Methods of treating OTIC disorders

The development of stable hydrogel compositions for the inner ear addresses inefficiencies in current treatments by providing controlled, prolonged delivery of therapeutic agents, enhancing treatment efficacy and reducing systemic side effects.

WO2025260023A1PCT designated stage Publication Date: 2025-12-18SPIRAL THERAPEUTICS INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/033608
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-14
Filing Date
2025-06-13
Publication Date
2025-12-18

AI Technical Summary

Technical Problem

The inner ear is difficult to treat effectively due to its limited access from oral, intravenous, and intramuscular routes, leading to inefficiencies and systemic side effects, and current local treatments face challenges with anatomical barriers and rapid agent clearance, necessitating repeated injections with risks.

Method used

Development of polymer compositions that form a stable hydrogel at body temperature, allowing controlled delivery of therapeutic agents to the middle and/or inner ear, with a gelation time of 45 seconds to 30 minutes, providing extended residence time and mucoadhesive properties for localized treatment.

Benefits of technology

The hydrogel compositions enable effective, prolonged delivery of neuroprotective and chemoprotective agents to the inner ear, reducing the need for repeated injections and minimizing systemic side effects, while maintaining therapeutic levels for at least 5 days.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025033608_18122025_PF_FP_ABST
    Figure US2025033608_18122025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are polymer compositions and extended release otic agents. In one aspect, provided herein is a polymer composition including about 3% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer includes a first functional group, about 0.03% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker includes a second functional group, an active agent, wherein the active agent comprises a neuroprotective agent or a chemoprotective agent, and water, wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 45 seconds to about 30 minutes at a temperature of about 20 °C.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No: 50051-0031WO1 METHODS OF TREATING OTIC DISORDERS CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application Serial No.63 / 660,295, filed on June 14, 2024, which is incorporated by reference in its entirety. FIELD OF THE INVENTION The disclosure relates to formulations for treatment of inner ear conditions or disease, particularly solutions which form a stable hydrogel at body temperature to provide controlled delivery over a period of time of therapeutic, prophylactic and / or diagnostic agents. BACKGROUND The inner ear can be difficult to treat effectively. For example, the inner ear accounts for only 0.004% of the average circulating blood volume and is encapsulated in one of the densest bones in the body. These, combined with the presence of the blood-labyrinth barrier (BLB), limit access of most therapeutic compounds to the inner ear. Oral, intravenous, and intramuscular routes of administration can be inefficient and can require high doses, risking systemic side effects. SUMMARY This document is based, at least in part, on compositions that can be used to deliver an active agent to the middle and / or inner ear of a subject. Provided herein are polymer compositions comprising about 3% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer comprises a first functional group, about 0.03% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker comprises a second functional group, an active agent, wherein the active agent comprises a neuroprotective agent or a chemoprotective agent, and water, wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 45 seconds to about 30 minutes at a temperature of about 20 °C. Attorney Docket No: 50051-0031WO1 Also provided herein are polymer compositions comprising about 3% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer comprises a first functional group; about 0.03% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker comprises a second functional group; an active agent, wherein the active agent comprises a neuroprotective agent or a chemoprotective agent; and water, wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 45 seconds to about 30 minutes at a temperature of about 37 °C. In some embodiments, the active agent is a neuroprotective agent selected from BDNF, NT3, NGF, a neurotrophin, an agonist of TrkB, and / or an agonist of TrkC. In some embodiments, the active agent is a neuroprotective agent comprising a ROCK inhibitor selected from netarsudil, Y-27632, ripasudil, fasudil, and netarsudil-M1. In some embodiments, the active agent is a neuroprotective agent comprising netarsudil. In some embodiments, the active agent is a neuroprotective agent comprising Y-27632. In some embodiments, the active agent comprises a chemoprotective agent. In some embodiments, the chemoprotective agent is 6-Phenyl-2- thiouracil. In some embodiments, the active agent is present in an amount of about 0.5% to about 15% by weight of the polymer composition. In some embodiments, the gel, when formed in the middle ear, has a residence time of at least 5 days. In some embodiments, the gel has a gel duration of at least 5 days at 37 °C. In some embodiments, the polymer composition has a pH of about 5.5 to about 8.5. In some embodiments, the gel, following equilibration in phosphate- buffered saline (PBS) for 1 day, swells less than 100%. In some embodiments, the gel is elastic. In some embodiments, the gel is mucoadhesive. In some embodiments, the polymer composition has a viscosity of about 1 mPa·s to about 1000 mPa·s. In some embodiments, the polymer composition comprises about 6% to about 12% by weight of the polymer composition of the functional polymer. In some embodiments, the polymer composition comprises about 0.1% to about 0.3% by weight of the polymer composition of the crosslinker. In some embodiments, the polymer composition has a gelation time of about 8 minutes to about 12 minutes at a temperature of about 20 °C. In some embodiments, the gel has an osmolality of about 150 mOsmol / kg to about 450 mOsmol / kg. In some embodiments, the gel has a pH of about 6.0 to about 6.5. In some embodiments, a ratio of the first functional group to the second functional group is about 0.7:1.3 to about Attorney Docket No: 50051-0031WO1 1.3:0.7. In some embodiments, a ratio of the first functional group to the second functional group is about 1:1. In some embodiments, the first functional group comprises a succinimidyl ester. In some embodiments, the functional group is selected from the group consisting of a succinimidyl succinate, a succinimidyl glutarate, a succinimidyl adipate, a succinimidyl glutarimide, a succinimidyl carbonate, a succinimidyl carboxymethyl ester, or a combination thereof. In some embodiments, the second functional group comprises a primary amine. In some embodiments, the functional polymer is pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate. In some embodiments, the crosslinker comprises polylysine, or a salt thereof. In some embodiments, the crosslinker comprises trilysine, or a salt thereof. Also provided herein are extended release otic compositions comprising about 5% to about 15% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.05% to about 0.6% by weight of trilysine or a salt thereof; about 0.01% to about 40% by weight of a chemoprotective agent; and water. Also provided herein are extended release otic compositions comprising: about 8.3% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.2% by weight of trilysine or a salt thereof; about 12% by weight of a chemoprotective agent; and water. In some embodiments, the chemoprotective agent is 6-Phenyl-2-thiouracil. Also provided herein are extended release otic compositions comprising: about 5% to about 15% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.05% to about 0.6% by weight of trilysine or a salt thereof; about 0.01% to about 40% by weight of a neuroprotective agent; and water. Also provided herein is an extended release otic composition comprising: about 8.3% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.2% by weight of trilysine or a salt thereof; about 12% by weight of a neuroprotective agent; and water. In some embodiments, the neuroprotective agent comprises BDNF, NT3, NGF, a neurotrophin, an agonist of TrkB, and / or an agonist of TrkC. In some embodiments, the neuroprotective agent is a ROCK inhibitor comprising one of netarsudil, Y-27632, ripasudil, fasudil, and netarsudil-M1. In some embodiments, the neuroprotective agent is netarsudil. In some embodiments, the neuroprotective agent is Y-27632. In some embodiments, the extended release otic composition further comprises about 0.01% to about 3.0% by weight of sodium borate decahydrate; about 0.01% to about 3.0% by weight of sodium phosphate; about Attorney Docket No: 50051-0031WO1 0.01% to about 3.0% by weight of phosphoric acid; about 0% to about 0.5% of FD&C Blue #1; and about 0% to about 0.01% by weight of butylated hydroxytoluene. In some embodiments, the further comprising about 1.2% by weight of sodium borate decahydrate; about 1.1% to about 3.0% by weight of sodium phosphate; about 0.9% to about 3.0% by weight of phosphoric acid; about 0.01% of FD&C Blue #1; and about 0.002% by weight of butylated hydroxytoluene. In some embodiments, about 0.01% to about 6.0% by weight of sodium phosphate; about 0% to about 0.5% of FD&C Blue #1; and about 0% to about 0.01% by weight of butylated hydroxytoluene. In some embodiments, about 0.05% to about 6.0% by weight of sodium phosphate; about 0.01% of FD&C Blue #1; and about 0.002% by weight of butylated hydroxytoluene. Also provided herein is a gel formed by any one of the polymer compositions described herein or any one of the extended release otic compositions described herein. Also provided herein is a method of manufacture of a medicament comprising any one of the extended release otic compositions described herein for the treatment of an otic disease or disorder. Also provided herein is a method of treating an otic disease or disorder in a subject, the method comprising: identifying a subject as having an otic disease or disorder; and administering a therapeutically effective amount of any one of the extended release otic compositions described herein to an affected ear of the subject. Also provided herein is a method of treating an otic disease or disorder in a subject in need thereof, the method comprising administering a therapeutically effective amount of any one of the extended release otic compositions described herein to an affected ear of the subject. In some embodiments, the otic disease or disorder is selected from the group consisting of Ménière’s Disease (MD), Autoimmune Inner Ear Disease (AIED), sudden sensorineural hearing loss (SSNHL), noise-induced hearing loss (NIHL), age-related hearing loss, sensorineural hearing loss associated with diabetes, tinnitus, an autoimmune disorder, an infection, excess fluid or pressure, hearing loss due to chemotherapy, and combinations thereof. Also provided herein is a method of treating noise-induced hearing loss (NIHL), the method comprising: administering a therapeutically effective amount of any one of the extended release otic compositions described herein to an affected ear of a subject in need thereof. Attorney Docket No: 50051-0031WO1 Also provided herein is a method of treating age-related hearing loss in a subject, the method comprising: administering a therapeutically effective amount of any one of the extended release otic compositions described herein to an ear of a subject in need thereof. Also provided herein is a method of treating chemotherapy related hearing loss in a subject, the method comprising administering a therapeutically effective amount of any one of the extended release otic compositions described herein to an ear of a subject in need thereof. Also provided herein is a method of treating noise-induced hearing loss (NIHL) in a subject, the method comprising: (i) identifying a subject as having NIHL; and (ii) administering a therapeutically effective amount of any one of the extended release otic compositions described herein to an affected ear of the subject. Also provided herein is a method of treating age-related hearing loss in a subject, the method comprising: (i) identifying a subject as having age-related hearing loss; and (ii) administering a therapeutically effective amount of any one of the extended release otic compositions described herein to an affected ear of the subject. Also provided herein is a method of treating chemotherapy related hearing loss in a subject, the method comprising: (i) identifying a subject as having chemotherapy related hearing loss; and (ii) administering a therapeutically effective amount of any one of the extended release otic compositions described herein to an affected ear of the subject. In some embodiments, the administering comprises administering about 40 μL to about 60 μL of the extended release otic composition. In some embodiments, the administering comprises administering such that the extended release otic composition is in contact with the round window membrane. In some embodiments, the administering comprises administering such that the extended release otic composition fills the round window niche. Also provided herein is a method of treating an otic disorder in a subject, the method comprising: (i) identifying a presence or an absence of the subject having endolymphatic hydrops (EH); and (ii) administering a therapeutically effective amount of the any one of the extended release otic compositions described herein to an affected ear of the subject. In some embodiments, administering a therapeutically effective amount is based at least in part on the presence or absence of EH and / or Perilymphatic Enhancement. In some embodiments, the presence of EH is determined in the subject. In some embodiments, the absence is EH is determined in the subject. In some embodiments, the otic disorder is noise-induced hearing loss Attorney Docket No: 50051-0031WO1 (NIHL), age-related hearing loss, or chemotherapy-related hearing loss. In some embodiments, identifying the presence of absence of EH is determined via MRI. In some embodiments, administering the therapeutically effective amount of the extended release otic composition modulates one or more genes. In some embodiments, the one or more genes are Nrlp3, Tlr1, Tlr2, Tlr4, Tlr7, Tlr9, Ccl3, Ccl5, Ccl12, Cxcl10, Il1a, Il1b, Il6, Il18, Cd14, Lbp, FoxP3, Il10, Ccr6, C3, Cd8a, iNos, Itgam, Rag1, Tjp1, Cdh5, Marveld2, and Serpinf1. In some embodiments, the one or more genes are -catenin, TCF, LEF, Rho, Rac, JNK, PKC, CaMKII, NFAT, NICD, CSL, MAML, HES, and HEY. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The word “comprising” in the claims may be replaced by “consisting essentially of” or with “consisting of,” according to standard practice in patent law. The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the disclosure will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1A is a structure of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate. FIG.1B is a structure of trilysine. FIG.2A is a graph of the Swelling profiles (percent) over time (days) for pH adjusted PEG-trilysine polymer samples containing 0% (solid squares), 1% (open squares), 3% (diamonds), and 6% (triangles) dexamethasone (Dex) (n=3). Attorney Docket No: 50051-0031WO1 FIG.2B is a graph of cumulative Drug release (μg) for pH adjusted PEG-trilysine polymer samples containing 6% (triangle), 3% (diamonds) or 1% (squares) dexamethasone (n=3). FIG.3 is a graph of the Swelling profiles (percent swelling) for pH adjusted PEG- trilysine polymer samples, pot life 67 minutes (circles), 26 minutes (squares), or 16 minutes (triangles) containing 6 wt% dexamethasone (n=6) over time (days). FIG.4 is a graph of Drug release (μg) over time (days) for pH adjusted PEG-trilysine polymer samples containing 6 wt% dexamethasone (n=6), pot life 67 minutes (circles), 26 minutes (squares), or 16 minutes (triangles) containing 6 wt% dexamethasone (n=6) FIGS.5A-5E. Cochlear function after LPS challenge and protection by SPT-2101. FIG. 5A. Experimental design. LPS was injected intraperitoneally at 5 and 10 mg / kg in two consecutive days (denoted by ). Either SPT-2101 (denoted by †) or vehicle (denoted by ( ) was intratympanically injected 72 hours before LPS systemic injection. Auditory brainstem responses (ABR) were recorded at the beginning of the experiment (baseline) and 72 hours after LPS challenge. At this endpoint, dynamic-contrast enhanced magnetic resonance images (DCE-MRI) of the inner ear were analyzed to determine the extravasation of the gadolinium-based contrast agent injected intravenously. Similarly, cochlear samples were obtained to quantify Evans blue (EB) dye levels in the cochlea after intravenous injection. FIG. 5B. Evolution of signal enhancement (mean±SE) obtained along a DCE-MRI acquisition of 45 cycles (gadolinium injection at cycle 7) was performed 72 hours after first LPS injection in the following experimental groups: control (white circles, n=16 and denoted by Å), LPS (red circles, n=16 and denoted by ), and LPS plus SPT-2101 (green triangles, n=14 and denoted by †) or plus vehicle (orange triangles, n=14 and denoted by ). LPS induced a change in the signal enhancement