Pan-cancer nucleic acid therapeutic

Abstract

The present invention provides an inhibitor capable of inhibiting the expression of PCDHA11 and inhibiting the function of PCDHA11. Specifically, the present invention provides nucleic acid molecules such as siRNA or antisense nucleic acids that inhibit PCDHA11 expression. These inhibitors are effective against gastric cancer, pancreatic cancer, breast cancer, esophageal squamous cell carcinoma, lung adenocarcinoma, colon cancer, and the like, and can be used as pan-cancer therapeutics.

Description

Nucleic acid therapeutics across cancer types

[0001] The present invention relates to a cancer therapeutic agent, a testing support method, and a testing kit, and in particular to a therapeutic agent for intractable solid cancer.

[0002] Although new medicines and treatments for cancer have been developed and established, and the number of cases of cure is increasing every year, cancer has been the leading cause of death in Japan since 1981, with 360,000 people dying from cancer each year. It is also a major cause of death worldwide, with approximately 10 million people dying from cancer each year. While early, curative resection can be expected to result in a good prognosis for solid cancers such as stomach cancer, lung cancer, and colon cancer, a common and serious problem is that the prognosis is extremely poor for cancers that metastasize or recur. For advanced cancers and blood tumors that have metastasized or recurred, chemotherapy is used with the aim of having a systemic effect.

[0003] Gastric cancer is the fifth most common cancer in the world and the fourth most deadly. In Japan, gastric cancer accounts for approximately 10% of all deaths from malignant neoplasms, ranking third among men and fifth among women. Furthermore, the 5-year survival rate for unresectable gastric cancer is 5-10%, making it a highly lethal cancer. The high mortality rate is primarily due to the onset of symptoms at an advanced stage and the frequent resistance to cytotoxic anticancer drugs. While the number of systemic chemotherapy options for metastatic and recurrent gastric cancer has gradually increased with the development of molecular-targeted drugs, the expected therapeutic effect has not always been achieved due to refractoriness and resistance. Furthermore, due to the heterogeneity of cancer cell phenotypes, existing therapeutic drugs are often ineffective. Therefore, the development of new therapeutic agents has been essential.

[0004] Molecularly targeted drugs, which have been introduced into cancer treatment since the late 1990s, are therapeutic drugs that target specific molecules, kill cancer cells, and suppress their growth. Antibodies against molecules such as receptors expressed on cancer cells, as well as small molecular weight compounds that bind to growth factors and signal transduction molecules, have been developed and are used in chemotherapy along with existing therapeutic drugs. Although the lineup of chemotherapy drugs is gradually increasing, there are many cases where treatment is ineffective due to refractoriness or resistance, and there is a constant demand for the development of drugs with different mechanisms of action.

[0005] Nucleic acid drugs based on natural nucleotides or chemically modified nucleotides act directly on the body without affecting gene expression. Not only do nucleic acid drugs possess higher specificity than conventional small molecule compounds, but they can also target intracellular molecules such as mRNA and non-coding RNA, which conventional pharmaceuticals cannot. While nucleic acid drugs have already been put to practical use in the treatment of genetic diseases such as muscular dystrophy, they have not yet been put to practical use in cancer treatment. In cancer treatment, antisense nucleic acid drugs, which can suppress only specific target genes using oligonucleotides with sequences complementary to mRNA, can suppress the expression of disease-causing proteins themselves and are attracting attention worldwide as next-generation cancer treatments.

[0006] Nucleic acid drugs targeting new target molecules have also already been disclosed. Patent Document 1 discloses a nucleic acid drug that is effective against gastric cancer and the like by suppressing the expression of TM4SF1AS1, a long-chain non-coding RNA. Patent Document 2 discloses a drug for improving cancer prognosis, including a nucleic acid drug that inhibits AEBP1 (adipocyte enhancer binding protein 1). In addition, nucleic acid drugs, such as antisense nucleic acids and siRNAs targeting existing target molecules such as STAT3 and KRAS (G12D), are also progressing into clinical trials.

[0007] International Publication No. 2019 / 189772 Japanese Patent Application Laid-Open No. 2020-19749

[0008] Penchovsky, R., et al., Antibiotics 2024, 13(3), 221; https: / / doi.org / 10.3390 / antibiotics13030221Kim, Y. Biomol Ther 2023, Vol.31(3), pp.241-252Morihiro, K., et al., Mol. BioSyst., 2017, Vol. 13, pp.235-245, DOI:10.1039 / c6mb00538aEgli, M. & Manoharan, M., Nucleic Acids Research, 2023, Vol. 51,No. 6 2529-2573Hori S., et al., Nucleic Acids Res. 2015, 43(19), e128.

[0009] As mentioned above, there is a constant demand for cancer therapeutic drugs with different mechanisms of action. Furthermore, because cancers are heterogeneous, there is a need to develop therapeutic drugs targeting new targets. In particular, an objective of the present invention is to develop new therapeutic drugs for recurrent and metastatic cancers, which have poor prognoses. An objective of the present invention is to provide pharmaceutical compositions that are highly effective in treating recurrent and metastatic cancers, specifically pharmaceutical compositions containing nucleic acids, antibodies, or peptides, or medium- or small-molecular-weight compounds targeting new targets as active ingredients. Because nucleic acid drugs effective against cancer have not yet been put to practical use, a particular objective is to develop nucleic acid drugs.

