Use of matrix bound nanovesicles (MBV) for inhibition of osteoclasts
Matrix bound nanovesicles derived from mammalian extracellular matrix inhibit osteoclasts by suppressing the NF-κB pathway, addressing the inadequacies of current treatments for periprosthetic osteolysis and osteoporosis by reducing osteoclast activity and bone resorption.
Patent Information
- Application Number
- PCT/US2025/033414
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-13
- Filing Date
- 2025-06-12
- Publication Date
- 2025-12-18
AI Technical Summary
Current treatments for periprosthetic osteolysis and osteoporosis are inadequate, as they fail to effectively inhibit osteoclast activity, leading to chronic inflammation and prosthetic failure in total joint arthroplasty procedures.
Administering matrix bound nanovesicles (MBV) derived from mammalian extracellular matrix, which do not express CD63 and CD81, to inhibit osteoclasts and suppress the NF-κB pathway, thereby reducing osteoclast formation and activity.
MBV effectively mitigate osteoclast-induced bone resorption, alleviating periprosthetic osteolysis and osteoporosis by suppressing osteoclast formation and activity, thus prolonging the lifespan of prosthetic implants and improving bone health.
Smart Images

Figure US2025033414_18122025_PF_FP_ABST
Abstract
Description
8123-111501-02 USE OF MATRIX BOUND NANOVESICLES (MBV) FOR INHIBITION OF OSTEOCLASTS CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Application No.63 / 659,775, filed June 13, 2024, which is herein incorporated by reference in its entirety. SEQUENCE LISTING
[0002] The Sequence Listing is submitted as an XML file in the form of the file named “Sequence.xml” (16,101 bytes), which was created on May 12, 2025, which is incorporated by reference herein. FIELD OF THE DISCLOSURE
[0003] This relates to the field of matrix bound nanovesicles, specifically to their use for inhibiting osteoclasts, for example to treat periprosthetic osteolysis (PPOL) or osteoporosis in a subject. BACKGROUND
[0004] Total joint arthroplasty (TJA) is one of the most common interventions for end-stage arthritic or traumatic joints, with an estimated 63,500 primary total hip arthroplasty (THA) and 1.26 million primary total knee arthroplasty (TKA) procedures performed annually in the U.S. by 2030, and a 10-year revision rate of approximately 12%. Despite advancements in the biophysical properties of implants, prolonged and repeated mechanical loading and thermodynamically driven electrochemical processes can cause the release of metallic and ultra-high molecular weight polyethylene (UHMWPE) wear debris ranging in size from nano- to micrometers. Phagocytosis of these particles by tissue-resident macrophages results in chronic inflammation and osteoclastogenesis via receptor activator of nuclear factor kappa- Β ligand (RANKL) / RANK axis signaling. Nondigestible particles repeatedly stimulate monocyte / macrophages to differentiate into osteoclasts leading to periprosthetic osteolysis (PPOL) in the short term, aseptic loosening (APL) in the long term, and eventual prosthetic failure requiring revision. Surgical correction of APL accounts for 55% of THA revisions and 30% of TKA revisions. However, as the number of joint replacements increases, there is a growing need to develop a treatment for PPOL.8123-111501-02 SUMMARY OF THE DISCLOSURE
[0005] Methods are disclosed for inhibiting osteoclasts in a subject. These methods include selecting a subject in need of osteoclast inhibition and administering to the subject a composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81loand wherein the MBV do not contain alkaline phosphatase. In specific, non-limiting examples, the subject can have periprosthetic osteolysis or osteoporosis.
[0006] Methods are also disclosed for treating or preventing periprosthetic osteolysis at the site of a prosthetic implant in bone or cartilage in a subject comprising administering to the subject a composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo. thereby treating or preventing periprosthetic osteolysis at the site of the prosthetic implant. In specific, non-limiting examples, the prosthetic implant is in bone, while in others, the implant is in cartilage.
[0007] Methods are also disclosed for treating a disease or disorder that causes increased bone resorption in a subject comprising administering to the subject a composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo. In specific, non-limiting examples, the disease or disorder is osteoporosis, while in others, the disease is osteopenia.
[0008] The foregoing and other features and advantages of the invention will become more apparent from the following detailed description of several aspects which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE FIGURES
[0009] FIGs.1A-1E. MBV characterization and assessment of cytocompatibility. (FIG. 1A) TEM imaging of MBV isolated from porcine urinary bladder matrix (UBM). Scale bars = 100 nm. (FIG.1B) MBV size as measured by nanoparticle tracking analysis (NTA). (FIG. 1C) RAW264.7 cells were treated with PBS, 5% DMSO, and serial dilutions of MBV ranging from 1.25 × 109to 1 × 1010particles / mL (MBV vs cells ratio 1.25×105to 1×106particles / mL / cell) for 24 hours and assayed for cytotoxicity by live / dead staining. Representative fluorescence images. Scale bars, 100 μm. (FIG.1D) Percentage of live cells.8123-111501-02 PBS control, 5% DMSO, and various doses of MBV. Values are shown as mean ± SD(n=4). Significant differences were determined as p < 0.05. (FIG.1E) Cell proliferation and cytotoxicity were assessed by CCK-8 assay. Values are shown as mean ± SD (n=4). Significant differences were determined as p < 0.05.
[0010] FIGs.2A-2H. MBV mitigate RANKL-induced osteoclast formation and activity in-vitro. (FIG.2A) Cellular uptake of MBV by RAW 264.7 cells. Csfe-labeled MBV were added to the RAW 264.7 cells culture media for 1 hour; nuclei were labeled with DAPI, and cytoskeleton F-actin was labeled with 594-phalloidin before imaging. Representative IF images (40× and enlarged). Scale bars for 40× images, 50 µm. Scale bars for enlarged images, 10 µm. (FIG.2B) MBV reduce osteoclasts differentiation. RAW 264.7 cells were cultured with RANKL (30 ng / mL) and serial doses of MBV ranging from 0 MBV / mL to 5 × 109MBV / mL for 5 days. Osteoclasts were determined with tartrate-resistant acid phosphatase (TRAP) staining. Representative light microscope TRAP staining images (10x and enlarged). Scale bars 200 µm. (FIG.2C) Raw 264.7 cells were cultured with RANKL (30ng / mL) with or without MBV for 5 days. Actin ring formation was determined with FITC-phalloidin, and nuclei were labeled with DAPI. Representative IF images (1× and 40×). Scale bars for 1× images, 2000 µm. Scale bars for 40× images, 100 µm. (FIG.2D) MBV reduce osteoclasts activity. RAW 264.7 cells were cultured with RANKL (30ng / mL) and serial doses of MBV ranging from 0 MBV / mL to 5 × 109MBV / mL on a calcium phosphate-coated plate for 7 days. Resorption areas were determined with a light microscope (5×). Scale bars 500 μm. (FIG.2E) Numbers of osteoclasts (trap positive, nuclei>3). Values are shown as mean ± SD(n=4). Significant differences were determined as p < 0.05. Average cell area (n=4). Values are shown as mean ± SD (n=4). Significant differences were determined as p < 0.05. (FIG.2G) At day 6, bone resorption assay culture media were tested for fluorescence intensity. Fluorescence intensity (n=4). Values are shown as mean ± SD(n=4). Significant differences were determined as *P < 0.05. (FIG.2H) Resorption pit area (n=4). Values are shown as mean ± SD(n=4). Significant differences were determined as *P < 0.05.
[0011] FIGs.3A-3E. MBV mitigate RANKL-induced osteoclast formation and functions by suppressing NF-κB pathway in vitro. RAW 264.7 cells were challenged with RANKL and various concentrations of MBV (1× 1010to 2× 1010particles / mL, MBV vs cells ratio 1× 104to 2 × 104particles / mL / cell), 1day for osteoclast differentiation and activity related gene RT-qPCR (FIG.3A and FIG.3B, RANKL 50ng / mL), 3 days for osteoclast differentiation and activity related protein western-blot (C, RANKL 50ng / mL), 5 days for TNF-α8123-111501-02 concentration in conditional media (FIG.3D, RANKL 30ng / mL, MBV 5× 109particles / mL). (FIG.3A) Osteoclast differentiation regulators (NFATc1 and DC-STAMP) relative expression(2-△△T) were measured by RT-qPCR (values = means ± SD; n = 9; significant differences *P < 0.05). (FIG.3B) Osteoclast activity related genes (CathepsinK, c-Src, MMP9 and β3-Integrin) relative expression(2-△△T) were measured by RT-qPCR (values = means ± SD; n = 9; significant differences *P < 0.05). (FIG.3C) Osteoclast differentiation related protein (NFATc1) and osteoclast activity proteins (c-Src and Cathepsin K) relative expression was measured by western blot (values = means ± SD; n = 3; significant differences *P < 0.05). (FIG.3D) TNF-α in conditional media from Raw 264.7 cells co- cultured with RANKL with or without MBV for 5 days was determined by ELISA (values = means ± SD; n = 3; significant differences *P < 0.05). (FIG.3E) RAW 264.7 cells were challenged with 50 ng / mL RANKL and 2 × 1010particles / mL MBV from 0 to 60 min. NF-κB pathway proteins were determined by western blot. Representative Western blotting images of the effects of MBV on p-p65, p65, and IĸB-α. Quantification of the ratios of band intensity of p-p65 / p65 and IĸBα relative to β-actin expression. (values = means ± SD; n = 3; significant differences *P < 0.05).
[0012] FIGs.4A-4E. MBV biodistribution in mouse model of particulate-induced calvarial osteolysis. (FIG.4A) Experiment design. Mice skull and periosteum were exposed to UHMWPE particles. Near infared (NIR)-labeled MBV peri-calvarial administrated post- UHMWPE implantation surgery. Post-surgery from 0 hour to 7 days, fluorescence signal was examined by an in vivo imaging system (IVIS). (FIG.4B) Representative IVIS images from 0 hour to 7 days. (FIG.4C) Post injection 7 days, mice were sacrificed, and organs and bones were taken for IVIS imaging. Representative organs and bone IVIS images. (FIG. 4D) Total radiant efficacy ([p / s] / [uW / cm2]) of the calvarial region from 0 hour to 7 days (values = means ± SD; n = 5). (FIG.4E) Total radiant efficacy ([p / s] / [uW / cm2]) of skull, liver, kidneys and femur-tibia (values = means ± SD; n = 5; significant differences *P < 0.05).
[0013] FIGs.5A-5E. Local administration of MBV alleviates osteolysis and bone remodeling in mouse model of UHMWPE particulate-induced osteolysis. (FIG.5A) Experimental design and treatment regimen. (FIG.5B) Mice were sacrificed to harvest skull specimens at day 28. Representative morphology images of mice skull. Scale bars, 10 mm. (FIG.5C) Representative images of mice skull dorsal / ventral microCT imaging 3D reconstruction. Scale bars, 2mm. (FIG.5D) Representative images of coronal cross section of microCT scan of mouse skull. Scale bars, 2mm. (FIG.5E) Quantification of cortical8123-111501-02 porosity (Ct.Po) and bone volume versus tissue volume (BV / TV) of skull. (values = means ± SD; n = 5; significant differences *P < 0.05).
[0014] FIGs.6A-6F. MBV alleviates inflammatory and osteoclastic activities in UHMWPE particulate-induced osteolysis. (FIG.6A) Representative images of mice calvarial bone coronal paraffin sections (10× and 20×) hematoxylin and eosin (H&E) staining. Scale bars for 10× images, 500 µm. Scale bars for 20× images, 200 µm. (FIG.6B) Representative images of mice calvarial bone paraffin sections (20× and 40×) TRAP staining. Scale bars for 20× images, 200 µm. Scale bars for 40× images, 100 µm. (FIG.6C) Representative images of calvarial bone coronal paraffin sections (20× and 40×) TNF-α immunohistology (IHC) staining. Scale bars for 20× images, 100 µm. Scale bars for 40× images, 50 µm. (FIG.6D) Periosteal thickness of H&E staining images. Values are shown as mean ± SD (n=5); significant differences *P < 0.05. (FIG.6E) TRAP+ cells numbers per 20× images. Values are shown as mean ± SD (n=5); significant differences *P < 0.05. (FIG. 6F) TNF-α cells percentage per 20× images. Values are shown as mean ± SD (n=5); significant differences *P < 0.05.
[0015] FIG.7. Schematic illustration of the mechanism by which MBV reduce particulate-induced osteolysis. MBV were derived from a porcine urinary bladder extracellular matrix (UBM) bioscaffold. In vitro, MBV reduce monocyte / macrophage differentiation to osteoclast by suppressing the NF-κB pathway and its downstream NFATc1, DC-STAMP, c-Src, and Cathepsin K expression. In vivo, MBV alleviate UHMWPE particle- induced osteolysis in a murine calvarial osteolysis model.
[0016] FIG.8. Table of primers.
[0017] FIG.9. Osteoclasts tartrate-resistant acid phosphatase (TRAP) staining and Hematoxylin staining. Representative light microscope TRAP staining images (40×). Scale bars 200 µm.
[0018] FIG.10. Macrophage phenotype and relative M2:M1 ratio. ×20 and enlarged immunofluorescent images of the mice calvarial bone coronal paraffin sections for M1-like macrophages (DAPI+ / CD86+) in the left column and M2-like macrophages (DAPI+ / CD206+) in the right column. Scale bar = 50 µm. DETAILED DESCRIPTION
[0019] Matrix bound nanovesicles (MBV) are embedded within the fibrillar network of extracellular matrix (ECM). These nanoparticles shield their cargo from degradation and denaturation during the ECM-scaffold manufacturing process.8123-111501-02
[0020] Exosomes are vesicles that previously have been identified almost exclusively in body fluids and cell culture supernatant. It has been demonstrated that MBV and exosomes are distinct. MBV differ from other vesicles, for example, as they are resistant to detergent and / or enzymatic digestion, have a unique lipid profile, contain a cluster of different microRNAs. MBV do not have the same characteristic surface proteins found in other vesicles, such as exosomes (Turner et al., Tissue Engineering Part A 28 (21-22), 2022): 879- 892; Hussey et al., Science Advances 6(12), p.eaay4361, 2020).
[0021] As disclosed herein, MBV inhibit osteoclasts. Periprosthetic osteolysis results from the release of metallic and ultra-high molecular weight polyethylene (UHMWPE) wear debris ranging in size from nano- to micrometers (Kandahari et al., Bone Res 4, 16014 (2016)), resulting in an immune response that activates osteoclasts, which then initiate bone resorption. Thus, MBV can be used for treating periprosthetic osteolysis. MBVs are also of use for treating diseases associated with increased osteoclast activity, such as, but not limited to, osteoporosis and osteopenia. Terms
[0022] Unless otherwise noted, technical terms are used according to conventional usage. Definitions of many common terms in molecular biology may be found in Krebs et al. (eds.), Lewin’s genes XII, published by Jones & Bartlett Learning, 2017. As used herein, the singular forms “a,” “an,” and “the,” refer to both the singular as well as plural, unless the context indicates otherwise. For example, the term “a joint” includes single or plural joints and can be considered equivalent to the phrase “at least one joint.” As used herein, the term “comprises” means “includes.” Unless otherwise indicated “about” indicates within five percent of the stated value. It is further to be understood that any and all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for descriptive purposes, unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. To facilitate review of the various aspects, the following explanations of terms are provided:
[0023] Acid Protease: An enzyme that cleaves peptide bonds, wherein the enzyme has increased activity of cleaving peptide bonds in an acidic pH. For example and without limitation, acid proteases can include pepsin and trypsin.8123-111501-02
[0024] Administration: The introduction of a composition (such as MBV or a pharmaceutical preparation that includes MBV) into a subject by a chosen route. The route can be local or systemic. For example, if the chosen route is intravenous, the composition is administered by introducing the composition into a vein of the subject. If the chosen route is local, the composition can be administered by introducing the composition directly into a tissue of the subject.
[0025] Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term “mammal” includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects.
[0026] Arthroplasty: A surgical procedure to replace some (partial arthroplasty) or all of a joint (total arthroplasty). The worn or damaged parts of a joint are replaced with an artificial (prosthetic) joint made of, for example, metal, plastic or ceramic. A first time replacement of joint is referred to as a primary arthroplasty, whereas second and subsequent replacements are referred to as secondary arthroplasty or a revision.
[0027] Aseptic loosening: The failure of fixation of a prosthetic implant in the absence of infection due to biologic causes. Aseptic loosening occurs when particulate from the implant causes immune cell activation and chronic inflammation in the tissue around the implant which induces periprosthetic osteolysis (PPOL) and ultimately failure of the orthopedic implant.
[0028] Biocompatible: Any material, that, when implanted in a mammalian subject, does not provoke an adverse response in the subject. A biocompatible material, when introduced into an individual, is able to perform its intended function, and is not toxic or injurious to that individual, nor does it induce immunological rejection of the material in the subject.
[0029] Bone defect: Includes any disease, defect, or disorder which affects bone strength, function, and / or integrity, such as those resulting from injury, or a defect brought about during the course of surgery, infection, malignancy, or developmental malformation. Examples of bone defects include, but are not limited to, fractures (such as a critical defect or non-union fracture), dental or facial defects (such as cleft palate or facial, skull, or dental injuries or malformations). Other examples of bone defects include damage to bones resulting from diseases of bone fragility, such as osteoporosis, osteopenia, and malignancies and / or cancers of the bone such as a sarcoma, such as osteosarcoma.
[0030] Bone disease: Includes any disease or disorder which affects bone strength, function, and / or integrity, such as decreasing bone tensile strength and modulus. Examples of bone diseases include, but are not limited to, diseases of bone fragility, such as osteoporosis,8123-111501-02 osteopenia, and genetic diseases which result in abnormal bone formation such as McCune- Albright syndrome (MAS) and osteogenesis imperfecta. Other examples of bone diseases include malignancies and / or cancers of the bone such as a sarcoma, such as osteosarcoma. Other bone diseases include Paget’s disease of bone, fibrous dysplasia, osteomyelitis and osteopetrosis.
[0031] Bone Healing and Fracture Healing: Bone heals (fuses) in a unique way compared with other connective tissues. Rather than develop scar tissue, it has the ability to regenerate itself completely. The majority of fractures heal by secondary fracture healing and that involves a combination of intramembranous and endochondral ossification. Without being bound by theory, it is generally believed that the fracture healing sequence involves five discrete stages of healing. This includes an initial stage in which a hematoma is formed and inflammation occurs; a subsequent stage in which cartilage begins to form and angiogenesis proceeds, and then three successive stages of cartilage calcification, cartilage resorption and bone deposition, and ultimately a more chronic stage of bone remodeling. Generally, committed osteoprogenitor cells and uncommitted, undifferentiated mesenchymal stem cells contribute to the process of fracture healing. Bone that forms by intramembranous ossification is found early and further from the site of the fracture, results in the formation of a hard callus, and forms bone directly without first forming cartilage. Generally, two weeks after fracture, cell proliferation declines and hypertrophic chondrocytes become the dominant cell type in the chondroid callus. The resulting endochondral bone is formed adjacent to the fracture site.
[0032] Bone Resorption: The process by which osteoclasts break down tissue in bone and release minerals. Osteoclasts are generally present on the outer layer of bone, just beneath the periosteum. Attachment of the osteoclast to the osteon begins the process. The osteoclast then induces an in-folding of its cell membrane, forms an isolated acidified microenvironment between itself and the bone surface and secretes collagenase, cathepsin K and other enzymes important in the resorption process. High levels of calcium, magnesium, phosphate and products of collagen will be released into the extracellular fluid as the osteoclasts tunnel into the mineralized bone. “Increased bone resorption” when used herein refers to a level or rate of bone resorption that exceeds what is normal to maintain bone homeostasis. Increased bone resorption is indicative of a lack of bone homeostasis, e.g., where the level of bone resorption is not balanced with the level of bone formation such that bone resorption exceeds bone formation leading to bone loss. Increased bone resorption can be pathological, e.g., caused by a disease or disorder, or caused by e.g., periprosthetic8123-111501-02 osteolysis (PPOL). Increased bone resorption may be localized at a site in a subject, e.g., at the site of a prosthetic implant in bone, or it may be systemic, such as in pathological conditions characterized by increased bone resorption. A non-exhaustive list of diseases or disorders characterized by increased bone resorption (and therefore bone loss) include Paget’s disease of bone, osteoporosis, osteopenia, osteomyelitis, primary hyperparathyroidism, and bone changes secondary to cancer (metastatic bone disease), as well as PPOL.