profile compared to controls, suggesting an alteration in cochlear permeability. Treatment with local SPT-2101 (green †) induced a therapeutic effect and recovery of the normal signal enhancement profile. FIG. 5C. Signal enhancement obtained in cycle 30 in the experimental groups shown in panel B. FIG.5D. Evans blue concentration (mean±SD, in mg / ml) in inner ear control (white denoted by Å) and LPS-injected (red gradient denoted by ) rats 1-2, 25 and 72 hours after LPS challenge. LPS induced an increase of BLB permeability and leakage of Evans blue dye administered. FIG.5E. ABR thresholds (mean±SE, in dB SPL) before and 72 hours after LPS injection, in LPS-injected rats (red circles denoted by , n=31), and LPS-injected and Attorney Docket No: 50051-0031WO1 treated with intratympanic SPT-2101 (green triangles denoted by †, n=8 ) or vehicle (orange triangles denoted by , n=11). Statistically significant differences were calculated using Kruskal- Wallis non-parametric test (*p<0.05). FIGS.6A-6C. Time course MRI and gene expression after LPS challenge. FIG.6A. Scheme of the experimental design. LPS was injected intraperitoneally (5 and 10 mg / kg, in two consecutive days). Dynamic-contrast enhanced magnetic resonance images (DCE-MRI) of the inner ear were taken before and following LPS challenge at different times. DCE-MRI were obtained along 45 cycles with a gadolinium intravenous injection at cycle 7. FIG. 6B. Time- course of the DCE-MRI signal enhancement (mean±SE) in LPS-injected rats. LPS induced a change in the signal enhancement, an index of cochlear increased permeability, which was maintained 72 hours after the first LPS injection (n=16 rats for temporal points 0 and 72 hour; n=4 rats for 0.5, 1, 2, and 4 hours; and n=8-9 for 25 and 48 hour time points). FIG.6C. LPS injection modified cochlear gene expression. LPS induced a significant increase in the expression of Tlr2 and Cd14 LPS receptors, with an initial peak 4 hours after the first LPS dose and a second peak at 25 hours (1 hour after the second dose). Gene expression levels decreased hereafter until the 72-hour time point. LPS injection also increased the expression of inflammation genes, especially Il1b, Il1ri, Nfkb, Inos and Cse with an initial peak 1 hour (Il1b) or 2 hours (Nfkb and Inos) after the first LPS challenge and a second peak 25 hours later (Il1ri). Gene expression levels decreased hereafter until 72 hours. Tgfb showed an increased expression 28-48 hours after the first LPS injection. No differences were observed in Vegfa, Vegfb, Flk1, Flt1 and Plgf expression levels after LPS injection. Results were calculated as , using Tbp as the reference gene and normalized to control rats without LPS. At least three rats were included for each temporal point. Statistically significant differences were calculated using one- way ANOVA or Kruskal-Wallis test for normal and no-normal populations, respectively. FIGS.7A-7E. Study of the stria vascularis cellular integrity after LPS challenge. FIG. 7A. Representative rat cochlear cytoarchitecture from control (a) showing the different cochlear turns (apex, middle and base), scala vestibuli (SV), tympanic (ST) and media (SM) highlighting the Stria vascularis (Stv) in each turn. Stria vascularis enlargement following LPS administration (b-j). Paraffin midmodiolar cochlear sections stained with hematoxylin-eosin showing the stria vascularis of rats from control (left bar), LPS (middle bar) and LPS plus SPT-2101 (right bar) experimental groups, 72 hours after first LPS injection. LPS increased stria vascularis area in the Attorney Docket No: 50051-0031WO1 middle cochlear turn, with statistically significant differences compared to control rats. FIG.7B. Stria vascularis capillary network disruption and pericytes response following LPS challenge. Representative confocal maximum projections of stria vascularis whole mounts showing capillaries in red (labeled with GS-IB4) and pericytes branching in green (labeled with desmin) in control (a), LPS injected (b) and LPS-injected treated with intratympanic SPT-2101 (c). Scale bar: 25 μm. FIG.7C. Desmin coverage (%) of strial capillaries 72 hours after LPS injection assessed by Desmin / GSIB4 colocalization. LPS treatment induces pericyte activation and increases capillaries area coverage due to branching compared to control rats. However, no decrease was observed when SPT-2101 was administered following LPS injection. Values are presented as mean ± SEM.4 rats were included in each group: control (white left bar in the bar graph), LPS-injected (red middle bar in the bar graph), LPS-injected treated with intratympanic SPT-2101 (green right bar in the bar graph). Statistical significance was analyzed by either one- way ANOVA or Kruskal Wallis test following Shapiro Wilk’s and Brown-Forsythe’s tests to determine normality and homogeneity of variances respectively: (* p < 0.05; ** p< 0.01; *** p< 0.001). FIG.7D. Expression levels of tight-junction genes (Tjp1, Cdh5 and Marveld2) and pigment epithelium derived factor (Serpinf1) analyzed by RT-qPCR in control (left bar in bar graph), LPS injected (middle bar in bar graph) and LPS-injected treated with intratympanic SPT- 2101 (right bar in bar graph). 72 hours after LPS challenge Cdh25 expression was induced compared to control rats. On the other hand, Serpinf1 levels were reduced when SPT-2101 is administered compared to both, control and LPS-injected rats at the same time point. No differences were observed in Tjp1 and Marveld2 between groups. Expression levels were calculated as using Tbp as the reference gene and normalized to control rats without LPS. At least five rats were included for each group. Statistical significance was analyzed by either one-way ANOVA or Kruskal Wallis test following Shapiro Wilk’s and Brown-Forsythe’s tests to determine normality and homogeneity of variances respectively: (* p < 0.05; ** p< 0.01; *** p< 0.001). FIG.7E shows selected portions of the cochlea. FIGS.8A-8C. LPS challenge does not cause cell loss or synapse alteration. FIG.8A. Gross cochlear morphology in LPS-injected rats. Paraffin midmodiolar cochlear sections stained with hematoxylin-eosin showing the organ of corti and the spiral ganglion of cochlear middle turns of rats from control and LPS-injected, 72 hours after first LPS injection. LPS induced no evident alterations in these cochlear structures. FIG. 8B. Hair cell and synapse evaluation in Attorney Docket No: 50051-0031WO1 LPS-injected rats. Representative confocal images of the organ of corti apical (4 kHz), middle (16 kHz) and basal (32–40 kHz) turns in saline (control) and LPS-injected rats 72 hours after LPS challenge, immunolabeled for MyoVIIa (blue), CtBP2 (green), and GluR2 / 3 (red). White arrowheads indicate co-localized CtBP2-GluR2 / 3 puncta, red arrowheads indicate individual postsynaptic marker staining, and green arrowheads indicate individual presynaptic marker staining. LPS-injected rats show preserved cochlear hair sensory cells and synapsis after 72 hours. Scale bar: eight m. FIG.8C. Inner (IHC) and outer (OHC) hair cell counts in apical (4-8 kHz), middle (16-24 kHz) and basal (32–40 kHz) turns regions of the organ of Corti (control denoted by Å and n=three, LPS denoted by and n=4). FIG.8D. Quantification of synaptic elements (co-localized CtBP2-GluR2 / 3 puncta), orphan CtBP2, and GluR2 / 3 puncta per IHC in control (n=3) and LPS-injected rats (n=4). Data presented as mean ± SEM. No differences were observed neither in HCs nor IHC synapse number. FIGS.9A-9B. SPT-2101 treatment improves the LPS-induced cochlear immune response. FIG. 9A. Heatmap representation generated from the expression data (2– obtained from RT² Profiler™ PCR Array Rat Innate & Adaptive Immune Responses derived from control or LPS-injected rats 4, 25, and 72 hours after injection. At least one pooled RNA extract per group (3 cochleae from different rats) was included. The experiment was performed in duplicate. FIG.9B. shows bar graphs for each candidate gene. In each bar graph, the control is presented on the left, the LPS is presented in the middle, and the LPS+SPT2101 is presented on the right. RT-qPCR gene expression levels of candidate genes from panel A analyzed in control (white - left), LPS injected (red -right), untreated or treated with intratympanic SPT-2101 (green- right) experimental groups. Results were calculated as 2– Ct(RQ), using Tbp as the reference gene and normalized to control rats without LPS. At least three rats were included for each group. Statistical significance was analyzed by either one-way ANOVA or Kruskal Wallis test following Shapiro Wilk’s and Brown-Forsythe’s tests to determine normality and homogeneity of variances respectively: (* p < 0.05; ** p< 0.01; *** p< 0.001). FIGS.10A-10C. SPT-2101 treatment improves the LPS-induced cochlear immune response. FIG. 10A. Macrophage infiltration in the cochlea following LPS challenge. Representative confocal maximum projections of cochlear cross-cryosections immunolabeled for IBA1 showing the spiral ligament (SL) and spiral ganglion (SG) of basal (a-f), middle (g-l) and apical (m-r) turns of control, LPS injected and LPS-injected treated with intratympanic SPT- Attorney Docket No: 50051-0031WO1 2101 rats. White arrowheads highlight positive staining of macrophages and SL area is outlined in a-c. Scale bar: 50 μm. FIG.10B and FIG.10C. show bar graphs. In each bar graph, the control is presented on the left, the LPS is presented in the middle, and the LPS+SPT2101 is presented on the right. FIG. 10B and FIG.10C show IBA1 staining intensity quantification in the SG and SL respectively. LPS challenge increases macrophage infiltration, assessed by IBA1 total staining, in both SL and SG compared to control rats. Additionally, SPT-2101 treatment successfully restored macrophage presence when compared to untreated rats in both cochlear structures. No differences were observed between control and SPT-2101 treated rats. Values are presented as mean ± SEM. At least three rats of each experimental group were studied: control (white -left), LPS-injected (red -middle), LPS-injected treated with intratympanic SPT-2101 (green -right). Statistical significance was analyzed by either one-way ANOVA or Kruskal Wallis test following Shapiro Wilk’s and Brown-Forsythe’s tests to determine normality and homogeneity of variances respectively: (* p < 0.05; ** p< 0.01; *** p< 0.001). FIG.11. Serial sections of the basal turn of the cochlea are shown using a T1 FLAIR subtraction MRI image 4-6 hours after gadolinium contrast. Perilymphatic signal enhancement appears black and in this case the signal intensity is lower at week 2 compared to baseline. FIG.12. The ratio of the perilymphatic signal intensity in the treated ear to that in the untreated ear is show at baseline, week 2 and week 12. Signal intensity ratios are determined from the gadolinium contrast T1 FLAIR subtraction MRI images. FIG.13. Endoscopic view of the middle ear cavity immediately after administration of SPT-2101 showing precise placement of approximately 50 microliters of gel formulation (indicated by dashed outline) in full contact with the round window membrane and filling the round window niche (shown by bracket). FIG.14 representative T2-weighted MRI scan showing the location of SPT-2101 gel in the treated ear 2 weeks after administration. Arrows indicate the gel location in the right ear, which appears white in the T2-weighted scan. In the most superior slice shown, the gel is located adjacent to the basal turn of the cochlea, indicating gel placement at the round window. FIG.15A shows a gel made with 6% netarsudil after it has been submersed in PBS at 37°C for 7 days still containing drug and acting as a depot. FIG.15B shows netarsudil levels released from drug-containing gels after 1 and 7 days incubation in PBS at 37°C. Attorney Docket No: 50051-0031WO1 FIG.16 shows the swelling behavior of the 12% SPT-5108 over time. FIG.17 shows SPT-5108 gel performance 1 day post administration. FIGS.18A and 18B depict 6P2T levels after 1 day as compared to prior rat studies. FIG.19 depicts viscosity demonstrated during rheological measurement of SPT-2101 gels during the gelation process. DETAILED DESCRIPTION Potential side effects of systemic treatment and complications from a long lasting, higher dose therapy can be avoided through topical application therapy. Inner ear therapeutics (e.g., drugs formulated as biocompatible gels) can be delivered via intra-tympanic injections into the middle ear across the tympanic membrane (TM). Passive diffusion of agents from the middle ear to the inner ear following intra-tympanic injection into the inner ear has variable efficacy due to anatomical variations, such as the presence of pseudomembranes covering the round window membrane, failure of the injected formulation to contact the round window membrane and limited permeability of the round window and oval window membranes. This can lead to poor patient outcomes. Additionally, the risk of surgical complications is high. Further, rapid clearance of agents from the perilymph of the inner ear can result in the need for repeated intra- tympanic injections, which are also undesirable for subjects and are associated with cumulative risk of infection, inflammation, and long-term damage to the tympanic membrane, in addition to the risk of lower compliance. Local delivery of therapeutics into the inner ear usually results in higher concentrations in the inner ear fluids than would be the case with systemic application. Substances applied locally (e.g., at a lower dose than would be used for systemic administration) can be administered where there are major restrictions or even contraindications associated with systemic application; see, e.g., Salt, et al. Drug Discov Today.2005 Oct 1; 10(19): 1299–1306. Substances are applied intra-tympanically, e.g., injected through the tympanic membrane into the middle ear cavity. Without being bound by any theory, this procedure is based on the premise that the drug will contact the round window membrane (RWM) of the cochlea, enter the scala tympani (ST) and spread throughout the ear. The target tissues of such treatments can include the sensory hair cells, the afferent nerve fibers and supporting cells of the cochlea (hearing) or vestibular (balance) portions of the inner ear. Attorney Docket No: 50051-0031WO1 Anesthetics, glucocorticoids and aminoglycosides have been used to treat inner ear disorders. Currently, the most widely used form of intratympanic therapy is the injection of glucocorticoids into the middle ear in subjects with MD or sudden sensorineural hearing loss. There are also clinical reports related to the local application of gentamicin for the treatment of Ménière’s Disease. Gentamicin is toxic to the sensory cells of the balance system and thereby suppresses vertigo in some subjects by partially ablating their vestibular system. Other substances that have been tested in humans include local anesthetics, neurotransmitters and neurotransmitter antagonists. There is also interest in the administration of growth factors, antioxidants, apoptosis inhibitors and antisense-oligonucleotides. Animal experiments have shown promising results using locally applied drugs to provide otoprotection from noise and drug toxicity. One extension of such studies is local viral and non-viral gene transfer for the sustained treatment of inner ear disorders. Ménière's Disease is a chronic disorder of the inner ear typically characterized by recurrent episodes of spontaneous dizziness, fluctuating hearing loss, ringing in the ears and a feeling of fullness or congestion in the ears. These clinical symptoms can have a significant negative impact on an individual’s quality of life (QOL). There is no cure for MD and there are currently no approved pharmacological treatments available that are indicated for MD. The current treatment of MD is primarily focused on decreasing the frequency and severity of vertigo attacks, reducing tinnitus and aural fullness as well as preserving or improving hearing and QOL. There are various treatments that are prescribed that include a low- salt diet, diuretics, betahistine, oral steroids, antivirals, benzodiazepines and intratympanic (IT) injections of gentamicin or corticosteroids. In some cases, destructive surgical ablation of the cochlea or the auditory nerve can be performed. The use of corticosteroids as a promising treatment option for MD patients stems from established clinical benefit of using corticosteroids to treat other auditory disorders, such as autoimmune inner ear disease and sudden sensorineural hearing loss (SNHL) combined with the role of inflammatory and immune mechanisms in the pathophysiology of MD. In addition to their anti-inflammatory and immunosuppressive effects in the cochlea, the mechanism of action of corticosteroids in MD has also shown to increase labyrinthine circulation and improve inner ear function through ion or water transport mechanisms influencing cochlear fluid homeostasis. The corticosteroid dexamethasone has been shown to suppress inflammation by inhibiting Attorney Docket No: 50051-0031WO1 multiple inflammatory cytokines resulting in decreased edema, fibrin deposition, capillary leakage and migration of inflammatory cells. There may be significant advantages to direct middle ear drug injection for managing the symptoms of MD. The tight blood-labyrinth barrier (BLB) can allow therapeutic drug levels to be achieved in the inner ear following IT administration while minimizing systemic exposure and the