[0010] The present invention relates to the following pharmaceutical compositions, testing support methods, and kits. (1) A pharmaceutical composition for treating cancer, containing a PCDHA11 inhibitor as an active ingredient. PCDHA11 is one of 21 candidate genes related to metastatic potential and potential molecular targeted drugs, identified by comprehensive gene expression profiling of primary gastric cancer, adjacent non-cancerous gastric mucosa, and liver metastatic tissue surgically resected from four gastric cancer patients with synchronous liver metastasis. Suppression of PCDHA11 expression has been shown to have a growth-inhibitory effect not only on gastric cancer cell lines but also on various cancer cell lines, suggesting that it may be effective in treating cancers in which PCDHA11 expression is observed. Furthermore, while the cancer cell growth-inhibitory effect of nucleic acid molecules is demonstrated here, because PCDHA11 is a molecule belonging to the cadherin superfamily involved in cell adhesion, the use of an antibody against the extracellular domain is expected to have a therapeutic effect. In other words, the term "inhibitor" is not particularly limited, as long as it not only inhibits PCDHA11 expression but also suppresses PCDHA11 function. The expression inhibitor may be any agent capable of inhibiting the expression level of PCDHA11 protein or mRNA, such as an antisense nucleic acid, small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), or ribozyme. The function inhibitor may be any agent capable of inhibiting the function of the protein, such as a substance that binds to a domain that affects its activity or function. It goes without saying that not only the antibodies described above, but also peptides, medium-molecular-weight compounds, or small molecular-weight compounds that inhibit function can be expected to have similar effects. These may be used alone or in combination of two or more. (2) The pharmaceutical composition described in (1), in which the inhibitor is an expression inhibitor, specifically a nucleic acid molecule. Drugs composed of nucleic acid molecules such as antisense nucleic acids, siRNA, shRNA, miRNA, and ribozymes have the advantage of being relatively inexpensive to produce compared to antibody drugs. As shown in the following examples, it is useful for stomach cancer, pancreatic cancer, breast cancer, esophageal squamous cell carcinoma, lung adenocarcinoma, and colon cancer, and is therefore thought to be effective against solid cancers.(3) The pharmaceutical composition according to (2), wherein the nucleic acid molecule is an antisense nucleic acid and may contain a modified artificial nucleic acid. As described in detail below, it has been demonstrated that antisense nucleic acids can be used to suppress PCDHA11 expression and treat cancer. Artificial nucleic acids can be preferably used in part or in whole as nucleic acid molecules, as this is expected to improve stability and binding affinity with target molecules. Examples of artificial nucleic acids include modifications to internucleoside bonds, modifications to base moieties (modified nucleic acids), and modifications or alterations to sugar moieties (modified sugar moieties). Specifically, known artificial nucleic acids, such as phosphorothioated phosphate groups, phosphodiester bonds (PO), AmNA, 2'-OMe, 2'-MOE, 2',4'-BNA (LNA), cEt, ENA, and 5-methylcytosine, can be used. (4) The antisense nucleic acid is selected from the group consisting of hPCDH11-5'UTR, hPCDHA11-0009 (hereinafter, "hPCDHA11-" will be abbreviated and only the "number" will be described), 0351, 0574, 0581, 0590, 0811, 0817, 0821, 0931, 0934, 0934(19), 0936(19), 0938, 09 38(19), 0940(19), 0942(19), 1210, 1409, 1430, 1869, 1875, 2072, 2181, 2270(19), 2272, 2274(19), 2276, 2276(19), 2305, 2520, 2525, 2527, 2529, 2532. The above antisense nucleic acids can be preferably used because they can suppress PCDHA11 expression by an average of 40% compared to cells not transfected with the antisense nucleic acid. Furthermore, hPCDH11-0009, 0351, 0574, 0811, 0821, 0931, 0934 (19), 0938, 0942 (19), 1210, 1409, 1430, 1869, 1875, 2272, 2276 (19), 2525, and 2529 were found to suppress PCDH11 expression by an average of about 20% compared to untreated cells, and therefore can be used more preferably.Furthermore, these antisense nucleic acids may have a base sequence in which 1 to 3, 1 to 2, or 1 base is substituted, deleted, or inserted. Regarding length, sequences of 13- to 24-mer, preferably 14- to 23-mer, more preferably 15- to 22-mer, and even more preferably 16- to 21-mer lengths may be designed using the above-mentioned nucleic acid as a core sequence. (5) A cancer screening support method characterized by measuring PCDHA11 expression. PCDHA11 expression can be used to predict cancer metastasis and prognosis. It also makes it possible to identify patients who will benefit from the pharmaceutical composition. PCDHA11 expression can be measured using conventional methods used in this field, such as PCR or anti-PCDHA11 antibodies. (6) A method for treating cancer by administering a pharmaceutical composition containing a PCDHA11 inhibitor as an active ingredient. (7) The method of treatment described in (6), wherein the active ingredient is a nucleic acid molecule, an antibody, a peptide, or a medium- or low-molecular-weight compound. (8) The therapeutic method according to (7), wherein the active ingredient is a nucleic acid molecule. As described above, suppression of PCDHA11 expression has been shown to have a growth-inhibiting effect in various cancer cell lines. Therefore, any PCDHA11 inhibitor is considered to have a therapeutic effect. Examples of such molecules include nucleic acid molecules, antibodies, peptides, and medium- or small-molecular-weight compounds. In particular, nucleic acid molecules that have been shown to be effective in mouse models are considered to be useful in treatment. (9) The therapeutic method according to (8), wherein the nucleic acid molecule is an antisense nucleic acid, siRNA, shRNA, miRNA, or ribozyme, preferably an antisense nucleic acid, siRNA, shRNA, or miRNA. (10) The therapeutic method according to (8) or (9), wherein the nucleic acid molecule is administered by intravenous injection or intraperitoneal administration. (11) The therapeutic method according to any one of (6) to (10), wherein PCDHA11 expression is measured by the method described in (5), and if PCDHA11 expression is detected, a pharmaceutical composition containing a PCDHA11 inhibitor as an active ingredient is administered.

[0011] 1. A diagram showing the results of analyzing the effect on cell proliferation after suppressing PCDHA11 expression with siRNA. 2. A diagram showing the expression levels of PCDHA11 in gastric cancer tissues and normal tissues. 3. A diagram showing the results of analyzing the correlation between PCDHA11 expression levels and prognosis in multiple cohorts. 4. A diagram showing the results of immunohistochemical analysis of PCDHA11 expression. 5. A diagram showing the results of analyzing the correlation between PCDHA11 expression and the expression of genes involved in proliferation and the TGF-β signaling system in various gastric cancer cell lines. 6. A diagram schematically showing the structure of the antisense nucleic acid (ASO) used. 7. A diagram showing the results of measuring the inhibitory effect of PCDHA11 expression by designed anti-PCDHA11 ASOs using gastric cancer cell lines. 8. A diagram showing the results of measuring the concentration-dependent inhibitory effect of selected ASOs on PCDHA11 expression. 9. A diagram showing the results of analyzing the inhibition of PCDHA11 protein expression by selected ASOs. 10. A diagram showing the results of analyzing the cell proliferation inhibitory effect of ASOs in various cancer cell lines. Figure showing the results of analyzing the cell growth inhibitory effect of ASO in various cancer cell lines. Time-lapse images showing morphological changes in gastric cancer cells caused by ASO. Figure showing the results of analyzing the effect on proliferation of endogenously low PCDHA11-expressing cells after overexpression of PCDHA11. Figure showing the results of analyzing the growth inhibitory effect of ASO in PCDHA11-knockout cells. Figure showing the results of analyzing the effect of ASO on caspase activity after PCDHA11 knockdown by ASO. Figure showing the effect of ASO on spheroid formation. Figure showing the results of FACS analysis of changes in cancer stem cell marker ALDH-positive cells caused by ASO. Figure showing the results of analyzing the effect of ASO on the invasive ability of gastric cancer cells MKN1 and HGC-27. Figure showing the results of analyzing the effect of ASO on the migration ability of gastric cancer cells HGC-27. Figure showing the results of analyzing the effect of ASO on adhesive ability. Volcano plot of cadherin superfamily members and ligand candidates in gastric cancer tissue with distant metastasis. Results of digital image analysis of Western blots for protein expression and phosphorylation involved in signal transduction. Diagram showing the signal transduction system involving PCDHA11 in cancer cells. Experimental schedule for intraperitoneal administration of ASO in mouse models of peritoneal metastasis of gastric cancer and pancreatic cancer.1. A diagram showing the effect of ASO administration in a peritoneal metastasis model using gastric cancer cells MKN1 (left) and pancreatic cancer cells AsPC-1 (right). 2. A diagram showing the results of analyzing the effects of multiple ASOs in a peritoneal metastasis model. 3. A diagram showing the results of analyzing the effect of ASO in a systemic metastasis model. 4. A diagram showing the therapeutic effect of ASO in a mouse subcutaneous xenograft model of gastric cancer. 5. A diagram schematically showing the safety test schedule. 6. A diagram showing the change in body weight following administration of 0.6 mg ASO (30 mg / kg). 7. A diagram showing the effect of 0.6 mg ASO administration on liver function. 8. A diagram showing the effect of 0.6 mg ASO administration on renal function. 9. Histological findings of mice following administration of 0.6 mg ASO. 10. Macroscopic findings, histological findings, and organ volumes of the liver, kidney, and brain are shown. 11. A diagram showing the genotype of the Pcdha11-deficient mice produced.