[0033] Bisphosphonate: A class of drugs that works by slowing bone loss. Structurally, bisphosphonates are chemically stable derivatives of inorganic pyrophosphate (PPi), a naturally occurring compound in which 2 phosphate groups are linked by esterification. Bisphosphonates have a very high affinity for bone mineral because they bind to hydroxyapatite crystals. Accordingly, bisphosphonate skeletal retention depends on availability of hydroxyapatite binding sites. Bisphosphonates are preferentially incorporated into sites of active bone remodeling, as commonly occurs in conditions characterized by accelerated skeletal turnover. Bisphosphonates suppress bone resorption by attaching to hydroxyapatite binding sites on the bone surface and by decreasing lifespan of osteoclasts and / or preventing the association of osteoclast precursors with bone. Bisphosphonates are reviewed, for example, in Drake et al., Mayo Clin. Proc.83: 1032-1045, 2008. In some examples, a bisphosphonate is used in combination with the methods provided herein.
[0034] Centrifugation: The process whereby a centrifugal force is applied to a mixture, whereby more-dense components of the mixture migrate away from the axis of the centrifuge relative to other less-dense components in the mixture. The force that is applied to the mixture is a function of the speed of the centrifuge rotor, and the radius of the spin. In most applications, the force of the spin will result in a precipitate (a pellet) gathering at the bottom of the centrifuge tube, where the remaining solution is properly called a “supernate” or “supernatant.” In other similar applications, a density-based separation or “gradient centrifugation” technique is used to isolate a particular species from a mixture that contains components that are both more dense and less dense than the desired component. During the circular motion of a centrifuge rotor, the force that is applied is the product of the radius and the angular velocity of the spin, where the force is traditionally expressed as an acceleration relative to “g,” the standard acceleration due to gravity at the Earth’s surface. The centrifugal force that is applied is termed the “relative centrifugal force” (RCF), and is expressed in multiples of “g.”8123-111501-02
[0035] Comminute (comminution and comminuting): The process of reducing larger particles into smaller particles, including, without limitation, by grinding, blending, shredding, slicing, milling, or cutting. ECM can be comminuted while in any form, including, but not limited to, hydrated forms, frozen, air-dried, lyophilized, powdered, or sheet-form. “Comminuted ECM” includes intact collagen. Comminuted ECM has not been subjected to ultrasound or enzymatic digestion, e.g., with a protease, such as an acid protease.
[0036] Contacting: Placement in direct physical association, which can be in solid or liquid form. An osteoclast can be contacted with an effective amount of MBV in vitro or in vivo.
[0037] Control: A reference standard. In some aspects, the control is a negative control sample obtained from a healthy patient (such as one without bone disease), or a subject treated with a carrier, or untreated cells from a healthy patient. In other aspects, the control is a positive control sample obtained from a patient that has been treated with an active agent, such as an effective amount of MBV. In still other aspects, the control is a historical control or standard reference value or range of values (such as a previously tested control sample, such as a group of patients with known prognosis or outcome, or group of samples that represent baseline or normal values).
[0038] A difference between a test sample and a control can be an increase or conversely a decrease. The difference can be a qualitative difference or a quantitative difference, for example a statistically significant difference. In some examples, a difference is an increase or decrease, relative to a control, of at least about 5%, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or greater than 500%.
[0039] Cytokine: The term “cytokine” is used as a generic name for a diverse group of soluble proteins and peptides that act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment. Examples of cytokines include, but are not limited to, tumor necrosis factor-α, interleukin (IL)-6, IL-10, IL-12, transforming growth factor, and interferon-γ.
[0040] Diagnosis: The process of identifying a disease by its signs, symptoms and results of various tests. The conclusion reached through that process is also called “a diagnosis.”8123-111501-02 Forms of diagnostic testing commonly performed include, without limitation, blood tests, medical imaging, and biopsy.
[0041] Effective Amount: A quantity of a specific substance, such as an MBV, sufficient to achieve a desired effect in a subject being treated. When administered to a subject, a dosage will generally be used that will achieve target tissue concentrations (for example, in the bone) that has been shown to achieve a desired in vitro effect. For instance, this can be the amount necessary to affect osteoclast fusion, or to reduce disease.
[0042] Enriched: A process whereby a component of interest, such as a nanovesicle, that is in a mixture has an increased ratio of the amount of that component to the amount of other components in that mixture after the enriching process as compared to before the enriching process.
[0043] Extracellular matrix (ECM): A complex mixture of structural and functional biomolecules and / or biomacromolecules including, but not limited to, structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors that surround and support cells within tissues and, unless otherwise indicated, is acellular. ECM preparations can be considered to be “decellularized” or “acellular,” meaning the cells have been removed from the source tissue through processes described herein and known in the art. By “ECM-derived material,” such as an “ECM-derived nanovesicle,” “Matrix bound nanovesicle,” “MBV” or “nanovesicle derived from an ECM” it is meant a nanovesicle that is prepared from a natural ECM or from an in vitro source wherein the ECM is produced by cultured cells. “Intact Extracellular Matrix” and “intact ECM” refers to an extracellular matrix that retains activity of its structural and non-structural biomolecules, including, but not limited to, collagens, elastins, laminins, glycosaminoglycans, proteoglycans, antimicrobials, chemoattractants, cytokines, and growth factors, such as, without limitation, comminuted ECM as described herein. The activity of the biomolecules within the ECM can be removed chemically or mechanically, for example, by cross-linking and / or by dialyzing the ECM. Intact ECM essentially has not been cross-linked and / or dialyzed, meaning that the ECM has not been subjected to a dialysis and / or a cross-linking process, or conditions other than processes that occur naturally during storage and handling of ECM prior to solubilization in making an enzymatic ECM hydrogel. Thus, ECM that is substantially cross-linked and / or dialyzed (in anything but a trivial manner which does not substantially affect the gelation and functional characteristics of the ECM in its uses described herein) is not considered to be “intact”.8123-111501-02
[0044] Implant: A prosthetic device. Implants include dental prostheses as well as orthopedic prostheses, for example. An implant is made from an artificial substance and can include, for example, plates, posts, rods, plates, springs, artificial discs, cages, or screws. Implants may be composed of metal (e.g., tantalum, titanium, a titanium alloy such as Ti6Al4V, cobalt, chromium, a cobalt-chromium alloy such as cobalt-chromium- molybdenum, zirconium, or a zirconium alloy such as OXINIUMTM(oxidized zirconium and niobium alloy), ceramics (e.g, zirconia or alumina), or plastic (polyethylene such as ultrahigh molecular weight polyethylene) or combinations thereof.
[0045] Inhibiting or treating a disease or condition: Inhibiting a disease, such as, but not limited to, osteoporosis, oseteopenia, or osteopetrosis, or a condition such as periprosthetic osteolysis, refers to inhibiting the full development of a disease or condition. In several examples, inhibiting a disease refers to lessening symptoms of the particular disease or condition. “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition related to the disease. Treatment can be measured using success or indicia of success in the attenuation or amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement, remission, diminishing of symptoms or making the condition more tolerable to the patient, slowing in the rate of degeneration or decline, making the final point of degeneration less debilitating, improving a subject’s physical state. The treatment may be assessed by objective or subjective parameters; including the results of a physical examination or biological tests. In some aspects, mobility can be increased, and / or pain decreased.
[0046] Isolated: An “isolated” biological component (such as a nucleic acid, protein cell, or nanovesicle) has been substantially separated or purified away from other biological components in the cell of the organism or the ECM, in which the component naturally occurs. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. MBV that have been isolated are removed from the fibrous materials of the ECM. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
[0047] Isotonic Buffered Solution: A solution that is buffered to a pH between 7.0 to 8.0, e.g., 7.2 and 7.8, and that has a balanced concentration of salts to promote an isotonic environment.
[0048] Joint: An articulation (or articular surface) that is the connection made between bones, ossicles, or other hard structures in the body which link an animal's skeletal system8123-111501-02 into a functional unit. Joints are classified anatomically into the following groups: finger / hand joints, elbow joints, wrist joints, axillary joints, sternoclavicular joints, vertebral articulations, temporomandibular joints, sacroiliac joints, hip joints, knee joints, and articulations of foot. Joints are structurally classified as fibrous joints, cartilaginous joints, synovial joints, and facet joints.
[0049] Lysyl oxidase (Lox): A copper-dependent enzyme that catalyzes formation of aldehydes from lysine residues in collagen and elastin precursors. These aldehydes are highly reactive, and undergo spontaneous chemical reactions with other lysyl oxidase-derived aldehyde residues, or with unmodified lysine residues. In vivo, this results in cross-linking of collagen and elastin, which plays a role in stabilization of collagen fibrils and for the integrity and elasticity of mature elastin. Complex cross-links are formed in collagen (pyridinolines derived from three lysine residues) and in elastin (desmosines derived from four lysine residues) that differ in structure. The genes encoding Lox enzymes have been cloned from a variety of organisms (Hamalainen et al., Genomics 11:508, 1991; Trackman et al., Biochemistry 29:4863, 1990; incorporated herein by reference). Residues 153-417 and residues 201-417 of the sequence of human lysyl oxidase have been shown to be important for catalytic function. There are four Lox-like isoforms, called LoxL1, LoxL2, LoxL3 and LoxL4.
[0050] Macrophage: A type of white blood cell that phagocytoses and degrades cellular debris, foreign substances, microbes, and cancer cells. In addition to their role in phagocytosis, these cells play an important role in development, tissue maintenance and repair, and in both innate and adaptive immunity in that they recruit and influence other cells including immune cells such as lymphocytes. Macrophages can exist in many phenotypes, including phenotypes that have been referred to as M1 and M2. Macrophages that perform primarily pro-inflammatory functions are called M1 macrophages (CD86+ / CD68+), whereas macrophages that decrease inflammation and encourage and regulate tissue repair are called M2 macrophages (CD206+ / CD68+). The markers that identify the various phenotypes of macrophages vary among species. It should be noted that macrophage phenotype is represented by a spectrum that ranges between the extremes of M1 and M2. F4 / 80 (encoded by the adhesion G protein coupled receptor E1 (ADGRE1) gene) is a macrophage marker, see GENBANK® Accession No. NP_001243181.1, April 6, 2018, and NP_001965, March 5, 2018, both incorporated herein by reference. Without wishing to be bound by theory, it is believed that MBV have the ability to modulate the phenotype of macrophages, leading to an increase in M2-like, regulatory, or pro-remodeling macrophages. The effect of MBV on8123-111501-02 macrophages is further characterized in PCT Publication No. WO 2017 / 151862A1, incorporated herein by reference in its entirety. In some aspects, MBV of the present invention can be used to induce an M2 phenotype in macrophages and inhibit M1 macrophages in a subject.
[0051] Mammal: This term includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects.
[0052] Metastasis: A pathogenic agent's spread from an initial or primary site to a different or secondary site within the subject’s body. When tumor cells from an initial organ (the primary tumor) metastasize, the new tumor is called a secondary or metastatic tumor. Cells of the metastatic tumor are similar to those in the original or primary tumor. Thus, a metastatic tumor of bone is not caused by cells from the bone, but have originated from a primary tumor (from a different tissue).
[0053] MicroRNA: A small non-coding RNA that is about 17 to about 25 nucleotide bases in length, that post-transcriptionally regulates gene expression by typically repressing target mRNA translation. A microRNA (“miRNA” or “miR”) can function as negative regulators, such that greater amounts of a specific miRNA will correlates with lower levels of target gene expression. There are three forms of miRNAs, primary miRNAs (pri-miRNAs), premature miRNAs (pre-miRNAs), and mature miRNAs. Primary miRNAs (pri-miRNAs) are expressed as stem-loop structured transcripts of about a few hundred bases to over 1 kb. The pri-miRNA transcripts are cleaved in the nucleus by an RNase II endonuclease called Drosha that cleaves both strands of the stem near the base of the stem loop. Drosha cleaves the RNA duplex with staggered cuts, leaving a 5’ phosphate and 2 nucleotide overhang at the 3’ end. The cleavage product, the premature miRNA (pre-miRNA) is about 60 to about 110 nucleotides long with a hairpin structure formed in a fold-back manner. Pre-miRNA is transported from the nucleus to the cytoplasm by Ran-GTP and Exportin-5. Pre-miRNAs are processed further in the cytoplasm by another RNase II endonuclease called Dicer. Dicer recognizes the 5’ phosphate and 3’ overhang, and cleaves the loop off at the stem-loop junction to form miRNA duplexes. The miRNA duplex binds to the RNA-induced silencing complex (RISC), where the antisense strand is preferentially degraded and the sense strand mature miRNA directs RISC to its target site. It is the mature miRNA that is the biologically active form of the miRNA and is about 17 to about 25 nucleotides in length.
[0054] Modulate: To alter in a statistically significant manner. Modulation can be an increase or a decrease. One of skill in the art can identify an appropriate assay to determine a statistically significant increase or decrease in a parameter. These include, but are not limited8123-111501-02 to, a student’s t-test or a paired ratio t test. Exemplary methods are provided in the Examples section.
[0055] Nanovesicle: An extracellular vesicle that is a nanoparticle of about 10 to about 1,000 nm in diameter. Nanovesicles are lipid membrane bound particles that carry biologically active signaling molecules (e.g. microRNAs, proteins) among other molecules. Generally, the nanovesicle is limited by a lipid bilayer, and the biological molecules are enclosed and / or can be embedded in the bilayer. Thus, a nanovesicle includes a lumen surrounded by plasma membrane. The different types of vesicles can be distinguished based on diameter, subcellular origin, density, shape, sedimentation rate, lipid composition, protein markers, nucleic acid content and origin, such as from the extracellular matrix or secreted. A nanovesicle can be identified by its origin, such as a matrix bound nanovesicle from an ECM (see above), protein content and / or the miR content.
[0056] An “exosome” or “liquid phase extracellular vesicle (EV)” is a membranous vesicle which is secreted by a cell, and ranges in diameter from 10 to 150 nm. Generally, late endosomes or multivesicular bodies contain intralumenal vesicles which are formed by the inward budding and scission of vesicles from the limited endosomal membrane into these enclosed vesicles. These intralumenal vesicles are then released from the multivesicular body lumen into the extracellular environment, typically into a body fluid such as blood, cerebrospinal fluid or saliva, during exocytosis upon fusion with the plasma membrane. An exosome is created intracellularly when a segment of membrane invaginates and is endocytosed. The internalized segments which are broken into smaller vesicles and ultimately expelled from the cell contain proteins and RNA molecules such as mRNA and miRNA. Plasma-derived exosomes largely lack ribosomal RNA. Extra-cellular matrix derived exosomes include specific miRNA and protein components, and have been shown to be present in virtually every body fluid such as blood, urine, saliva, semen, and cerebrospinal fluid. Exosomes can express CD11c, CD63, CD81, and / or CD9, and thus can be CD11c+and / or CD63+and / or C81+and / or CD9+. Exosomes do not have high levels of lysyl oxidase on their surface.
[0057] A “matrix bound nanovesicle,” “MBV,” “nanovesicle derived from an ECM,” or an “ECM-derived nanovesicle” all refer to the same membrane bound particles, ranging in size from 10 nm-1000 nm, present in the extracellular matrix, which contain biologically active signaling molecules such as protein, lipids, nucleic acid, growth factors and cytokines that influence cell behavior. The terms are interchangeable, and refer to the same vesicles. These nanovesicles are embedded within, and bound to, the ECM and are not simply attached8123-111501-02 to the surface or circulating freely in body fluids. These nanovesicles are resistant to harsh isolation conditions, such as freeze-thawing and digestion with proteases such as pepsin, elastase, hyaluronidase, proteinase K, and collagenase, and digestion with detergents. MBV are distinct from other extracellular vesicles including exosomes and have a phospholipid composition distinct from exosomes. MBV are distinct from bone matrix vesicles which express alkaline phosphatase, as MBV do not express alkaline phosphatase, see PCT Application No. PCT / US2024 / 029787 and PCT Publications Nos. WO2021 / 211885, WO2023 / 250436, and WO2023 / 196970. In certain circumstances, MBV can also be distinguished from exosomes based on the absence of certain markers commonly attributed to exosomes.
[0058] In some aspects, MBV are characterized by one or more of the following features of protein expression or lipid content: MBV may not express one or more of CD63 and / or CD81 and / or CD9 or have low or barely detectable levels of CD63 and / or CD81 and / or CD9 (CD63loand / or CD81loand / or CD9lo)(see, e.g., Example 1) compared with other vesicles, such as exosomes. A variety of methods can be used to distinguish low, barely detectable, or absent expression of CD63 and / or CD81 and / or CD9 in MBV, for example, antibody-based methods, such as western blotting or flow cytometry (see, e.g., Bashashati and Brinkman, Adv Bioinformatics, 2009: 584603). In some aspects, MBV expression of CD63 and / or CD81 and / or CD9 is considered low or barely detectable compared with other vesicles where the expression of CD63 and / or CD81 and / or CD9 in MBV is at least one standard deviation or at least two standard deviations below the mean expression of other vesicles, such as exosomes; MBV have a phospholipid content wherein at least 55% of total phospholipids comprise phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; MBV have a phospholipid content wherein 10% or less of total phospholipids comprise sphingomyelin (SM); MBV have a phospholipid content wherein 20% or less of total phospholipids comprise phosphatidylethanolamine (PE); MBV have a phospholipid content wherein 15% or greater of the total phospholipid content comprises phosphatidylinositol (PI) with the percent representing the percent of lipid concentration.
[0059] In some aspects, MBV are characterized by all of the following features:8123-111501-02 do not express one or more of CD63 and / or CD81 and / or CD9 or have low or barely detectable levels of CD63 and / or CD81 and / or CD9 (CD63loand / or CD81loand / or CD9lo)( as further described above); a phospholipid content wherein at least 55% of total phospholipids comprise phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; a phospholipid content wherein 10% or less of total phospholipids comprise sphingomyelin (SM); a phospholipid content wherein 20% or less of total phospholipids comprise phosphatidylethanolamine (PE); and a phospholipid content wherein 15% or greater of the total phospholipid content is phosphatidylinositol (PI).
[0060] In some aspects, MBV are characterized by all of the following features: a phospholipid content wherein at least 55% of total phospholipids comprise phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; a phospholipid content wherein 10% or less of total phospholipids comprise sphingomyelin (SM); a phospholipid content wherein 20% or less of total phospholipids comprise phosphatidylethanolamine (PE); and a phospholipid content wherein 15% or greater of the total phospholipid content is phosphatidylinositol (PI).
[0061] In some aspects, MBV are characterized by one or more of the following features: a phospholipid content wherein at least 55% of total phospholipids comprise phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; a phospholipid content wherein 10% or less of total phospholipids comprise sphingomyelin (SM); a phospholipid content wherein 20% or less of total phospholipids comprise phosphatidylethanolamine (PE); and a phospholipid content wherein 15% or greater of the total phospholipid content is phosphatidylinositol (PI).
[0062] In some aspects, MBV are characterized by one or more of the following features: do not contain detectable levels of alkaline phosphatase; do not contain detectable levels of osteopontin; do not contain detectable levels of osteoprogeterin; do not contain detectable levels of complement C5; and / or8123-111501-02 do not contain detectable levels of c-reactive protein.
[0063] In some aspects, MBV contain IL33 and are IL33+.
[0064] The ECM from which MBV are isolated can be an ECM from a tissue, can be produced from cells in culture, or can be purchased from a commercial source.