adverse effects that are often associated with systemic administration. The BLB separates the inner ear from blood and regulates stria vascularis permeability, which a part of the maintenance of ionic homeostasis and the prevention of the entry of deleterious substances. A BLB dynamic is altered upon bacterial infection and its disruption or altered permeability, has been associated with other hearing pathologies as autoimmune inner ear disease, acoustic trauma, and presbycusis. In some cases, dexamethasone has been used to treat several of these disorders by using repeated systemic administration, which is some cases can cause secondary effects. The clinical use of corticosteroids to treat MD and tinnitus patients via the IT route of administration began over 30 years ago. Clinical benefit has been reported in both patient groups with no adverse reactions to the treatment. Local administration of dexamethasone, which is thought to enter the inner ear via diffusion through the round and oval window membranes, has been shown to play a role in improving hearing outcomes in patients with MD. The AAO 2020 Clinical Practice Guideline for MD describes IT steroid therapy as a treatment option for patients with active MD not responsive to noninvasive treatment (e.g., diet and lifestyle modifications), and as an alternative to IT gentamicin therapy. Local treatment with dexamethasone sodium phosphate has been established as an option in clinical practice as a result of a systematic review and a randomized controlled trial. The conclusion is that IT steroid therapy results in more benefit than harm. Ménière's Disease is a chronic disorder of the inner ear characterized by recurrent episodes of spontaneous dizziness (vertigo), fluctuating hearing loss, ringing in the ears (tinnitus) and a feeling of fullness or congestion in the ears (aural fullness). These symptoms can be debilitating and have a significant impact on QOL. Ménière's Disease typically presents as unilateral (affecting only one ear) with no observed difference in the ratio of right to left ear, but eventually affects the contralateral ear in 25-40% of cases (bilateral MD). Bilateral MD is associated with increased vestibular symptoms as well as an increased negative impact on health- Attorney Docket No: 50051-0031WO1 related QOL (Espinosa-Sanchez JM and JA Lopez-Escamez. Meniere’s disease. Handbook of Clinical Neurology 2016; 137: 257-77., nidcd.nih.gov / health / menieres-disease). The prevalence of MD is approximately 50 to 200 per 100,000 adults in the United States (US) (Basura et al. Clinical Practice Guideline: Meniere’s Disease. Otolaryngology – Head and Neck Surgery 2020, Vol.162(2S) S1-S55) with a small female predominance (Lopez-Escamez JA, Carey J, Chung WH et al. (2015). Diagnostic criteria for Meniere’s disease. J Vestib Res 25: 1-7). Although MD can occur at any age, it is more likely to affect adults between the 4th and 6th decade of life. As a result, children are rarely affected (Espinosa-Sanchez JM and JA Lopez- Escamez. Meniere’s disease. Handbook of Clinical Neurology 2016; 137: 257-77). There is no cure for MD and there are currently no approved pharmacological treatments available that are indicated for the treatment of MD. The natural course of MD is typically fluctuating auditory and vestibular acuity accompanied by periodic severe vertiginous spells and, long-term, progressive decline of both auditory and vestibular function (Basura et al., 2020). Some MD patients suffer from other disorders and comorbidities including allergic and autoimmune disorders (Espinosa-Sanchez JM and JA Lopez-Escamez. Meniere’s disease. Handbook of Clinical Neurology 2016; 137: 257-77), though a causal relationship between MD and these comorbidities has not been well-established (Gurkov R, Pyyko I, Zou J, Kentala E. What is Meniere’s disease? A contemporary re-evaluation of endolymphatic hydrops. J Neurol. 2016;263(Suppl 1):S71–81). In 1861, Prosper Ménière noted that vertigo, balance and hearing loss symptoms associated with MD were the result of a lesion of the inner ear (Basura et al., 2020). Although the underlying etiology of MD is not completely clear, it has been associated with inner ear fluid (endolymph) volume increases (hydrops), culminating in episodic ear symptoms (vertigo, fluctuating hearing loss, tinnitus and aural fullness) (Basura et al., 2020). The diagnostic criteria for MD have been jointly formulated by the Classification Committee of the Barany Society, the Japan Society for Equilibrium Research, the European Academy of Otology and Neurotology (EAONO), the Equilibrium Committee of the American Academy of Otolaryngology-Head and Neck Surgery (AAO-HNS) and the Korean Balance Society. The classification includes two categories: definite MD and probable MD (see Table 1). Attorney Docket No: 50051-0031WO1 Table 1: Diagnostic Criteria for Ménière's The management of MD is generally aimed at decreasing the frequency and severity of vertigo attacks, reducing tinnitus and aural fullness, preserving or even improving hearing and improving QOL. There are various treatments that are prescribed that include a low-salt diet, diuretics, betahistine, oral steroids, antivirals, benzodiazepines and IT injections of gentamicin or corticosteroids. In the intractable cases, destructive surgical ablation of the cochlea or the auditory nerve can be performed (Albu S, Chirtes F, Trombitas V et al. (2015). Intratympanic dexamethasone versus high dosage of betahistine in the treatment of intractable unilateral Meniere disease. Am J Otolaryngol 36: 205-209; Coelho DH, Lalwani AK. Medical management of Meniere’s disease. Laryngoscope 2008; 118:1099-108; Alarcón AV, Hidalgo LO, Arévalo RJ, Diaz MP. Labyrinthectomy and Vestibular Neurectomy for Intractable Vertiginous Symptoms. Int Arch Otorhinolaryngol.2017 Apr;21(2) 184-190. doi:10.1055 / s- 0037-1599242. PMID: 28382129; PMCID: PMC5375706). The established clinical benefit of using corticosteroids to treat other auditory disorders, such as autoimmune inner ear disease and sudden SNHL (Li H, Feng G, Wang H, Feng Y (2015). Intratympanic steroid therapy as a salvage treatment for sudden sensorineural hearing loss after failure of conventional therapy: a meta-analysis of randomized, controlled trials. Clin Ther 37: 178-187), taken together with the role of inflammatory and immune mechanisms in the pathophysiology of MD, have resulted in corticosteroids being considered as a promising treatment option in MD (Espinosa-Sanchez JM and JA Lopez-Escamez. Meniere’s disease. Handbook of Clinical Neurology 2016; 137: 257-77; Lopez-Escamez JA, Vilchez JR, Soto- Varela A et al. (2007). HLA-DRB1*1101 allele may be associated with bilateral Meniere’s disease in southern European population. Otol Neurotol 28: 891-895; Lopez-Escamez JA, Saenz- Attorney Docket No: 50051-0031WO1 Lopez P, Acosta L et al. (2010). Association of a functional polymorphism of PTPN22 encoding a lymphoid protein phosphatase in bilateral Meniere’s disease. Laryngoscope 120: 103-107; Hamid M, Trune D (2008). Issues, indications, and controversies regarding intratympanic steroid perfusion. Curr Opin Otolaryngol Head Neck Surg 16: 434-440; Hu A, Parnes LS. Intratympanic steroids for inner ear disorders: a review. Audiol Neurootol.2009;14(6):373-82). Dexamethasone, a corticosteroid, has been shown to suppress inflammation by inhibiting multiple inflammatory cytokines resulting in decreased edema, fibrin deposition, capillary leakage and migration of inflammatory cells. In addition to their anti-inflammatory and immunosuppressive effects in the cochlea, the mechanism of action of corticosteroids in MD has also shown to increase labyrinthine circulation and improve inner ear function through ion or water transport mechanisms influencing cochlear fluid homeostasis (Espinosa-Sanchez, 2016, Nevoux J, Viengchareun S, Lema I et al. (2015). Glucocorticoids stimulate endolymphatic water reabsorption in inner ear through aquaporin 3 regulation. Pflugers Arch 467: 1931-1943). There are significant advantages to direct middle ear drug injection for managing the symptoms of MD. The tight blood-labyrinth barrier allows therapeutic drug levels to be achieved in the inner ear following IT administration while minimizing systemic exposure. Animal studies demonstrate that IT delivery of corticosteroids leads to significantly higher levels of steroids in the inner ear compared with systemic administration. In addition, many adverse effects associated with systemic administration can be avoided such as osteoporosis, diabetes mellitus, hypertension, peptic ulcer, cataracts, and endocrine disorders (Espinosa-Sanchez, 2016). From a historical point of view, clinical use of corticosteroids via the IT route of administration began when Sakata et al. (1986) and ten years later when Shea et al. (Shea JJ Jr, Ge X. Dexamethasone perfusion of the labyrinth plus intravenous Dexamethasone for Meniere’s disease. Otolaryngol Clin North Am 1996;29:353–358) used them to treat MD and tinnitus patients. Clinical benefit was reported in both patient groups with no adverse reactions to the treatment. Local administration of dexamethasone, which is thought to enter the inner ear via diffusion through the round and oval window membranes, has been shown to play a role in improving the hearing in patients with MD. It is thought that the dexamethasone targets the endolymphatic sac and acts on the stria vascularis and spiral ligament, which are the known targets of immune response in the inner ear. As a result, a reduction in endolymphatic hydrops Attorney Docket No: 50051-0031WO1 (EH) is observed and fluid dynamics are restored to the endolymph (Shea et al., 1996). Following IT injection, the concentration of steroid within the perilymph has been estimated to be 260 times greater than oral administration (Devantier L, Djurhuus BD, Hougaard DD, et al. Intratympanic Steroid for Menière's Disease: A Systematic Review. Otol Neurotol.2019;40(6):806 812; Bird PA, Murray DP, Zhang M, Begg EJ. Intratympanic versus intravenousdelivery of dexamethasone and dexamethasone sodium phosphate to cochlear perilymph. Otol Neurotol 2011;32:933–6). Steroid therapy via IT delivery appears to have less risk of treatment-associated hearing loss than IT gentamicin therapy, 0% to 8% versus 12.5% to 15.4%, respectively (Basura et al., 2020; Casani AP, Piaggi P, Cerchiai N, Seccia V, Franceschini SS, Dallan I. Intratympanic treatment of intractable unilateral Meniere disease: gentamicin or dexamethasone? A randomized controlled trial. Otolaryngol Head Neck Surg.2012; 146(3):430-437; ElBeltagy Y, Shafik A, Mahmoud A, Hazaa N. Intratympanic injection in Meniere’s disease; symptomatic and audiovestibular; comparative, prospective randomized 1-year control study. Egypt J Otolaryngol. 2012;28(3):171-183; Sarafraz M, Saki N, Nikakhlagh S, Mashali L, Arad A. Comparison the efficacy of intratympanic injections of methylprednisolone and gentamicin to control vertigo in unilateral Meniere’s disease. Biomed Pharmacol J. 2015;8:705-709; Syed MI, Ilan O, Nassar J, Rutka JA. Intratympanic therapy in Meniere’s syndrome or disease: up to date evidence for clinical practice. Clin Otolaryngol. 2015;40(6):682-690). One study found a similar improvement in aural fullness with both IT steroid (38%) and IT gentamicin therapy (31%). As in sudden hearing loss, 2 systematic reviews suggest that IT steroid therapy may have a role in salvaging hearing secondary to a MD flare (Basura et al., 2020; Lavigne P, Lavigne F, Saliba I. Intratympanic corticosteroids injections: a systematic review of literature. Eur Arch Otorhinolaryngol. 2016;273(9):2271-2278; Patel M. Intratympanic corticosteroids in Meniere’s disease: a mini-review. J Otol.2017;12(3):117-124), although 1 randomized controlled trial found no benefit regarding hearing salvage (Basura et al., 2020; Silverstein H, Isaacson JE, Olds MJ, Rowan PT, Rosenberg S. Dexamethasone inner ear perfusion for the treatment of Meniere’s disease: a prospective, randomized, double-blind, crossover trial. Am J Otol.1998;19(2):196- 201). When compared with placebo or with conventional medical therapy in 1 randomized controlled trial (Basura et al., 2020; Paragache G, Panda NK, Ragunathan M, Sridhara. Attorney Docket No: 50051-0031WO1 Intratympanic dexamethasone application in Meniere’s disease—is it superior to conventional therapy? Indian J Otolaryngol Head Neck Surg. 2005;57(1):21-23) and in 3 systematic reviews (Lavigne et al., 2016; Patel, 2017; Phillips JS, Westerberg B. Intratympanic steroids for Meniere’s disease or syndrome. Cochrane Database Syst Rev.2011;(7):CD008514), IT steroid therapy generally has shown to yield greater improvement in vertigo symptoms (85%-90% vs 57%-80%). Variable benefit has been found with the associated symptoms of tinnitus and aural fullness, with 1 randomized controlled trial comparing IT steroids against placebo (Garduno- Anaya MA, Couthino De Toledo H, Hinojosa-Gonzalez R, Pane-Pianese C, Rios-Castaneda LC. Dexamethasone inner ear perfusion by intratympanic injection in unilateral Meniere’s disease: a two-year prospective, placebo-controlled, double-blind, randomized trial. Otolaryngol Head Neck Surg 2005;33:285-94) showing improvement in tinnitus (48% vs 20%), hearing loss (35% vs 10%), and fullness (48% vs 20%). Initial work with a sustained-release form of dexamethasone has documented a reduction in vertigo frequency with 3 mg and 12 mg doses (56% and 73%, respectively) when compared with placebo (42%), with similar reductions in tinnitus (Basura et al., 2020; Lambert PR, Nguyen S, Maxwell KS, et al. A randomized, double-blind, placebo-controlled clinical study to assess safety and clinical activity of OTO-104 given as a single intratympanic injection in patients with unilateral Meniere’s disease. Otol Neurotol.2012;33(7):1257-1265). A subsequent study reported reduced vertigo severity that was not statistically significant as compared with placebo and no difference in tinnitus perception (Basura et al., 2020; Lambert et al., 2016). Statistically significant reduction in average number of daily vertigo attacks and number of vertigo days per month was noted (Basura et al., 2020; Lambert et al., 2016). Overall, IT steroid therapy is well tolerated with low side effects and / or complications. The most frequently cited complications are post-procedure otitis media (7%) (Basura et al., 2020; Patel et al., 2016) and persistent tympanic perforation (3%-38%) (Basura et al., 2020; Lambert et al., 2012; Lambert PR, Carey J, Mikulec AA, LeBel C. Intratympanic sustained-exposure dexamethasone thermosensitive gel for symptoms of Meniere’s disease: randomized phase 2b safety and efficacy trial. Otol Neurotol. 2016;37(10):1669-1676). As noted by Basura et al. (2020), the effectiveness of IT steroid therapy has been challenging to assess due to the variability in treatment protocols. Number of doses, time between doses, length of follow-up, and the effects on vertigo control, tinnitus, and aural fullness Attorney Docket No: 50051-0031WO1 vary considerably (Syed MI, Ilan O, Nassar J, Rutka JA. Intratympanic therapy in Meniere’s syndrome or disease: up to date evidence for clinical practice. Clin Otolaryngol.2015;40(6):682- 690). Steroid therapy via IT delivery may be considered an alternative for oral steroid therapy (Basura et al., 2020; Morales-Luckie E, Cornejo-Suarez A, Zaragoza-Contreras MA, Gonzalez- Perez O. Oral administration of prednisone to control refractory vertigo in Meniere’s disease: a pilot study. Otol Neurotol. 2005;26(5):1022-1026; Phillips et al., 2011; Doyle KJ, Bauch C, Battista R, et al. Intratympanic steroid treatment: a review. Otol Neurotol.2004;25(6):1034- 1039; Morgan AE, Ismail EI, Ashraf B. Intratympanic injections of dexamethasone in delayed endolymphatic hydrops: a prospective clinical study. ORL J Otorhinolaryngol Relat Spec.2018; 80(1):19-27) and IT gentamicin therapy (Basura et al., 2020; Casani AP, Piaggi P, Cerchiai N, Seccia V, Franceschini SS, Dallan I. Intratympanic treatment of intractable unilateral Meniere disease: gentamicin or dexamethasone? A randomized controlled trial. Otolaryngol Head Neck Surg.2012; 146(3):430-437; ElBeltagy et al., 2012; Patel et al., 2016; Sarafraz et al., 2015). Oral steroids have significant risk of side effects (Basura et al., 2020; Stachler RJ, Chandrasekhar SS, Archer SM, et al. Clinical practice guideline: sudden hearing loss. Otolaryngol Head Neck Surg.2012;146(3):S1-S35; Doyle et al., 2004) and patients with usable hearing may be hesitant to undergo an ablative inner ear therapy, such as IT gentamicin, with a known potential for hearing loss. Therefore, there is a significant role for patient preference when offering IT steroid therapy (Basura et al., 2020; Radtke A, Lempert T, Gresty MA, Brookes GB, Bronstein AM, Neuhauser H. Migraine and Meniere’s disease: is there a link? Neurology.2002;59(11):1700-1704). Intratympanic delivery can be a minimally invasive injection performed in the office setting that offers a potential direct route of administration (Piu F, Wang X, Fernandez R, Dellamary L, Harrop A, Ye Q, Sweet J, Tapp R, Dolan DF, Altschuler RA, Lichter J, LeBel C. OTO-104: a sustained-release dexamethasone hydrogel for the treatment of otic disorders. Otol Neurotol.2011 Jan;32(1):171-9). Over the years, there have been several clinical investigations evaluating the safety and efficacy of IT administration of corticosteroids in MD patients. The safety, tolerability and clinical activity of a single IT injection of 12 mg of dexamethasone (n=93) was evaluated in two recent clinical studies in patients with unilateral MD. Results demonstrated that dexamethasone (formulated in a buffered solution containing a glycol polymer, poloxamer 407) was safe, well- Attorney Docket No: 50051-0031WO1 tolerated and showed promising improvement in vertigo endpoints supportive of moving this program into a Phase 3 which is currently ongoing. (Lambert PR, Nguyen S, Maxwell KS, et al. A randomized, double-blind, placebo-controlled clinical study to assess safety and clinical activity of OTO-104 given as a single intratympanic injection in patients with unilateral Meniere’s disease. Otol Neurotol. 