[0039] Figures show macroscopic findings of Pcdha11-deficient mice and heterozygous mice, as well as macroscopic findings of major organs (brain, lung, liver) and hematoxylin-eosin stained images. Figures showing the results of motor ability and motor coordination tests in rotarod tests for each mouse. Figures showing white blood cell counts, hemoglobin levels, and platelet counts for each mouse. Figures showing liver function for each mouse. Figures showing kidney function for each mouse.

[0012] As described below, the present inventors have discovered that protocadherin α11 (PCDHA11) is a molecule involved in the proliferation and metastasis of cancer cells, and have developed an antisense nucleic acid (hereinafter referred to as ASO) that targets PCDHA11 mRNA. While ASO will be primarily described here, as will be explained with reference to the data below, it goes without saying that if the expression or function of PCDHA11 can be suppressed, a pharmaceutical composition that is effective in suppressing the proliferation and metastasis of cancer cells can be obtained. Therefore, any pharmaceutical composition that can inhibit the expression level of PCDHA11 protein or mRNA or the function of the protein can be used. This is not limited to nucleic acid molecules, and pharmaceutical compositions containing antibodies, peptides, medium- or low-molecular-weight compounds as active ingredients are also acceptable. Furthermore, nucleic acid molecules are not limited to ASOs; siRNA, shRNA, miRNA, and ribozymes that can suppress PCDHA11 expression are also effective as pharmaceutical compositions.

[0013] In the following examples, analyses were mainly carried out using multiple gastric cancer cell lines, but the effect of PCDHA11 expression inhibition was observed not only in gastric cancer cell lines, but also in pancreatic cancer cell lines, breast cancer cell lines, esophageal squamous cell carcinoma cell lines, lung adenocarcinoma cell lines, and colon cancer cell lines. Furthermore, when analyzed using Kaplan-Meier Plotter, cases with high PCDHA11 expression in bladder cancer, breast cancer, head and neck cancer, esophageal squamous cell carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, ovarian cancer, pheochromocytoma, gastric cancer, rectal cancer, and thyroid cancer showed poor prognosis. Therefore, the pharmaceutical composition of the present invention is useful for at least gastric cancer, pancreatic cancer, breast cancer, esophageal squamous cell carcinoma, lung adenocarcinoma, and colon cancer, and is also considered to be effective in bladder cancer, head and neck cancer, lung squamous cell carcinoma, ovarian cancer, pheochromocytoma, and thyroid cancer.

[0014] The present invention will be explained below with reference to data. It is known that dysregulation of the expression of adhesion molecules, such as E-cadherin, affects the cell adhesion of epithelial cells, leading to epithelial-mesenchymal transition and playing an important role in the development and progression of epithelial tumors. Therefore, we performed transcriptome analysis and bioinformatics analysis of cell surface antigens for molecules involved in cell adhesion to identify potential targets. Surgically resected primary gastric cancer, adjacent non-cancerous gastric mucosa, and liver metastasis tissues from four gastric cancer patients with synchronous liver metastases were subjected to comprehensive gene expression profiling using the HiSeq platform (Illumina, Inc.), and molecules with functions related to metastatic potential were identified.

[0015] Comprehensive gene expression analysis identified 21 candidate genes from 57,749 molecules that showed progressively increased expression in primary gastric cancer tissues and their metastatic tumor tissues compared to normal gastric tissues, suggesting potential molecular targeting drugs. Among these 21 candidate genes, protocadherin α11 (PCDHA11) was selected as the target molecule. PCDHA11 is a member of the cadherin superfamily of cell adhesion regulators, known as α-protocadherins. While physiologically, it functions to maintain neuronal connectivity in the brain, its role in malignant tumors is unknown. However, because high expression of PCDHA11 in gastric cancer tissues correlated with poor prognosis in our in-house cohort of 230 patients and high expression was observed in multiple solid tumors, we analyzed whether knockdown of PCDHA11 using siRNA inhibited gastric cancer cell proliferation.

[0016] [Effect of PCDHA11 siRNA on cell proliferation] The three types of PCDHA11 siRNA shown below were mixed and simultaneously transfected into the human gastric cancer cell line HGC-27, and cell proliferation was measured using Cell Counting Kit-8 (Dojindo Laboratories) (Figure 1A). The sequences of the siRNAs used are as follows: siPCDHA11-1: CAAGUUUUAUAAAAUUGAATT (SEQ ID NO: 1) siPCDHA11-2: GGAAAAUGCUGCUAAAGAATT (SEQ ID NO: 2) siPCDHA11-3: AAUCUAAAGAAAAAAUACUCAU (SEQ ID NO: 3) siControl: GUACCUUGACAGUACCGAUTT (SEQ ID NO: 4)

[0017] The suppression of siRNA expression was confirmed, and cell proliferation was measured over time. PCDHA11 expression and, as a control, GAPDH expression were amplified using the following primers: PCDHA11 forward: TCAGCCCCAGTCTTCCTCTA (SEQ ID NO: 5) PCDHA11 reverse: CTCAGGGAGGCAGAGTAACG (SEQ ID NO: 6) GAPDH forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7) GAPDH reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8)

[0018] As shown in the upper panel of Figure 1A, PCDHA11 expression was suppressed by siRNA. Accordingly, cell proliferation was significantly suppressed in cells transfected with PCDHA11 siRNA (lower panel of Figure 1A). Based on these results, we decided to analyze PCDHA11 expression in clinical samples.

