRNA quantification via qPCR. Relative mRNA levels were normalized to relative mRNA levels from cells treated with the NTC ASO.

[0235] As shown in FIG. 7, ASOs targeting the regRNA regions 1, 2 and 3 induced upregulation of SYNGAP1 mRNA in the iPSC-derived neurons.Example 4: SYNGAP1 RR93 regRNA-targeting ASO binding to regRNA increases SYNG P1 gene transcription

[0236] To determine whether treatment with SYNGAP1 regRNA-targeting ASO CO-9437 results in increased transcriptional activity at the SYNGAP1 promoter as demonstrated by recruitment of polymerase II, the following experiment was performed using chromatin immunoprecipitation targeting RNA polymerase II (Pol II) followed by quantitative Real-Time PCR (qPCR). Briefly, SK-N-AS cells were treated at day 0 with 100 nM of steric CO-9437 and the NTC ASO CO- 1589 for 40 hours. Cells were reverse transfected at day 0 using Lipofectamine™ RNAiMAX transfection reagent. The cells were harvested for SYNGAP1 mRNA quantification via qPCR. Another portion of the cells were used to assess ASO treatment efficacy, while the remaining portion of cells were cross-linked using formaldehyde-based crosslinking buffer, lysed and chromatin was fragmented through sonication. Chromatin cross-linked to Pol II was immunoprecipitated using anti-Pol II antibody conjugated to protein G beads, andDNA fragments corresponding to the SYNGAP1 promoter region were quantified using SYNGAP1 promoter-specific qPCR probes. qPCR probes specific for the promoter regions of the housekeeping genes glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and beta-2- microbulin (B2M) were used as negative controls. Enrichment for SYNGAP1 promoter and housekeeping genes was normalized to the enrichment for SYGAP1 promoter and housekeeping genes from cells treated the NTC-ASO CO- 1589.

[0237] As shown in FIG. 8 increased Polymerase II occupancy was observed at the SYNGAP1 promoter in cells treated with the SYNGAP1 regRNA-targeting ASO. In contrast, an increase in Polymerase II occupancy was not detected at the promoters of the housekeeping genes (control).Example 5: SYNGAP1 RR93 regRNA-targeting ASO up regulates SYNGAP1 protein in the brains of human SYNGAP1 transgenic mice in a dose dependent manner across multiple brain regions

[0238] To assess the effects of a SYNGAP regRNA-targeting ASO in vivo, homozygous human SYNGAP transgenic mice (MMRRC Strain #069939-JAX) were administered a SYNGAP1 regRNA-targeting steric ASO of SEQ ID NO: 3612 via intracerebroventricular (ICV) injection at postnatal day (PND) 21. The mice were treated with this SYNGAP 1 regRNA- targeting ASO at 25 pg, 50 pg, 100 pg, or with artificial cerebrospinal fluid (aCSF) as a vehicle control. The mice were humanly euthanized 2 weeks post injection at PND 35, and their brains were dissected into separate tissue regions and snap frozen. To quantify the human SYNGAP 1 protein expression, each tissue region was homogenized in RIPA buffer (Invitrogen Cat. No. 89901). Total protein levels were quantified by bicinchoninic acid assay (BCA; Abeam Cat. No. 102536) and normalized prior to quantifying SYNGAP1 protein levels via ELISA (Cell Signaling Technologies Cat. No. 57320). SYNGAP1 protein levels were normalized to the total protein, and then normalized to the vehicle aCSF control to establish fold change. As shown in FIG. 9, a dose-responsive increase in human SYNGAP 1 protein levels in the cortex, hippocampus, and midbrain regions of the homozygous human SYNGAP transgenic mice was observed following treatment with the SYNGAP 1 regRNA-targeting ASOExample 6: SYNGAP1 regRNA-targeting ASOs that target the regRNA RR93 upregulate human SYNGAP1 mRNA in patient and wildtype iPSC-derived neurons

[0239] SYNGAP1 regRNA-targeting ASOs that target the regRNA RR93 were tested for their ability to modulate SYNGAP gene expression in SYNGAP1 haploinsufficient patient iPSC- derived neurons (nonsense mutation KI 185X) and healthy control iPSC derived neurons from a family member of the patient having wildtype levels of SYNGAP 1. Briefly, iPSCs from both donors were differentiated into NGN2 neurons through viral transduction. Neurons were matured in culture for 8 days prior to treatment. Both neuron lines were forward transfected with 100 nM of the ASOs CO-9438, CO-19781, or a steric non-targeting control CO-1589 using Lipofectamine RNAiMAX (Invitrogen Cat. No. 13778150). Cells were collected 5 days posttransfection for SYNGAP 1 mRNA quantification by qPCR. mRNA for all groups were normalized to the wildtype familial control neurons treated with the steric nontargeting control ASO.