[0065] Osteoblast: A mononucleate cell that is responsible for bone formation. Osteoblasts produce osteoid, which is composed mainly of Type I collagen. Osteoblasts are also responsible for mineralization of the osteoid matrix. Bone is a dynamic tissue that is constantly being reshaped by osteoblasts, which build bone, and osteoclasts, which resorb bone. Osteoblasts arise from osteoprogenitor cells located in the periosteum and the bone marrow. Osteoprogenitors are immature progenitor cells that express the master regulatory transcription factor Cbfa1 / Runx2. Once osteoprogenitors start to differentiate into osteoblasts, they begin to express a range of markers including osterix, collagen type 1, alkaline phosphatase, osteocalcin, osteopontin, and osteonectin.
[0066] Osteoclast: A type of bone cell that removes bone tissue by removing its mineralized matrix by the process of bone resorption and degradation of the organic phase of the osteoid. Osteoclasts are formed by the fusion of cells of the monocyte-macrophage cell line. Osteoclastogenesis is composed of several steps including progenitor survival, differentiation to mono-nuclear pre-osteoclasts, fusion to multi-nuclear mature osteoclasts. Classically, osteoclast fusion includes four basic steps: (1) attraction / migration, (2) recognition, (3) cell– cell adhesion, and (4) membrane fusion. Osteoclasts are characterized by high expression of tartrate resistant acid phosphatase and cathepsin K and the process of osteoclastogenesis is evaluated by the detection of specific osteoclastogenic transcription factors (e.g., Nuclear factor of activated T-cells, cytoplasmic 1). Single osteoclasts can contain between 3 and 100 nuclei, varying in diameter between 10 and 300 μM. In humans, mature osteoclasts typically have 4-8 nuclei / cell
[0067] Osteocyte: Mature, non-dividing bone cells that are housed in their own lacunae (small cavities in the bone). Osteocytes are derived from osteoblasts, and they represent the final stage of maturation of the bone cell lineage. They are less active than osteoblasts, and although they are not responsible for a net increase in bone matrix, they are essential to the maintenance, routine turnover of the matrix, and play a vital role in the production of osteoclasts. The narrow, cytoplasmic processes of osteocytes remain attached to each other and to osteoblasts through canaliculi (small channels in the bone).
[0068] Osteomyelitis: An infection of the bone. Symptoms may include pain in a specific bone with overlying redness, fever, and weakness. The cause is usually a bacterial infection8123-111501-02 but can be a fungal infection. Osteomyelitis is accompanied by increased formation and activity of bone-resorbing osteoclasts and bone loss.
[0069] Osteoporosis: A systemic skeletal disorder characterized by low bone mass, micro- architectural deterioration of bone tissue leading to bone fragility, and consequent increase in fracture risk. It is the most common reason for a broken bone among the elderly. The main consequence of osteoporosis is the increased risk of bone fractures. Osteoporotic fractures occur in situations where healthy people would not normally break a bone; they are therefore regarded as fragility fractures. Typical fragility fractures occur in the vertebral column, rib, hip and wrist. The World Health Organization (WHO defines osteoporosis as bone density 2.5 standard deviations below the bone density of a reference standard (i.e., generally a healthy young adult of about 30 years old). “Osteopenia” refers to a decrease in bone mineral density that is not as severe as osteoporosis, whether or not osteoporosis is present, as detected by a suitable diagnostic procedure, such as a radiographic technique. The WHO defines osteopenia as a bone density between 1 standard deviation and 2.5 standard deviations below the bone density of a reference standard as above.
[0070] Osteosarcoma: A cancerous tumor in a bone. Specifically, it is an aggressive malignant neoplasm that arises from primitive transformed cells of mesenchymal origin (and thus a sarcoma) and that exhibits osteoblastic differentiation and produces malignant osteoid. Osteosarcomas tend to occur at the sites of bone growth, presumably because proliferation makes osteoblastic cells in this region prone to acquire mutations that could lead to transformation of cells (the RB gene and p53 gene are commonly involved).
[0071] Paget’s Disease of Bone: A chronic bone disorder, that usually appears in the spine, pelvis, long bones of the limbs, and the skull, wherein there is excessive breakdown and regrowth of bone. Bones in these subjects are excessively eroded by the ectopic formation of osteoclasts that are too large and too numerous, causing bone to regrow too quickly. This results in bones that are bigger and softer than normal, often misshapen and easily fractured. These subjects can be treated with bisphosphonates and / or calcitonin, for example in combination with the methods provided herein. The initial stage of the disorder is characterized by increased bone resorption in a focal region, with an osteolytic lesion being a commonly detected abnormality upon radiological examination. The osteoclasts are larger than normal adult osteoclasts and show a higher number of nuclei. The excessive bone resorption is followed by an increase in bone formation, a stage characterized by increased number of normal appearing osteoblasts. The rapidly deposited bone, however, is structurally disorganized in appearance, being soft and porous in character, which accounts8123-111501-02 for the skeletal deformations and increased fracture risk. There are elevated levels of serum alkaline phosphatase and urinary excretions of hydroxyproline and pyridinoline, reflecting the increased rate of bone remodeling.
[0072] Periprosthetic Osteolysis (PPOL): The most common complication after primary arthroplasty whereby deterioration of bone at the site of arthroplasty (e.g., in and around the interface of the implant and the bone) occurs, which can lead to loosening and ultimately failure of the arthroplasty. Components of the implant, usually formed of plastic or metal, used in arthroplasty generate debris, or wear particles, caused by abrasion. These wear particles trigger recruitment of cells, including macrophages, fibroblasts, lymphocytes, and osteoclasts, leading to a localized inflammatory response, which causes the release of various cytokines that affect osteoclast differentiation and activity (e.g., TNF, RANKL, IL-6, IL-1, and IL-11). The prolonged duration of inflammatory activity promotes progressive osteolysis. Periprosthetic osteolysis is progressive and may be complicated by joint failure or periprosthetic fracture with the subsequent need for surgical revision. Thus, diagnostic imaging can be used for evaluating the extent and distribution of osteolysis. For example, radiographs can be used to characterize and monitor periprosthetic osteolysis. Geographic or linear zones of periprosthetic lucency greater than 2 mm that progress on serial examinations or develop after 2 years following arthroplasty are indicative of osteolysis. Computed tomograph (CT) can sometimes provide a more sensitive detection of images characteristic of osteolysis. For example, radiolucent lesions that communicate with the joint space and have well-defined sclerotic borders- are indicative of osteolysis. Magnetic resonance imaging (MRI) is also used to diagnose periprosthetic osteolysis. MRI provides higher sensitivity than CT in detection of small (less than 3 cm) periprosthetic lesions. MRI can also be used to identify extraosseous soft tissue deposits, pathology affecting neurovascular bundles, or precursors to bone resorption. Unlike infections, osteolysis presents as well-defined lesions with low signal intensity similar to skeletal muscle by MRI. (Desai, M. A. et al. Orthopedics 2008, 31(6).)
[0073] Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers of use are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the therapeutic agents (such as La protein, or an agent that modulates the function or activity of La protein) herein disclosed. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include8123-111501-02 pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (such as powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
[0074] Phospholipid: A class of lipids having a structure consisting of two hydrophobic fatty acid tails and a hydrophilic head consisting of a phosphate group. Major classes of phospholipids include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidylglycerol (PG), sphingomyelin (SM), cardiolipin (CL), phosphatidic acid (PA), and bis- monoacylglycerophosphate (BMP). Phospholipids can be measured in a variety of ways. For example, liquid chromatography–mass spectrometry (LC-MS) based global lipidomics and redox lipidomics can be used. In some aspects, specific phospholipid content is indicated as the percent concentration of the total phospholipids (such as total phospholipids in MBV), where the percent concentration is weight / weight (w / w).
[0075] Prophylactic: as used herein refers to a medication or a treatment designed and used to prevent a disease or disorder from occurring. As used herein, the terms “prophylactic” and “prevention” are used interchangeably.
[0076] Purified: The term “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified nucleic acid molecule preparation is one in which the nucleic referred to is more pure than the nucleic in its natural environment within a cell. For example, a preparation of a nucleic acid is purified such that the nucleic acid represents at least 50% of the total protein content of the preparation. Similarly, a purified MBV preparation is one in which the exosome is more pure than in an environment including cells, wherein there are microvesicles and exosomes. A purified population of nucleic acids or MBV is greater than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% pure, or free other nucleic acids or cellular components, respectively.
[0077] Prosthetic: An artificial (man-made) body part. Prosthetics include, but are not limited to, implants, artificial joints, pins, screws, plates, dental implants, posts, rods, plates, springs, artificial discs, cages, or screws.8123-111501-02
[0078] Receptor activator of nuclear factor kappa-Β ligand (RANKL): A protein encoded by the TNFSF11 gene in humans. RANKL binds to RANK on cells of the myeloid lineage and functions in osteoclast differentiation and activation. RANKL may also bind osteoprotegerin, a protein secreted mainly by cells of the osteoblast lineage which is a potent inhibitor of osteoclast formation by preventing binding of RANKL to RANK. RANKL also has a function in the immune system, where it is expressed by T helper cells and is thought to be involved in dendritic cell maturation. It is a dendritic cell survival factor and helps regulate T cell-dependent immune responses. T cell activation induces RANKL expression and can lead to an increase of osteoclastogenesis and bone loss. Exemplary amino acid and nucleic acid sequences for human RANKL can be found in GENBANK Accession No. NM_003701.4, February 16, 2021, incorporated herein by reference.
[0079] Subject: Living multi-cellular vertebrate organisms, a category that includes human and non-human mammals, such as non-human primates, rats, mice, dogs, cats, horses, cows and pigs. In an example, a subject is a human. In an additional example, a subject is selected that is in need of modulating osteoclast fusion. For example, the subject can need increased or decreased osteoclast fusion, or can need decreased bone resorption.
[0080] Tartrate-resistant acid phosphatase (TRAP): A phosphatase, also called acid phosphatase 5, tartrate resistant (ACP5), is a glycosylated monomeric metalloprotein enzyme. It has a molecular weight of approximately 35kDa, a basic isoelectric point (7.6–9.5), and optimal activity in acidic conditions. TRAP is synthesized as latent proenzyme and activated by proteolytic cleavage and reduction. In humans, TRAP is highly expressed by osteoclasts, activated macrophages, and neurons. TRAP is associated with osteoclast migration to bone resorption sites, and plays a role in osteoclast differentiation. Exemplary mRNA and protein sequences for TRAP are provided in GENBANK® Accession No. NM_001111034.3, February 10, 2024, incorporated herein by reference, and GENBANK® Accession No NM_001111035.3, February 12, 2024, incorporated herein by reference.
[0081] Total phospholipid content: “Total phospholipids” or “total phospholipid content”, as used herein, with respect to MBV, refers to the sum of all phospholipids present in a given quantity of isolated MBV, i.e., MBV isolated from the ECM. MBV can be isolated, for example, by enzymatic digestion of decellularized ECM and differential centrifugation. The total phospholipid content can be determined by methods such as LC-MS based global lipidomics and redox lipidomics. The total phospholipid content is measured by weight. A percentage of the total phospholipid content refers to a percent concentration on a weight / weight basis.8123-111501-02
[0082] Transplanting: The placement of a biocompatible substrate, such as an MBV, into a subject in need thereof.
[0083] Treating, Treatment, and Therapy: Any success or indicia of success in the attenuation or amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement, remission, diminishing of symptoms or making the condition more tolerable to the patient, slowing in the rate of degeneration or decline, making the final point of degeneration less debilitating, or improving a subject’s physical or mental well-being. The treatment may be assessed by objective or subjective parameters; including the results of a physical examination, neurological examination, or psychiatric evaluations. Overview
[0084] Methods are disclosed herein for inhibiting osteoclasts in a subject in need of osteoclast inhibition. These methods include administering to the subject a composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo, thereby inhibiting osteoclasts in the subject. In some aspects, the method includes the step of selecting a subject in need of osteoclast inhibition prior to administering to the subject the composition.
[0085] Methods are also disclosed for treating or preventing periprosthetic osteolysis at the site of a prosthetic implant in bone or cartilage in a subject. Such methods include administering to the subject a composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo. thereby treating or preventing periprosthetic osteolysis at the site of the prosthetic implant. In some aspects, the prosthetic implant is in bone, while in others, the implant is in cartilage. In other aspects, the method includes the step of selecting a subject having a prosthetic implant, e.g., a prosthetic implant that is at risk of periprosthetic osteolysis.
[0086] Methods are also disclosed for treating a disease or disorder that causes increased bone resorption in a subject. Such methods include administering to the subject a composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo. In specific, non-limiting examples, the disease or disorder is osteoporosis, while in others, the disease is osteopenia. In yet other examples, the disease or disorder is Paget’s disease of bone or metastatic bone disease. In some examples,8123-111501-02 the method includes a step of selecting a subject having a disease or disorder that causes increased bone resorption.
[0087] In some aspects, the matrix bound vesicles: (a) contain miR-145 and miR-181; (b) do not include alkaline phosphatase; and / or (c) do not include or have barely detectable levels of epithelial cell adhesion molecule (EpCAM), annexin (ANX)A5, tumor susceptibility gene (TSG)101, golgi matrix protein (GM)130, flotillin (FLOT)1, intracellular adhesion molecule (ICAM)1, and / or ALG-2-interacting protein (ALIX1). In additional aspects, the matrix bound vesicles include: (a) a phospholipid content comprising at least 55% phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; (b) a phospholipid content comprising 10% or less sphingomyelin (SM); (c) a phospholipid content comprising 20% or less phosphatidylethanolamine (PE); and / or (d) a phospholipid content comprising 15% or greater phosphatidylinositol (PI).
[0088] In additional aspects, the MBV are administered locally to a bone or joint of the subject. In other aspects, the MBV are administered locally to the site of an implant. In other aspects, the MBV are administered systemically to the subject. In further aspects, the MBV are administered to the subject in an amount of: a) 1x106to 1x1020MBV per kg of body weight per administration; b) 1x106to 1x1012MBV per kg of body weight per administration; or c) 1x109to 1x1014MBV per kg of body weight per administration. In some aspects, the MBV are administered to the subject by intravenous infusion, intradermal injection, or subcutaneous injection. In additional aspects, the MBV are administered to the subject weekly, monthly, every two months, every three months, or every six months.
[0089] In further aspects, the MBV are derived from mammalian extracellular matrix from urinary bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In particular aspects, the MBV are derived from bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS). In more aspects, the mammal is a pig, cow, or sheep.
[0090] In some aspects, the subject is human. In additional aspects, the method decreases osteoclast fusion and bone resorption in the subject. In more aspects, the subject has a prosthetic in bone or cartilage, and wherein the method treats or prevents prosthetic osteolysis in the subject. In further aspects, the subject has experienced bone loss at the site of the prosthetic and / or aseptic loosening of the prosthetic. In some aspects, the subject has experienced a total or partial arthroplasty of a joint, and the prosthetic is implanted to totally or partially replace the joint.8123-111501-02
[0091] In some aspects, the joint is a knee, hip, shoulder, elbow, wrist, ankle, finger, toe, or temporomandibular joint. In some aspects, the prosthetic is an artificial knee, artificial hip, artificial shoulder, artificial elbow, artificial wrist, artificial ankle, artificial finger joint, artificial toe joint, or artificial temporomandibular joint, respectively. In more aspects, the prosthetic is an artificial finger joint, and wherein the finger joint is a metacarpophalangeal joint (MCP), a proximal interphalangeal joint (PIP), a distal interphalangeal joint (DIP), or an interphalangeal joint (IP). In particular aspects, the prosthetic is an artificial toe joint, and wherein the toe joint is a metatarsophalangeal joint (MTP), a proximal interphalangeal joint (PIP), a distal phalangeal joint (DP), or an interphalangeal joint (IP). In other aspects, the subject has received a total hip arthroplasty and / or a total knee arthroplasty. In further aspects, the MBV are administered intraarticularly to the joint, or at an interface between the prosthetic and the bone. In some aspects, the prosthetic is implanted into the skull, jaw, neck (cervical spine), thoracic spine, lumbar spine, or coccyx. In more aspects, the prosthetic is a dental implant into the jaw. In some aspects, the prosthetic is implanted into a bone in the subject that is not at an articular joint. In further aspects, the prosthetic is implanted into a bone of the leg, arm, foot, hand, chest, or pelvis.
[0092] In some aspects, the prosthetic is a pin, post, rod, plate, spring, artificial disc, cage, or screw. In other aspects, the prosthetic is made of polyethylene, cobalt-chromium- molybdenum, titanium or titanium alloy, stainless steel, or ceramic. In further aspects, the polyethylene is ultra-high molecular weight polyethylene or cross-linked polyethylene. In more aspects, the ceramic is zirconia or alumina.
[0093] In some aspects, administration of the MBV reduces inflammation at the site of the implant. In additional aspects, the osteoclasts are tartrate-resistant acid phosphatase (TRAP)+ osteoclasts.
[0094] In some aspects, the subject has a disease that comprises increased bone resorption. In particular aspects, the disease is osteoporosis, osteopenia, Paget’s disease of bone, osteomyelitis or metastatic bone disease. In further aspects, the subject has or is at risk of osteoporosis or osteopenia and the method treats or prevents the onset of osteoporosis or osteopenia. In some aspects, the subject has osteoporosis, and wherein the method further comprises administering to the subject an effective amount of one or more of a bisphosphonate, an antibody that specifically binds Receptor activator of nuclear factor kappa-Β ligand (RANKL), or a teriparatide. In particular aspects, the antibody that specifically binds RANKL is denosumab.8123-111501-02
[0095] In some aspects, the subject has a bone fracture. In additional aspects, the subject has an osteosarcoma.
[0096] In further aspects, the MBV are administered in an amount of 1x101to about 1x1020MBV per kg of body weight per administration.
[0097] In more aspects, a composition is disclosed that includes an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo, for use in inhibiting osteoclasts in the subject, such as according to the methods disclosed herein.
[0098] In additional aspects, a composition is disclosed that includes an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo, for use in treating or preventing periprosthetic osteolysis at the site of a prosthetic implant in bone or cartilage, such as according to the methods disclosed herein.
[0099] In yet further aspects, a composition is disclosed that includes an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo, for use in treating a disease or disorder that causes increased bone resorption in a subject, such as according to the methods disclosed herein. Matrix Bound Nanovesicles (MBV) Derived from an Extracellular Matrix (ECM)
[0100] Nanovesicles derived from ECM (also called matrix bound nanovesicles, “MBV”) are generally described in PCT Publication Nos. WO 2017 / 151862, WO 2018 / 204848, WO 2019 / 213482, WO 2021 / 211885, WO 2023 / 196970, and WO 2023 / 250436, all incorporated herein by reference. It is disclosed that MBV are embedded in the extracellular matrix. These MBV can be isolated and are biologically active. MBV do not express CD63 and CD81 or are CD63loCD81loand do not contain alkaline phosphatase. The MBV can contain IL-33. These MBV can be used for therapeutic purposes. In some aspects, the MBV do not contain alkaline phosphatase, osteopontin, osteoprogeterin, complement C5, and / or c-reactive protein.
[0101] An extracellular matrix is a complex mixture of structural and functional biomolecules and / or biomacromolecules including, but not limited to, structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors that surround and support cells within mammalian tissues and, unless otherwise indicated, is acellular. Generally, the disclosed MBV are embedded in any type of extracellular matrix (ECM), and8123-111501-02 can be isolated from this location. Thus, MBV are not detachably present on the surface of the ECM, and are not exosomes (also known as extracellular vesicles or EV).
[0102] Extracellular matrices are disclosed, for example and without limitation, in U.S. Patent Nos.4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,414; 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273; 6,852,339; 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666; each of which is incorporated by reference in its entirety). However, an ECM can be produced from any tissue, or from any in vitro source wherein the ECM is produced by cultured cells and comprises one or more polymeric components (constituents) of native ECM. ECM preparations can be considered to be “decellularized” or “acellular”, meaning the cells have been removed from the source tissue or culture.