2012;33(7):1257-1265; Lambert PR, Carey J, Mikulec AA, LeBel C. Intratympanic sustained-exposure dexamethasone thermosensitive gel for symptoms of Meniere’s disease: randomized phase 2b safety and efficacy trial. Otol Neurotol. 2016;37(10):1669-1676). In a Phase 1b study, 16 patients received a single IT injection of 12 mg dexamethasone, 14 patients received 3 mg dexamethasone and 14 received placebo. There were no deaths, no serious adverse events (SAEs) and no adverse events (AEs) leading to discontinuation from this study. There were also no adverse findings in laboratory measurements, physical examination, vital signs or electrocardiogram (ECG) (Lambert et al., 2012). In this study, most patients had at least 1 treatment-emergent adverse event (TEAE). The only prespecified AE of interest that was observed in more than 1 patient was perforation of the tympanic membrane (TM). At the end of this study, the incidence of TM perforation was 3% in patients who received dexamethasone (either 3 mg or 12 mg). Perforation of the TM has been observed in other studies using IT injection (Lambert et al., 2012; Rauch SD, Halpin CF, Antonelli PJ, et al. Oral vs intratympanic corticosteroid therapy for idiopathic sudden sensorineural hearing loss: a randomized trial. JAMA 2011;305:2071-79; Herraiz C, Plaza G, Aparicio JM, et al. Transtympanic steroids for Meniere’s disease. Otol Neurotol 2010;31:162-7) and most perforations resolved spontaneously (Lambert et al., 2012; Muehlmeier G, Biesinger E, Maier H. Safety of intratympanic injection of AM-101 in patients with acute inner ear tinnitus. Audiol Neurotol 2011;16:388-97). In a Phase 2b study, 77 patients received a single IT injection of 12 mg dexamethasone and 77 patients received placebo. Most AEs were mild or moderate in severity and no TEAE resulted in patient discontinuation in this study. Results of the safety assessments in this study (otoscopy, audiometry, tympanometry, vital signs, clinical laboratory evaluations, word recognition and the Columbia-Suicide Rating Scale (C-SSRS)) support continued evaluation of IT injection of corticosteroids as they appear to be well-tolerated; no new risks were identified. Persistent TM perforations were observed in two dexamethasone-treated patients at the end of Attorney Docket No: 50051-0031WO1 this study which is consistent with perforations observed following IT administration of a corticosteroid (Lambert et al., 2016; Garduno-Anaya MA, Couthino De Toledo H, Hinojosa- Gonzalez R, Pane-Pianese C, Rios-Castaneda LC. Dexamethasone inner ear perfusion by intratympanic injection in unilateral Meniere’s disease: a two-year prospective, placebo- controlled, double-blind, randomized trial. Otolaryngol Head Neck Surg 2005;33:285-94; Silverstein H, Farrugia M, Van Ess M. Dexamethasone inner ear perfusion for subclinical endolymphatic hydrops.Ear Nose Throat J 2009;88:778-85; Kitahara T, Kubo T, Okumura S, Kitahara M. Effects of endolymphatic sac drainage with steroids for intractable Meniere’s disease: a long-term follow-up and randomized controlled study. Laryngoscope 2008;118:854- 61; Herraiz C, Plaza G, Aparicio JM, et al. Transtympanic steroids for Meniere’s disease. Otol Neurotol 2010;31:162-7; Rauch SD, Halpin CF, Antonelli PJ, et al. Oral vs intratympanic corticosteroid therapy for idiopathic sudden sensorineural hearing loss: a randomized trial. JAMA 2011;305:2071-79). EH is generally accepted as the pathologic hallmark of MD although the etiology of the disease remains unclear. In 2010, Naganawa et al. (Naganawa, S. et al. Visualization of endolymphatic hydrops in Meniere’s disease with single-dose intravenous gadolinium-based contrast media using heavily T(2)-weighted 3D-FLAIR. Magn Reson Med Sci 9, 237–242 (2010)) developed an IV- gadolinium (Gd) enhanced inner ear MRI which visualized EH in patients with MD. The IV-Gd enhanced inner ear MRI is minimally invasive, has a relatively short waiting time (4 hours) and can visualize both inner ears simultaneously which enables identification of asymptomatic EH in the opposite ear. Cho YS et al. (Cho YS, Ahn JM, Choi JE, et al. Usefulness of Intravenous Gadolinium Inner Ear MR Imaging in Diagnosis of Ménière's Disease. Sci Rep. 2018;8(1):17562. Published 2018 Dec 3. doi:10.1038 / s41598-018-35709-5) conducted a clinical study that aimed to investigate the usefulness of the IV-Gd enhanced inner ear MRI in diagnosing MD to find a correlation between the degree of EH and the audiovestibular tests. The results demonstrate appropriate correlations with auditory vestibular functional testing which show the usefulness of IV-Gd inner ear MRI as a diagnostic method for visualizing the EH in MD. Despite these findings, EH is currently not part of the diagnostic criteria for definite MD. To improve the diagnostic accuracy in patients with suspected MD based on imaging, recent studies have introduced perilymphatic enhancement (PE) as an additional MD- Attorney Docket No: 50051-0031WO1 discriminating parameter. What remains unclear, however, is the presence and value of PE in other vertigo-associated inner ear pathology (VAIEP). In February 2020, JM van Steekelenburg et al published a retrospective analysis of 220 patients (median age, 55.8) with inner ear pathology, suspected of having MD. The purpose of this study was to evaluate the presence of EH and the additional value of PE in the diagnosis of patients with MD and in patients with other VAIEP not attributable to MD (Van Steekelenburg JM, van Weijnen A, de Pont LMH, Vijlbrief OD, Bommeljé CC, Koopman JP, Verbist BM, Blom HM, Hammer S. Value of Endolymphatic Hydrops and Perilymph Signal Intensity in Suspected Ménière Disease. AJNR Am J Neuroradiol. 2020 Mar;41(3):529-534. doi: 10.3174 / ajnr.A6410. Epub 2020 Feb 6). The results showed that increased PE was more prevalent in definite and probable MD ears compared with other VAIEP ears (p<.001 and p=.003, respectively) and asymptomatic ears (both, p<.001). Since vestibular or cochlear EH or both were present in 91.9% of the definite MD ears, this study emphasizes the relevance of EH as a hallmark of definite MD. Compared with asymptomatic ears, the definite MD ears showed increased PE both visually and in quantitative measurements. This study also demonstrates the value of delayed Gd enhanced 3D-FLAIR MRI in diagnosing MD in a cohort with a wide range of VAIEP showing that the combination of EH and increased PE is uncommon in patients with other VAIEP. These findings have the potential to help differentiate patients with vertigo attributable to MD (van Steekelenburg et al, 2020). Off-label IT steroid injections are often administered in MD patients. However, the therapeutic benefit is limited, at least in part, by rapid clearance of solution formulations from the middle ear, uncertain middle ear placement of drug formulations because the injections are “blind”, and the presence of membranous barriers and air pockets in the middle ear. Current MD treatment guidelines (Basura, 2020), suggest compounded dexamethasone sodium phosphate or methylprednisolone sodium succinate solutions be administered in 3 to 4 sessions every 3 to 7 days. Suspension gel formulations of dexamethasone have shown promise in the amelioration of vertigo symptoms in MD patients (Lambert 2012, 2016), but even such thermoresponsive gel formulations have been shown to clear from the middle ear within days after administration (Piu2011). Pseudomembranes (false membranes) are present in 42% of ears ( ahin B, Orhan KS,Asl yüksek H, Kara E, Büyük Y, Güldiken Y. Endoscopic evaluation of middle ear anatomicvariations in autopsy series: analyses of 204 ears. Braz J Otorhinolaryngol.2020 Jan- Attorney Docket No: 50051-0031WO1 Feb;86(1):74-82), limiting the contact with the round window membrane of rapidly clearing and randomly placed formulations. However, currently available formulations for intra-tympanic delivery have short middle ear residence times and usually require multiple administrations to achieve the desired effects in the inner ear. The short residence of these formulations may result in a lack of uniform drug distribution and release, with poor pharmacokinetics. Therefore, it is an object to provide formulations with beneficial effects that can be administered for sustained intra-tympanic delivery of therapeutic, prophylactic, or diagnostic agents over a period of days into the inner ear, providing controlled release and pharmacokinetics while minimizing risk of systemic exposure and reducing the need for repeated administrations. I. Definitions Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The word “comprising” in the claims may be replaced by “consisting essentially of” or with “consisting of,” according to standard practice in patent law. The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the disclosure will be apparent from the description and drawings, and from the claims. “Active agent” and “active pharmaceutical ingredient” are used interchangeably and refer to a physiologically and / or pharmacologically active substance that acts locally and / or systemically in the body. An active agent is a substance that is administered to a subject for the treatment (e.g., glucocorticoids or antiangiogenics), prevention (e.g. antiapoptotics), or diagnosis (e.g. gadolinium) of a disease or disorder. Attorney Docket No: 50051-0031WO1 The term “AUC” or “area under the curve” in the field of pharmacokinetics is the definite integral in a plot of active agent concentration in blood plasma versus time. In practice, the active agent concentration is typically measured at certain discrete points in time and the trapezoidal rule is used to estimate AUC. The AUC of an active agent is typically used to evaluate the exposure of a subject to an active agent over time. The term “auditory brainstem response” or “ABR” refers to an auditory evoked potential extracted from ongoing electrical activity in the brain and recorded via electrodes placed on, for example, the scalp. ABR is considered an exogenous response because it is dependent on external factors. The term “blood labyrinth barrier” or “BLB” refers to the barrier between the vasculature and the inner ear fluids, either endolymph or perilymph. The BLB is involved in the maintenance of the inner ear fluid ionic homeostasis. The term “BLLQ” is an abbreviation for “below the lower limit of quantification” and is defined as below the lowest standard on a calibration curve. The term “Cmax” refers to the maximum (or peak) serum concentration that an active agent achieves (e.g., systemically, or in a specified compartment or test area of the subject) after the active agent has been administered. In some embodiments, Cmaxis measured before the administration of a second dose of the active agent. The term “Cmin” refers to the minimum (or trough) serum concentration that an active agent achieves (e.g., systemically, or in a specified compartment or test area of the subject) after the active agent has been administered. In some embodiments, Cmin is measured before the administration of a second dose of the active agent. The term “cytocochleogram” refers to a graphic representation of the anatomical state of the hair cells along the complete width and length of the organ of Corti. The abbreviation “DDI” refers to drug-drug interaction. The term “degree of functionalization” when referring to polymers that can participate in crosslinking, is the number of functional groups per appropriate polymeric unit (e.g., polymer chain, branch, or monomer) that are suitable for crosslinking using a given crosslinker. For example, if a polymer has one or more functional group(s) per monomer, then the appropriate polymeric unit is a monomer. As another example, if a polymer has one or more functional group(s) per branch terminus, then the appropriate polymeric group is a branch. It will be further Attorney Docket No: 50051-0031WO1 understood that a degree of functionalization, in some cases, can be less than one, for example, if a subpopulation of the functional groups have degraded. The term “drug absorption” or “absorption” refers, typically, to the process of movement of the active agent from the localized site of administration to a site of therapeutic effect. In some cases, drug absorption can be through the round window niche of the cochlea, and across a barrier (e.g., the round window membrane) into one or more inner ear structures. The term “co- administration”, as used herein, are meant to encompass, generally, administration of two or more active agents to a single subject, and are intended to include prevention regimens in which the active agents are administered by the same or different route of administration or at the same or different time. The term “elastic”, as used herein with reference to a gel, can mean that the gel demonstrates elasticity, e.g., resisting a distorting force and returning to its original size and shape when the force is removed. An elastic modulus can be measured, in some cases, by oscillatory rheology. The phrase “effective amount” or “effective concentration” means an amount of active agent that, when at a site of action, is sufficient to (i) treat a disease or disorder, (ii) attenuate, ameliorate, or eliminate one or more symptoms of the particular disease, condition, or disorder, or (iii) delay the onset of one or more symptoms of the particular disease, condition, or disorder described herein. The amount of an active agent that will correspond to such an amount will vary depending upon factors such as the particular active agent, disease condition and its severity, the identity (e.g., age and / or weight) of the patient in need of treatment, but can nevertheless be routinely determined by one skilled in the art. The terms “effective amount” or “therapeutically effective amount,” as used herein, can refer to a sufficient amount an active agent at a site of action that would be expected to relieve to some extent one or more of the symptoms of the disease or condition being treated. In some embodiments, an effective amount of an active agent is a quantity necessary to render a desired anti-inflammatory result at a site of action. The term “therapeutically effective amount” includes, for example, an “effective amount” of an active agent to achieve a desired pharmacologic effect without undue adverse side effects. The phrase “effective dose” means an amount of active agent that, when administered to a patient in need of such treatment, is sufficient to (i) treat a disease or disorder, (ii) attenuate, ameliorate, or eliminate one or more symptoms of the particular disease, condition, or disorder, Attorney Docket No: 50051-0031WO1 or (iii) delay the onset of one or more symptoms of the particular disease, condition, or disorder described herein. In some embodiments, an “effective dose” is an amount of active agent, when administered to a patient in need of such treatment, achieves a sufficient concentration at a site of action to (i) treat a disease or disorder, (ii) attenuate, ameliorate, or eliminate one or more symptoms of the particular disease, condition, or disorder, or (iii) delay the onset of one or more symptoms of the particular disease, condition, or disorder described herein for a period of time. The dose of an active agent that will correspond to such an amount will vary depending upon factors such as the particular active agent, disease condition and its severity, the identity (e.g., age and / or weight) of the patient in need of treatment, but can nevertheless be routinely determined by one skilled in the art. The terms “effective dose” or “therapeutically effective dose,” as used herein, can refer to a sufficient amount of an active agent being administered that would be expected to relieve to some extent one or more of the symptoms of the disease or condition being treated. In some embodiments, an effective dose of an active agent is a quantity necessary to render a desired anti-inflammatory result. The term “therapeutically effective dose” includes, for example, an “effective dose” of an active agent to achieve a desired pharmacologic effect without undue adverse side effects. It will also be understood that “an effective dose” in an extended-release dosing format may differ from “an effective dose” in an immediate-release dosing format based upon pharmacokinetic and / or pharmacodynamic considerations. The term “enhance” or “enhancing,” can refer to an increase in potency or a prolongation of a desired effect. In some cases, “enhance” or “enhancing” can also refer to a decrease of one or more adverse effects associated with an active agent. For example, in reference to enhancing the effect of the active agents disclosed herein, the term “enhancing” can refer to the ability to increase the potency or prolong the duration of effect of the active agent by an anti-inflammatory agent. An “enhancing-effective