[0240] As shown in FIG. 10, the SYNGAP 1 haploinsufficient patient iPSC-derived neurons expressed 50% of the SYNGAP1 mRNA expressed by the wildtype familial iPSC-derived neurons. Moreover, treatment of the SYNGAP 1 haploinsufficient patient iPSC-derived neurons with the SYNGAP1 regRNA-targeting ASOs CO-9438 (“ASO-7”) and CO-19781 (“ASO-9”) induced increased expression of SYNGAP 1 mRNA expression (over 2-fold).

[0241] Further, the ability of this SYNGAP 1 regRNA-targeting steric ASO to modulate the expression of SYNGAP 1 in SK-N-AS cells and human glutamatergic-enriched neurons derived from induced pluripotent stem cells was assessed. Briefly, SK-N-AS cells cultured in Dulbecco's Modified Eagle Medium (DMEM; supplemented with 10% fetal bovine serum) were reverse transfected using Lipofectamine™ RNAiMAX with either the SYNGAP 1 regRNA-targeting ASO or a steric non-targeting control (CO-1589) at 9 dose concentrations (0.78, 1.56, 3.12, 6.25, 12.5, 25, 50, 100, and 200 nM). SK-N-AS cells were lysed 48-hours post-transfection as described below. iCell® GlutaNeurons (FujiFilm Cellular Dynamics) were plated on poly-L- ornithine and laminin coated cell culture plates in culture media (Neurobasal Media (Life Technologies, Cat. No. 21103-049) at a 1: 1 ratio with DMEM:F12 Media (Life Technologies, Cat. No. 11320033) and supplemented with lx Gibco™ GlutaMAX™ Supplement (Thermo Fisher Scientific, Cat. No. 35050061), 0.5x Gibco™ N-2 Supplement (Thermo Fisher Scientific, Cat. No. 17502048), 0.5x Gibco™ B-27™ (Thermo Fisher Scientific, Cat. No. 12587010),200 uM ascorbic acid, 1 pM dibutyryl cAMP sodium salt, 10 ng / mL human BDNF protein, and 10 ng / ml human GDNF protein) and matured, with media changes every 3-4 days. On day 9, the neurons were forward transfected using Lipof ectamine™ RNAiMAX with either the SYNGAP1 regRNA-targeting ASO or a steric non-targeting control, CO- 1589, at 6 dose concentrations (6.25, 12.5, 25, 50, 100, and 200 nM). Neurons were cultured an additional 5 days posttransfection before being lysed. Cells were lysed in Buffer RLT (QIAGEN) and processed for SYNGAP 1 mRNA quantification as determined using qPCR. Gene expression was normalized to house keepers GAPDH and PPI A. Fold change was determined by normalizing expression values to non-targeting control results at the corresponding concentrations. As shown in FIGs. 11A and 11B, the SYNGAP1 regRNA targeting ASO induced a dose dependent upregulation of SYNGAP1 mRNA expression in SK-N-AS cells above 2-fold (EC50 at 9.26 nM) and in the human glutamatergic neurons above 1.5-fold (EC50 at 25.10 nM).Example 7: A SYNGAP1 regRNA-targeting ASO restores SYNGAP1 protein levels and rescues motor function defects, spatial learning defects and hyperactivity in a humanized heterozygous haploinsufficient SYNG P1 mouse model