[0103] In some aspects, the ECM is isolated from a vertebrate animal, for example, from a mammalian vertebrate animal including, but not limited to, human, monkey, pig, cow, sheep, etc. Accordingly, MBV can be isolated from ECM derived from a human, monkey, pig, cow or sheep. The ECM may be derived from any organ or tissue, including without limitation, urinary bladder, intestine (such as small intestine or large intestine), heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. Accordingly, MBV can be isolated from ECM derived from any organ or tissue, including without limitation, urinary bladder, intestine (such as small intestine or large intestine), heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In specific non-limiting examples, the extracellular matrix is isolated from esophageal tissue, urinary bladder (such as urinary bladder matrix or urinary bladder submucosa), small intestinal submucosa, dermis, umbilical cord, pericardium, cardiac tissue, or skeletal muscle. Accordingly, MBV can be isolated from ECM derived from esophageal tissue. MBV can be isolated from ECM derived from urinary bladder (such as urinary bladder matrix or urinary bladder submucosa). MBV can be isolated from ECM derived from small intestinal submucosa. MBV can be isolated from ECM derived from dermis. MBV can be isolated from ECM derived from umbilical cord. MBV can be isolated from ECM derived from pericardium or cardiac tissue. MBV can be isolated from ECM derived from skeletal muscle. MBV can be isolated from ECM derived from liver. MBV can be isolated from ECM derived from kidney. The ECM can comprise any portion or tissue obtained from an organ, including, for example and without limitation, submucosa, epithelial basement8123-111501-02 membrane, tunica propria, etc. In one non-limiting aspect, the ECM is isolated from urinary bladder. Accordingly, MBV may be derived from urinary bladder ECM, such as urinary bladder matrix (UBM). MBV may be derived from small intestinal submucosa. MBV may be derived from esophageal ECM. MBV may derived from dermal ECM. MBV may be derived from muscle ECM. In some aspects, the ECM is from a human subject. In other aspects, the ECM is from a porcine subject. In some aspect, the ECM is not porcine ECM.
[0104] In other aspects, the MBV are derived from bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS). The ECM can be from any mammal, such as, but not limited to, a pig, cow, or sheep. For example, the MBV may be derived from ECM from the urinary bladder, e.g., UBM, of a pig, cow or sheep, e.g., a pig. For example, the MBV may be derived from ECM from the intestine, e.g., small intestine, of a pig, cow or sheep. For example, the MBV may be derived from ECM from the dermis or a pig, cow or sheep. For example, the MBV may be derived from the ECM from the esophagus of a pig, cow or sheep. For example, the MBV may be derived from the ECM from the kidney or liver of a pig, cow, or sheep.
[0105] The ECM may or may not include the basement membrane. In another non-limiting aspect, the ECM includes at least a portion of the basement membrane. The ECM material may or may not retain some of the cellular elements that comprised the original tissue such as capillary endothelial cells or fibrocytes. In some aspects, the ECM contains both a basement membrane surface and a non-basement membrane surface.
[0106] In some aspects, the ECM is harvested from porcine urinary bladders (also known as urinary bladder matrix or UBM). Briefly, the ECM is prepared by removing the urinary bladder tissue from a mammal, such as a pig, and trimming residual external connective tissues, including adipose tissue. All residual urine is removed by repeated washes with tap water. The tissue is delaminated by first soaking the tissue in a de-epithelializing solution, for example and without limitation, hypertonic saline (e.g., 1.0 N saline), for periods of time ranging from ten minutes to four hours. Exposure to hypertonic saline solution removes the epithelial cells from the underlying basement membrane. Optionally, a calcium chelating agent may be added to the saline solution. The tissue remaining after the initial delamination procedure includes the epithelial basement membrane and tissue layers abluminal to the epithelial basement membrane. The relatively fragile epithelial basement membrane is invariably damaged and removed by any mechanical abrasion on the luminal surface. This tissue is next subjected to further treatment to remove most of the abluminal tissues but maintain the epithelial basement membrane and the tunica propria. The outer serosal,8123-111501-02 adventitial, tunica muscularis mucosa, tunica submucosa and most of the muscularis mucosa are removed from the remaining deepithelialized tissue by mechanical abrasion or by a combination of enzymatic treatment (e.g., using trypsin or collagenase) followed by hydration, and abrasion. Mechanical removal of these tissues is accomplished by removal of mesenteric tissues with, for example and without limitation, Adson-Brown forceps and Metzenbaum scissors and wiping away the tunica muscularis and tunica submucosa using a longitudinal wiping motion with a scalpel handle or other rigid object wrapped in moistened gauze. Automated robotic procedures involving cutting blades, lasers and other methods of tissue separation are also contemplated. After these tissues are removed, the resulting ECM consists mainly of epithelial basement membrane and subjacent tunica propria.
[0107] In another aspect, the ECM is prepared by abrading porcine bladder tissue to remove the outer layers including both the tunica serosa and the tunica muscularis using a longitudinal wiping motion with a scalpel handle and moistened gauze. Following eversion of the tissue segment, the luminal portion of the tunica mucosa is delaminated from the underlying tissue using the same wiping motion. Care is taken to prevent perforation of the submucosa. After these tissues are removed, the resulting ECM consists mainly of the tunica submucosa (see FIG.2 of U.S. Patent No.9,277,999, which is incorporated herein by reference).
[0108] ECM can also be prepared as a powder. Such powder can be made according to the method of Gilbert et al., Biomaterials 26 (2005) 1431-1435, herein incorporated by reference in its entirety. For example, UBM sheets can be lyophilized and then chopped into small sheets for immersion in liquid nitrogen. The snap frozen material can then be comminuted so that particles are small enough to be placed in a rotary knife mill, where the ECM is powdered. Similarly, by precipitating NaCl within the ECM tissue the material will fracture into uniformly sized particles, which can be snap frozen, lyophilized, and powdered.
[0109] In one non-limiting aspect, the ECM is derived from small intestinal submucosa or SIS. Commercially available preparations include, but are not limited to, SURGISIS™, SURGISIS-ES™, STRATASIS™, and STRATASIS-ES™ (Cook Urological Inc.; Indianapolis, Ind.) and GRAFTPATCH™ (Organogenesis Inc.; Canton Mass.). In another non-limiting aspect, the ECM is derived from dermis. Commercially available preparations include, but are not limited to PELVICOL™ (sold as PERMACOL™ in Europe; Bard, Covington, Ga.), REPLIFORM™ (Microvasive; Boston, Mass.) and ALLODERM™ (LifeCell; Branchburg, N.J.). In another aspect, the ECM is derived from urinary bladder.8123-111501-02 Commercially available preparations include, but are not limited to UBM (ACell Corporation; Jessup, Md.).
[0110] MBV can be derived from (released from) an extracellular matrix using the methods disclosed below. For example, MBV may be obtained from extracellular matrix according to the methods disclosed in U.S. Patent Application Publication No.2019 / 0117837, the contents of which are incorporated by reference herein for all purposes. In some aspects, the ECM is digested with an enzyme, such as pepsin, collagenase, elastase, hyaluronidase, and / or proteinase K, and the MBV are isolated. In other aspects, the MBV are released and separated from the ECM by changing the pH with solutions such as glycine HCL, citric acid, ammonium hydroxide, use of chelating agents such as, but not limited to, EDTA, EGTA, by ionic strength and or chaotropic effects with the use of salts such as, but not limited to potassium chloride (KCl), sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, or by exposing ECM to denaturing conditions like guanidine HCl or Urea.
[0111] The MBV may be derived from extracellular matrix of urinary bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, and / or esophagus. In specific non- limiting examples, the MBV are derived from urinary bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS). In one aspect, the MBV are derived from dermis. In another aspect, the MBV are derived from UBM. In further aspects, the MBV are derived from extracellular matrix from a mammalian vertebrate selected from a human, monkey, pig, cow, or sheep. In specific non-limiting examples, the MBV are from a non-human mammal. In some aspects, the MBV are not derived from bone ECM. In some aspects, the MBV are not derived from heart (cardiac) ECM. In some aspects, the MBV are not derived from heart (cardiac) ECM or bone ECM. In particular aspects, the MBV are prepared following digestion of an ECM with an enzyme, such as pepsin, elastase, hyaluronidase, proteinase K, salt solutions, and / or collagenase, or combinations thereof. The ECM can be freeze-thawed, or subject to mechanical degradation.
[0112] In some aspects, expression of CD63, CD81, and / or CD9 cannot be detected on the MBV. Thus, in some aspects the MBV do not express CD63 and / or CD81 and / or CD9. In one specific example, CD63, CD81, and CD9 cannot be detected on the nanovesicles. In other aspects, the MBV have barely detectable levels of CD63, CD81, and CD9, such as that detectable by Western blot. These MBV are CD63loCD81loCD9lo. In other aspects, MBV do not express detectable levels of one or more of CD63, CD81, or CD9. In other aspects, MBV express barely detectable levels of one or more of CD63, CD81, or CD9. One of skill in the8123-111501-02 art can readily identify MBV that are CD63loand / or CD81loand / or CD9lo, using, for example, antibodies that specifically bind CD63, CD81, and CD9. A low level of these markers can be established using procedures such as fluorescent activated cell sorting (FACS) and fluorescently labeled antibodies to determine a threshold for low and high amounts of CD63, CD81, and CD9. In some examples, the disclosed MBV do not contain detectable alkaline phosphatase, osteopontin, osteoprogeterin, complement C5, and / or c-reactive protein. The disclosed MBV differ from nanovesicles, such as exosomes that may be transiently attached to the surface of the ECM due to their presence in biological fluids, as MBV in vivo are bound within the ECM and not found in biological fluids.
[0113] MBV have distinctive phospholipid content, for example, in comparison to exosomes. In some aspects, the total phospholipid content of the MBV is at least about 50%, 55%, 60%, 65%, 70%, 75%, 85%, or 90%, or about 50%-90%, 50%-65%, 50%-60%, 50%-70%, 60%- 70%, 60%-90%, or 70%-90% of phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination. In specific aspects, the total phospholipid content of the MBV is at least about 55% of phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination. In specific aspects, the total phospholipid content of the MBV is at least 60% of phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination. In some aspects, the phospholipid content of the MBV comprises a phosphatidylcholine (PC) to phosphatidyl inositol (PI) ratio of less than 8:1 (for example, less than 7:1, less than 6:1, less than 5:1, less than 4:1, less than 3:1, or less than 2:1). In some aspects, the phospholipid content of the MBV comprises a phosphatidylcholine (PC) to phosphatidyl inositol (PI) ratio in the range of 0.5-1:1, or in the range of 1:0.5-1, or in the range of 0.5-1:2, or in the range of 2:0.5-1, or in the range of 0.8- 1:1, or in the range of 1:0.8-1. In one aspect, the phospholipid content of the MBV comprises a phosphatidylcholine (PC) to phosphatidyl inositol (PI) ratio of about 1:1. In specific aspects, the phospholipid content of the MBV comprises a phosphatidylcholine (PC) to phosphatidyl inositol (PI) ratio of about 0.9:1.
[0114] In some aspects, the total phospholipid content of the MBV is about 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4% or less, or about 5%-10%, 5%-15%, 10%-15%, or 8%-12% of sphingomyelin (SM). In specific aspects, the total phospholipid content of the MBV is about 10% or less of sphingomyelin (SM). In some aspects, the total phospholipid content of the is about 15% or less of sphingomyelin (SM), 14% or less of sphingomyelin, 13% or less of sphingomyelin, about 12% or less of sphingomyelin, 11% or less of sphingomyelin, 10% or less of sphingomyelin, about 9% or less of sphingomyelin, 8% or less of sphingomyelin, 7%8123-111501-02 or less of sphingomyelin, about 6% or less of sphingomyelin, 5% or less of sphingomyelin, or 4% or less of sphingomyelin.
[0115] In some aspects, the total phospholipid content of the MBV is about 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% or less, or about 10%-20%, 15%-20%, 14%- 18%, or 12%-16% of phosphatidylethanolamine (PE). In specific aspects, the total phospholipid content of the MBV is 20% or less of phosphatidylethanolamine (PE).
[0116] In some aspects, the total phospholipid content of the MBV is about 5%, 10%, 12%, 15%, 18%, 20%, 25%, or 30% or greater, or about 5%-30%, 10%-20%, 10-25%, 15%-25%, or 12%-18% of phosphatidylinositol (PI). In specific aspects, MBV include a phospholipid content of about 15% or greater of phosphatidylinositol (PI).
[0117] In specific aspects, the total phospholipid content of the MBV comprises about 15% or more phosphatidylinositol, about 20% or less phosphatidylethanolamine, and about 10% or less sphingomyelin. In specific aspects, the total phospholipid content of the MBV is about 15% or more phosphatidylinositol and about 20% or less phosphatidylethanolamine. In specific aspects, the total phospholipid content of the MBV is about 15% or more phosphatidylinositol and about 10% or less sphingomyelin. In specific aspects, the total phospholipid content of the MBV comprises about 20% or less phosphatidylethanolamine and about 10% or less sphingomyelin. In specific aspects, the total phospholipid content of the MBV is more than about 15% phosphatidylinositol, about 20% or less phosphatidylethanolamine, about 10% or less sphingomyelin, and at least about 55% of phosphatidylinositol and phosphatidylcholine in combination. In one aspect, the total phospholipid content of the MBV is at least about 55% phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination and about 10% or less sphingomyelin (SM). In specific aspects, the total phospholipid content of the MBV is at least about 55% of phosphatidylinositol and phosphatidylcholine in combination and more than about 15% phosphatidylinositol. In specific aspects, the total phospholipid content of the MBV is about 55% of phosphatidylinositol and phosphatidylcholine in combination and about 20% or less phosphatidylethanolamine.
[0118] The MBV may also comprise lysyl oxidase (Lox). Generally, nanovesicles derived from the ECM have a higher Lox content than exosomes. Lox is expressed on the surface of MBV. Nano-LC MS / MS proteomic analysis can be used to detect Lox proteins. Quantification of Lox can be performed (see, e.g., Hill RC, et al., Mol Cell Proteomics. 2015;14(4):961-73, incorporated herein by reference in its entirety).
[0119] In some aspects, MBV are characterized by one or more of the following features:8123-111501-02 do not contain detectable levels of alkaline phosphatase; do not contain detectable levels of osteopontin; do not contain detectable levels of osteoprogeterin; do not contain detectable levels of complement C5; and / or do not contain detectable levels of c-reactive protein.
[0120] In some aspects, MBV are characterized by one or more of the following features: contain low or do not contain detectable levels of epithelial cell adhesion molecule (EpCAM), contain low or do not contain detectable levels of Annexin (ANX)A5, contain low or do not contain detectable levels of tumor susceptibility gene (TSG)101; contain low or do not contain detectable levels of flotillin (FLOT)1; contain low or do not contain detectable levels of intracellular adhesion molecule (ICAM1); contain low or do not contain detectable levels of glolgi matrix protein (GM)130; and / or contain low or do not contain detectable levels of ALG-2-interacting protein (ALIX).
[0121] In one aspect, MBV are characterized by low or undetectable levels of ANXA5, TSG101, and ICAM1.
[0122] In one aspect, MBV are characterized by low or undetectable levels of CD81, CD63, ANXA5, TSG101, and ICAM1.
[0123] In certain aspects, the MBV comprise one or more miRNA. In specific non-limiting examples, the MBV comprise one, two, or all three of miR-143, miR-145 and miR-181. MiR-143, miR-145 and miR-181 are known in the art.
[0124] The miR-145 nucleic acid sequence is provided in MiRbase Accession No. MI0000461, incorporated herein by reference. A miR-145 nucleic acid sequence is CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGG GGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU (SEQ ID NO: 1). An miR-181 nucleic acid sequence is provided in miRbase Accession No. MI0000269, incorporated herein by reference. A miR-181 nucleic acid sequence is: AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGU CGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGU CCUUA (SEQ ID NO: 2). The miR-143 nucleic acid sequence is provided in NCBI Accession No. NR_029684.1, March 30, 2018, incorporated herein by reference. A DNA8123-111501-02 encoding an miR-143 nucleic acid sequence is: GCGCAGCGCC CTGTCTCCCA GCCTGAGGTG CAGTGCTGCA TCTCTGGTCA GTTGGGAGTC TGAGATGAAG CACTGTAGCT CAGGAAGAGA GAAGTTGTTC TGCAGC (SEQ ID NO: 3).
[0125] Following administration, the MBV maintain expression of F4 / 80 (a macrophage marker) and CD-11b on macrophages in the subject. MBV treated macrophages are predominantly F4 / 80 + Fizz1 + indicating an M2 phenotype. The MBV disclosed herein can be formulated into pharmaceutical compositions for pharmaceutical delivery. Isolation of MBV from ECM
[0126] MBV can be produced from ECM that is produced by any cells of interest, or they be isolated from a commercial source of ECM, as described supra. The MBV can be produced from the same species as, or a different species than, the subject being treated. In some aspects, these methods include digesting the ECM with an enzyme to produce digested ECM. In specific aspects, the ECM is digested with one or more of pepsin, elastase, hyaluronidase, collagenase a metalloproteinase, and / or proteinase K, or combinations thereof. In a specific non-limiting example, the ECM is digested with only elastase and / or a metalloproteinase. In another non-limiting example, the ECM is not digested with collagenase and / or trypsin and / or proteinase K. In other aspects, the ECM is treated with a detergent. In further aspects, the method does not include the use of enzymes. In specific non-limiting examples, the method utilizes chaotropic agents or ionic strength to isolate MBV such as salts, such as potassium chloride. In additional aspects, the ECM can be manipulated to increase MBV content prior to isolation of MBV. Techniques for isolating MBV from ECM are described, for example, in U.S. Patent Application Publication No.2019 / 0117837, the contents of which are incorporated by reference herein for all purposes. Techniques for isolating MBV are also disclosed in Quijano et al., Tissue Eng Part C Methods.2020 Oct;26(10):528-540, also incorporated by reference herein.
[0127] In some aspects, the ECM is digested with an enzyme. The ECM can be digested with the enzyme for about 12 to about 48 hours, such as about 12 to about 36 hours. The ECM can be digested with the enzyme for about 12, about 24 about 36 or about 48 hours. In one specific non-limiting example, the ECM is digested with the enzyme at room temperature. However, the digestion can occur at about 4 ºC, or any temperature between about 4ºC and 25ºC. Generally, the ECM is digested with the enzyme for any length of time, and at any temperature, sufficient to remove collagen fibrils. The digestion process can be varied8123-111501-02 depending on the tissue source. Optionally, the ECM is processed by freezing and thawing, either before or after digestion with the enzyme. The ECM can be treated with detergents, including ionic and / or non-ionic detergents.
[0128] The digested ECM is then processed, such as by centrifugation, to isolate a fibril-free supernatant. In some aspects the digested ECM is centrifuged, for example, for a first step at about 300 to about 1000g. Thus, the digested ECM can be centrifuged at about 400g to about 750g, such as at about 400g, about 450g, about 500g or about 600g. This centrifugation can occur for about 10 to about 15 minutes, such as for about 10 to about 12 minutes, such as for about 10, about 11, about 12, about 14, about 14, or about 15 minutes. The supernatant including the digested ECM is collected.
[0129] In some aspects, the MBV comprise Lox. In some aspects, methods for isolating such MBV include digesting the extracellular matrix with elastase and / or metalloproteinase to produce digested extracellular matrix, centrifuging the digested extracellular matrix to remove collagen fibril remnants and thus to produce a fibril-free supernatant, centrifuging the fibril-free supernatant to isolate the solid materials, and suspending the solid materials in a carrier.
[0130] In some aspects, digested ECM also can be centrifuged for a second step at about 2000g to about 3000g. Thus, the digested ECM can be centrifuged at about 2,500g to about 3,000g, such as at about 2,000g, 2,500g, 2,750g or 3,000g. This centrifugation can occur for about 20 to about 30 minutes, such as for about 20 to about 25 minutes, such as for about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29 or about 30 minutes. The supernatant including the digested ECM is collected.