amount,” as used herein, refers to an amount of an agent that is adequate to enhance the effect of an active agent in a desired system. The amount of an agent that will correspond to such an amount will vary depending upon factors such as the particular active agent, disease condition and its severity, the identity (e.g., age and / or weight) of the patient in need of treatment, but can nevertheless be routinely determined by one skilled in the art. The term “a gel” refers to a semisolid composition. In some embodiments, a gel can be differentiated from a liquid by assessing flow under gravity, for example, by performing a Attorney Docket No: 50051-0031WO1 gelation reaction in a vial, then inverting the vial. In some assessments, a visual inspection can confirm whether there is still flow of the composition. In some cases, a gravimetric assessment can be performed after inverting a vial and wiping off liquid from a sample in an insert. In some cases, a gel can be differentiated from a liquid by the ability of the composition to prevent a stir bar from spinning (e.g., a 7x2 mm PTFE stir rod with about 0.2 to about 1 mL of a composition in a 2 mL vial). In some embodiments, a gel can be differentiated from a liquid by having an elastic modulus. In some embodiments, formation of a gel can be determined by a rapid change in the ordinate value when plotting the ratio of storage modulus to loss modulus (G’’ / G’) vs time (t). In some embodiments, a gel can be differentiated from a liquid by analyzing its cohesion, for example, by drop weight or compression force (see, e.g., Edsman, Katarina LM, et al. "Is there a method that can measure cohesivity? Cohesion by sensory evaluation compared with other test methods." Dermatologic Surgery 41 (2015): S365-S372 and Edsman, Katarina LM, and Åke Öhrlund. "Cohesion of hyaluronic acid fillers: correlation between cohesion and other physicochemical properties." Dermatologic Surgery 44.4 (2018): 557, both of which are incorporated by reference herein in their entireties). The term “to gel” refers to the formation of a gel. Typically, a gel is formed by gelation of a liquid composition. The term “gel duration” refers to the amount of time a gel lasts before being degraded, dissolved, or turning back into a solution. In some cases, gel duration is measured by placing a gel into a vial and storing at room temperature, at 37 °C, or at an accelerated condition of 50 °C. In some cases, gel duration is measured by placing a gel (e.g. at least 1 mL) in a receptor solution (e.g., pH 7.4 PBS) at 37 °C (or at an accelerated condition of 50 °C), optionally periodically changing the receptor solution. The term “gelation time” refers to the amount of time it takes, after combining all appropriate components, for a composition to form a gel. In some cases, the gelation time can be determined by measuring the time it takes to achieve one or more of the properties of a gel as defined herein. In some embodiments, the gelation time can be determined by measuring the time it takes for a stir bar to stop spinning in a container in which gelation occurs. The term “GLP” refers to “good laboratory practice” and is a set of principles intended to assure the quality and integrity of non-clinical laboratory studies. Attorney Docket No: 50051-0031WO1 The term “hERG” can refer to a human ether-a-go-go-related gene that encode a protein that is the alpha subunit of a potassium ion channel. In some cases, the ion channel that includes this subunit is also called hERG. The term “IC50” refers to the concentration of an inhibitor at which an assayed outcome is reduced by 50%. The term “inhibit” can mean to reduce or decrease an activity (e.g., signaling activity) or expression (e.g., of a gene or gene product). The term can also include preventing, slowing, or reversing the development of a disease or condition or the advancement of a disease or condition in a subject. In some cases, inhibition can be partial. In some cases, inhibition can be complete. In some embodiments, a level of inhibition can be determined based on comparison to a control or to a standard level. The term “macromolecule” generally refers to a molecule that greater than 1500 g / mol, greater than about 2000 g / mol, or greater than about 2500 g / mol. In some forms, a macromolecule can be polymeric and / or oligomeric. The term “MRSD” or “maximum recommended starting dose” refers to the highest amount of an agent that can be given safely and without complication while maintaining its efficacy. The term “MTD” or “maximum tolerated dose” refers to the highest dose of a drug or prevention that does not cause unacceptable side effects. The term “mucoadhesion” as used herein, can refer to adhesion between two materials, one of which is a mucosal surface. The term “NOAEL” refers to “no observed adverse effect level” and can be an important part of the non-clinical risk assessment. The terms “otic” and “auris” refer to relating to the ear. For example, an otic composition can be a composition intended for administration to the ear. The term “pharmaceutically acceptable” indicates that the compound, or salt or composition thereof is compatible chemically and / or toxicologically with the other ingredients comprising a formulation and / or the patient being treated therewith. In some embodiments, a pharmaceutically acceptable salt can be a salt that conserves the efficiency and / or the biological properties of the free bases or free acids. In some embodiments, a pharmaceutically acceptable salt can be a salt that change the efficiency and / or the biological properties of the free bases or Attorney Docket No: 50051-0031WO1 free acids; for example, a pharmaceutically acceptable salt can improve the bioavailability of a free base or free acid. The term “pharmaceutical combination”, as used herein, refers to a pharmaceutical therapy resulting from the mixing or combining of more than one active agent and includes both fixed and non-fixed combinations of the active agents. The term “fixed combination” means that a first active agent or a pharmaceutically acceptable salt or solvate thereof and at least one additional active agent, are both administered to a patient simultaneously in the form of a single composition or dosage. The term “non-fixed combination” means that a first active agent or a pharmaceutically acceptable salt or solvate thereof and at least one additional active agent are formulated as separate compositions or dosages, such that they may be administered to a subject in need thereof simultaneously, concurrently or sequentially with variable intervening time limits, using the same or different routes of administration, wherein such administration provides effective levels of the two or more compounds in the body of the subject. In one embodiment, the first active agent and the second active agent are formulated as separate unit dosage forms, wherein the separate dosage forms are suitable for either sequential or simultaneous administration. These also apply to cocktail therapies, e.g., the administration of three or more active ingredients. The term “pot life”, as used herein when referring to a solution or suspension containing moiety that includes an electrophile that can form crosslinks with a nucleophile (e.g., a succinimidyl ester-functionalized PEG), refers to the time since the moiety was made into the solution or suspension (e.g., from a powder or a solid). The term “auris-acceptable penetration enhancer” or “penetration enhancer” refers to an agent that reduces barrier resistance (e.g., barrier resistance of the round window membrane). The term “prophylactically effective amount” means an amount of active agent that, when administered to a patient in need of such treatment and at a site of action, is sufficient to (i) prevent a disease or disorder, (ii) attenuate, ameliorate, or eliminate one or more symptoms of the particular disease, condition, or disorder, before it occurs. In some cases, a “prophylactically effective amount” refers to an amount of a composition at a site of action, having been administered to a subject susceptible to or otherwise at risk of a particular disease, disorder or condition, for example, a prophylactically effective amount of an active agent can be an amount effective to prevent or to attenuate ototoxicity at a site of action. Attorney Docket No: 50051-0031WO1 The term “prophylactically effective dose” means an amount of active agent that, when administered to a patient in need of such treatment, is sufficient to (i) prevent a disease or disorder, (ii) attenuate, ameliorate, or eliminate one or more symptoms of the particular disease, condition, or disorder, before it occurs. In some cases, a “prophylactically effective dose” refers to an amount of a composition administered to a subject susceptible to or otherwise at risk of a particular disease, disorder or condition, for example, a prophylactically effective amount of an active agent can be an amount effective to prevent or to attenuate ototoxicity. For example, an apoptotic inhibitory formulation may be administered to an individual prior to chemotherapy to prevent hearing loss by a subsequently administered chemotherapeutic agent. The term “residence time” as used herein can refer to the amount of time that a formulation remains in the location of administration. In some embodiments, residence time can be the time when there is no gel visualized on the round window membrane area, e.g., after collecting the gel at a time after injection. The term “room temperature” refers to a temperature between about 15 °C and less than about 27 °C, preferably about 20°C. The term “body temperature” refers to a temperature between about 36.5 °C and about 37.5 °C, preferably about 37 °C. As used herein, the terms “subject,” “individual,” or “patient,” are used interchangeably, refers to any animal, including mammals such as mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, primates, and humans. In some embodiments, the patient is a human. In some embodiments, the subject has experienced and / or exhibited at least one symptom of the disease or disorder to be treated and / or prevented. “Small molecule” generally refers to a molecule that is less than about 1500 g / mol, less than about 1000 g / mol, less than about 800 g / mol, or less than about 500 g / mol. In some forms, small molecules are non-polymeric and / or non-oligomeric. In some embodiments, a small molecule can be organic. In some embodiments, a small molecule can be inorganic. In some embodiments, a small molecule can include both organic and inorganic atoms. “Steady state,” can refer to when the amount of drug administered (e.g., auris media and / or auris interna) is equal to the amount of drug eliminated within one dosing interval resulting in a plateau or constant levels of drug exposure within the targeted structure. Attorney Docket No: 50051-0031WO1 “Stable” as used herein can refer to chemical and / or physical stability over a time period under defined conditions. In some embodiments, a stable solution can retain a high percentage or all of what was originally dissolved remaining in solution. In some embodiments, a solution can retain more than 60, 70, 80, 90, 95, 98, 99, or 100% of the originally dissolved solute at room temperature (approximately 15-25°C, most preferably 25°C). “Sustained release” as used herein refers to release of a substance over an extended period of time. In some embodiments, this can be contrasted with to a bolus type administration in which the entire amount of the substance is made biologically available at one time. “Swelling” of a gel as used herein can refer to a percent increase in gel weight after equilibration with phosphate-buffered saline (PBS). Swelling of a gel can be measured, for example, by preparing a gel inside an insert, recording initial gel weight, allowing gel to form at room temperature for about 20 to 60 minutes, submerging in PBS (PBS volume at least 5X volume of gel) (e.g., pH 7.4) and storing at 37 °C, removing the gel-filled insert after 1-3 days, and recording weight after wiping off surface fluid, followed by a calculation of the increase in gel weight normalized by the initial gel weight. The term “Tmax” refers to the time it takes a drug or other substance to reach the maximum concentration Cmax. The term “transtympanic” or “intratympanic” administration refers to the administration of an active agent via the tympanic cavity, in some cases, via a hypodermic needle that accesses the tympanic cavity (middle ear) by penetrating the tympanic membrane (eardrum). As used herein, terms “treat” or “treatment” refer to therapeutic or palliative measures. Beneficial or desired clinical results include, but are not limited to, alleviation, in whole or in part, of symptoms associated with a disease or disorder or condition, diminishment of the extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state (e.g., one or more symptoms of the disease), and remission (whether partial or total), whether detectable or undetectable. The term “unit dosage form” refers to physically discrete units suitable as unitary dosages for human subjects and other patients, each unit containing a predetermined quantity of active material (i.e., an active agent as provided herein) calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient. Attorney Docket No: 50051-0031WO1 The terms “prevent,” “preventing” or “prevention,” as used herein means the prevention of the onset, recurrence or spread, in whole or in part, of a disease or condition as described herein, or a symptom thereof. II. Extended Release Otic Compositions Provided herein are otic compositions (e.g., an extended release otic composition) comprising a polymer composition as provided herein and an active agent. Otic (sometimes also called auris) compositions have been developed for extended release, either continuously or in a pulsatile manner, or variants of both, of therapeutic, prophylactic and / or diagnostic agent(s) within the ear. In some embodiments, an extended release otic composition as described herein can increase the area under the curve (AUC) of the agent being delivered in otic fluids (e.g., endolymph and / or perilymph) by about 30%, about 40%, about 50%, about 60%, about 70%, about 80% or about 90% compared to a composition that is not an extended release otic composition. The extended release compositions can, in some cases, decrease the Cmaxin otic fluids (e.g., endolymph and / or perilymph) by about 40%, about 30%, about 20%, or about 10%, compared to a composition that is not an extended release otic composition. This can reduce the ratio of Cmaxto Cmincompared to a composition that is not an extended release otic composition. Therefore, in some embodiments, an extended release otic composition can provide a more constant release of an active agent. In certain implementations, the ratio of Cmax to Cmin can be 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1 or 1:1. The length of time that the concentration of an otic agent is above Cmin can be increased by about 30%, about 40%, about 50%, about 60%, about 70%, about 80% or about 90% compared to a composition that is not an extended release otic composition. In certain instances, an extended release composition can delay the time to Cmax, and / or prolong the time the concentration of the drug will stay above the Cmin. In some forms, extended release otic compositions prolong the residence time of a drug in the inner ear. In some instances, sustained delivery to the middle and / or inner ear can be achieved because the extended release otic composition is provided in the form of a gel. In some such embodiments, the gel can remain intact at a preferred location, such as the round window membrane, for extended periods of time. In some embodiments, the extended release otic composition in the form of a gel can extend residence times by at least about two-fold, four-fold, Attorney Docket No: 50051-0031WO1 ten-fold, or twenty-fold and this can lead to increases of AUC by about two-fold, four-fold, ten- fold, or twenty-fold compared to a composition that is not an extended release otic composition. In some embodiments, once the concentration in the endolymph or perilymph of a drug reaches steady state, the concentration of the active agent in the endolymph or perilymph stays at or about an effective concentration for an extended period of time (e.g., one day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months). In some embodiments, extended release otic compositions can have at least two components: an active agent (e.g., a therapeutic, prophylactic and / or diagnostic agent); a gel forming polymer composition (e.g., including a functional polymer, a crosslinker, and water); and optionally one or more excipients, which together form an extended release otic composition. A. Therapeutic, Prophylactic and Diagnostic Agents In some embodiments, extended release otic compositions are useful for localized therapy, prophylaxis, and / or diagnosis. A therapeutically active, prophylactically active, diagnostic or visualization agent, or combination thereof can be delivered from the extended release otic composition, for instance, from a crosslinked polymer or gel formed following administration of the extended release otic composition. An active agent can be any appropriate active agent. In some embodiments, an active agent can be a therapeutic agent. In some embodiments, an active agent can be a prophylactic agent. In some embodiments, an