[0242] To assess whether administration a SYNGAP1 regRNA-targeting ASO can modulate the expression of human SYNGAP1 in a humanized heterozygous happloinsufficient SYNGAP1 mouse model, the following experiment was performed. Homozygous human SYNGAP1 transgenic mice (STOCK Is(SYNGAPl-ZBTB9)lBpro / Mmjax, Mutant Mouse Resource & Research Centers Strain #069939-JAX) were crossed to heterozygous Syngapl conditional rescue mice (B6;129S2-Syngapltm2Geno / RumbJ; Jax Strain # 029304; The Jackson Laboratory) to produce humanized haploinsufficient SYNGAP1 mice that were heterozygous for human SYNGAP and were mouse Syngapl knock-outs. The mice were then backcrossed to the homozygous human SYGNAP1 transgenic mice. The resulting litter contained both humanized homozygous SYNGAP1 mice and humanized heterozygous haploinsufficient SYNGAP1 mice. The humanized heterozygous haploinsufficient SYNGAP 1 mice were treated with a SYNGAP 1 regRNA-targeting steric ASO of SEQ ID NO: 3612 via intracerebroventricular (ICV) injection at postnatal day (PND) 21. The mice were treated with this SYNGAP 1 regRNA-targeting ASO at 25 pg, 50 pg, 100 pg in 5 pL of aCSF, or with vehicle control. 14 days post ICV injection, the mice were humanely euthanized and brain tissue collected for mRNA, protein, and ASO quantification as described above (see Example 3). Humanized homozygous SYNGAP 1littermate mice were euthanized at the same age to establish untreated wild-type control levels, and SYNGAP1 protein levels were normalized to the homozygous control protein levels. A oneway ANOVA was performed with a Dunnet post-hoc test comparing the mean to the humanized homozygous SYNGAP1 mouse group.

[0243] As shown in FIG. 12, the humanized heterozygous haploinsufficient SYNGAP1 control mice treated with aCSF vehicle control exhibited a statistically significant (about 58%) reduction in hippocampal SYNGAP1 protein levels as compared to their homozygous littermates (p<0.0001). Treatment with the SYNGAP1 regRNA-targeting steric ASO resulted in a dosedependent upregulation of SYNGAP1 protein levels of up to 2-fold, restoring expression to near homozygous levels.

[0244] Mice with murine Syngapl haploinsufficiency have been reported to exhibit various behavioral alterations including in motor learning and goal directed behaviors (see, e.g., Haetzel et al. (2024) J Neurosci. 44(48): el264232024 and Nakajima et al. (2019) Neuropsychopharmacol. Rep. 39(3): 223-37, the entire contents of each of the foregoing are incorporated herein by reference). To assess whether the humanized heterozygous haploinsufficient SYNGAP1 mouse model described above displays altered behavioral phenotypic activity, and whether any such alterations could be rescued following treatment with SYNGAP1 regRNA-targeting steric ASO, motor function, spatial learning and hyperactivity were assessed using the accelerating rotarod test, a Y -maze memory task, and gait analysis test, respectively (see, e.g., Haetzel et al. (2024) (supra) Nakajima et al. (2019) (supra); Cording and Bateup (2023) Front Cell Neurosci. 17: 1270489; and Zhang et al. (2022) Pain 163(12): 2326- 36; the entire contents of each of the foregoing are incorporated herein by reference). Humanized heterozygous haploinsufficient SYNGAP1 mice were administered two doses of 30 pg of the SYNGAP1 regRNA-targeting steric ASO in aCSF (n=10) or aCSF (n=18) at postnatal day (PND) 2 and again at PND5. Humanized homozygous SYNGAP1 mice (n=12) dosed with aCSF (vehicle control) were also used as control. Behavioral assessments were performed from PND 16 to PND 22. Each behavior was analyzed using a one-way ANOVA with a Dunnet post-hoc test comparing the means of the 3 mice groups. Following the behavioral assessments, the mice were humanely euthanized at PND 27, and brain tissue collected and evaluated for SYNGAP1 protein levels, as described above.

[0245] Accelerating rotarod test: Before initiation of testing, mice were habituated to handling and then habituated to the rotarod by placing them on the apparatus at 5 rpm for 5 continuous minutes to acclimate. For testing, mice were placed on an accelerating rotarod, with the speed of the rotarod ramping up from 4 to 40 rpm over 300 seconds. Latency to fall was recorded across 5 trials and time across all 5 trials was averaged to determine motor ability.