[0131] In additional aspects, the digested ECM can be centrifuged for a third step at about 10,000 to about 15,000g. Thus, the digested ECM can be centrifuged at about 10,000g to about 12,500g, such as at about 10,000g, 11,000g or 12,000g. This centrifugation can occur for about 25 to about 40 minutes, such as for about 25 to about 30 minutes, for example for about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39 or about 40 minutes. The supernatant including the digested ECM is collected. One, two or all three of these centrifugation steps can be independently utilized. In some aspects, all three centrifugation steps are utilized. The centrifugation steps can be repeated, such as 2, 3, 4, or 5 times. In one aspect, all three centrifugation steps are repeated three times.
[0132] In some aspects, the digested ECM is centrifuged at about 500g for about 10 minutes, centrifuged at about 2,500 g for about 20 minutes, and / or centrifuged at about 10,000g for8123-111501-02 about 30 minutes. These step(s), such as all three steps are repeated 2, 3, 4, or 5 times, such as three times. Thus, in one non-limiting example, the digested ECM is centrifuged at about 500g for about 10 minutes, centrifuged at about 2,500 g for about 20 minutes, and centrifuged at about 10,000g for about 30 minutes. These three steps are repeated three times. Thus, a fibril-free supernatant is produced. The fibril-free supernatant is then centrifuged to isolate the MBV. In some aspects, the fibril-free supernatant is centrifuged at about 100,000g to about 150,000g. Thus, the fibril-free supernatant is centrifuged at about 100,000g to about 125,000g, such as at about 100,000g, about 105,000g, about 110,000g, about 115,000g or about 120,000g. This centrifugation can occur for about 60 to about 90 minutes, such as about 70 to about 80 minutes, for example for about 60, about 65, about 70, about 75, about 80, about 85 or about 90 minutes. In one non-limiting example, the fiber-free supernatant is centrifuged at about 100,000g for about 70 minutes. The solid material is collected, which is the MBV. These MBV then can be re-suspended in any carrier of interest, such as, but not limited to, a buffer.
[0133] In further aspects the ECM is not digested with an enzyme. In these methods, ECM is suspended in an isotonic saline solution, such as phosphate buffered saline. Salt is then added to the suspension so that the final concentration of the salt is greater than about 0.1 M. The concentration can be, for example, up to about 3 M, for example, about 0.1 M salt to about 3 M, or about 0.1 M to about 2M. The salt can be, for example, about 0.1M, 0.15M, 0.2M, 0.3M, 0.4 M, 0.7 M, 0.6 M, 0.7 M, 0.8M., 0.9M, 1.0 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5M, 1.6 M, 1.7 M, 1.8M, 1.9 M, or 2M. In some non-limiting examples, the salt is potassium chloride, sodium chloride or magnesium chloride. In other aspects, the salt is sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, a sodium salt, a lithium salt, a cesium salt or a calcium salt.
[0134] In some aspects, the ECM is suspended in the salt solution for about 10 minutes to about 2 hours, such as about 15 minutes to about 1 hour, about 30 minutes to about 1 hour, or about 45 minutes to about 1 hour. The ECM can be suspended in the salt solution for about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115 or 120 minutes. The ECM can be suspended in the salt solution at temperatures from 4°C to about 50°C, such as, but not limited to about 4°C to about 25°C or about 4°C to about 37°C. In a specific non-limiting example, the ECM is suspended in the salt solution at about 4°C. In other specific non-limiting examples, the ECM is suspended in the salt solution at about 22ºC or about 25°C (room temperature). In further non-limiting examples, the ECM is suspended in the salt solution at about 37°C.8123-111501-02
[0135] In some aspects, the method includes incubating an extracellular matrix at a salt concentration of greater than about 0.4 M; centrifuging the digested extracellular matrix to remove collagen fibril remnants, and isolating the supernatant; centrifuging the supernatant to isolate the solid materials; and suspending the solid materials in a carrier, thereby isolating MBV from the extracellular matrix.
[0136] Following incubation in the salt solution, the ECM is centrifuged to remove collagen fibrils. In some aspects, digested ECM also can be centrifuged at about 2000g to about 5000g. Thus, the digested ECM can be centrifuged at about 2,500g to about 4,500g, such as at about 2,500g, about 3,000g, 3,500, about 4,000g, or about 4,500g. In one specific non- limiting example, the centrifugation is at about 3,500g. This centrifugation can occur for about 20 to about 40 minutes, such as for about 25 to about 35 minutes, such as for about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33 about 34 or about 35 minutes. The supernatant is then collected.
[0137] In additional aspects, the supernatant then can be centrifuged for a third step at about 100,000 to about 150,000g. Thus, the digested ECM can be centrifuged at about 100,000g to about 125,000g, such as at about 100,000g, 110,000g or 120,000g. This centrifugation can occur for about 30 minutes to about 2.5 hour, such as for about 1 hour to about 3 hours, for example for about 30 minutes, about 45 minutes, about 60 minutes, about 90 minutes, or about 120 minutes (2 hours). The solid materials are collected and suspended in a solution, such as buffered saline, thereby isolating the MBV.
[0138] In yet other aspects, the ECM is suspended in an isotonic buffered salt solution, such as, but not limited to, phosphate buffered saline. Centrifugation or other methods can be used to remove large particles (see below). Ultrafiltration is then utilized to isolate MBV from the ECM, particles between about 10 nm and about 10,000 nm, such as between about 10 and about 1,000 nm, such as between about 10 nm and about 300 nm.
[0139] In specific non-limiting examples, the isotonic buffered saline solution has a total salt concentration of about 0.164 mM, and a pH of about 7.2 to about 7.4. In some aspects, the isotonic buffered saline solution includes 0.002 M KCl to about 0.164 M KCL, such as about 0.0027 M KCl (the concentration of KCL in phosphate buffered saline). This suspension is then processed by ultracentrifugation.
[0140] Following incubation in the isotonic buffered salt solution, the ECM is centrifuged to remove collagen fibrils. In some aspects, digested ECM also can be centrifuged at about 2000g to about 5000g. Thus, the digested ECM can be centrifuged at about 2,500g to about8123-111501-02 4,500g, such as at about 2,500g, about 3,000g, 3,500, about 4,000g, or about 4,500g. In one specific non-limiting example, the centrifugation is at about 3,500g. This centrifugation can occur for about 20 to about 40 minutes, such as for about 25 to about 35 minutes, such as for about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33 about 34 or about 35 minutes.
[0141] Microfiltration and centrifugation can be used and combined to remove large molecular weight materials from the suspension. In one aspect, large size molecule materials, such as more than 200 nm are removed using microfiltration. In another aspect, large size materials are removed by the use of centrifugation. In a third aspect both microfiltration and ultracentrifugation are used to remove large molecular weight materials. Large molecular weight materials are removed from the suspended ECM, such as materials greater than about 10,000 nm, greater than about 1,000 nm, greater than about 500 nm, or greater than about 300 nm.
[0142] The effluent for microfiltration or the supernatant is then subjected to ultrafiltration. Thus, the effluent, which includes particle of less than about 10,000 nm, less than about 1,000 nm, less than about 500 nm, or less than about 300 nm is collected and utilized. This effluent is then subjected to ultrafiltration with a membrane with a molecular weight cutoff (MWCO) of 3,000 to 100,000. Methods of Treatment
[0143] Methods are disclosed for decreasing osteoclast activity in a subject. In non-limiting aspects, the osteoclasts are tartrate-resistant acid phosphatase (TRAP)+ osteoclasts. The method incudes administering to the subject an effective amount of MBV in the subject. In aspects, the effective amount of the MBV can decrease bone resorption in the subject. In some aspects, administration of the effective amount of the MBV reduces inflammation at the site of an implant. The method can include selecting a subject in need of osteoclast inhibition, such as, but not limited to, a subject with an implant or a subject with osteoporosis or osteopenia. The MBV can be derived from the same or a different species than the subject in need of treatment. In some aspects, the MBV can be autologous. In some aspects, the MBV are exogenous to the subject. In some aspects, the subject is a human subject.
[0144] Methods are also disclosed for treating or preventing periprosthetic osteolysis at the site of a prosthetic implant in bone or cartilage. The method includes administering to the subject an effective amount of MBV. The MBV can be exogenous to the subject. The MBV8123-111501-02 can be derived from mammalian extracellular matrix. In some aspects, the subject is a human subject.
[0145] Methods are also disclosed for treating a disease or disorder that causes increased bone resorption in a subject. Such methods include administering to the subject an effective amount of MBV. The MBV can be exogenous to the subject. The MBV can be derived from mammalian extracellular matrix. In some aspects, the subject is a human subject. In some aspects, the disease or disorder is osteoporosis, while in other aspects, the disease or disorder is osteopenia, while in yet other aspects, the disease or disorder is Paget’s disease of bone. In still other aspects, the disease or disorder is metastatic bone disease.
[0146] As disclosed in U.S. Published Patent Application No.2015 / 0352131 A1, there is a signaling mechanism for RANKL in osteoclasts. Binding of RANKL to its receptor RANK promotes receptor trimerization and its recruitment of members of TNF receptor-associated factors (TRAF) and Gab family adaptor proteins (Wada T, et al. (2005) Nat Med 11(4):394-9; Taguchi Y, et al. (2009) Genes to Cells 14(11):1331-1345); these interactions are required for the subsequent activation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) and c-Jun N-terminal kinase (JNK) pathways and expression of c-Fos (Grigoriadis A E, et al. (1994) Science 266(5184):443-8) and nuclear factor of activated T cells (NFATc1) (Takayanagi H, et al. (2002) Dev Cell 3(6):889-901), a calcineurin- and calcium-regulated transcription factor reported as important in the regulation of osteoclastogenesis. It is disclosed herein that MBV mitigate RANKL-induced osteoclast formation. In aspects, the present methods treat disorders associated with RANKL-induced osteoclast formation, such as, but not limited to, periprosthetic osteolysis, osteoporosis and osteopenia. In some aspects, the disclosed methods inhibit TRAP+ osteoclasts and / or reduce inflammation. Also disclosed herein are methods of inhibiting these osteoclasts in a subject with periprosthetic osteolysis.
[0147] In some aspects, the method reduces resorption of a bony tissue in the subject. For example, the inhibitor reduces resorption of a bony tissue in a subject, e.g., by at least 1.5- fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 10-fold, 15-fold, 20-fold, 50-fold, 100-fold, or more compared to the extent of resorption of a subject that has not been administered the MBV. In other examples, the inhibitor reduces resorption of a bony tissue at a site of a subject, e.g., by at least 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 10-fold, 15-fold, 20- fold, 50-fold, 100-fold, or more compared to the extent of resorption of a bony tissue at a different site of the same subject. A bony tissue is a type of tissue that is formed by osteoblasts, which deposit calcium, phosphate, and magnesium, along with collagen, to form8123-111501-02 a crystalline bone mineral. The bony tissue can be a joint, but in some aspects the bony tissue is not in a joint.
[0148] In some aspects, the method reduces resorption of a bony tissue at a site of an implant, in the subject. For example, the inhibitor reduces resorption of a bony tissue in a subject, e.g., by at least 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 10-fold, 15-fold, 20-fold, 50-fold, 100-fold, or more compared to the extent of resorption of a subject that has not been administered the MBV. In other examples, the inhibitor reduces resorption of a bony tissue at a site of an implant in a subject, e.g., by at least 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6- fold, 10-fold, 15-fold, 20-fold, 50-fold, 100-fold, or more compared to the extent of resorption of a bony tissue at a different site of the same subject.
[0149] Methods are disclosed herein for treating periprosthetic osteolysis. These methods include administering an effective amount of MBV to a subject with periprosthetic osteolysis, or at risk for periprosthetic osteolysis. In some aspects, the subject has experienced bone loss at the site of the prosthetic and / or aseptic loosening of the prosthetic. In some aspects, the subject has a joint replacement, wherein the joint replacement has loosened. Loosening can be due to infection or aseptic.
[0150] The periprosthetic osteolysis (PPOL) can be occurring at any joint that has received an implant. These joints include hand joints (fingers, thumb), elbow joints, wrist joints, axillary joints, sternoclavicular joints, vertebral articulations, temporomandibular joints, sacroiliac joints, hip joints, knee joints, and articulations of foot (e.g., ankles, toes). The joint can be a fibrous joints, cartilaginous joints, synovial joints, or facet joints.
[0151] The periprosthetic osteolysis (PPOL) can be occurring at a site that has received an implant that is not a joint. For example, when an implant is position in bone due to a break or crush of the bone or other bone void in a location that is not at a joint, PPOL may occur at that site. For example, PPOL may occur at the site of a plate, pin, screw, or the like that has been implanted in a bone. For example, the site may be in a bone of the leg, arm, skull, spine, hip, rib, hand, foot, ankle, or wrist.
[0152] In aspects, the subject has experienced a total arthroplasty of a joint. In further aspects, the subject has a partial arthroplasty of a joint. In these aspects, the prosthetic is implanted to totally or partially replace the joint. The partial or total arthroplasty of the joint may be of a joint in the finger or hand, the elbow, the wrist, the axilla (shoulder or acromioclavicular joint), a sternoclavicular joint, a facet joint of the spine, neck joint, temporomandibular joint, a sacroiliac joint, a hip joint, a knee joint, and / or articulations of foot (ankle joint, toe joints). For example, the PPOL may be occurring in the knee at the site8123-111501-02 of total or partial arthroplasty, e.g., a “knee replacement.” For example, the PPOL may be occurring in the hip at the site of a total or partial arthroplasty, e.g., a “hip replacement.”
[0153] A subject can be selected for treatment with an effective amount of MBV that has a joint replacement. The joint can be any joint of interest, including, but not limited to, a knee, hip, shoulder, elbow, wrist, ankle, finger, toe, or temporomandibular joint. The prosthetic can be an artificial knee, artificial hip, artificial shoulder, artificial elbow, artificial wrist, artificial ankle, artificial finger joint, artificial toe joint, or artificial temporomandibular joint, respectively. In certain aspects, the prosthetic is an artificial finger joint. The finger joint can be a metacarpophalangeal joint (MCP), a proximal interphalangeal joint (PIP), a distal interphalangeal joint (DIP), or an interphalangeal joint (IP). In other aspects, the prosthetic is an artificial toe joint, and the toe joint can be a metatarsophalangeal joint (MCP), a proximal interphalangeal joint (PIP), a distal phalangeal joint (DP), or an interphalangeal joint (IP). In specific non-limiting examples, the joint is a hip or a knee, and the subject has received a total hip arthroplasty (THA) and / or a total knee arthroplasty (TKA). The disclosed methods can decrease periprosthetic osteolysis of a prosthetic that is an artificial joint.
[0154] The disclosed methods can decrease periprosthetic osteolysis of a dental implant. Dental implants may include implants into the mandible or maxilla to support crowns or other prosthetic dental structures or other implants that support the teeth. Pins and plates may be inserted to strengthen a bone or joint after an injury, such as a fracture. For example, a dental implant is a replacement tooth root, e.g., that connects directly to a jaw bone. In some examples, a dental implant is an endosteal (in the bone) implant or a subperiosteal (on the bone) implant. Exemplary dental implants include screws, cylinders or blades surgically placed into the jawbone. In some aspects, each implant holds at least one tooth (e.g., prosthetic tooth). Subperiosteal implants are placed on top of the jaw, and the implant framework contains posts that protrude through the gum of the subject in order to secure the implant. The inhibition of osteoclasts by MBV can also be of use in inhibiting osteoclasts for the treatment of periprosthetic osteolysis of osteointegrated implants, e.g. teeth, digits, facial prosthesis and implanted hearing devices.
[0155] The inhibition of osteoclasts by MBV can also of use in inhibiting osteoclasts for the treatment of periprosthetic osteolysis of other types of orthopedic implants. Exemplary orthopedic implants are bone screws, orthopedic pins, mechanical devices for the fixation and stabilization of an orthopedic fracture, bone cement, elbow replacements, synthetic joints, synthetic cartilage, synthetic spin discs, bone plates, orthopedic nails, orthopedic rods,8123-111501-02 orthopedic rectangles, compression plates, shoulder replacements, bone wires, and prostheses.
[0156] The inhibition of osteoclasts by MBV can also of use in inhibiting osteoclasts for the treatment of periprosthetic osteolysis resulting from disintegration of metal, ceramic, or plastic implants. For example, the implant (e.g., orthopedic or dental) comprises a metal (e.g., tantalum, titanium, a titanium alloy such as Ti6Al4V, cobalt, chromium, a cobalt- chromium alloy, zirconium, or a zirconium alloy such as oxinium oxidized zirconium), a ceramic, hydroxyapatite, and / or polyethylene. In certain aspects, the prosthetic is made of polyethylene, cobalt-chromium-molybdenum, titanium or titanium alloy, stainless steel, or ceramic. In non-limiting examples, the polyethylene is ultra-high molecular weight polyethylene or cross-linked polyethylene. In more non-limiting examples, the ceramic is zirconia or alumina. An effective amount of MBV can be used to treat periprosthetic osteolysis resulting from any of these implants.
[0157] The inhibition of osteoclasts by MBV can also be of use in inhibiting osteoclasts for the treatment of periprosthetic osteolysis resulting from a prosthetic implanted into a bone in a subject that is not an articular joint. The prosthetic can be implanted into any bone, including, but not limited to, the skull, jaw, neck (cervical spine), thoracic spine, lumbar spine, or coccyx. The prosthetic can be implanted into a bone of the leg, arm, foot, hand, chest, or pelvis. The prosthetic can be, for example, a pin, post, rod, plate, spring, artificial disc, cage, or screw. These subjects can be selected for treatment, and an effective amount of MBV can be used to treat periprosthetic osteolysis resulting from any of these implants.
[0158] The use of MBV results in inhibition of osteoclasts. A therapeutic effect experienced by the subject may be (i) a reduction in the severity of the symptoms for the period of time as compared to the severity of the symptoms prior to the treatment course, (ii) remission of the periprosthetic osteolysis or its symptoms for the period of time, (iii) prevention of flare up or relapse of the periprosthetic osteolysis during the period of time, (iv) reduction in the severity of symptoms experienced during a flare-up or relapse during the period of time compared to the severity of symptoms experienced prior to the treatment course, (v) reduction in the frequency of relapse or flare-up during the period of time as compared to frequency of relapse or flare up prior to the treatment course, or (vi) absence of signs of progression of the periprosthetic osteolysis during the period of time after completing the treatment course. For any given subject, a reduction or improvement in the severity of symptoms or remission of the disorder can be measured according to relevant clinical indicia and relevant clinical objective standards, for example, a scoring system for joint mobility or immune reactivity.8123-111501-02 For example, a patient may experience a reduction in a clinical during the time period indicative of improvement of the disorder as a result of the treatment course with MBV as compared to the score prior to the treatment course.
[0159] Diagnostic imaging can be used for evaluating the extent and distribution of osteolysis at a site of an implant or of aseptic loosening of the implant. For example, radiographs can be used to characterize and monitor periprosthetic osteolysis. Geographic or linear zones of periprosthetic lucency greater than 2 mm that progress on serial examinations or develop after 2 years following arthroplasty are indicative of osteolysis. Computed tomograph (CT) may provide a more sensitive detection of images characteristic of osteolysis. For example, radiolucent lesions that communicate with the joint space and have well-defined sclerotic borders- are indicative of osteolysis. Magnetic resonance imaging (MRI) is also used to diagnose periprosthetic osteolysis. MRI provides higher sensitivity than CT in detection of small (less than 3 cm) periprosthetic lesions. MRI can also be used to identify extraosseous soft tissue deposits, pathology affecting neurovascular bundles, or precursors to bone resorption. Unlike infections, osteolysis presents as well-defined lesions with low signal intensity similar to skeletal muscle by MRI. (Desai, M. A. et al. Orthopedics 2008, 31(6).) These methods can be used to assess the efficacy of treatment.