active agent can be a diagnostic or visualization agent. In some embodiments, an active agent can include a diagnostic or visualization agent and a therapeutic agent. In some embodiments, an active agent can include a diagnostic or visualization agent and a prophylactic agent. An active agent can include, for example, a protein (e.g., an enzyme, a growth factor, an antibody or an antigen-binding fragment thereof), a carbohydrate (e.g., a glycosaminoglycan), a nucleic acid (e.g., an antisense oligonucleotide, an aptamer, a micro RNA, a short interfering RNA, or a ribozyme), small molecules, or combinations thereof. In some embodiments, a small molecule can include an antibiotic, an antineoplastic agent (e.g., doxorubicin), a local anesthetic, a steroid, a hormone, an apoptotic inhibitor (for example, an inhibitor of Apaf-1; see, e.g., U.S. Patent No.9,040,701, incorporated by reference herein in its Attorney Docket No: 50051-0031WO1 entirety), an angiogenic agent, an anti-angiogenic agent, a neurotransmitter, a neuroprotective agent, a chemoprotective agent, a psychoactive drug, an anti-inflammatory, and combinations thereof. In some embodiments, an active agent can include an anti-angiogenic agent. In some embodiments, an active agent can include an anti-angiogenic agent and a steroid. In some embodiments, an active agent includes dexamethasone. In some embodiments, an active agent is dexamethasone, as described herein. In some embodiments, the dexamethasone is present in an amount of about 1% to about 15% (w / w), about 2% to about 8% (w / w), or about 5% to about 7% (w / w). In some embodiments, the dexamethasone is present in an amount of about 5% to about 7% (w / w). In some embodiments, the dexamethasone is present in an amount of about 6% (w / w). In some embodiments, an active agent includes a chemoprotective agent (e.g., 6-phenyl- 2-thiouracil). In some embodiments, an active agent is a chemoprotective agent, as described herein. In some embodiments, the chemoprotective agent is present in an amount of about 1% to about 18% (w / w), about 8% to about 16% (w / w), or about 11% to about 13% (w / w). In some embodiments, the chemoprotective agent is present in an amount of about 11% to about 13% (w / w). In some embodiments, the chemoprotective agent is present in an amount of about 12% (w / w). In some embodiments, an active agent is a chemoprotective agent comprising 6-phenyl-2- thiouracil, as described herein. In some embodiments, the 6-phenyl-2-thiouracil is present in an amount of about 0.5% to about 18% (w / w), about 8% to about 16% (w / w), or about 11% to about 13% (w / w). In some embodiments, the 6-phenyl-2-thiouracil is present in an amount of about 11% to about 13% (w / w). In some embodiments, the 6-phenyl-2-thiouracil is present in an amount of about 18% (w / w). In some embodiments, the 6-phenyl-2-thiouracil is present in an amount of about 12% (w / w). In some embodiments, the 6-phenyl-2-thiouracil is present in an amount of 6% (w / w). In some embodiments, an active agent includes a neuroprotective agent (e.g., Brain- Derived Neurotrophic Factor (BDNF), a neurotrophin, NT3, NGF, an agonist of TrkB, an agonist of TrkC, a ROCK inhibitor (e.g., netarsudil, verosudil, Y-27632, ripasudil, fasudil, and netarsudil-M1)). In some embodiments, an active agent is BDNF, a neurotrophin, NT3, NGF, an agonist of TrkB, and / or an agonist of TrkC as described herein. In some embodiments, the neuroprotective agent is a ROCK inhibitor comprising one of netarsudil, Y-27632, ripasudil, Attorney Docket No: 50051-0031WO1 fasudil, and netarsudil-M1. In some embodiments, the neuroprotective agent is present in an amount of about 0.05% to about 10% (w / w), about 0.05% to about 2% (w / w), about 0.5% to about 4% (w / w), about 1% to about 5% (w / w), about 2% to about 8% (w / w), or about 5% to about 7% (w / w). In some embodiments, the neuroprotective agent is present in an amount of about 5% to about 7% (w / w). In some embodiments, the neuroprotective agent is present in an amount of about 6% (w / w). In some embodiments, the neuroprotective agent is present in an amount of 6% (w / w). In some embodiments, an active agent is BDNF, as described herein. In some embodiments, the BDNF is present in an amount of about 0.05% to about 10% (w / w), about 0.05% to about 2% (w / w), about 0.5% to about 4% (w / w), about 1% to about 5% (w / w), about 2% to about 8% (w / w), or about 5% to about 7% (w / w). In some embodiments, the BDNF is present in an amount of about 5% to about 7% (w / w). In some embodiments, BDNF is present in an amount of about 6% (w / w). In some embodiments, the BDNF is present in an amount of 6% (w / w). In some embodiments, an active agent is a ROCK inhibitor (e.g., netarsudil, verosudil, Y- 27632, ripasudil, fasudil, and netarsudil-M1), as described herein. In some embodiments, an active agent is a ROCK inhibitor, as described herein. In some embodiments, the ROCK inhibitor is present in an amount of about 1% to about 18% (w / w), about 8% to about 16% (w / w), or about 11% to about 13% (w / w). In some embodiments, the ROCK inhibitor is present in an amount of about 11% to about 13% (w / w). In some embodiments, the ROCK inhibitor is present in an amount of about 12% (w / w). In some embodiments, the ROCK inhibitor is present in an amount of 12% (w / w). In some embodiments, an active agent is netarsudil, as described herein. In some embodiments, the netarsudil is present in an amount of about 0.1% to about 18% (w / w), about 1% to about 18% (w / w), about 8% to about 16% (w / w), or about 11% to about 13% (w / w). In some embodiments, the netarsudil is present in an amount of about 0.1% to about 6% (w / w). In some embodiments, the netarsudil is present in an amount of about 11% to about 13% (w / w). In some embodiments, the netarsudil is present in an amount of about 12% (w / w). In some embodiments, the netarsudil is present in an amount of 6% (w / w). In some embodiments, administering the therapeutically effective amount of the extended release otic composition modulates one or more genes. For example, the modulated genes can be Attorney Docket No: 50051-0031WO1 those found in the Inflammasome Pathway, e.g., Nlrp3; the Toll-like Receptor (TLR) Pathway, e.g., Tlr1, Tlr2, Tlr4, Tlr7, and Tlr9; the Chemokine Signaling Pathway, e.g., Ccl3, Ccl5, Ccl12, and Cxcl10; the Cytokine Signaling Pathway, e.g., Il1a, Il1b, Il6, and Il18; the TLR Pathway, e.g., Cd14 and Lbp; the Regulatory T Cell Pathway, e.g., FoxP3; the Anti-inflammatory Cytokine Pathway, e.g., Il10; the Chemokine Signaling Pathway, e.g., the Complement Pathway, e.g., C3; the Cytotoxic T Cell Pathway, e.g., Cd8a; the Nitric Oxide Signaling Pathway, e.g., iNos; the Leukocyte Adhesion Pathway, e.g., Itgam; the V(D)J Recombination Pathway, e.g., Rag1; the Tight Junction Pathway, e.g., Tjp1 and Marveld2; the Adherens Junction Pathway, e.g., Cdh5; and the Anti-angiogenic Pathway, e.g., Serpinf1. In some embodiments, administering the therapeutically effective amount of the extended release otic composition modulates WNT and Notch and other downstream pathways. For example, the modulated genes can be those found in the WNT downstream pathways, includingthe canonical WNT / -catenin Pathway, e.g., -catenin, TCF, and LEF; the non-canonicalWNT / Planar Cell Polarity (PCP) Pathway, e.g., Rho, Rac, and JNK; and the WNT / Ca² Pathway,e.g., PKC, CaMKII, and NFAT; and the Notch downstream pathways, including the NICD translocation and transcriptional activation pathway, e.g., NICD, CSL, MAML, HES, and HEY. Table 2: Active Agents and formulation names: In some embodiments, a diagnostic or visualization agent can include a dye, a fluorophore, an MRI contrast agent (e.g., an agent including gadolinium) or other agents detectable by ultrasound, MRI, or x-ray. In some embodiments, a visualization agent can improve visibility of a polymer composition or extended release otic composition during a surgical procedure. Non-limiting examples of visualization agents can include colored substances suitable for use in medical implantable medical devices, such as FD&C dyes 1, 3, and 6, eosin, methylene blue, indocyanine green, or colored dyes normally found in synthetic Attorney Docket No: 50051-0031WO1 surgical sutures. In some embodiments, a visualization agent can include FD&C Blue #1. In some embodiments, a visualization agent can be present in a polymer composition or extended release otic composition in an amount of about 0% to about 0.5% (e.g., about 0% to about 0.02%, about 0% to about 0.05%, about 0% to about 0.1%, about 0% to about 0.2%, about 0.02% to about 0.5%, about 0.05% to about 0.5%, about 0.1% to about 0.5%, or about 0.2% to about 0.5%) by weight. In some embodiments, a visualization agent can be present in a polymer composition or extended release otic composition in an amount of about 0% to about 0.05% (e.g., about 0.005% to about 0.02%, about 0.005% to about 0.0015%, about 0.009%, or about 0.1%) by weight. In some embodiments, a visualization agent is green or blue; without being bound by any particular theory, green or blue may have better visibility in the presence of blood or on a pink or white tissue background. In some embodiments, the active agent can be substantially in the form of microparticles or nanoparticles. Without being bound by any particular theory, it is believed that in some cases, a microparticle form can aid in the controlled release of an active agent from an extended release otic composition as described herein. In some cases, a nanoparticle form can increase dissolution rates and deliver active agent at controlled release rates higher than from microparticles. In some embodiments, a microparticle can be a particle that is between about 0.1 μm and about 100 μm in diameter (e.g., between about 0.1 μm and about 1 μm, between about 0.1 μm and about 10 μm , between about 0.1 μm and about 50 μm, between about 1 μm and about 100 μm, between about 10 μm and about 100 μm, between about 50 μm and about 100 μm, between about 1 μm and about 50 μm, or between about 1 μm and 10 μm), for instance, as measured by optical microscopy. In some embodiments, a nanoparticle can be a particle that is between about 1 nm and about 100 nm in diameter (e.g., between about 1 nm and about 10 nm, between about 1 nm and about 50 nm, between about 10 nm and about 100 nm, or between about 50 nm and about 100 nm), for instance, as measured by electron microscopy. B. Polymer Compositions Also provided herein are polymer compositions. Typically, a polymer composition as described herein includes a functional polymer, a crosslinker, and water. In some embodiments, the polymer compositions described herein are injectable into the middle and / or inner ear, where the functional polymers crosslink ionically and / or covalently, to generate a crosslinked polymer Attorney Docket No: 50051-0031WO1 composition in the form of a gel (e.g., hydrogel). Crosslinking can occur upon mixing and injecting the polymer composition, by altering pH, exposure to ions, and / or exposure to a photocrosslinker. In some embodiments, a polymer composition as described herein can have one or more functional properties that are advantageous for administration to a subject (e.g., to the middle and / or inner ear of a subject). In some cases, a polymer composition can be characterized by the ability to crosslink and to form a durable gel (e.g., hydrogel), for example, in situ. The phenomenon of transition from a solution to a gel is commonly referred to as sol-gel transition. The sol-gel transition of a polymer composition can be experimentally verified by a number of techniques such as the vial inversion method, spectroscopy, differential scanning calorimetry (DSC), and rheology. In some embodiments, a gel formed from a polymer composition described herein can have a gel duration of at least 20 days (e.g., at least 30 days, at least 40 days, at least 50 days, at least 60 days, at least 70 days, at least 80 days, at least 90 days, at least 100 days, or more) when stored in an inverted vial at room temperature (e.g., 20 °C). In some embodiments, a gel formed from a polymer composition as described herein can have a gel duration of at least 5 days (e.g., at least 7 days, at least 10 days, at least 14 days, at least 18 days, at least 21 days, at least 25 days, at least 28 days, or more) when stored at body temperature (e.g., 37 °C), as measured by placing a gel (e.g., 200 μL) in a receptor solution (e.g., pH 7.4 PBS). In situ, the degradation of a gel (e.g., a hydrogel) formed from a polymer composition as described herein can depend on the identity of the components (e.g., functional polymer and / or crosslinker) of the polymer composition, as well as administration accuracy and subject metabolism. In some embodiments, a gel formed from a polymer composition as described herein can have a residence time of at least 5 days (e.g., at least 7 days, at least 10 days, at least 14 days, at least 18 days, at least 21 days, at least 25 days, at least 28 days, at least 42 days, at least 56 days, or more) when administered to the middle ear of a subject. In some cases, a polymer composition can be characterized by the ability to crosslink and to form a shape conforming gel (e.g., hydrogel), for example, in situ. In some embodiments, a gel formed from a polymer composition (e.g., 200 μL of gel) described herein can retain its shape for at least 20 days (e.g., at least 30 days, at least 40 days, at least 50 days, at least 60 days, at least 70 days, at least 80 days, at least 90 days, at least 100 days, or more) when stored in an Attorney Docket No: 50051-0031WO1 upright vial at 37 °C with 1 mL of PBS; inversion of the vial can be used to determine whether the polymer composition is still a gel. In some embodiments, a polymer composition as described herein can form a gel that is significantly elastic, rather than significantly viscoelastic. Without being bound by any particular theory, it is believed that an elastic gel will have a greater residence time in a location of administration than a viscoelastic gel, which may flow away. For example, in some embodiments, a gel formed from a polymer composition described herein can have an elastic modulus of about 0.01 to about 100 kPa (e.g., about 0.1 to about 100 kPa, about 1 to about 100 kPa, about 5 to about 100 kPa, about 10 to about 100 kPa, about 25 to about 100 kPa, about 50 to about 100 kPa, about 75 to about 100 kPa, about 0.01 to about 0.1 kPa, about 0.01 to about 1 kPa, about 0.01 to about 5 kPa, about 0.01 to about 10 kPa, about 0.01 to about 25 kPa, about 0.01 to about 50 kPa, or about 0.01 to about 75 kPa). In some embodiments, a polymer composition can have a wide transition in viscosity, e.g., some polymer compositions as described herein can flow (e.g., as a solution or suspension) to a target site and form a gel (e.g., hydrogel), for example, in situ. In some embodiments, a polymer composition can be injected in the form of a solution or suspension, flows by gravity throughout the middle ear or to one or more sites in the middle ear, and then forms a gel (e.g., hydrogel). In some such embodiments, the polymer composition wets (e.g., completely wets) the round window membrane. In some embodiments, delivery of the polymer composition can be accomplished without bubbles, for example, bubbles in the gel and / or bubbles trapped between the gel and round window membrane. In some embodiments, the viscosity of the polymer composition (e.g., immediately after combining the functional polymer, crosslinker, and water), is between about 1 and about 100 mPa*s (e.g., about 2 and about 100 mPa*s, about 5 and about 100 mPa*s, about 10 and about 100 mPa*s, about 25 and about 100 mPa*s, about 50 and about 100 mPa*s, about 75 and about 100 mPa*s, about 1 and about 2 mPa*s, about 1 and about 5 mPa*s, about 1 and about 10 mPa*s, about 1 and about 25 mPa*s, about 1 and about 50 mPa*s, or about 1 and about 75 mPa*s). In some cases, a polymer composition as described herein can be injected using a 23-gauge (23 G) needle, or a needle of high gauge (smaller diameter), e.g., without significant clogging of the needle. In some cases, a polymer composition can be characterized by the ability to crosslink and to form a gel (e.g., hydrogel), for example, in situ, with a gelation time that is suitable for Attorney Docket No: 50051-0031WO1 administration to a site (e.g., the middle and / or inner ear) of a subject. Some polymer compositions, such as DURASEAL®, can form gels in 3 seconds or less, which may not be desirable for delivery of an extended release otic composition as disclosed herein. In some embodiments, the polymer compositions described herein can have a gelation time of about 45 seconds to about 60 min (e.g., about 1 minute to about 60 min, about 45 seconds to about 45 min, about 45 seconds to about 30 min, about 45 seconds to about 20 min, about 45 seconds to about 10 min, about 45 seconds to about 8 min, about 45 seconds to about 5 min, about 45 seconds to about 3 min, about 45 seconds to about 2 min about 45 seconds to about 1 minute, about 1 minute to about 60 min, about 2 min to about 60 min, about 3 min to about 60 min, about 4 min to about 60 min, about 5 min to about 60 min, about 8 min to about 60 min, about 10 min to about 60 min, about 20 min to about 60 min, about 30 min to about 60 min, about 45 min to about 60 min, about 1 minute to about 5 min, about 5 min to about 20 min, about 8 min to about 12 min, about 4 min to about 12 min, or about 1 min to about 