[0246] Y-maze memory task: The Y -maze memory task was run as a forced alternation test using a symmetrical Y-maze made of acrylic. Each arm of the Y-maze was 35 cm long, 5 cm wide, and 10 cm high, and the wall at the end of each arm was marked with a different black and white pattern. To reduce animal anxiety, light in the testing area was dimmed to 30 ± 5 lux. Mice were handled for 3 days before testing. Training consisted of a 10-min habituation to the apparatus where mice were allowed to explore 2 of the 3 arms of the Y -maze. The blocked arm was alternated for each animal and designated “the novel arm” during the testing phase. After the training trial, mice were returned to their cages for a 30 min. inter-trial interval. Testing consisted of a 5 min. trial where the mice had access to all 3 arms of the Y -maze allowing them to explore freely. Time in Novel Arm (%) was defined as the time spent in the novel arm divided by the time spent in all arms during testing.

[0247] Gait Analysis Test: The gait analysis test was run using the Blackbox One rodent imaging instrument (Blackbox Biotech, Inc.). Animals were placed on the device for 5 minutes and allowed to freely explore. Results were analyzed using Palmreader™ software platform (Blackbox Biotech, Inc.).

[0248] As shown in FIG. 13A, in the accelerating rotarod test, the humanized heterozygous haploinsufficient SYNGAP1 mice exhibited a motor function defect as demonstrated by their reduced latency to fall, as compared to their aCSF-treated homozygous littermates (p<0.01). Treatment with the SYNGAP1 regRNA-targeting steric ASO increased the latency to fall in these mice, as compared to aCSF-treated heterozygous haploinsufficient SYNGAP1 mice (p<0.05). Moreover, heterozygous haploinsufficient SYNGAP1 mice treated with the SYNGAP1 regRNA-targeting steric ASO performed comparably to their homozygous aCSF- treated littermates, demonstrating that treatment with the ASO rescues the observed motor function defects.

[0249] In the Y-maze memory task (FIG. 13B), the humanized heterozygous haploinsufficient SYNGAP1 mice exhibited a deficit in the spatial learning (e.g., cognition andmemory), as compared to their homozygous littermates (p<0.05), spending a smaller percentage of time exploring the Y-maze apparatus’ novel arm. However, humanized heterozygous haploinsufficient SYNGAP1 mice treated with the SYNGAP1 regRNA-targeting steric ASO, spent more time exploring the novel arm, as compared to aCSF-treated humanized heterozygous haploinsufficient SYNGAP1 mice (p<0.05), and spent a comparable amount of time as aCSF- treated humanized homozygous SYNGAP1 mice. These results demonstrate that treatment with the SYNGAP1 regRNA-targeting steric ASO rescued the spatial learning defect observed in this humanized heterozygous haploinsufficient SYNGAP1 mouse model.

[0250] In the gait analysis test (FIG. 13C), the humanized heterozygous haploinsufficient SYNGAP1 mice were observed to travel a longer distance, as compared to their homozygous littermates (p<0.001), demonstrating that the haploinsufficient mice exhibited hyperactivity, a potential indicator of anxiety. Humanized heterozygous haploinsufficient SYNGAP1 mice treated with the SYNGAP1 regRNA-targeting steric ASO traveled a shorter distance than aCSF- treated humanized heterozygous haploinsufficient SYNGAP1 mice (p<0.01), and a comparable distance as aCSF-treated humanized homozygous SYNGAP1 mice, demonstrating that treatment with the SYNGAP1 regRNA-targeting steric ASO rescued the hyperactivity phenotype.

[0251] Examination of the SYNGAP1 protein levels (FIG. 13D) in the cortex and hippocampus tissues showed that aCSF-treated humanized heterozygous haploinsufficient SYNGAP1 mice had about a 50% reduction in cortical and hippocampal SYNGAP1 protein levels, as compared to their homozygous littermates. Moreover, humanized heterozygous haploinsufficient SYNGAP1 mice treated with the SYNGAP1 regRNA-targeting steric ASO had increased SYNGAP1 protein levels these brain tissues (ranging from about a 70% to near homozygous levels of SYGAP1 protein).

[0252] Overall, these studies show that treatment with the SYNGAP1 regRNA-targeting steric ASO rescues motor function defects, spatial learning defects an d hyperactivity in this humanized heterozygous haploinsufficient SYNGAP1 mouse model.INCORPORATION BY REFERENCE

[0253] Unless stated to the contrary, the entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes.EQUIVALENTS

[0254] The disclosure may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting the disclosure described herein. Scope of the disclosure is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

WHAT IS CLAIMED IS:

1. An antisense oligonucleotide (ASO) complementary to at least 8 contiguous nucleotides of a regulatory RNA of human synaptic Ras GTPase activating protein 1 (SYNGAP1), wherein the regulatory RNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 or 2.