[0160] In further aspects, methods are provided for treating a subject has a disease that comprises increased bone resorption. These methods decrease bone resorption and can be used for the treatment of disorders wherein increased bone resorption is observed in the subject. In some aspects, the subject has osteoporosis, Paget’s disease of bone, osteomyelitis, sarcoma or metastatic bone disease. In one non-limiting example, the subject has osteoporosis. In another non-limiting example, the subject has osteomyelitis. In a further non-limiting example, the subject has Paget’s disease of bone. In yet a further non-limiting example, the subject has osteopenia. An effective amount of MBV can be used for the treatment of a condition characterized by low bone density. The condition can be disuse osteopenia, arterial calcification, or osteolysis associated with tumor metastasis, bone cancer pain.
[0161] In some aspects, the subject has osteoporosis. Osteoporosis is a systemic skeletal disease that is characterized by low bone density and deterioration of bone tissue, leading to an increase in fragile bones and susceptibility to fracture. Osteoporosis manifests as a fracture of a vertebra or backbone, hip, forearm, or any bony site where sufficient bone mass is lost. These fractures often occur after apparently mild stress, such as bending over, falling, lifting, or jumping from a standing position. In later stages of the disease, disfigurement,8123-111501-02 pain, and debilitation commonly occur. Subjects at risk for osteoporosis include subjects with risk factors, such as women age 65 or older (e.g., age 65, 70, 75, 80, 85, 90, or older), men age 70 or older (e.g., age 70, 75, 80, 85, 90, or older), postmenopausal women age 65 or younger (e.g., age 65, 60, 55, 45, 40, 35, 30, or younger) with one or more risk factors for osteoporosis, men ages 50-70 (e.g., age 50, 55, 60, 65, or 70) with one or more risk factors for osteoporosis, and men or women age 50 or older (e.g., age 50, 55, 60, 65, 70, 75, 80, 85, 90, or older) who have suffered a fracture. Risk factors for osteoporosis include long-term use of medications associated with low bone mass or bone loss (e.g., corticosteroids, anti- seizure medications, Depo-Provera, thyroid hormone, and aromatase inhibitors), especially long-term use of corticosteroids (i.e., more than 5 mg / day for more than 3 months), a history of prostate cancer or breast cancer treatment, a history of diabetes, reduced calcium absorption in the gut, prior gastric surgery, caffeine intake, cigarette smoking, family history of fracture or fragility, physical inactivity, estrogen or thiazide use, alcohol consumption, calcium, vitamin K, or vitamin D deficiency, thyroid imbalances, estrogen or testosterone deficiencies, early menopause, anorexia nervosa, rheumatoid arthritis, significant loss of height, and significant weight loss or low body mass index. (Prevention and Management of Osteoporosis. WHO Technical Report Series, 921.2003). Any of these subjects can be selected for treatment according to the presently disclosed methods.
[0162] Diagnosis of osteoporosis (or osteopenia) is made by using a number of techniques to measure bone mass or bone density, including but not limited to single X-ray absorptiometry (SXA), dual-energy x-ray absorptiometry (DXA), ultrasound, quantitative computed tomography (QCT) scan, radiography, and MRI. Bone density measurements are generally provided as Z and T scores compared to the average bone density of the young healthy population. A T score provides the standard deviation of a subject relative to the normal value in young adults. A Z score provides the standard deviation of a subject relative to the normal value in the subject's own body size and age group. A T score greater than or equal to −1 (i.e., a value of bone mineral density within 1 standard deviation of the adult reference mean) indicates normal bone density. A T score between −2.5 and −1 (i.e., a value of bone mineral density more than 1 standard deviation below but less than 2 standard deviations below the young adult mean) indicates low bone mass, or osteopenia. A T-score lower than or equal to −2.5 (i.e., a value of bone mineral density 2.5 standard deviations or more below the young adult mean) indicates osteoporosis. A bone mineral density 2.5 or more standard deviations below the young adult mean in the presence of one or more fragility fractures indicates severe osteoporosis. Osteopenia is generally considered a precursor to osteoporosis. (Prevention and8123-111501-02 Management of Osteoporosis. WHO Technical Report Series, 921.2003). These methods can be used to select a subject for treatment with the presently disclosed methods.
[0163] The subject can have a bone defect or fracture. These subjects can be selected for treatment according to the methods disclosed herein. Exemplary assays to determine when the treatment has promoted healing of the bone defect include radiographic methods (Lehmann et al., Bone 35: 1247-1255, 2004; Rundle et al., Bone 32: 591-601, 2003; Nakamura et al., J. Bone Miner. Res.13: 942-949, 1998); microcomputed tomography (µCT) methods (Nakamura et al., J. Bone Miner. Res.13: 942-949, 1998; Lehmann et al., Bone 35: 1247-1255, 2004; Tamasi et al., J. Bone Miner. Res.18: 1605-1611, 2003; Shefelbine et al., Bone 36:480-488, 2005); peripheral quantitative computed tomographic methods (Rundle et al., Bone 32: 591-601, 2003; Tamasi et al., J. Bone Miner. Res.18: 1605-1611, 2003); dual energy X-ray absorptiometry methods (Holzer et al., Clin. Orthop. Rel. Res.366: 258-263, 1999; Nakamura et al., J. Bone Miner. Res.13: 42-949, 1998); histomorphometry methods (Lehmann et al., Bone 35: 247-1255, 2004; Tamasi et al., J. Bone Miner. Res.18:1605-1611, 2003; Li et al., J. Bone Miner. Res.17: 791-799, 2002; Schmidmaier et al., Bone 30: 816-822; 2002; Nakamura et al., J. Bone Miner. Res.13:942-949, 1998; Sheng et al., Bone 30: 486- 491, 2002); Masson’s trichrome stain for collagen (Rundle et al., Bone 32: 591-601, 2003); Goldner’s stain for collagen (Holzer et al., Clin. Orthop. Rel. Res.366: 258-263; 1999); Von Kossa’s silver stain for bone (Schmidmaier et al., Bone 30: 816-822, 2002); Safranin Orange stain for collagen (Schmidmaier et al., Bone 30: 816-822, 2002); and immunohistochemistry methods (Rundle et al., Bone 32: 591-601, 2003; Li et al., J. Bone Miner. Res.17: 791-799, 2002; Safadi et al., J. Cell Physiol.196: 51-62, 2003; Iwaki et al., J. Bone Miner. Res.12: 96- 102, 1997).
[0164] Treatment of the bone defect does not require a process of complete healing or a treatment which is 100% effective at restoring a defect to its pre-defect state. Successful treatment of a bone defect includes partial repair or healing, for example filling of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the bone defect with new bone material.
[0165] Methods are provided to promote fracture healing. The fracture can be in any bone, including but not limited to cranial bones such as the frontal bone, parietal bone, temporal bone, occipital bone, sphenoid bone, ethmoid bone; facial bones such as the zygomatic bone, superior and inferior maxilla, nasal bone, mandible, palatine bone, lacrimal bone, vomer bone, the inferior nasal conchae; the bones of the ear, such as the malleus, incus, stapes; the hyoid bone; the bones of the shoulder, such as the clavicle or scapula; the bones of the thorax,8123-111501-02 such as the sternum or the ribs; the bones of the spinal column including the cervical vertebrae, lumbar vertebrae, and thoracic vertebrae; the bones of the arm, including the humerus, ulna and radius; the bones of the hands, including the scaphoid, lunate, triquetrum bone, pisiform bone, trapezium bone, trapezoid bone, capitate bone, and hamate bone; the bones of the palm such as the metacarpal bones; the bones of the fingers such as the proximal, intermediate and distal phalanges the bones of the pelvis such as the ilium, sacrum and coccyx; the bones of the legs, such as the femur, tibia, patella, and fibula; the bones of the feet, such as the calcaneus, talus, navicular bone, medial cuneiform bone, intermediate cuneiform bone, lateral cuneiform bone, cuboidal bone, metatarsal bone, proximal phalanges, intermediate phalanges and the distal phalanges; and the pelvic bones.
[0166] The disclosed methods including administering to the subject a composition comprising an effective amount of MBV. The methods can deliver an effective amount of MBV locally to a target tissue (e.g., a specific bone, cartilage, joint, prosthesis, implant, or tissue in proximity to a prosthesis or implant). Alternatively, an effective amount of the MBV is delivered systemically (e.g., oral, intravenous, intramuscular, subcutaneous). In aspects, the effective amount of MBV are administered by intravenous infusion. In other aspects, the effective amount of MBV are administered by intradermal injection. In still other aspects, the effective amount of MBV are administered by subcutaneous injection. In other aspects, an effective amount of MBV is administered locally, such as to the area of an implant in a subject with periprosthetic osteolysis or to the site of a fracture.
[0167] For administration to a joint, or the site of an implant, administration of the composition can be performed by procedures including but not limited to injection, endoscopic delivery, minimally invasive surgery, arthroscopy, infusion, or surgical implantation. For administration to a fracture, the administration can be performed, without limiting, by injection or infusion, or during a surgical procedure, such as when the bone is set.
[0168] The administration can be systemic. Routes of administration of use also include intraarticular, oral, pulmonary, rectal, parenteral, intradermal, transdermal, topical, transmucosal, subcutaneous, intravenous, intramuscular, intraperitoneal, intratympanic, inhalational, buccal, sublingual, intrapleural, intracerebroventricular (ICV), intrathecal, intranasal, and the like. Intravenous administration is used in some aspects. In other aspects, administration by subcutaneous injection is used.
[0169] In some aspects, the subject experiences a therapeutic effect from a treatment course of MBV. In aspects, treatment can occur over a period of time. This may be a period of time beginning at the start of a course of treatment and ending 1 month, 2 months, 3 months, 48123-111501-02 months, 5 months, or 6 months thereafter. For example, this period of time may be a period of time beginning at the end of a course of treatment and ending 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months thereafter. In some aspects, the MBV are administered to the subject weekly, monthly, every two months, every three months, or every six months
[0170] A subject may be administered 1 or more administrations of MBV constituting a course of treatment. A course of treatment may be administration of MBV 1 time per week for 4 weeks, 1 time per week for 3 weeks, 1 time per week for 2 weeks, 1 time per week for 1 week (i.e., only 1 administration), 2 times per week for 4 weeks, 2 times per week for 3 weeks, 2 times per week for 2 weeks, 2 times per week for 1 week, 3 times per week for 4 weeks, 3 times per week for 3 weeks, 3 times per week for two weeks, 3 times per week for 1 week, 4 times per week for 1 week, 4 times per week for two weeks, four times per week for three weeks, or 4 times per week for four weeks.
[0171] In one aspect, a subject receives an initial treatment course 1 time per week for 4 weeks, 1 time per week for 3 weeks, 1 time per week for 2 weeks, 1 time per week for 1 week (i.e., only 1 administration), 2 times per week for 4 weeks, 2 times per week for 3 weeks, 2 times per week for 2 weeks, 2 times per week for 1 week, 3 times per week for 4 weeks, 3 times per week for 3 weeks, 3 times per week for two weeks, 3 times per week for 1 week, 4 times per week for 1 week, 4 times per week for two weeks, four times per week for three weeks, or 4 times per week for four weeks, followed by a maintenance course after 1 month, after 2 months, after 3 months, after 4 months, after 5 months, after 6 months, after 7 months, after 8 months, after 9 months, after 10 months, after 11 months, or after 12 months from completion of the initial treatment course. In one aspect, the patient receives a maintenance course 6 months after the treatment course. The maintenance course may be the same or different than the treatment course. A maintenance course may be administration of MBV 1 time per week for 4 weeks, 1 time per week for 3 weeks, 1 time per week for 2 weeks, 1 time per week for 1 week (i.e., only 1 administration), 2 times per week for 4 weeks, 2 times per week for 3 weeks, 2 times per week for 2 weeks, 2 times per week for 1 week, 3 times per week for 4 weeks, 3 times per week for 3 weeks, 3 times per week for 2 weeks, 3 times per week for 1 week, 4 times per week for 1 week, 4 times per week for 2 weeks, 4 times per week for 3 weeks, or 4 times per week for 4 weeks.
[0172] In some aspects, a maintenance course may be administered every 3 months, every 6 months, every 9 months, or every year. In one aspect, a maintenance course is administered every 6 months.8123-111501-02
[0173] According to some aspects, a subject is administered about 1x101to about 1x1020MBV per kg of body weight per administration. For example, a subject is administered about 1x106to about 1x1020MBV / kg of body weight, such as about 1x106to about 1x1012MBV per kg of body weight per administration. In some examples, a subject is administered about 1x106to about 1x1019MBV, about 1x106to about 1x1018MBV, about 1x106to about 1x1017MBV, about 1x106to about 1x1016MBV, about 1x106to about 1x1015MBV, about 1x106to about 1x1014MBV, about 1x106to about 1x1013MBV, or about 1x106to about 1x1012MBV per administration. In other examples, a subject is administered about 1x107to about 1x1011MBV per kg of body weight per administration. In another example, a subject is administered 1x107to 1x108MBV per kg of body weight per administration. In another aspect, a subject is administered 1x108to 1x1010MBV per kg of body weight per administration. In another aspect, a subject is administered 1x109to 1x1010MBV per kg of body weight per administration. In another aspect, a subject is administered 1x106to 1x108MBV per kg of body weight per administration. In another aspect, a subject is administered 1x107to 1x109MBV per kg of body weight per administration. In another aspect, a subject is administered 1x108to 1x1011MBV per kg of body weight per administration. In another aspect, a subject is administered 1x109to 1x1011MBV per kg of body weight per administration. In another aspect, a subject is administered 1x1010to 1x1011MBV per kg of body weight per administration. In another aspect, a subject is administered 1x1011to 1x1012MBV per kg of body weight per administration. In another aspect, a subject is administered 1x106to 1x1014MBV per kg of body weight per administration. In another aspect, a subject is administered 1x1012to 1x1014MBV per kg of body weight per administration. In another aspect, a subject is administered 1x1012to 1x1020MBV per kg of body weight per administration. In another aspect, a subject is administered 1x1012to 1x1016MBV per kg of body weight per administration. In another aspect, a subject is administered 1x1014to 1x1018MBV per kg of body weight per administration. In another aspect, a subject is administered 1x1010to 1x1016MBV per kg of body weight per administration. In another aspect, a subject is administered 1x1012to 1x1018MBV per kg of body weight per administration. In one aspect, administration of MBV according to any of the aforementioned amounts is by systemic administration. For example, in one aspect, the administration is intravenous. In another aspect, the administration is by bolus subcutaneous injection, for example, into muscle.
[0174] According to one aspect, a subject is administered a course of treatment with MBV when the subject experiences symptoms associated with periprosthetic osteolysis, e.g.,8123-111501-02 inflammation or other signs of PPOL, such as may be assessed by imaging or other diagnostic methods. According to one aspect, a subject is administered a course of treatment when the subject experiences periprosthetic osteolysis after joint replacement. According to one aspect, a subject is administered a course of treatment with MBV to prevent periprosthetic osteolysis (PPOL), e.g., after a procedure where an implant is placed in a bone or joint. For example, to prevent PPOL, the subject is administered an effective amount of MBV every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, or once per year, e.g., after the implant is placed in the bone or the joint. In other aspects, the subject is administered an effective amount of MBV weekly, monthly, every two months, every three months, or every six months.
[0175] According to another aspect, a subject is administered a course of treatment with MBV to prevent osteoporosis or osteopenia. Accordingly, a subject at risk of osteoporosis or osteopenia is administered an effective amount of MBV at intervals, such as every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, or once per year. Administration may be systemic, e.g., by intravenous or subcutaneous administration.
[0176] In additional aspects, provided is a device comprising an implant (e.g., orthopedic / dental implant) and an effective amount of MBV. For example, the device comprises an orthopedic / dental implant and an effective amount of MBV, wherein an effective amount of the MBV is incorporated into, coupled to, coated onto, or eluted from the implant.
[0177] In certain aspects, the subject is further administered an effective amount of a bisphosphonate compound. Exemplary bisphosphonates are Aldronate, Etidronate, Clodronate, Tiludronate, Pamidronate, Neridronate, Olpadronate, Alendronate, Ibandronate, Risedronate, and Zoldronate. Preferably, the bisphosphonate comprises Aldronate. In some aspects, the subject has Paget’s disease of bone. The method can include administering an effective amount of a bisphosphonate or calcitonin. Examples of bisphosphonates include, but are not limited to, zoledronic acid, pamidronate, ibandronate, alendronate, and risedronate. In other aspects, the subject is further administered an effective amount of an antibody that specifically binds Receptor activator of nuclear factor kappa-Β ligand (RANKL), or a teriparatide. The antibody can be denosumab.
[0178] In more aspects, the subject has osteomyelitis. The method can include administering an effective amount of an antibiotic. Suitable antibiotics include, but are not limit to,8123-111501-02 amoxicillin-clavulanate, ciprofloxacin plus clindamycin, Levofloxacin plus clindamycin or moxifloxacin). The method can also include administering an anti-fungal, such as, but not limited to, itraconazole, fluconazole, ketoconazole, terbinafine, andvoriconazole. The method can also include administering denosumab and / or teriparatide.
[0179] In yet other aspects, the subject has metastatic bone disease. The primary cancer can be, for example, a breast tumor, lung tumor, thyroid tumor, kidney tumor, or a prostate tumor. The subject can have a malignancy of the bone such as a sarcoma, such as osteosarcoma. In further aspects, the subject has an osteosarcoma. The method can include treating the subject with a chemotherapeutic agent, immunotherapy or radiation. EXAMPLES
[0180] Extracellular matrix (ECM)-based biomaterials provide a biologically compatible scaffold for tissue repair and regeneration and have been utilized in diverse medical applications (Hussey et al., Nature Reviews Materials 3, 159-173 (2018); Naranjo et al., Science advances 6, eaba4526 (2020); Saldin et al., Journal of immunology and regenerative medicine 13, (2021); Mehrban et al., Acta Biomater 111, 141-152 (2020)). The ECM is a three-dimensional meshwork of structural and functional macromolecules that are remodeled by and provide biophysiochemical feedback to resident cells to maintain homeostasis ( Hussey et al., Nature Reviews Materials 3, 159-173 (2018); Badylak et al., Acta Biomater 23 Suppl, S17-26 (2015); Theocharis et al., Adv Drug Deliv Rev 97, 4-27 (2016)). Acellular (e.g., decellularized) ECM and its derivatives have been shown to have immunomodulatory properties, largely effected through modulation of macrophage phenotype, and have produced promising results in preclinical models of inflammatory diseases (Naranjo et al., Science advances 6, eaba4526 (2020); Saldin et al., Journal of immunology and regenerative medicine 13, (2021); Petrosyan et al., Matrix biology: journal of the International Society for Matrix Biology 57-58, 334-346 (2017); Keane et al., Journal of Crohn's & colitis 11, 360-368 (2017); Huleihel et al., Semin Immunol 29, 2-13 (2017); Sicari et al., Biomaterials 35, 8605- 8612 (2014); Londono et al., J Biomed Mater Res A 105, 2109-2118 (2017); Meng et al., Biomaterials 46, 131-140 (2015); Ploeger et al., Immunobiology 217, 299-306 (2012); Londono et al., Annals of biomedical engineering 43, 577-592 (2015); Dziki et al., J Biomed Mater Res A 105, 138-147 (2017); Brown et al., Acta Biomater 8, 978-987 (2012)).
[0181] Recent studies have shown that matrix-bound nanovesicles (MBV) are a mediator of the immunomodulatory effects of ECM (Huleihel et al., Science advances 2, e1600502 (2016); Hussey et al., Science advances 6, eaay4361 (2020)). MBV are a class of8123-111501-02 extracellular vesicle (EV) integrally bound to the ECM, with unique composition, cargo, and function distinct from those of other EV types (Huleihel et al., Science advances 2, e1600502 (2016); Heleihel et al., Tissue Eng Part A 23, 1283-1294 (2017); Hussey et al., Tissue Eng Part A 23, 1283-1294 (2017); Crum et al., NPJ Regen Med 7, 13 (2022); Crum et al., Science advances 9, eadf9016 (2023)). MBV modulate macrophage phenotype and prevent adverse bone remodeling in a preclinical model of autoimmune-associated rheumatoid arthritis (RA) (Crum et al., NPJ Regen Med 7, 13 (2022)). However, the effects of MBV on osteoclasts were not determined in this work.