[0019] [Expression of PCDHA11 in tissues] First, we analyzed PCDHA11 expression in 300 cases of gastric cancer at a wide range of stages, from early gastric cancer to advanced cancer with distant metastasis, and in adjacent normal tissues. PCDHA11 mRNA expression was analyzed by qRT-PCR using the primers described above.

[0020] PCDHA11 mRNA expression in gastric cancer tissues was significantly higher than that in corresponding adjacent normal tissues (Figure 1B). Statistical analysis was performed using JMP16 software (SAS Institute Inc.), with P<0.05 considered significant.

[0021] Using data from our own cohort, we analyzed the correlation between PCDHA11 expression and overall survival (OS). Patients were divided into high and low PCDHA11 expression groups based on the median PCDHA11 mRNA level in primary gastric cancer tissue, and the correlation with prognosis was analyzed (Figure 1C, top). Furthermore, as an external validation cohort, we used data obtained from The Cancer Genome Atlas (TCGA) and Kaplan-Meier Plotter via the open-source c-BioPortal. The correlation between PCDHA11 expression and prognosis was analyzed in a similar manner (Figure 1C, middle and bottom). In both our own cohort and other cohorts, the high PCDHA11 expression group had significantly shorter overall survival than the low PCDHA11 expression group. Furthermore, although not shown here, the disease-free survival period (DFS) was also significantly shorter in the high PCDHA11 expression group compared to the low expression group, indicating a poor prognosis. Multivariate analysis identified high PCDHA11 expression as an independent prognostic factor for overall survival.

[0022] The patient attributes of our in-house cohort were divided into high and low PCDHA11 expression groups and are summarized in Table 1. The high PCDHA11 expression group was significantly associated with pathological T4, undifferentiated tumor, pathological invasive growth, the presence of peritoneal metastasis, and advanced stage.

[0023]

[0024] Immunohistochemical staining was performed using primary gastric cancer tissues from 100 cases of pStage (pathological classification) II or III. The primary antibody used for immunohistochemical staining was rabbit polyclonal anti-PCDHA11 antibody (biorbyt), EnVision. ＋ Detection was performed using PCDHA11 Single Reagent (DAKO). The upper panel of Figure 1D shows representative staining images of positive or negative PCDHA11 expression. Of 100 stage II or stage III gastric cancer patients, 52 expressed PCDHA11 in the primary tumor. The postoperative recurrence rate was significantly higher in the PCDHA11-positive group compared to the PCDHA11-negative group (negative group recurrence rate 14.6%, positive group recurrence rate 55.8%), revealing that PCDHA11 expression in the primary tumor correlates with a high recurrence frequency.

[0025] We analyzed PCDHA11 expression in gastric cancer cell lines. Using 14 human gastric cancer cell lines and the normal epithelial cell line FHs74, PCDHA11 expression was analyzed by qRT-PCR (Figure 1E). The mRNA levels of Snail family transcriptional repressor 1 (Snail), transforming growth factor β1 (Tgfb1), and zinc finger E-box binding homeobox 1 (Zeb1) were positively correlated with PCDHA11 mRNA levels. On the other hand, the interleukin-1 receptor antagonist (Il1rn) and PCDHA11 mRNA levels were negatively correlated (Figure 1E).

[0026] As described above, the PCDHA11 gene and protein are significantly expressed in gastric cancer tissue, and therefore can be used as a gastric cancer marker for detecting gastric cancer. Furthermore, since recurrent and metastatic cancers are thought to maintain similar properties, it is believed that recurrent and metastatic cancers can also be detected. Furthermore, since high expression of the PCDHA11 gene or protein is associated with a significantly poor prognosis, it can also be used as a prognostic predictive marker.

[0027] [Development of a therapeutic drug by inhibiting PCDHA11 expression] Since PCDHA11 expression has been found to be correlated with gastric cancer, we investigated the possibility of inhibiting PCDHA11 expression as a treatment and decided to proceed with the development of antisense nucleic acids. The loop structure of PCDHA11 mRNA (NM_018902.4, SEQ ID NO: 9) was predicted using RNAfold and UNAFold, and the target site to which ASO binds with high affinity was identified. Furthermore, taking into account sequence identity with mouse PCDHA11 mRNA and avoiding sequences associated with hepatotoxicity, 46 ASOs of different lengths were created. Note that since NM_018902.5 (SEQ ID NO: 10) was published after design, the names of the ASOs used in the following experiments are named based on the position of the starting point in NM_018902.5.

[0028] Here, because experiments were performed using a mouse model, consideration was given to homology with mouse Pcdha11 mRNA; however, when used in human treatment, consideration of homology with the mouse gene is not necessary. Therefore, it is sufficient to select a sequence that avoids sequences associated with hepatotoxicity from the target site to which the ASO binds with high affinity, and that also has minimal off-target effects. To prevent off-target effects, a sequence that is completely complementary to the ASO and is not present anywhere other than the target, i.e., human PCDHA11 mRNA, and a spliced ​​RNA containing a sequence containing one deletion, insertion, or mismatch is selected to be present in 20 or fewer genes, preferably 10 or fewer genes, and more preferably 5 or fewer genes other than the target.

[0029] Here, chemically modified nucleic acids (artificial nucleic acids) were used because chemical modification is expected to confer resistance to nucleases, thereby improving in vivo stability and binding affinity with target molecules. Artificial nucleic acids may be used in part or in whole in the nucleic acid molecules of the present invention. Examples of such artificial nucleic acids include modifications to internucleoside linkages, modifications to base moieties (modified nucleic acids), and modifications or alterations to sugar moieties (modified sugar moieties). In the examples below, ASOs were designed in which all phosphate groups were phosphorothioated and the flanking regions (wing regions) were modified with amido-bridged nucleic acid (AmNA) (Figure 2A). Note that the cytosines in the wing regions were 5-methylcytosines. Because a large number of phosphorothioates can lead to toxicity, some of the phosphate groups in the wing regions may be converted to phosphodiester bonds (PO). In addition to AmNA, known artificial nucleic acids such as 2'-OMe, 2'-MOE, 2',4'-BNA (LNA), cEt, and ENA can also be used. Furthermore, the artificial nucleic acid may be introduced into the wing region of a gapmer, and does not necessarily have to follow the pattern shown in Figure 2A. Regarding nucleic acid modification and the position at which the modified nucleic acid is introduced, optimal modifications and introduction positions can be determined based on known methods (see, for example, Non-Patent Documents 1 to 4). Furthermore, future artificial nucleic acids, introduction positions, combinations of multiple artificial nucleic acids, modifications, etc. can be combined and optimized. The AmNA-modified ASO used was HPLC-grade, synthesized and purified by Gene Design, Inc.