2. The ASO of claim 1, wherein the regulatory RNA comprises a nucleotide sequence of SEQ ID NO: 1, and the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3-779.

3. The ASO of claim 1, wherein the regulatory RNA comprises a nucleotide sequence of SEQ ID NO: 2, and the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 780-1535.

4. An antisense oligonucleotide (ASO) complementary to a regulatory RNA of human SYNGAP1, wherein the ASO comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2856-3228.

5. The ASO of any one of claims 1-4, wherein the ASO is no more than 50, 40, 30, 25, 20, or 18 nucleotides in length.

6. The ASO of any one of claims 1-5, wherein one or more nucleotides of the ASO comprises one or more chemical modifications.

7. The ASO of claim 6, wherein at least 3, 4, or 5 nucleotides at the 5’ end and at least 3, 4, or 5 nucleotides at the 3’ end of the ASO comprise ribonucleotides with one or more chemical modifications.

8. The ASO of claim 6 or 7, wherein the one or more chemical modifications comprise a nucleotide sugar modification comprising one or more of 2'-0 — Ci ralkyl, 2'-deoxy (2'-H), 2'- O — Ci-3alkyl-0 — Ci aalkyl, 2'-fluoro, 2'-amino, 2'-arabinosyl nucleotide, 2'-F-arabinosyl nucleotide, 2'-locked nucleic acid nucleotide, 2'-amido bridge nucleic acid, 2'-unlocked nucleic acid nucleotide, a sugar in L form, 4'-thioribosyl nucleotide, constrained ethyl, 2'-fluoro-arabino, or thiomorpholino.

9. The ASO of any one of claims 6-8, wherein the one or more chemical modifications comprise an internucleotide linkage modification comprising one or more of phosphorothioate, phosphoramidate, phosphonocarboxylate, thiophosphonocarboxylate, alkylphosphonate, boranophosphonate, or phosphorodithioate.

10. The ASO of any one of claims 6-9, wherein the one or more chemical modifications comprise a nucleobase modification comprising one or more of 2-thiouracil, 2-thiocytosine, 4- thiouracil, 6-thioguanine, 2-aminoadenine, 2-aminopurine, pseudouracil, hypoxanthine, 7- deazaguanine, 7-deaza-8-azaguanine, 7-deazaadenine, 7-deaza-8-azaadenine, 5-methylcytosine, 5-methyluracil, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5,6-dehydrouracil, 5- propynylcytosine, 5-propynyluracil, 5-ethynylcytosine, 5-ethynyluracil, 5-allyluracil, 5- allylcytosine, 5 -aminoallyluracil, 5-aminoallyl-cytosine, an abasic nucleotide, Z base, P base, unstructured nucleic acid, isoguanine, isocytosine, a glycerol nucleic acid, or thiophosphoramidate morpholinos.

11. The ASO of any one of claims 6-10, wherein the one or more chemical modifications comprise 2'-O-methoxyethyl, 5-methyl on cytidine, locked nucleic acid, phosphodiester internucleotide bond, or phosphorothioate internucleotide bond.

12. The ASO of any one of claims 6-11, wherein the ASO does not comprise 10 or more contiguous non-chemically modified nucleotides.

13. The ASO of claim 12, wherein the ASO does not comprise a deoxyribonucleotide.

14. The ASO of any one of claims 6-13, wherein the ASO does not comprise an unmodified nucleotide.

15. The ASO of any one of claims 6-14, wherein the length of the ASO is 5 x n + 5 nucleotides (n is an integer of 3 or greater), wherein the nucleotides at positions 5 x m are ribonucleotides modified by LNA (m is an integer from 1 to n) and the nucleotides at the remaining positions are ribonucleotides modified by 2'-O-methoxyethyl.

16. The ASO of any one of claims 6-14, wherein the length of the ASO is 3 x n + 2 nucleotides (n is an integer of 6 or greater), wherein the nucleotides at positions 3 x m areribonucleotides modified by LNA (m is an integer from 1 to n) and the nucleotides at the remaining positions are ribonucleotides modified by 2'-O-methoxyethyl.

17. The ASO of any one of claims 6-14, wherein each ribonucleotide of the ASO is modified by 2'-O-methoxyethyl.

18. The ASO of any one of claims 6-14, wherein each nucleotide of the ASO is a ribonucleotide modified by 2'-O-methoxyethyl.