[0182] In the present study, RANKL-treated RAW264.7 monocyetes / macrophages were used as an in vitro model of osteoclastogenesis. A UHMWPE particulate-induced calvarial osteolysis mouse model was used, and it was demonstrated that MBV inhibit osteoclast differentiation by inhibiting downstream NF-κB signaling. The studies documents that MBV attenuate UHMWPE-induced soft-tissue inflammation, osteolytic destruction, and remodeling in vivo. EXAMPLE 1: MATERIALS AND METHODS
[0183] Preparation of acellular urinary bladder ECM: Acellular porcine urinary bladder ECM (UB-ECM) was prepared as described in Huleihel et al. (Science Advances 2, e1600502 (2016)). Briefly, commercial porcine urinary bladder (Animal Biotech Industries, Doylestown, PA, USA) was obtained from market-weight animals (approximately 110 kilograms). The bladder was mechanically processed to removed tunica serosa, tunica muscularis externa, most of the tunica submucosa and tunica muscularis mucosa, then soaked in 4% ethanol and 0.1% peracetic acid (Enviroguard MP2, Rochester Midland, USA) and put on a shaker for 2 hours at 300 rpm at room temperature. The tissue was extensively rinsed with PBS (pH 7.4) and deionized water to remove luminal urothelial cells leaving the basement membrane intact. The basement membrane was lyophilized as UB-ECM scaffold and milled into powder by a Wiley mill (Thomas Scientific, Swedesboro, NJ, USA) with a #40 mesh screen.
[0184] Isolation and identification of MBV: MBV were isolated from ECM bioscaffold (Huleihel et al., Science Advances 2, e1600502 (2016); Hussey et al., Science Advances 6, eaaay4361 (2020); Urabe et al., Journal of extracellular vesicles 12, e12312 (2023); Quijano et al., Tissue engineering. Part C, Methods 26, 528-540 (2020)). UB-ECM powder was digested in a 10 μg / mL LIBERASETM(05401046001, Roche, Germany) with 50mM Tris, 200mM NaCl, and 5 mM CaCl2on a tube revolver / rotator at 40 rpm for 16 hours. UB-ECM8123-111501-02 digestion was centrifuged from 500g to 2,500g at 4 ℃ for 20 minutes, then 10,000g at 4 ℃ for 3 x 30 minutes. The clarified supernatant was filtered with a 0.22 μm filter, then centrifuged (Optima L-90K Ultracentrifuge, Beckman Coulter, Brea, CA, USA) at 100,000g for 70 minutes. The supernatant was discarded and the pellet was resuspended with 1× PBS (pH 7.4). The morphology of MBV was determined by transmission electron microscopy (TEM). Particle concentration and distribution were determined using nano-tracking analysis (NTA).
[0185] Mouse monocytes / macrophages culture: Mouse monocytes / macrophage cell line RAW 264.7 was obtained from the American Type Culture Collection (ATCC) and cultured following the ATCC guidelines in DMEM / F12 (11320033, Gibco, USA) with 10% fetal bovine serum (S11150, Bio-Techne Sales Corp, USA), and 1% Penicillin Streptomycin (SV30010, Hyclon, USA) at 37 ℃ in 5% CO2.
[0186] Live / dead staining: The cell cytotoxicity assay was determined by a live-dead staining kit (R37601, Invitrogen, USA) and obtained images by microscope (Zeiss Axio Observer Z1, Germany). 1 × 104cells / well RAW 264.7 cells were cultured in a 96-well plate (12556008, Thermo Fisher Scientific, USA) with PBS, 5% DMSO, and serial dilution of MBV ranging from 1.25 × 109particles / mL to 1 × 1010particles / mL, MBV versus cells ratio from 1.25 × 105particles / mL / cell to 1 × 106particles / mL / cell for 24 hours. The live- dead cells were counted by CellProfiler (BROAD Institute).
[0187] CCK-8 assay: The cell proliferation assay was determined by cell counting kit 8 (K1018, APExBIO, USA).1 × 104cells / well RAW 264.7 cells were cultured in a 96-well plate (12556008, Thermo Fisher Scientific, USA) with serial dilution of MBV ranging from 1.25 × 109particles / mL to 1 × 1010particles / mL, MBV versus cells ratio from 1.25 × 105particles / mL / cell to 1 × 106particles / mL / cell for 24 hours. At 24 hours, all culture wells were added to 10μl cell counting kit 8 assay in 90μl culture media incubated at 37 ℃ for 2 hours and absorbance was determined at 450nm.
[0188] MBV uptake assay: The MBV uptake assay was determined by labeled 5-(and-6)- Carboxyfluorescein Diacetate, Succinimidyl Ester (CSFE) (C1157, Thermo Fisher Scientific, USA) MBV and DAPI-labeled (0100-20, SouthernBiotech, USA) nuclei under a fluorescence microscope. Approximately 1 × 1012particles / mL MBV were cultured with CSFE at a 299:1 dilution for 2 hours at 37℃. After incubation, the MBV CSFE mix was diluted by 1× PBS in a 1:7 ratio and the mixture was added to a size exclusion chromatography (SEC) column to remove residue CSFE. CSFE labeled MBV were collected and diluted to 1 × 1011particles / mL with 1X particle-free PBS. RAW 264.7 cells were treated with CSFE-labeled8123-111501-02 MBV in a µ-slide 8 well ibiTreat plate (80826, Ibidi, Germany) for 1 hour. Cells were then fixed with 4% paraformaldehyde (PFA) and the cells’ nuclei were labeled with DAPI (OB010020, Thermo Fisher Scientific, USA) and F-actin was labeled with Alexa Fluor 594 Phalloidin (A12381, Thermo Fisher Scientific, USA), and slides were visualized under a Zeiss AxioObserver Z1 microscope.
[0189] In vitro osteoclast induction of RAW 264.7 monocytes / macrophages: Recombinant RANKL (390-TN, R&D system, USA) was used in a range from 30 to 50 ng / mL for 0 min to 5 days to induce RAW 264.7 cells differentiate into osteoclasts. For osteoclast formation and supernatant TNF-α Enzyme-Linked Immunosorbent Assay (ELISA), RAW 264.7 cells were seeded in 48-well plates at a 6.25 × 103cells / cm2density and stimulated with 30 ng / mL RANKL for 5 days (Song et al., J Cell Physiol 234, 11969-11975). For osteoclast-related gene expression determination, RAW 264.7 cells were seeded in 6-well plates at a density of 5× 105cells per well and stimulated with 50 ng / mL RANKL for 1 day. For osteoclast-related protein expression determination, RAW 264.7 cells were seeded in 6-well plates at a density of 1.5 × 105cells with 50 ng / mL RANKL stimulation for 3 days. For NF-κB pathway related Western-blot, RAW 264.7 cells were seeded in 6-well plates at a density of 1× 106cells per well with 50 ng / mL RANKL stimulation from 0 to 60 min.
[0190] TRAP staining: The Tartrate-resistant acid phosphorus staining kit (387A, Sigma- Aldrich, USA) following manufacturer’s instruction.4% PFA (pH 7.0) was used to fix RANKL-induced RAW 264.7 cells. Fixed cells were washed with 1× PBS and treated with TRAP staining solution for 1 hour at 37 ℃. Stained cells were washed with 1× PBS twice and stained with hematoxylin then washed under tap water. The TRAP+cells were visualized under a Zeiss AxioObserver Z1 microscope.
[0191] Actin Ring staining: RANKL-induced RAW 264.7 cells were fixed with 4% paraformaldehyde (pH 7.0) and washed with 1× PBS. The osteoclasts actin rings were determined with ALEXA FLUORTM488 Phalloidin (A12379, Thermo Fisher Scientific, USA) following manufacturer’s guideline and nuclei were DAPI-labeled (0100-20, SouthernBiotech, USA). The actin rings and nuclei were visualized under a Zeiss AxioObserver Z1 microscope.
[0192] Bone resorption assay: Follow the manufacturer’s instructions. RAW 264.7 cells were seeded in a 48-well fluoresceinamine-labeled chondroitin sulfate (FACS) calcium phosphate- coated plate (Cosmo bio, CSR-BRA-48KIT, USA) at a 6.25 × 103cells / cm2density and stimulated with 1 mL, 30 ng / mL RANKL phenol red-free macrophage / monocyte media for 7 days. At day 6, 100uL media was moved to a 96-well plate mix with 50μL bone resorption8123-111501-02 buffer (Cosmo bio, CSR-BRA-48KIT, USA) to assess fluorescence intensity with a plate reader at 485 / 535nm. At day 7, the cells were removed with 5% sodium hypochlorite. Resorption pit area was visualized under a Zeiss AxioObserver Z1 microscope.
[0193] Quantitative RT-qPCR: RANKL-induced RAW 264.7 cells were treated with 1× 1010particles / mL or 2 × 1010particles / mL MBV at the same time (MBV vs cells ratio 1× 104to 2 × 104particles / mL / cell) and RNA was extracted with a commercial RNA extraction kit (74536, Qiagen, USA). The concentration and purity of total RNA were determined with nanodrop spectrophotometers (NanoDropTM2000, Thermo Fisher, USA). A reverse transcription kit (18080051, Thermo Fisher Scientific, USA) was utilized to synthesize cDNA. The gene levels of NFATc1, DC-STAMP, Cathepsin K, c-Src, β3-Integrin, and MMP-9 were measured by Quant Studio 6 (Thermo Fisher Scientific, USA) using a commercial SYBR mix (A25778, Applied Biosystem, USA) as well as the forward and reverse primers listed in FIG.7. The GADPH gene was utilized as the housekeeping gene. The RT-qPCR results were analyzed using the delta-delta CT method.
[0194] Western-blot: For osteoclast protein determination, RANKL-induced RAW 264.7 cells were treated with 1× 1010or 2×1010particles / mL MBV at the same time. For MBV function on RANKL activated NF-κB pathway investigation, RAW 264.7 cells were pretreated with 2×1010particles / mL MBV for 2 hours then treated with RANKL from 0 to 60 minutes. To collect total protein, the plates were placed on ice, washed with cold PBS twice, and lysed with radioimmunoprecipitation (RIPA) buffer (PI89900, Thermo Fisher Scientific, USA) with added protease / phosphatase inhibitor (A32963, Thermo Fisher Scientific, USA). The protein concentration of lysis buffer was quantified by a commercial BCA kit (PI23224, Thermo Fisher Scientific, USA). After determining the total protein concentration, the protein buffer was diluted by 4× loading buffer (1610747, Bio-rad, USA) containing 10% β- mercaptoethanol (M3148-100ML, Sigma-Aldrich, USA) at a volume ratio of 1:3 then heated to 95℃ for 5 minutes to denature the proteins. The proteins were separated using 4-20% sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (456-1093, Bio-rad, USA) and proteins were transferred to polyvinylidene difluoride membranes (1620177, Bio-rad, USA). Membranes were blocked with 5% non-fat milk in Tris-buffered saline containing 0.1% TWEEN®-20 (TBST) for 1 hour at room temperature, and subsequently probed with 1:1000 dilution primary antibodies NFATc1 (8032S,Cell signaling technology, USA), Cathepsin K (57056S,Cell signaling technology, USA), c-Src (25978-1-AP, Proteintech, USA), phospho- p65 (3033S, Cell signaling technology, USA), p65 (8242S, Cell signaling technology, USA), IκBα(4812S, Cell signaling technology, USA) and β-actin (4970T, Cell signaling technology,8123-111501-02 USA) in Tris-buffered saline containing 0.1% TWEEN®-20 (TBST) and 1% bovine serum albumin (BSA) overnight at 4 ℃. The probes’ primary antibody membrane was washed with TBS-T then incubated with 1:5000 secondary antibody (Sigma Aldrich, A0545, USA) at room temperature for 60 minutes, washed with TBS-T, and then exposed to a chemiluminescent substrate detection reagent (PI34095, Thermo Fisher Scientific, USA) for visualization.
[0195] Enzyme-Linked Immunosorbent Assay (ELISA): Commercial mouse TNF-α ELISA (MTA00B, R&D Systems, USA) kit was utilized to determine TNF-α concentration within RANKL-induced osteoclast culture media at day 5 following manufacturer’s instruction.
[0196] UHMWPE particulate-induced mice calvarial osteolysis: This study investigated the role of local MBV administration in treating mouse peri-calvarial particulate-induced osteolysis and periosteal inflammation. A mouse peri-calvarial UHMWPE implantation model was utilized to simulate in vivo prosthetic wear debris-induced osteolysis. BALB / c mice were randomly divided into a SHAM surgery group, UHMWPE + PBS (vehicle) group, and UHMWPE+MBV (treatment) group; each group including 5 mice. Each mouse was placed in the prone position under anesthesia, hair was removed from the parietal region, the parietal area was disinfected with complex iodine and 70% alcohol, and an incision was made along the median sagittal line of the skull from the midpoint of the eyes to the midpoint of the ears with a scalpel, the galea aponeurotica was incised by extending the incision, the periosteum attached to the bony surface of the skull was removed, and 30mg of endotoxin free UHMWPE powder (φ=5μm, ceridust 3610, Clariant, Gersthofen, Germany) was uniformly applied to the bony surface of the skull. The muscles and the skin were closed with 4-0 sutures (Knoch et al., Biomaterials 26, 1803-1808 (2005)). Post-surgery, 100μl (PBS diluted 2×1011particle (20ug) per mouse MBV administrated, delete) of MBV (2×1011particles in PBS) were administrated to the peri-calvarial area within the capacity between the skin-muscle layer and skull of each mouse at day 0, 7, 14 and 21 by local injection. The vehicle group was administrated the same volume PBS. On day 28, mice were euthanatized and calvarial caps harvested. The calvarial caps were fixed by paraformaldehyde (pH 7.4) for 24 hours and then rinsed with PBS (pH 7.4) for micro-CT scanning. High-resolution skull film micro-CT (Scanco μCT 50, Scanco Medical AG, Bassersdorf, Switzerland) was performed with the voxel resolution at 10μm. The micro-CT slides were 3-dimensionally reconstructed by mimics 17.0 (Materialise, Leuven, Belgium). After reconstruction, the regions of interest (ROI, 400 coronal layers) were selected by image Pro Plus 6.0 (Media8123-111501-02 Cybernetics, Maryland, USA) along the bone boundary to measure bone areas and pores area to calculate cortical bone porosity (Ct. Po) and bone volume / tissue volume (BV / TV). The calvarial caps were decalcified in 10% ethylenediaminetetraacetic acid (EDTA) for 14 days, followed by paraffin sectioning for histology and immunolabeling staining. Animal studies were conducted with the approval of the University of Pittsburgh Institutional Animal Care and Use Committee (protocol 00021619).
[0197] MBV biodistribution in particulate-induced osteolysis model in vivo: Mice were fed an imaging diet (AIN-76A, bio-serv, USA) two weeks prior to biodistribution examination to prevent background fluorescence. The UHMWPE particulate-induced mice calvarial osteolysis model was established as described above. MBV with PBS suspension and same volume PBS were processed by an extracellular vesicle near-IR label kit (EXOGV900A, System Bioscience, USA) following the manufacturer’s introduction. Post-surgery 2 days, 100 μl (approximately 100 ug) near-IR labeled MBV and dye-only PBS were administrated peri-calvarial separately into the MBV and dye-only control groups. Following injection, animals were imaged at 0 hours, 3 hours, 6 hours and 1, 2, 3, 4, 5 and 7 days using the IVIS® Spectrum in vivo imaging system (n=5 animals; PerkinElmer, USA). At 7 days, mice were euthanatized, and calvarial caps, hearts, lungs, livers, kidneys and lower limb bones were collected to acquire fluorescence images using IVIS Spectrum in vivo imaging system. Images were processed and quantified using IVIS® software (PerkinElmer, USA).
[0198] Histological and Immunolabeling Analyses: Paraffin sections were deparaffinized with progressive xylene, followed by ethanol rinses decreasing from 100% to 70%, then running tap water and deionized water rinses to rehydrate sections. Hydrated sections stained with hematoxylin and eosin (H&E) staining and TRAP staining. For immunolabeling, hydrated sections were processed with proteinase K for 30 minutes to unmask antigen. Endogenous peroxidase and alkaline phosphatase were blocked with 2.5% horse serum. Then the sections were probed with TNF-α primary antibody (1:200, Abcam, ab1793, USA) overnight at 4 ℃. Primary antibody probes sections were washed with TBST and incubated with amplifier antibody, polymer reagent and DAB solution (MP-7602, Vector laboratories, USA) for color reactions. The images were visualized under a light microscope. Macrophage phenotype was assessed by immunofluorescence staining. The same deparaffinized and rehydrated sections were processed with proteinase K for 30 min to unmask the antigen. Then, the sections were blocked with 4% donkey serum, 2% BSA, and 0.1% Triton X-100 TBST buffer at room temperature for 60 min.1% BSA-TBST dilute CD86 (1:100, rabbit-anti mouse, Bioss, BS-1035R, USA) and CD206 (1:100, goat-anti mouse, R&D systems, AF2535,8123-111501-02 USA) primary antibodies probe sections overnight at 4 ℃. Primary antibody probes sections were rinsed washed with TBST and incubated with fluorescence conjugated secondary antibody (1:500, 488 donkey anti-rabbit, Invitrogen, R37119, USA and 1:500, 594 donkey anti-goat, Invitrogen, A11055, USA) avoid from light at room temperature for 60 min. Rinsed and washed sections were immersed with a DAPI mounting media (Southern Biotech, 0100-20, USA) and covered with a coverslip. The CD86 was assigned a red channel, and the CD206 was assigned a green channel. CD86 was assigned to the red channel and CD206 was assigned green channel. The H&E and TRAP staining sections were visualized by MoticEasyScan (Schertz, TX, USA) digital slide scanner and quantified with Image J FIJI (Schindelin et al., Nature methods 9, 676-682 (2012)). The immunolabeling staining sections were visualized under a Zeiss AxioObserver Z1 microscope and quantified with QuPath (Bankhead et al., Sci Rep 7, 16878 (2017)). The positive cell QuPath analysis pipeline is set with a workflow: line annotation / pixel width & length setting / rectangle annotation analysis area selection / cell detection ((blue nuclei, total cells) / positive cell detection (nuclei blue / cytoplasm color(DAB, red, green). Samples were then batch-processed to identify these characteristics within all samples in an automated fashion without user input.
[0199] Statistical analysis: All data are presented as means ± standard deviation. Comparisons were performed using t test, one-way analysis of variance (ANOVA) with Tukey’s post hoc correction with no adjustments made for multiplicity as appropriate, by using GraphPad Prism version 9.0. P < 0.05 was considered statistically significant (*, P < 0.05; **, P < 0.01; ***, P < 0.001). EXAMPLE 2: MBV MITIGATE RANKL-INDUCED OSTEOCLAST FORMATION BY SUPPRESSING NF-kB SIGNALING PATHWAYS IN VITRO
[0200] MBV characterization and assessment of cytocompatibility: MBV were isolated from porcine urinary bladder matrix (UBM) and characterized by transmission electron microscopy (TEM) (Fig.1A) and nanoparticle tracking analysis (NTA) (Fig.1B). The results show that MBV had an average diameter of 112 nm and classic concave spherical EV morphology under TEM. Following MBV treatment of RAW 264.7 macrophages, there was no significant difference in cytotoxicity compared to PBS control based upon live-dead staining across serial dilutions of MBV ranging from 1.25 × 109particles / mL to 1 × 1010particles / mL (p>0.05; FIGs.1C-1D). Treatment with 5% DMSO induced a significant decrease in cell viability compared to phosphate buffered saline (PBS)8123-111501-02 control and compared to all dilutions of MBV based upon live-dead staining (p < 0.05; FIGs. 1C-1D). For cell proliferation and cytotoxicity measurements, different concentrations of MBV were cocultured with macrophages for 24 hours. There was no significant difference in cell proliferation between the 1.25 × 109particles / mL group, 2.5 × 109particles / mL group, and the PBS control group (p>0.05; FIG.1E). However, the 5 × 109particles / mL group and 1 × 1010particles / mL group each caused a significant increase in cell proliferation by approximately 5% compared to PBS control group (p < 0.05; FIG.1E). Results show that MBV are not cytotoxic to RAW 264.7 cells.