8 min) at a temperature of about 20 °C. In some embodiments, the polymer compositions described herein can have a gelation time of about 8 minutes to about 16 minutes (e.g., about 9 minutes to about 15 minutes, about 10 minutes to about 14 minutes, or about 11 minutes to about 13 minutes) at a temperature of about 20 °C. In some embodiments, the polymer compositions described herein can have a gelation time of about 9 minutes to about 11 minutes at a temperature of about 20 °C. In some embodiments, the polymer compositions described herein can have a gelation time of at least about 45 seconds (e.g., at least about 1 minute, at least about 2 min, at least about 3 min, at least about 5 min, or at least about 10 min) at a temperature of about 20 °C. In some embodiments, the polymer compositions described herein can have a gelation time of about 8 min, 9 min, 10 min, 11 min, or 12 min at a temperature of about 20 °C. In some embodiments, the polymer compositions described herein can have a gelation time of about 10 s to about 30 min (e.g., about 10s to about 30 s, about 10 s to about 1 min, about 10 s to about 2 min, about 10 s to about 3 min, about 10 s to about 4 min, about 10 s to about 5 min, about 10 s to about 8 min, about 30 s to about 10 min, about 30 s to about 15 min, about 30 s to about 20 min, about 1 min to about 30 min, about 2 min to about 30 min, about 3 min to about 30 min, about 4 min to about 30 min, about 5 min to about 30 min, about 8 min to about 30 min, about 10 min to about 30 min, about 15 min to about 30 min, about 20 min to about 30 min, about 30 s to about 3 min, about 1 min to about 2 min, about 2 min to about 8 min, about 3 min Attorney Docket No: 50051-0031WO1 to about 8 min, about 2 min to about 6 min, about 4 min to about 6 min, about 3 min to about 5 min, or about 1 min to about 4 min) at about 37 °C. In some embodiments, the polymer compositions described herein can have a gelation time of about 30 s to about 2 min (e.g., about 45 s to about 1 min) at about 37 °C. In some embodiments, the polymer compositions described herein can have a gelation time of at least about 10 s (e.g., at least about 30 s, at least about 1 min, at least about 2 min, at least about 3 min, at least about 4 min, at least about 5 min, at least about 8 min, or at least about 10 min), and optionally less than 30 minutes (e.g., less than 15 minutes) at about 37 °C. In some embodiments, the polymer compositions described herein can have a gelation time of about 3 min, 4 min, 5 min, 6 min, 7 min, or 8 min at a temperature of about 37 °C. Without being bound by any particular theory, it is believed that the gelation time of a polymer composition or extended release otic composition can impact its usefulness in a clinical setting, as compositions that gel too quickly may decrease the amount of time in which a composition can be administered to the ear of a subject (e.g., via transtympanic injection). In some embodiments, a polymer composition or extended release otic composition provided here is injectable through a 27 gauge (or larger diameter) needle for at least 10 minutes after the functional polymer and crosslinker are combined. In some embodiments, a polymer composition or extended release otic composition provided here is injectable through a 27 gauge (or larger diameter) needle for at least 2 minutes (e.g., 2 to 4 minutes, 2 to 6 minutes, 2 to 8 minutes, 2 to 10 minutes) after the functional polymer and crosslinker are combined. The rate of a crosslinking reaction can be influenced by selection of properties of the polymer composition; for example, pH, amounts of crosslinker and functionalized polymer, and buffer selection can affect gelation time. Mixing components while chilled can also slow down the crosslinking reaction to allow time for injection. In some cases, a polymer composition or an extended release otic composition can adhere to tissue in the middle ear and to create a sufficiently crosslinked gel that will be maintained for long durations in the middle ear before degrading into liquid. Controlled rates of active agent delivery also may be obtained with the system by degradable, covalent attachment of the molecules to the crosslinked hydrogel network. The nature of the covalent attachment can be controlled to enable control of the release rate from Attorney Docket No: 50051-0031WO1 hours to weeks or longer. By using a composite made from linkages with a range of hydrolysis times, a controlled release profile may be extended for longer durations. In some cases, a gel formed from a polymer composition or extended release otic composition as described herein can exhibit a swelling of less than about 150% (e.g., less than about 140%, less than about 120%, less than about 100%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, or less than about 40%), for example, when incubated in an excess of phosphate buffered saline (PBS) at 37°C (e.g., for about 1 day, or for about 2 days). In some cases, a gel formed from a polymer composition or extended release otic composition as described herein can exhibit a swelling of about 25% to about 45% (e.g., about 30% to about 40%), for example, when incubated in an excess of phosphate buffered saline (PBS) at 37°C after 1 day. In some cases, a gel formed from a polymer composition or extended release otic composition as described herein can exhibit a swelling of about 40% to about 80% (e.g., about 50% to about 70%), for example, when incubated in an excess of phosphate buffered saline (PBS) at 37°C after 7 days. In some embodiments, a gel formed from a polymer composition or extended release otic composition can have a resorption time (e.g., time to where the mass of the gel incubated in an excess of PBS at 50 °C is less than the starting mass of the gel) of about 5 days to about 30 days (e.g., about 5 days to about 10 days, about 5 days to about 15 days, about 5 days to about 20 days, about 5 days to about 25 days, about 10 days to about 30 days, about 15 days to about 30 days, about 20 days to about 30 days, about 25 days to about 30 days, about 7 days to about 9 days, or about 7 days to about 15 days). In some embodiments, a gel formed from a polymer composition or extended release otic composition described herein can be characterized by demonstrating adhesion to a surface in contact with polymer composition during gelation. In some embodiments, adhesion can be mechanical adhesion, gel adhesion, chemical adhesion, mucoadhesion, or a combination thereof. In some cases, a polymer composition can demonstrate adhesion to a tissue within the ear (e.g., the round window membrane). This can be achieved, for example, by crosslinking of one or more components of the polymer formulation, which may include a component that forms covalent crosslinks with tissue. As an example, a polymer composition can include amine-reactive and / or thiol-reactive groups, which can bind to tissue. In some embodiments, a gel formed from a polymer composition described herein, can be characterized by demonstrating mucoadhesion to a mucosal surface (e.g., the round window Attorney Docket No: 50051-0031WO1 membrane) in contact with the polymer composition during gelation. In some embodiments, adhesion can be achieved though the formation of covalent bonds between the amine groups of proteins in tissue and activated esters of functional polymer. An active agent (e.g., a therapeutic, prophylactic and / or visualization or diagnostic agent), for example, any of one or more the active agents described herein, can be included in any of the polymer compositions described herein. Typically, when an active agent is present in a polymer composition described herein, such a composition is termed an extended-release otic composition. An active agent can be present in a polymer composition as described herein in any appropriate amount or concentration. In some embodiments, an active agent can be present in a polymer composition in an amount sufficient to deliver a therapeutically effective concentration to a site of action (e.g., through the round window membrane) for a period of time. In some embodiments, a period of time can be less than or equal to the residence time of the extended release otic composition in the site of administration. For example, in some embodiments, a period of time can be about 5 days to about 6 months (e.g., about 5 days to about 1 week, about 5 days to about 2 weeks, about 5 days to about 3 weeks, about 5 days to about 1 month, about 5 days to about 2 months, about 5 days to about 3 months, about 5 days to about 4 months, about 5 days to about 5 months, about 1 week to about 6 months, about 2 weeks to about 6 months, about 3 weeks to about 6 months, about 1 month to about 6 months, about 2 months to about 6 months, about 3 months to about 6 months, about 4 months to about 6 months, about 5 months to about 6 months, about 2 weeks to about 2 months, or about 1 month to about 3 months). In some embodiments, an active agent can be present in an amount of about 0.01% to about 40% (e.g., about 0.01% to about 0.1%, about 0.01% to about 1%, about 0.01% to about 2%, about 0.01% to about 3%, about 0.01% to about 5%, about 0.01% to about 8%, about 0.01% to about 10%, about 0.01% to about 12%, about 0.01% to about 15%, about 0.01% to about 20%, about 0.01% to about 20%, about 0.01% to about 40%, about 0.1% to about 40%, about 1% to about 40%, about 2% to about 40%, about 3% to about 40%, about 5% to about 40%, about 8% to about 40%, about 10% to about 40%, or about 12% to about 40%) by weight of the polymer composition. In some embodiments, an active agent can be present in an amount of about 1% to about 10% (e.g., about 2% to about 9%, about 3% to about 8%, or about 4% to about 6%) by weight of the polymer composition. In some embodiments, an active agent can be present in an Attorney Docket No: 50051-0031WO1 amount of about 4%, 5%, 6%, 7%, or 8% by weight of the polymer composition. In some embodiments, an active agent can be present in an amount of about 8% to about 18% (e.g., about 8% to about 10%, about 8% to about 12%, about 8% to about 14%, about 8% to about 16%, about 10% to about 18%, about 12% to about 18%, about 14% to about 18%, about 16% to about 18%, about 9% to about 16%, or about 10% to about 15%) by weight of the polymer composition. In some embodiments, an active agent can be present in an amount of about 10%, 11%, 12%, 13%, 14%, or 15% by weight of the polymer composition. An active agent can be present in a polymer composition in any appropriate form. In some embodiments, an active agent can be present in a polymer composition as a solution or as a suspension. In some embodiments, an active agent can be present in a polymer composition in the form of microparticles or nanoparticles. In some embodiments, an active agent can change from solution to suspension from one form of microparticle or nanoparticle to another microparticle or nanoparticle after combining the components of the extended release otic composition. A generally preferred characteristic of a drug suspension composition is the ability to administer uniform doses. This can be easier to achieve for compositions that do not form a dense sediment during storage and can be easily re-dispersed upon manual agitation of a container. In some embodiments, extended release otic compositions can contain particles of an active agent that are easy to disperse with manual agitation and have a low viscosity such that they are easy to inject. This can be achieved, in some cases, by addition of a flocculating agent that promotes aggregation of drug particles into loose floccules. The flocculation efficiency can be defined as the ratio of final sediment volume (e.g., as a percentage of the total volume) to particle concentration. The final sediment volume cannot be greater than 100%, thereby limiting upper values of flocculation efficiency. In some embodiments, extended release otic compositions as described herein have a flocculation efficiency greater than about 3 (e.g., greater than about 4, or greater than about 5). In some embodiments, the choice of functional polymer and / or crosslinking agent can affect the flocculation efficiency of a given active agent in solution. For example, in some embodiments, the use of a polylysine (e.g., trilysine or tetralysine) or a salt thereof as crosslinker can provide a high degree of flocculation without the addition of other dispersing agents. It can be desirable for the crosslinking agent to also serve as a flocculating agent to minimize the number of excipients Attorney Docket No: 50051-0031WO1 in an extended release formulation. Other amphiphilic crosslinkers, such as tetralysine, can also be used for dual purposes of crosslinking and flocculating drug particles. In some embodiments, the active agent is stored as a dry powder until combined with other components of an extended release otic composition (e.g., at or near time of use). For example, microparticles and nanoparticles prepared by spray drying and / or super critical fluid processing can form loose aggregates that have good flow and handling properties and are easily dispersed to primary particles with low input of energy. When the components of an extended release otic composition are combined, the aggregates can be separated into primary particles by shear generated via introduction of air and / or other components of the extended release otic composition. As noted above, polymer compositions as described herein typically include a functional polymer, a crosslinker, and water. Gels (e.g., hydrogels) can be formed from the reaction of functional polymers and crosslinkers having functional groups, e.g., electrophilic or nucleophilic functional groups. As used herein, a “functional polymer” can be a polymer including one or more functional groups that can react with one or more functional groups on a crosslinker to form a bond (e.g., a covalent bond). As used herein, a “crosslinker” can be a molecule including one or more functional groups that can react with one or more functional groups on a functional polymer to form a bond (e.g., a covalent bond). In some cases, a crosslinker is a polymer (e.g., trilysine or tetralysine, or a salt thereof). In some cases, a crosslinker is not a polymer. In general, functional polymers and crosslinkers are water soluble, non-toxic and biologically acceptable. In some embodiments, a crosslinker is a small molecule. In some embodiments, a crosslinker has a solubility of at least 1 g / 100 mL in an aqueous solution. In some embodiments, a functional polymer is a macromolecule. Exemplary classes of functional polymers and crosslinkers are described in U.S. Patent Nos.6,566,406; 6,887,974; 7,332,566; and 8,535,705, each of which is incorporated herein by reference in its entirety. In some embodiments, a functional polymer or a crosslinker can be multifunctional, meaning that it comprises two or more functional groups. In some embodiments, a multifunctional functional polymer or crosslinker has only one type of functional group (e.g., all nucleophilic or all electrophilic functional groups). In some cases, a functional polymer or a Attorney Docket No: 50051-0031WO1 crosslinker can include at least three (e.g., at least four, at least five, or more) functional groups, so that, as a result of reactions (e.g., electrophilic-nucleophilic reactions), the functional polymer and the crosslinker combine to form a crosslinked gel (e.g., hydrogel). Such reactions are typically referred to as “crosslinking reactions”. A functional polymer can include a plurality of a first functional group. A crosslinker can include a plurality of a second functional group. In some such embodiments, the first functional group of the polymer can form covalent linkages with the second functional group of the crosslinker, thereby generating a gel (e.g., hydrogel). The distribution of functional groups can be any appropriate distribution. In some embodiments, the functional polymer is a branched polymer, where the terminus of each branch is functionalized with the first functional group. In some embodiments, the functional polymer can include a first type of monomer, where the functional polymer is a homopolymer of the first type of monomer. In some embodiments, the functional polymer can include a first type of monomer, where each of the first type of monomer includes the first functional group. In some cases, the first type of monomer can be randomly distributed in the functional polymer. In some cases, the first type of monomer can be regularly distributed (e.g., as block co-polymer or as an alternating co-polymer) in the functional polymer. In some cases, the first type of monomer can be part of a grafted co-polymer (e.g., as the backbone or as a branch) in the functional polymer. A functional polymer can be of any appropriate size. In some embodiments, a functional polymer is a macromolecule, for example, a macromolecule with a Mn of 5,000, 10,000, 20,000, 30,000, or more. In some embodiments, the crosslinker can include a second type of monomer, where the functional polymer is a homopolymer of the second type of monomer. In some embodiments, the crosslinker is a branched polymer, where the terminus of each branch is functionalized with the second functional group. In some embodiments, the crosslinker can include a second type of monomer, where each of the second type of monomer includes the second functional group. In some cases, the second type of monomer can be randomly distributed in the crosslinker. In some cases, the