19. The ASO of any one of claims 6-18, wherein the ASO comprises 10 or more contiguous nucleotides of unmodified DNA flanked by at least 3 nucleotides of modified ribonucleotides at each of the 5’ end and the 3’ end.

20. The ASO of any one of claims 6-19, wherein each cytidine in the ASO is modified by 5- methyl.

21. The ASO of any one of claims 5-20, wherein the ASO comprises a nucleotide sequence and chemical modifications set forth in any one of SEQ ID NOs: 3239-3755.

22. The ASO of any one of claims 1-3 or 5-20, wherein the ASO comprises a nucleotide sequence and chemical modifications set forth in any one of SEQ ID NOs: 1536-2141 and 2143- 2843.

23. A pharmaceutical composition comprising the ASO of any one of claims 1-22 and a pharmaceutically acceptable carrier or excipient.

24. A method of increasing transcription of synaptic Ras GTPase activating protein 1 (SYNGAP1) in a human cell, the method comprising contacting the cell with the ASO of any one of claims 1-22 or the pharmaceutical composition of claim 23.

25. The method of claim 24, wherein the cell is a neuron.

26. The method of any one of claims 24-25, wherein the method results in increased SYNGAP1 mRNA in the cell.

27. The method of any one of claims 24-26, wherein the method results in increased SYNGAP1 protein in the cell.

28. A method of treating a disease or disorder, the method comprising administering to a subject in need thereof an effective amount of the ASO of any one of claims 1-22 or the pharmaceutical composition of claim 23.

29. The method of claim 28, wherein the disease or disorder is a SYNGAP1 -related disease or disorder.

30. The method of claim 29, wherein the SYNGAP1 -related disorder is SYNGAP1 -related intellectual disability (ID), mental retardation, autosomal dominant 5 (MRD5), or SYNGAP1- related non-syndromic intellectual disability (NSID).

31. The method of claim 28, wherein the disease or disorder is a central nervous system (CNS) disorder or a peripheral nervous system (PNS) disorder.

32. The method of claim 28, wherein the disease or disorder is an affective disorder (e.g., depression), schizophrenia, Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, an autism spectrum disorder (ASD), (e.g., Asperger’s syndrome, autistic disorder, Pervasive Developmental Disorder-Not Otherwise Specified (PDD-NOS)), or a CNS or PNS trauma (e.g., brain or spinal cord ischemia or trauma, stroke, or a neurological deficit associated with surgery or anesthesia).

33. The method of any one of claims 28-32, wherein administration of the ASO or the pharmaceutical composition modulates SYNGAP1 gene expression in the subject relative to a pre-administration baseline level.

34. The method of any one of claims 28-32, wherein administration of the ASO or the pharmaceutical composition increases SYNGAP1 gene expression in the subject relative to a pre-administration baseline level.

35. The method of any one of claims 28-32, wherein administration of the ASO or the pharmaceutical composition increases SYNGAP1 gene expression in a cell of the subject relative to a pre-administration baseline level.

36. The method of any one of claims 28-32, wherein administration of the ASO or the pharmaceutical composition modulates expression of one or more isoforms of SYNGAP1 in the subject relative to a pre-administration baseline level.

37. The method of any one of claims 28-32, wherein administration of the ASO or the pharmaceutical composition modulates expression of one or more isoforms of SYNGAP1 in a cell of the subject relative to a pre-administration baseline level.

38. The method of claim 35 or claim 37, wherein the cell is a neuron.

39. The method of any one of claims 28-32, wherein the expression of one or more isoforms of SYNGAP1 is increased after administering the ASO or the pharmaceutical composition.

40. The method of claim 39, wherein the one or more isoforms of SYNGAP1 comprise SYNGAP1 Aal, SYNGAP1 Aa2, SYNGAP1 A , SYNGAP1 Ay, SYNGAP1 Bal, SYNGAP1 Ba2, SYNGAP1 Bp, SYNGAP1 By, SYNGAP1 Cal, SYNGAP1 Ca2, SYNGAP1 CP, SYNGAP1 Cy, or any combination thereof.

41. The method of any one of claims 28-40, wherein the administering is performed via an intrathecal, intracerebral, intraventricular, intracerebroventricular, intracisternal, intraspinal, or peri-spinal route.

Images