[0030] Of the designed anti-PCDHA11 ASOs, 46 sequences were synthesized as AmNA-modified ASOs (SEQ ID NOs: 11 to 56, Table 2). Table 2 lists the nucleic acid sequences as unmodified, but as shown in FIG. 2A, all nucleic acids were phosphorothioated, and the third base from the 5' end and the fourth to second bases from the 3' end were AmNA-modified, with cytosine being converted to 5-methylcytosine. However, as described above, the nucleic acid modifications are not limited to these, and different modifications may also be used.

[0031]

[0032] The optimal ASO was screened by inhibiting PCDHA11 mRNA expression in a gastric cancer cell line. In this specification, unless otherwise specified, ASO refers to AmNA-modified anti-PCDHA11 ASO. HGC-27 cells highly expressing PCDHA11 mRNA were transfected with 400 nM of each candidate ASO, and PCDHA11 mRNA expression was analyzed. For transfection, cells were seeded at 5,000 cells per well in a 24-well plate, and the next day, the cells were transfected with 9 mM CaCl (see Non-Patent Document 5). ２ The ASOs were transfected into culture medium supplemented with . As shown in Figure 2B, all ASOs suppressed PCDHA11 expression, although to different degrees. Here, 17-mer and 19-mer ASOs were synthesized and used, and both were effective. Therefore, based on the sequences disclosed in Table 2, sequences of 13-mer to 24-mer length, preferably 14-23-mer, more preferably 15-22-mer, and even more preferably 16-21-mer length can be designed and used as ASOs. Furthermore, the ASOs shown in Table 2 may have 1-3, 1-2, or 1 base substituted, deleted, or inserted. The sequence described in hPCDHA11-"number" indicates an ASO consisting of a 17-consecutive base sequence complementary to the base sequence starting with the nucleotide designated by "number" in the base sequence shown in SEQ ID NO: 10. The "number" followed by (19) refers to an ASO consisting of a complementary 19-consecutive base sequence. Furthermore, ASO-NEG (SEQ ID NO: 57: CACAGTATCTATGTA) was used as a negative control in the experiment.

[0033] As shown in Figure 2B, all ASOs had the effect of suppressing PCDH11 expression, but only hPCDH11-5'UTR, hPCDH11-0009 (hereinafter, "hPCDH11-" will be abbreviated and only the "number" will be described), 0351, 0574, 0581, 0590, 0811, 0817, 0821, 0931, and 0932 suppressed expression by an average of 40% compared to untreated cells. 34, 0934 (19), 0936 (19), 0938, 0938 (19), 0940 (19), 0942 (19), 1210, 1409, 1430, 1869, 1875, 2072, 2181, 2270 (19), 2272, 2274 (19), 2276, 2276 (19), 2305, 2520, 2525, 2527, 2529, and 2532 can be preferably used. Furthermore, hPCDH11-0009, 0351, 0574, 0811, 0821, 0931, 0934 (19), 0938, 0942 (19), 1210, 1409, 1430, 1869, 1875, 2272, 2276 (19), 2525, and 2529, which were observed to suppress expression by an average of about 20% compared to untreated cells, can be more preferably used. Furthermore, in most cases, longer sequences tend to increase specificity and therefore produce stronger inhibition. Therefore, even ASO sequences other than these that did not show high expression suppression may exhibit high efficacy by using longer sequences such as 19mers or 21mers.

[0034] Furthermore, as a secondary screening step, concentration-dependent expression suppression of ASO was analyzed, and those with a large inhibitory effect and concentration-dependent inhibition were selected. Based on the above results, hPCDHA11-0811, hPCDHA11-0938, hPCDHA11-1875, hPCDHA11-2272, and hPCDHA11-2525 were selected as nucleic acid drug candidates (Figure 2C). As described above, ASO was introduced into the HGC-27 cell line at varying concentrations, and PCDHA11 expression was analyzed. Although the results are not shown here, it was also shown that PCDHA11 expression was knocked down in a concentration-dependent manner in the gastric cancer cell line MKN1.

[0035] Western blotting was performed to analyze the expression level of PCDHA11 protein in cells treated with anti-PCDHA11 ASO. PCDHA11 expression was measured using rabbit anti-PCDHA11 polyclonal antibody (1:500 dilution, St. John's Laboratory) as the primary antibody and HRP-conjugated anti-rabbit IgG (Cell Signaling Technology) as the secondary antibody. As shown in Figure 2D, ASO treatment significantly reduced PCDHA11 expression.

[0036] [Effect of PCDHA11 Expression on Cell Proliferation] Cell proliferation inhibitory activity is an important antitumor activity. hPCDHA11-0811, hPCDHA11-1875, and hPCDHA11-2525, each at 400 nM, were transfected into poorly differentiated gastric cancer cells (HGC-27), pancreatic cancer cells (AsPC-1), breast cancer cells (MCF7 and SKBR3), esophageal squamous cell carcinoma cells (TT), and lung adenocarcinoma cells (H1975), and cell proliferation was analyzed over time. Cell proliferation was measured using Cell Counting Kit-8 (Dojindo Laboratories). Significant growth inhibition was observed in all cancer cell lines (Figure 3A). Furthermore, we analyzed the proliferation effects of hPCDHA11-0938 and hPCDHA11-2272 on MKN1 (differentiated gastric cancer) cells and SW1116 (colon cancer) cells, and found that these ASOs also had similar cell proliferation inhibitory effects (Figure 3B).

[0037] To observe the dynamic changes in cancer cells induced by ASO treatment, we performed time-lapse imaging for 36 hours after transfection of hPCDHA11-2525 into HGC-27 cells. Time-lapse imaging was performed using a BZ-X810 system (Keyence). Although no obvious changes in the morphology of individual cells were observed, cell migration and aggregation decreased. Ultimately, the structure of the cancer cells collapsed (Figure 3C).