[0201] Macrophages uptake MBV and MBV reduce RANKL-induced osteoclast formation and activity in-vitro.
[0202] MBV were labeled with 5-(and-6)-Carboxyfluorescein Diacetate, Succinimidyl Ester (CFSE) and added to RAW 264.7 cells for 1 hour to examine MBV uptake. Nuclei were labeled with Hoechst and cytoskeleton F-actin was labeled with 594-phalloidin before imaging (FIG.2A). The effects of MBV on osteoclast formation was investigated by culturing RAW 264.7 cells with serial dilutions of MBV ranging from 0 particles / mL to 5 × 109particles / mL in the presence of 30ng / mL RANKL for 5 days. The presence of multi- nucleated osteoclasts was identified by tartrate-resistant acid phosphatase (TRAP) staining (nuclei were identified by hematoxylin staining after TRAP staining, FIG.8). The RANKL + PBS group showed more TRAP-positive, multi-nucleated osteoclasts compared to the Control group (FIG.2B). Serial dilutions of MBV ranging from 1.25 × 109particles / mL to 5 × 109particles / mL + RANKL group showed a dose dependent decrease in TRAP-positive, multi-nucleated osteoclasts compared to the RANKL + PBS group (FIG.2E). Following RANKL induction, osteoclast formation decreased significantly with increasing MBV concentration compared to the RANKL + PBS group (p < 0.05; FIG.2C) The TRAP + osteoclast number in the RANKL + 5 × 109particles / mL MBV group was not significantly different from the Control group (p>0.05; FIG.2E). The effects of MBV on osteoclast activity were assessed by FITC-phalloidin labeled actin rings, which relates to the bone matrix sealing zone formed by osteoclast to secreted matrix metalloproteases and acids (Kodama et al., Int J Mol Sci 21, 5685 (2020)). RAW 264.7 cells were cultured with or without 5 × 109particles / mL MBV and 30 ng / mL RANKL for 5 days. Results showed a smaller actin ring (average cell area) formation in RANKL + MBV group compared to RANKL + PBS group (p < 0.05; FIGs.2C and F). A fluorescence bone resorption assay assessed further osteoclast activity. RAW 264.7 cells were cultured with the same condition8123-111501-02 in the osteoclast formation test on a fluorescence-labeled calcium phosphate-coated plate for 7 days. At day 6, the culture media fluorescence intensity was assessed. At day 7, the cells were removed to assess the pit resorption area. Relative to RANKL +PBS group, MBV significantly decreased fluorescence intensity and pit resorption area (P < 0.05; Fig.2, D, G, and H). Cumulatively, the results showed that MBV reduce osteoclast formation and activity in vitro. MBV mitigate RANKL-induced osteoclast formation by suppressing NF-kB signaling pathway in vitro.
[0203] To determine the effect of MBV on initial osteoclast differentiation, expression of the master transcription factor NFATc1 and the osteoclast precursor multinucleation factor DC- STAMP were measured by RT-qPCR 24 hours after MBV treatment (Kodama et al., Int J Mol Sci 21, 5685 (2020); Dai et al., Front Cell Dev Biol 8, 433 (2020)). The expression of NFATc1 was significantly decreased after treatment with 2× 1010MBV / mL compared to the RANKL + PBS group (FIG.3A, p < 0.05), though treatment with a lower concentration (1× 1010particles / mL) did not cause a decrease. DC-STAMP expression was increased in the RANKL + PBS group compared to the control group (FIG.3A, p < 0.05), and MBV treatment at either concentration decreased its expression. The effect of MBV on expression of genes related to osteoblast function, including Cathepsin K, c-Src, MMP-9, and β3-integrin was next examined (Dai et al., Front Cell Dev Biol 8, 433 (2020); McHugh et al., J Clin Invest 105, 433-440 (2000); Paiva et al., Prog Mol Biol Transl Sci 148, 203-303 (2017)). While RANKL treatment (RANKL + PBS group) increased Cathepsin K, c-Src and MMP-9 gene expression compared to the control group (FIG.3B, p < 0.05), the addition of MBV significantly downregulated Cathepsin K and c-Src expression compared to RANKL + PBS group (FIG.3B, p < 0.05). MMP-9 expression was not different between RANKL + PBS and RANKL + MBV groups (FIG.3B, p < 0.05). Across all groups, β3-integrin expression showed no significant difference (FIG.3B; p > 0.05).
[0204] These trends were mirrored at the protein level, where RANKL-induced cells showed increased expression of NFATc1, c-Src, and Cathepsin K at the 3-day timepoint (FIG.3C, p < 0.05), and the addition of MBV significantly abrogated these increases. Similarly, treatment with RANKL for five days significantly increased the TNF-α concentration in the media compared to the control group, and this was significantly reduced with the addition of MBV (FIG.3D, p < 0.05).8123-111501-02
[0205] To determine whether MBV-mediated modulation of NF-κB pathway signaling is involved in the observed reduction of osteoclastogenesis, macrophages were pretreated with MBV for two hours and then treated with RANKL for 0 to 60 min before analysis of pathway components by Western blot. Although the ratio of phosphorylated p65 versus p65 showed no significant difference between the RANKL + PBS group and the RANKL + MBV group, a significant decrease in the level of IκBα was observed at the 20 min time point in the RANKL + PBS group, which was not observed in the RANKL + MBV group (FIG.3E, p < 0.05). EXAMPLE 3: MBV ALLEVIATES OSTEOCLASTIC AND INFLAMMATORY ACTIVITIES IN A MOUSE MODEL MBV biodistribution in a mouse model of particulate-induced calvarial osteolysis.
[0206] The biodistribution of near infrared-labeled MBV after local injection was examined in a mouse UHMWPE particulate-induced calvarial osteolysis model (FIG.4A). IVIS imaging showed strong fluorescent signal accumulation in the peri-calvarial region in the MBV group, while the dye-only PBS group showed a minimal fluorescent signal throughout the seven days (FIG.4B). The highest fluorescence signal in the MBV group was observed 3 hours post-administration, and the signal in this area did not decrease over seven days (FIGs. 4B,4D; p >0.05). At seven days post-administration, mice were euthanized and the calvarial bones, brains, heart, lungs, liver, kidneys, femurs and tibias were removed to individually measure the fluorescent signals. Significantly higher signal was observed in the calvarial bones, liver, kidney, and femur / tibia in the MBV group relative to those in the dye-only PBS group (FIGs.4C, 4E; p < 0.05), with the signal in calvarial bones in the MBV group approximately 20 times higher than that of other organs. Thus, peri-calvarial administration of MBV resulted in a robust and lasting local accumulation and showed limited systematic distribution in a mouse UHMWPE particulate-induced calvarial osteolysis model. Local administration of MBV alleviates osteolysis and bone remodeling in UHMWPE particulate-induced osteolysis.
[0207] Based on the IVIS results showing MBV retention in the peri-calvarial area, osteolysis and bone remodeling by microCT following peri-calvarial MBV treatment were next examined (FIG.5A). Gross observation of the calvarial bones following euthanasia showed dense, white, tissue in the UHMWPE+PBS (vehicle control) group and the UHMWPE+MBV group relative to the sham group (FIG.5B). Representative microCT8123-111501-02 three-dimensional reconstruction images showed multiple osteolytic areas in the dorsal and ventral sides of the calvarial bones in the vehicle control group and the sagittal suture was obscured by extensive bone remodeling (FIG.5C). In contrast, the MBV group showed fewer osteolytic areas and a preserved sagittal suture, comparable to the vehicle control group (FIG.5C). Coronal cross-sectional microCT images showed non-physiologic holes in the calvarial bone and loss of smooth, continuous bone surfaces in the vehicle control group, whereas the MBV group showed smooth, continuous bone surfaces with few osteolytic area (FIG.5D). Finally, quantification showed that cortical porosity (Ct.Po) was significantly increased and bone volume versus tissue volume (BV / TV) significantly decreased in the UHMWPE +PBS group relative to the sham group, but the addition of MBV resulted in a reversal of these trends (FIG.5E; p < 0.05). These data suggest that peri-calvarial administration MBV alleviated osteolysis and bone remodeling in UHMWPE particulate- induced osteolysis. MBV alleviates inflammatory and osteoclastic activities in UHMWPE particulate- induced osteolysis.
[0208] Histopathologic examination of the calvarial bone at 28 days post-UHMWPE implantation showed signs of severe inflammation and osteoclastic activity, including thickening of the periosteum, osteoclast formation and cytokine expression compared to the sham group (FIG.6, sham versus UHMWPE + PBS). Animals treated with MBV showed a reduction of periosteum thickness compared to the vehicle control group (FIGs.6A, 6D; p < 0.05), with reduced TRAP+osteoclast numbers (FIGs.6B, 6E; p < 0.05) and fewer TNF-α+cells (P<0.05; FIGs.6B, 6E). With MBV treatment, polarization of macrophages within periosteum was towards M2 phenotype (P<0.05; FIG.10). Thus, MBV alleviated inflammatory and osteoclastic activities in UHMWPE particulate-induced osteolysis in vivo.
[0209] Therapies investigated for treatment of aseptic periprosthetic have focused on improvement of prosthesis materials and design, and suppression of the inflammatory responses that lead to osteoclast differentiation and activity (Hussain et al., Polymers 12, (2020); Spece et al., J Arthroplasty 38, 970-979 (2023); Goodman et al., J Clin Med 8, (2019)). Given the current difficulties in detecting early aseptic periprosthetic osteolysis, the limited treatment options for aseptic loosening, and the increasing number of joint replacements (Sloan et al., J Bone Joint Surg Am 100, 1455-1460 (2018); Labek et al., The Journal of bone and joint surgery. British volume 93, 293-297 (2011); Sadoghi et al., J8123-111501-02 Arthroplasty 28, 1329-1332 (2013)), the need for therapies that target local foreign body- induced inflammation and osteoclast formation is clinically relevant.
[0210] The results of the present studies demonstrate that MBV treatment can attenuate RANKL-induced osteoclast formation in vitro, as indicated by reduced TRAP positive cells and osteoclast activity. In periprosthetic osteolysis, particulate debris released from the prosthesis is phagocytosed by macrophages, resulting in RANKL production, NF-κB pathway activation, and osteoclastogenic gene expression (Park et al., Mol Cells 40, 706-713 (2017); Goodman et al., J Clin Med 8, (2019); Luo et al., Molecular medicine reports 17, 6605-6611 (2018)). These monocyte / macrophages differentiate to osteoclast precursor cells, then fuse to form large multinucleated osteoclasts that secrete MMPs and Cathepsin K to degrade bone matrix (Kodama et al., Int J Mol Sci 21, (2020)). The results disclosed herein show that MBV can inhibit the degradation of IκBα to suppress NF-κB-mediated production of TNF-α and downstream osteoclastogenic transcription factors NFATc1 and DC-STAMP, with concomitant decreases in Cathepsin K and c-Src.
[0211] The debris released from the prosthesis during periprosthetic osteolysis is confined to the joint cavity, causing local inflammation and osteolysis (Hodges et al., Biomaterials 278, 121127 (2021)). Due to the anatomical structure of the joint cavity, systemic drug administration has limited access to the joint cavity; therefore, intra-articular injection is typically required (Rastogi et al., American journal of roentgenology 207, 484-494 (2016)). As disclosed herein, following local injection, MBV persists in the cavity formed between the cranial bone and the overlying skin-muscle layer and maintains a local concentration approximately 20-fold higher than the liver and kidneys. In clinical scenarios of PPOL, the feasibility of knee joint cavity injection makes local delivery a practical option. Research on human urine-derived stem cell (HUSCs) EV showed that specific targeting properties in a particle-induced osteolysis model could be enhanced by engineering HUSCs EV with macrophage membranes (Xie et al., Acta Biomater 160, 297-310 (2023); similar methods could be applied to MBV.
[0212] The results provided herein show that MBV can modulate inflammation and attenuate bone remodeling caused by particle-induced osteolysis while preserving bone mass. The current study provides insight on the regulatory function of MBV and underlines their ability to modulate both inflammation and osteoclast formation. Indeed, MBV can be used therapeutically for NF-κB pathway-driven inflammatory diseases such as periprosthetic osteolysis.8123-111501-02
[0213] In view of the many possible aspects to which the principles of our invention may be applied, it should be recognized that illustrated aspects are only examples of the invention and should not be considered a limitation on the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.
Claims
8123-111501-02 We claim:
1. A method of inhibiting osteoclasts in a subject in need of osteoclast inhibition, comprising; administering to the subject a composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo, thereby inhibiting osteoclasts in the subject.
2. The method of claim 1, further comprising the step of selecting a subject in need of osteoclast inhibition prior to administering to the subject the composition.
3. A method of treating or preventing periprosthetic osteolysis at the site of a prosthetic implant in bone or cartilage in a subject, comprising administering to the subject a composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo. thereby treating or preventing periprosthetic osteolysis at the site of the prosthetic implant.
4. The method of claim 3, further comprising the step of selecting a subject in need of treatment or prevention of periprosthetic osteolysis.
5. The method of claims 3 or 4, wherein the prosthetic implant is in bone.
6. The method of claims 3 or 4, wherein the prosthetic implant is in cartilage.
7. The method of any one of claims 1-6, wherein the matrix bound vesicles (a) contain miR-145 and miR-181; (b) do not comprise alkaline phosphatase; and / or (c) do not comprise or have barely detectable levels of epithelial cell adhesion molecule (EpCAM), annexin (ANX)A5, tumor susceptibility gene (TSG)101, golgi matrix protein (GM)130, flotillin (FLOT)1, intracellular adhesion molecule (ICAM)1, and / or ALG-2-interacting protein (ALIX1).8123-111501-02 8. The method of any one of claims 1-7, wherein the matrix bound vesicles comprise: (a) a phospholipid content comprising at least 55% phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; (b) a phospholipid content comprising 10% or less sphingomyelin (SM); (c) a phospholipid content comprising 20% or less phosphatidylethanolamine (PE); and / or (d) a phospholipid content comprising 15% or greater phosphatidylinositol (PI).
9. The method of any one of claims 1, 2, 7 or 8, wherein the MBV are administered locally to a bone or joint of the subject.
10. The method of any one of claims 3-8, wherein the MBV are administered locally to the site of the implant.
11. The method of any one of claims 1-8, wherein the MBV are administered systemically to the subject.
12. The method of claim 10 or 11, wherein the MBV are administered to the subject in an amount of: a) 1x106to 1x1020MBV per kg of body weight per administration; b) 1x106to 1x1012MBV per kg of body weight per administration; or c) 1x109to 1x1014MBV per kg of body weight per administration.
13. The method of claim 11 or claim 12, wherein the MBV are administered to the subject by intravenous infusion, intradermal injection, or subcutaneous injection.
14. The method of any one of claim 1-13, wherein the MBV are administered to the subject weekly, monthly, every two months, every three months, or every six months.
15. The method of any one of claims 1-14, wherein the MBV are derived from mammalian extracellular matrix from urinary bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus.8123-111501-02 16. The method of any one of claims 1-15, wherein the MBV are derived from bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS).
17. The method of any one of claims 1-16, wherein the mammal is a pig, cow, or sheep.
18. The method of any one of claims 1-17, wherein the subject is human.
19. The method of any one of claims 1-18, wherein the method decreases osteoclast fusion and bone resorption in the subject.
20. The method of any one of claims 1-19, wherein the subject has a prosthetic in bone or cartilage, and wherein the method treats or prevents periprosthetic osteolysis in the subject.
21. The method of claim 20, wherein the subject has experienced bone loss at the site of the prosthetic and / or aseptic loosening of the prosthetic.
22. The method of claim 20 or 21, wherein the subject has experienced a total or partial arthroplasty of a joint, and the prosthetic is implanted to totally or partially replace the joint.
23. The method of any one of claims 20-22, wherein the joint is a knee, hip, shoulder, elbow, wrist, ankle, finger, toe, or temporomandibular joint.
24. The method of any one of claims 20-23, wherein the prosthetic is an artificial knee, artificial hip, artificial shoulder, artificial elbow, artificial wrist, artificial ankle, artificial finger joint, artificial toe joint, or artificial temporomandibular joint, respectively.
25. The method of claim 24, wherein the prosthetic is an artificial finger joint, and wherein the finger joint is a metacarpophalangeal joint (MCP), a proximal interphalangeal joint (PIP), a distal interphalangeal joint (DIP), or an interphalangeal joint (IP).8123-111501-02 26. The method of claim 24, wherein the prosthetic is an artificial toe joint, and wherein the toe joint is a metatarsophalangeal joint (MTP), a proximal interphalangeal joint (PIP), a distal phalangeal joint (DP), or an interphalangeal joint (IP).
27. The method of any one of claims 20-24, wherein the subject has received a total hip arthroplasty and / or a total knee arthroplasty.
28. The method of any one of claims 22-27, wherein the MBV are administered intraarticularly to the joint, or at an interface between the prosthetic and the bone.
29. The method of any one of claims 20-22, wherein the prosthetic is implanted into the skull, jaw, neck (cervical spine), thoracic spine, lumbar spine, or coccyx.
30. The method of claim 29, wherein the prosthetic is a dental implant into the jaw.
31. The method of any one of claims 20, 21, or 29-30, wherein the prosthetic is implanted into a bone in the subject that is not at an articular joint.
32. The method of claim 31, wherein the prosthetic is implanted into a bone of the leg, arm, foot, hand, chest, or pelvis.
33. The method of any one of claims 20-32, wherein the prosthetic is a pin, post, rod, plate, spring, artificial disc, cage, or screw.
34. The method of any one of claims 20-33, wherein the prosthetic is made of polyethylene, cobalt-chromium-molybdenum, titanium or titanium alloy, stainless steel, or ceramic.
35. The method of claim 34, wherein the polyethylene is ultra-high molecular weight polyethylene or cross-linked polyethylene.
36. The method of claim 34, wherein the ceramic is zirconia or alumina.8123-111501-02 37. The method of any one of claims 20-36, wherein administration of the MBV reduces inflammation at the site of the implant.
38. The method of any one of claim 1-2 or 7-37, wherein the osteoclasts are tartrate- resistant acid phosphatase (TRAP)+ osteoclasts.
39. The method of any one of claims 1, 2, or 7-19, wherein the subject has a disease that comprises increased bone resorption.
40. The method of claim 37, wherein the disease is osteoporosis, osteopenia, Paget’s disease of bone, osteomyelitis or metastatic bone disease.
41. The method of any one of claims 1, 2, or 7-19, wherein the subject has or is at risk of osteoporosis or osteopenia and the method treats or prevents the onset of osteoporosis or osteopenia.
42. The method of any one of claims 1, 2, 7-19 or 39-41, wherein the subject has osteoporosis, and wherein the method further comprises administering to the subject an effective amount of one or more of a bisphosphonate, an antibody that specifically binds Receptor activator of nuclear factor kappa-Β ligand (RANKL), or a teriparatide.
43. The method of claim 42, wherein the antibody that specifically binds RANKL is denosumab.
44. The method of any one of claims 1, 2, or 7-19, wherein the subject has a bone fracture.
45. The method of any one of claims 1, 2, or 7-19, wherein the subject has an osteosarcoma.
46. The method of any one of claims 1-45, wherein the MBV are administered in an amount of 1x101to about 1x1020MBV per kg of body weight per administration.8123-111501-02 47. A composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo, for use in inhibiting osteoclasts in the subject according to the method of any one of claims 1-46.
48. A composition comprising an effective amount of exogenous matrix bound nanovesicles (MBV) derived from a mammalian extracellular matrix, wherein the MBV do not express CD63 and CD81 or are CD63loCD81lo, for use in treating or preventing periprosthetic osteolysis at the site of a prosthetic implant in bone or cartilage in a subject according to the method of any one of claims 3-46.
Citation Information
Patent Citations
Use of MBV for treating autoimmune diseae
WO2021081231A1