[0038] The effect of PCDHA11 overexpression was analyzed. PCDHA11 was overexpressed in KATO-III cells, which have a low expression level of endogenous PCDHA11 mRNA. KATO-III cells (1 × 10５ ) were transfected with a PCDHA11 expression vector (PCDHA11-OE, OriGene Technologies) or vector alone (OriGene Technologies) as a control using a Neon electroporation system (Thermo Fisher Scientific). Compared with the vector-only control, overexpression of PCDHA11 significantly increased proliferation of KATO-III cells (Figure 3D).

[0039] Next, PCDHA11 knockout cells were created using HGC-27 cells, which had the highest relative expression level of PCDHA11. A knockout cell line was created using genome editing, and the sequence was confirmed by Sanger sequencing to obtain the knockout cell line PCDHA11-KO HGC-27. ASO was introduced by transfection, and the growth inhibitory effect was measured. A significant inhibitory effect of ASO was observed in the parent HGC-27 cells, but growth inhibition by ASO was not induced in the knockout PCDHA11-KO HGC-27 cells (Figure 3E). These results revealed that PCDHA11 expression is correlated with cell proliferation, and that growth can be suppressed by suppressing expression.

[0040] [Analysis of the mechanism of anti-PCDHA11 ASO on cancer cell proliferation] First, we analyzed the effect of PCDHA11 knockdown on apoptosis. hPCDHA11-0811, hPCDHA11-1875, and hPCDHA11-2525 were transfected into HGC27 and knockout cells PCDHA11-KO HGC-27 (HGC27-PCDHA11 / KO in Figure 4A), and caspase activity was analyzed. Caspase activity was measured using the Caspase-Glo 3 / 7 Assay System (Promega) (Figure 4A). ASO-mediated PCDHA11 knockdown increased caspase activity compared to HGC-27 cells not transfected with ASO. In particular, suppression of PCDHA11 expression with hPCDHA11-2525 resulted in a significant increase in caspase activity. On the other hand, in PCDHA11-KO HGC-27 cells, almost no increase in caspase activity due to ASO was observed. Furthermore, although data are not shown here, when HGC-27 cells were transfected with hPCDHA11-2525 and apoptotic cells were visualized using annexin V, a greater number of annexin V-positive cells were observed in the hPCDHA11-2525-transfected cells.

[0041] Next, cancer stemness was evaluated by a spheroid cell culture assay. MKN1 cells were transfected with hPCDHA11-2525 or ASO-NEG (SEQ ID NO: 57: CACAGTATCTATGTA), and spheroid formation was observed. Spheroid culture was performed using a PrimeSurface 96U multiwell plate (Sumitomo Bakelite). hPCDHA11-2525 was found to significantly inhibit spheroid formation, one of the phenotypes of cancer stemness (Figure 4B).

[0042] Aldehyde dehydrogenase (ALDH) is known to be a marker for stem / progenitor cells. The ALDH assay was used to analyze the percentage of cells exhibiting cancer stem cell-like properties. ALDH levels were measured using the ALDEFLOUR fluorescent reagent system (Stem Cell Technologies). ALDH-positive cells were detected using a FACS Calibur system (BD Biosciences). The percentage of HGC-27 cells expressing the stem cell marker ALDH was reduced by transfection with hPCDHA11-2525 compared with cells not transfected with ASO or cells transfected with NEG-ASO cells (Figure 4C). These results indicate that PCDHA11 is closely related to apoptosis sensitivity and cancer stemness.

[0043] [Effect of ASO on Metastatic Potential] The effect of ASO on the invasive, migratory, and adhesive capabilities of cancer cells, which are functions related to metastasis, was evaluated. hPCDHA11-0938 or hPCDHA11-2272 was transfected into gastric cancer cells MKN1 or HGC-27, and cell invasiveness was evaluated using BioCoat Matrigel invasion chambers (BD Biosciences) (Figure 5A). In both cell types, significantly fewer cells migrated to the underside in cells transfected with hPCDHA11-0938 or hPCDHA11-2272 than in cells transfected with the control ASO-NEG, demonstrating that anti-PCDHA11 ASO suppresses cell invasiveness.

[0044] The migration ability of HGC-27 cells was evaluated by a wound-healing assay (Fig. 5B). Cells transfected with hPCDHA11-0938 or hPCDHA11-2272 showed significantly reduced migration ability compared with control cells not transfected with ASO or cells transfected with ASO-NEG (Fig. 5B, lower graph).

[0045] Adhesion to mesothelial cells is a cancer cell function that correlates with peritoneal metastatic potential. Therefore, we evaluated the adhesion of cancer cells to primary cultured human mesothelial cells using the Vybrant Cell Adhesion Assay Kit (Thermo Fisher Scientific) (Figure 5C). hPCDHA11-0811, hPCDHA11-1875, hPCDHA11-2525, or ASO-NEG was transfected into HGC-27 cells. Adhesion of transfected cells to mesothelial cells was calculated as a ratio to that of cells not transfected with ASO. The percentage of cells adhering to human mesothelial cells was significantly suppressed by ASO introduction (Figure 5C).

[0046] [Role of PCDHA11 in signal transduction] Many members of the cadherin superfamily have been reported to have diverse functions in cancer cells. We performed transcriptome analysis of metastatic gastric cancer tissues (n = 93) to analyze the expression of cadherin-related molecules and create a volcano plot. Ten mRNA levels were significantly elevated in metastatic gastric cancer tissues. Among these, PCDHA11 was most highly expressed and exhibited unique behavior among protocadherins (Figure 6A).

[0047] To understand the mechanism of action by which anti-PCDHA11 ASO inhibits the proliferation and function of cancer cells, we analyzed the changes in molecules involved in intracellular signaling pathways induced by ASO. hPCDHA11-0811, hPCDHA11-1875, hPCDHA11-2525, or ASO-NEG were transfected into HGC-27 cells, and the expression and phosphorylation status of proteins involved in cancer-related signaling pathways were assessed by Western blotting. Specifically, the PTMScan Direct Multi-Pathway Enrichment Kit (Cell Signaling Technology) was used to quantify the phosphorylation of 1,006 unique sites in 409 proteins in the cells. Protein expression and phosphorylation were performed using capillary electrophoresis Simple Western (ProteinSimple).

[0048] Knockdown of PCDHA11 expression by ASO suppressed the phosphorylation of FAK and PKCα, and also reduced the phosphorylation of AKT and mTOR. Furthermore, β-catenin, a downstream signaling pathway mediated by the Axin1-TEAD1 pathway, was inactivated by PCDHA11 knockdown. Furthermore, knockdown of PCDHA11 expression inhibited the phosphorylation of CDC45 and CDC73, which regulate cell cycle and DNA synthesis. Inhibition of phosphorylation of the JAK1-STAT3 signaling pathway and the c-Raf-MEK1 / 2 signaling pathway was also detected in ASO-transfected cells (Figure 6B). Figure 6C summarizes the PCDHA11-mediated signaling pathway in cancer cells, as well as their role in cancer stemness, metastasis, and resistance to apoptosis, as predicted by the above analysis.

[0049] [Analysis Using Peritoneal Metastasis Mouse Model] The effect of hPCDHA11 ASO was analyzed in a peritoneal metastasis mouse model using gastric cancer cell line MKN1 and pancreatic cancer cell line AsPC-1. The following animal experiments were performed in accordance with the ARRIVE guidelines. Gastric cancer cell line MKN1 or pancreatic cancer cell line AsPC-1 was used at 5 x 10 ６The tumor cells were intraperitoneally transplanted into Nod-SCID mice (male, 6 weeks old). Starting one week after tumor cell transplantation, the mice (n=4 per group) were injected once a week for four weeks with 500 μL of glucose, 15 mM CaCl ２ In the presence of α-hPCDHA11-2272, 0.6 mg (approximately 30 mg / kg) of hPCDHA11-2272 was intraperitoneally injected (FIG. 7A).

[0050] The mice were euthanized one week after the fourth administration, and the effects of anti-PCDHA11 ASO administration were evaluated (Figure 7B). Macroscopic observation revealed almost no peritoneal nodules in the hPCDHA11-2272-administered group, regardless of whether the cells were MKN1 or AsPC-1 cells, whereas numerous peritoneal nodules were observed in the control and ASO-NEG-administered groups. The peritoneal nodules were removed and weighed, revealing a significant decrease in total peritoneal nodule weight in the hPCDHA11-2272-administered group compared with the control and ASO-NEG-administered groups. Thus, hPCDHA11-2272 administration was effective in inhibiting tumor cell proliferation and suppressing peritoneal metastasis.

[0051] Peritoneal metastasis was evaluated in mice implanted with MKN1 cells using a peritoneal metastasis model. 0.2 mg of hPCDHA11-0811, -1875, and -2525 were administered according to the same schedule as above. Significant inhibition of peritoneal metastasis was observed in the hPCDHA11-1875 and -2525 administration groups (Figure 7C). While no effect was observed with low doses (0.2 mg) of hPCDHA11-0811, in vitro experimental results indicated that it had a cell proliferation inhibitory effect, suggesting that higher doses may be effective.

[0052] [Analysis using hematogenous metastasis mouse model] Next, the effect of PCDHA11 knockdown on systemic metastasis was analyzed. MKN45 cells, which can be used to stably generate systemic metastasis mouse models by tail vein injection, were used to analyze hematogenous metastasis. MKN45 cells transfected with 400 nM of hPCDHA11-2525, MKN45 cells as a control, and MKN45 cells transfected with 400 nM of ASO-NEG were each injected into the tail vein of Nod-SCID mice (male, 6 weeks old). ６Each mouse was injected with 1000 mg of MKN45 cells (n = 5 per group). The mice were euthanized 6 weeks after MKN45 cell transplantation and analyzed. One mouse in the ASO-NEG group died during the experiment. Macroscopic findings of lung and skin tumors and HE-stained images of the tumors formed are shown (Figure 7D). Tumor formation was observed in the lungs and skin of each individual in the control and ASO-NEG groups. On the other hand, tumor formation was observed in two of the five mice in the hPCDHA11-2525 transfection group, but no tumor formation was observed in three mice.

[0053] [Analysis using subcutaneous tumor model mice] Next, we used subcutaneous tumor model mice to examine whether a therapeutic effect could be obtained even if ASO administration was initiated after tumor formation. HGC-27 cells (5 × 10 ６ The tumor volume was 50 mm ３ At the time of reaching 100 mg / kg, mice were randomly assigned to control, ASO-NEG, hPCDHA11-0811, -1875, and -2525 (n = 3 per group). The control group received glucose alone, while the ASO-NEG, hPCDHA11-0811, -1875, and -2525 groups received 0.6 mg of each ASO and 15 mM CaCl. ２ The mixture was mixed with glucose and injected intraperitoneally once a week for 4 weeks (Figure 7E). Subcutaneous tumor growth was significantly delayed by weekly administration of hPCDHA11-1875 and -2525. Therefore, it was demonstrated that anti-hPCDHA11 ASO is effective even on tumors that have already formed. Because treatment is initiated clinically on tumors that have already formed, these results suggest that anti-PCDHA11 ASO has a therapeutic effect in clinical practice.

[0054] [Safety of PCDHA11 ASO Administration] The safety of ASO was evaluated. ｎｕ／ｎｕ Mice (6 weeks old, male, n = 4 per group) were maintained in a 15 mM CaCl ２Mice were intraperitoneally administered 500 μL of glucose (control), 0.2 mg NEG-ASO (10 mg / kg), and 0.2 mg (10 mg / kg), 0.6 mg (30 mg / kg), or 2.0 mg (100 mg / kg) of AmNA-modified anti-PCDHA11 ASO (hPCDHA11-0811, -1875, or -2525) twice, seven days apart. Blood tests were performed immediately after the second ASO administration and one week later. Blood tests were also performed three weeks after the second ASO administration (Figure 8A). Skin appearance, food intake, and body weight were monitored for each group. Four weeks after the start of administration, mice were euthanized, and macroscopic and pathological examinations of the liver, kidney, and brain were performed.

[0055] No changes were observed in the skin around the injection site. No significant differences in body weight were observed in mice administered hPCDHA11-ASO compared to controls at any dose (Figure 8B). Furthermore, no decrease in activity or impairment of oral intake was observed. Blood tests showed increases in aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP) in mice administered hPCDHA11-ASO (Figure 8C). In particular, significant increases in AST and ALT levels were observed in mice administered hPCDHA11-2525. Although data are not shown here, the increases in AST, ALT, and ALP were concentration-dependent. Regardless of the sequence and concentration of hPCDHA11-0811, -1875, or -2525, the elevated AST and ALT levels following administration decreased three weeks after the end of administration. Notably, AST and ALT levels returned to near baseline in mice treated with 0.2 mg of hPCDHA11-0811 and -1875. These findings indicate that the hepatotoxicity induced by AmNA-modified anti-PCDHA11 ASO is reversible and sequence-dependent. No increase in total bilirubin levels was observed at any dose of ASO.

[0056] Renal function was assessed by measuring amylase, urea nitrogen (UN), and creatinine (Cr). Administration of any hPCDHA11-ASO at any dose did not induce detectable renal dysfunction or elevated amylase levels (Figure 8D). Furthermore, after euthanasia, tissue effects were confirmed. The liver, kidney, and brain showed no significant changes in appearance, volume, or hematoxylin-eosin staining (Figure 8E). Therefore, anti-PCDHA11 ASO is considered to be highly safe.

[0057] As shown above, the therapeutic effect of PCDHA11 ASO administration was confirmed in various cancer-bearing models. In particular, in a mouse peritoneal metastasis model using MKN1 cells, sufficient efficacy was demonstrated with a low dose of 0.2 mg (10 mg / kg) administered weekly. Furthermore, even when administered at a dose of 2.0 mg / kg, temporary liver toxicity may be observed, but this is reversible and therefore not considered to be a safety issue. Therefore, in mice (based on a body weight of 25 g), administration in the range of 0.2 mg to 2.0 mg can safely achieve therapeutic efficacy. Based on this, the human equivalent dose is 0.767 mg / kg or more and 7.67 mg / kg or less, or 46.0 mg to 460 mg for a body weight of 60 kg. Commonly used administration methods, such as intravenous injection and intraperitoneal administration, can be used. Furthermore, since sufficient efficacy was observed with once-weekly administration in mice, it is believed that once-weekly administration will also be sufficient in humans. Furthermore, since the mechanism of action of suppressing PCDHA11 expression is different from that of conventional chemotherapy drugs, a synergistic effect can be expected when used in combination with other chemotherapy drugs.

[0058] [Identification of Pcdha11 function using Pcdha11- / - mice] To identify the pathophysiological function of PCDHA11, Pcdha11- / - mice were generated. Pcdha11- / - mice were generated using the CRISPR / Cas9 system and raised under SPF conditions. The genomes of Pcdha11+ / +, Pcdha11+ / -, and Pcdha11- / - mice were analyzed by electrophoresis (Figure 9A). The appearance, weight, development of major organs, and blood tests of Pcdha11-deficient mice were evaluated.

[0059] Knockout of one or both Pcdha11 alleles (Pcdha11+ / - and Pcdha11- / - mice) did not result in embryonic lethality or abnormalities in appearance or development of the liver, lungs, or brain (Figure 9B). Body weight was also unaffected, although data not shown here were not shown. Furthermore, motor performance and general motor coordination were measured using the rotarod test (Economex Rotarod). Neither Pcdha11+ / - nor Pcdha11- / - mice showed impairments in motor performance or coordination (Figure 9C). Both genotypes showed no abnormalities in white blood cell count, hemoglobin, or platelet count (Figure 9D); liver function measured by AST, ALT, ALP, and total bilirubin levels (Figure 9E); or kidney function measured by urea nitrogen, creatinine, sodium, and potassium levels (Figure 9F). Although the results are not shown here, no abnormalities were observed in metabolic parameters such as glucose, cholesterol, and albumin.

[0060] Since no abnormalities were observed in appearance, weight, development of major organs, motor ability, blood tests, etc. in Pcdha11-deficient mice, it is presumed that suppressing PCDHA11 expression by ASO does not adversely affect physiological function. Therefore, treatment with PCDHA11 ASO is thought to be an effective treatment option for various malignant tumors.

[0061] Furthermore, as described above, PCDHA11 expression is a molecule involved in cancer metastasis, so cancer metastasis and prognosis prediction can be performed by measuring PCDHA11 expression. PCDHA11 expression can be measured using any known method, and methods for measuring protein or mRNA expression commonly used in this field can be used.

[0062] In the case of protein expression, immunoassays using antibodies are preferably used, although not particularly limited thereto. Examples of immunoassays include enzyme-linked immunosorbent assays (ELISA, EIA), fluorescence immunoassays (FIA), radioimmunoassays (RIA), luminescence immunoassays (LIA), electrochemiluminescence (ECL), Western blotting, surface plasmon resonance, antibody array methods, immunohistochemical staining, fluorescence-activated cell sorting (FACS), immunochromatography, immunoprecipitation, immunoturbidimetry, and latex agglutination. In addition to the antibodies used herein, commercially available polyclonal or monoclonal antibodies can be used as antibodies specific to PCDHA11. Alternatively, monoclonal antibodies may be prepared separately.

[0063] Methods for measuring mRNA include RT-PCR, in situ hybridization, and Northern blotting, but quantitative methods using techniques such as RT-PCR, particularly real-time PCR and digital PCR, are preferably used due to their high detection sensitivity and ease of experimental procedures. The PCDHA11 primer may be the primer used above, or a separately designed primer may be used.

[0064] When PCDHA11 expression is detected using an antibody, the test kit can include an anti-PCDHA11 antibody as well as the detection reagents, instruments, manuals, etc. required for each method. For example, in the case of sandwich ELISA, capture antibodies, antibodies labeled with fluorescent dyes or enzymes, assay plates, solutions required for antibody reactions, etc. can be appropriately included. Furthermore, when a PCR method is used, in addition to a primer set, reagents required for the reverse transcription reaction, such as reverse transcriptase, oligo d(T) primer, and buffer solution, as well as reagents required for the PCR reaction, such as DNA polymerase, buffer solution, and dNTPs, can be appropriately included. Measuring PCDHA11 expression in individual patients makes it possible not only to predict metastasis and prognosis, but also to predict whether a PCDHA11 inhibitor will be effective.

Claims

1. A pharmaceutical composition for treating cancer, which comprises an inhibitor of PCDHA11 expression as an active ingredient.

2. The pharmaceutical composition according to claim 1, wherein the active ingredient is a nucleic acid molecule, an antibody, a peptide, or a medium- or low-molecular-weight compound.

3. The pharmaceutical composition according to claim 2, wherein the active ingredient is a nucleic acid molecule.

4. The pharmaceutical composition according to claim 3, wherein the nucleic acid molecule is an antisense nucleic acid, siRNA, shRNA or miRNA.

5. The pharmaceutical composition according to claim 4, wherein the nucleic acid molecule is an antisense nucleic acid and includes a modified artificial nucleic acid.

6. A pharmaceutical composition according to any one of claims 1 to 5, characterized in that the cancer is a solid cancer.

7. A cancer testing support method characterized by measuring PCDHA11 expression.

8. The examination support method according to claim 7, characterized in that cancer metastasis and prognosis are predicted based on PCDHA11 expression.

9. The test support method according to claim 7 or 8, characterized in that the measurement of PCDHA11 expression is carried out by PCR or by detecting an anti-PCDHA11 antibody.

10. A test kit comprising a PCR primer or anti-PCDHA11 antibody for use in the test support method according to claim 9, and a reagent for detection.

Images