second type of monomer can be regularly distributed (e.g., as block co-polymer or as an alternating co-polymer) in the crosslinker. In some cases, the second type of monomer can be part of a grafted co-polymer (e.g., as the backbone or as a branch) in the crosslinker. A crosslinker can be any appropriate size. In some embodiments, a crosslinker is a small molecule. Attorney Docket No: 50051-0031WO1 In some embodiments, a crosslinker is an oligomer, for example, a dimer, a trimer, a tetramer, or a pentamer. It will be appreciated that a first functional group (e.g., on a functional polymer) and a second functional group (e.g., on a crosslinker) should be such that a crosslinking reaction can occur. Therefore, the choice of functional polymer can be based on the choice of crosslinker, or vice versa. In some embodiments, a first functional group can be a NHS group and a second functional group can be an amine (e.g., a primary amine), or vice versa. In some cases, the functional polymer contains only electrophilic or nucleophilic functional groups, and the crosslinker contains only nucleophilic or electrophilic functional groups, respectively. Thus, for example, if a crosslinker has nucleophilic functional groups such as amines (e.g., primary amines), the functional polymer, in some cases, may only have electrophilic functional groups such as N-hydroxysuccinimides. If, for example, a crosslinker has electrophilic functional groups such as sulfosuccinimides, then, in some cases the functional polymer may have nucleophilic functional groups such as amines (e.g., primary amines). A functional polymer can be present in any appropriate concentration in a polymer composition as described herein. In some embodiments, a functional polymer can be present in a concentration of about 1% to about 15%, about 3% to about 15%, about 3% to about 15% (e.g., about 3% to about 15%, about 3% to about 7%, about 3% to about 9%, about 3% to about 11%, about 3% to about 13%, about 7% to about 15%, about 9% to about 15%, about 11% to about 15%, about 13% to about 15%, about 7% to about 13%, about 8% to about 11%, about 6% to about 12%, or about 7% to about 10%) by weight of the polymer composition. In some embodiments, a functional polymer can be present in a concentration of about 3% to about 15% by weight of the polymer composition. In some embodiments, a functional polymer can be present in a concentration of about 3%, about 6%, about 7%, about 8%, about 9%, about 10%, or about 11% by weight of the polymer composition. In some embodiments, a functional polymer can be present in a concentration of about 8.3% by weight of the polymer composition. In some embodiments, a functional polymer can be present in an extended release otic composition as in a polymer composition as described herein. A crosslinker can be present in any appropriate concentration in a polymer composition as described herein. In some embodiments, a crosslinker can be present in a concentration of about 0.2% to about 0.6% (e.g., about 0.2% to about 0.4%, about 0.4% to about 0.6%, or about Attorney Docket No: 50051-0031WO1 0.3% to about 0.5%) by weight of the polymer composition. In some embodiments, a crosslinker can be present in a concentration of about 0.05% to about 0.6% (e.g., about 0.05% to about 0.2%, about 0.05% to about 0.4%, about 0.05% to about 0.5%, about 0.1% to about 0.6%, about 0.2% to about 0.6%, about 0.4% to about 0.6%, or about 0.1% to about 0.3%) by weight of the polymer composition. In some embodiments, a crosslinker can be present in a concentration of about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, or 0.6% by weight of the polymer composition. In some embodiments, a crosslinker can be present in a concentration of about 0.05% to about 10% (e.g., about 0.05% to about 0.5%, about 0.05% to about 1%, about 0.05% to about 2%, about 0.05% to about 3%, about 0.05% to about 5%, about 0.05% to about 7%, about 0.05% to about 9%, about 0.5% to about 10%, about 1% to about 10%, about 2% to about 10%, about 3% to about 10%, about 5% to about 10%, about 7% to about 10%, about 9% to about 10%, or about 0.5% to about 2%) by weight of the polymer composition. In some embodiments, a crosslinker can be present in an extended release otic composition as in a polymer composition as described herein. In some embodiments, a crosslinker can include amine (e.g., primary amine) groups, or salts (e.g., acetate salts) thereof. In some embodiments, a crosslinker can be a polylysine, for example a trilysine, or a salt (e.g., acetate salt) thereof. It will be understood that the weight percentage of a crosslinker, when in a salt form, will correspond to a smaller weight percentage of the crosslinker when not in salt form (e.g., as the free base), as the salt provides additional molar mass. As an illustrative example, if the crosslinker is trilysine acetate, then the weight percentage of the crosslinker in the polymer composition or extended release otic composition for trilysine free base is approximately 69% of the weight percentage of trilysine acetate, all else being the same. In some embodiments, the crosslinker is present in an amount of about 0.01% to about 1% (w / w), about 0.03 % to about 0.6% (w / w), about 0.05% to about 0.5% (w / w), or about 0.15% to about 0.25% (w / w). In some embodiments, the crosslinker is present in an amount of about 0.15% to about 0.25% (w / w). In some embodiments, the crosslinker is present in an amount of about 0.03% to about 0.6% (w / w). In some embodiments, the crosslinker is present in an amount of about 0.2% (w / w). In some embodiments, the crosslinker is present in an amount of 0.6% (w / w). The functional groups can be present in any appropriate ratio. In some embodiments, where a first functional group and a second functional group are used (e.g., an electrophilic functional group a nucleophilic functional group), the ratio of the first functional group to the Attorney Docket No: 50051-0031WO1 second functional group can be between about 1.2 equivalents first functional group: 0.8 equivalents second functional group to about 0.8 equivalents first functional group: 1.2 equivalents second functional group. In some embodiments, the ratio of the first functional group to the second functional group can be between about 1.3 equivalents first functional group: 0.7 equivalents second functional group to about 0.7 equivalents first functional group: 1.3 equivalents second functional group. In some embodiments, the ratio of the first functional group to the second functional group can be between about 1 equivalent first functional group: 0.9 equivalents second functional group to about 0.9 equivalents first functional group: 1 equivalent second functional group. In some embodiments, the ratio of the first functional group to the second functional group is about 1:1. It will be understood that the molar ratio or weight ratio of the functional polymer and the crosslinker will be based on the relative number of functional groups per functional polymer or crosslinker, respectively. In some embodiments, a functional polymer can be a modified polyethylene glycol (PEG) polymer. Exemplary modified PEG polymers include linear, branched, or multi-arm water soluble polymers including a plurality of polyethylene glycol units and (e.g., as part of a monomer or as an end-cap) two or more instances of functional groups (e.g., a succinimidyl ester (e.g., N-hydroxysuccinimide ester (NHS)), a sulfo-succinimidyl ester, epoxide or similar reactive groups). A multi-arm functional polymer can include a water soluble core, for example, sugars (xylitol, erythritol), glycerol, or trimethylolpropane. A water soluble core can be extended, optionally with at least one biodegradable linkage between it and each terminal group, which in some cases can be a functional group. A biodegradable linkage can, in some cases, be a single linkage or copolymers or homopolymers of absorbable polymers such as polyhydroxy acids or polylactones. In some embodiments, a functional polymer can include an enzymatically and / or hydrolytically cleavable link. For example, molecules cleaved by enzymes such as collagenase may be synthesized and inserted into the polymers using methods known to those skilled in the peptide synthesis art. In some embodiments, carboxyl-, amine- or hydroxy-terminated polyethylene glycol can be used as a starting material for building a suitable peptide sequence for enzymatic cleavage, and a terminal end of the peptide sequence is converted into a carboxylic acid by reacting succinic anhydride with an appropriate amino acid. The acid group generated can then be converted to an NHS ester by reaction with N-hydroxysuccinimide. Attorney Docket No: 50051-0031WO1 In some cases, a functional polymer can be purchased or prepared using a variety of synthetic methods. A functional group on a functional polymer or a crosslinker can, in some embodiments, be a reactive functional group that is also water solubilizing, such a succinimidyl ester group further functionalized with a PEG or sulfonate group. An ionic group, like a metal salt (e.g., a sodium salt) of sulfonic acid, or a nonionic group, like a polyethylene oxide on the succinimide ring, can improve water solubility while the NHS ester provides chemical reactivity towards amines. Functional polymers, such as polyethylene glycols, functionalized with reactive functional groups such as succinimidyl ester groups are commercially available from, for example, MilliporeSigma (Milwaukee, Wis.) and Creative PEGWorks (Chapel Hill, NC). Functional polymers, such as polyethylene glycols, functionalized with reactive functional groups such as primary amines and thiols are commercially available from, for example, MilliporeSigma (Milwaukee, Wis.) and JenKem (Plano, Texas). In some embodiments, commercially available polymers with terminal hydroxyl groups can be converted into functional polymers with amine groups by methods known in the art. Similarly, crosslinkers complementary to a functional polymer are typically commercially available from companies such as MilliporeSigma. In some embodiments, the functional polymer is a multi-arm (e.g., 3-arm, 4-arm, 6-arm, or 8-arm) polyethylene glycol (PEG) including a plurality of (e.g., two more) succinimidyl functional groups (e.g., a succinimidyl succinate, a succinimidyl glutarate, a succinimidyl adipate, succinimidyl glutarimide, succinimidyl carbonate, or succinimidyl carboxymethyl ester) or sulfo-succinimidyl ester functional groups and the crosslinker contains a plurality of amine (e.g., primary amine) functional groups. In some embodiments, the functional polymer is a 4-arm PEG with a pentaerythritol core. In some embodiments, the functional polymer is an 8-arm PEG with a hexaglycerol core. In some embodiments, the functional polymer is an 8-arm PEG with a tripentaerythritol core. In some embodiments, the multi-arm PEG can have two or more arms that terminate in a succinimidyl functional group. In some embodiments, one or more monomers of the multi-arm PEG can include a succinimidyl functional group. In some embodiments, the crosslinker can be a polylysine (e.g., an epsilon-polylysine) (e.g., trilysine, tetralysine, or pentalysine), or a salt (e.g., an acetate salt) thereof. For example, in some embodiments, the Attorney Docket No: 50051-0031WO1 functional polymer can be pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate, and the crosslinker can be trilysine, or a salt thereof (shown in Figures 1A and 1B, respectively). In some embodiments, the functional polymer (e.g., pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate) can have a molecular weight (MN) of about 10 kDa to about 25 kDa (e.g, about 10 kDa to about 15 kDa, about 10 kDa to about 20 kDa, about 15 kDa to about 25 kDa, or about 20 kDa to about 25 kDa). In some embodiments, the functional polymer (e.g., pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate)can have a molecular weight (MW) of about 10 kDa to about 25 kDa (e.g, about 10 kDa to about 15 kDa, about 10 kDa to about 20 kDa, about 15 kDa to about 25 kDa, or about 20 kDa to about 25 kDa). Molecular weight can be determined, for example, by gas phase chromatography or matrix assisted laser desorption chromatography. In some embodiments, the functional polymer (e.g., pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate) can have a polydispersity (PD) of 1.5 ± 0.5. In some embodiments, the functional polymer is poly(ethylene glycol) ether tetrasuccinimidyl glutarate. In some embodiments, the functional polymer has a molecular weight of about 20kDa. In some embodiments, the functional polymer is present in an amount of about 1% to about 20% (w / w), about 5% to about 15% (w / w), or about 7% to about 10% (w / w). In some embodiments, the functional polymer is present in an amount of about 7% to about 10% (w / w). In some embodiments, the functional polymer is present in an amount of about 7.5% to about 8.5% (w / w). In some embodiments, the functional polymer is present in an amount of about 8.3% (w / w). In some embodiments, the functional polymer is present in an amount of 8.3% (w / w). In some embodiments, the functional polymer is a multi-arm (e.g., 3-arm 4-arm, 6-arm, or 8-arm) polyethylene glycol including two or more amine (e.g., primary amine) functional groups and the crosslinker includes a plurality of succinimidyl ester (e.g., a succinimidyl succinate or succinimidyl glutarate) or sulfo-succinimidyl ester functional groups. In some embodiments, the multi-arm PEG can have two or more arms terminate in an amine (e.g., primary amine) functional group. In some embodiments, one or more monomers of the multi- arm PEG can include an amine (e.g., primary amine) functional group. In some embodiments, the crosslinker can be disuccinimidyl glutarate, disuccinimidyl suberate, bis(sulfosuccinimidyl)suberate, or disuccinimidyl succinate. Attorney Docket No: 50051-0031WO1 Crosslinking Reactions Typically, crosslinking reactions can occur under physiological conditions. In some embodiments, crosslinking reactions can occur “in situ”, meaning they occur at local sites such as on organs or tissues in a living animal or human body. In some embodiments, the crosslinking reactions do not release heat of polymerization. Crosslinking between the functional polymer and the crosslinker can be initiated under any appropriate conditions. In some embodiments, the crosslinking between the functional polymer and the crosslinker is initiated upon the addition of a catalyst (e.g., an initiator molecule). In some embodiments, the crosslinking is initiated by a stimulus, e.g., a change in pH, temperature, or irradiation (e.g., using photo initiation). The rate of crosslinking and gelation time can be influenced by factors such as pH, temperature, excipients, ratio of functional groups, degree of functionalization of the functional polymer, and concentration of the functional polymer and crosslinker. In some embodiments, the crosslinking between the functional polymer and the crosslinker is initiated upon mixing the functional polymer and the crosslinker. In some such embodiments, the gelation time is sufficient to allow administration of the polymer composition or extended release otic composition to a site of administration (e.g., an area of the middle and / or inner ear) in a significantly fluid form (e.g., by injection through a 23G needle). In some embodiments, crosslinking can be initiated prior to or at the time of administration, but the polymer composition does not significantly gel prior to flowing into the site of administration (e.g., an area of the middle and / or inner ear). Viscosity typically increases with crosslinking, and it is therefore generally desirable to administer a polymer composition or an extended release otic composition before significant crosslinking has occurred. Accordingly, in some embodiments, a polymer composition or an extended release otic composition can have a viscosity of less than about 1000 mPa·s (e.g., less than about 800 mPa·s, 500 mPa·s, 300 mPa·s, 100 mPa·s, 75 mPa·s, 50 mPa·s, or 25 mPa·s) at a temperature of about 20 °C. In some embodiments, a polymer composition or an extended release otic composition, can have a viscosity of about 1 mPa·s to about 100 mPa·s (e.g., about 1 mPa·s to about 80 mPa·s, about 1 mPa·s to about 60 mPa·s, about 1 mPa·s to about 50 mPa·s, about 1 mPa·s to about 40 mPa·s, about 1 mPa·s to about 20 mPa·s, about 1 mPa·s to about 10 mPa·s, about 10 mPa·s to about 100 mPa·s, about 20 to about 100, about 40 to about 100, about 50 to about 100 mPa·s, about 60 Attorney Docket No: 50051-0031WO1 mPa·s to about 100 mPa·s, or about 80 mPa·s to about 100 mPa·s) at a temperature of about 20 °C. In some embodiments, a polymer composition comprises about 3% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer comprises a first functional group and about 0.03% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker comprises a second functional group. The polymer composition can further comprise an active agent, wherein the active agent comprises a neuroprotective agent or a chemoprotective agent; and water, wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 45 seconds to about 30 minutes at a temperature of about 20 °C. In some embodiments, a polymer composition comprises about 3% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer comprises a first functional group and about 0.03% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker comprises a second functional group. The polymer composition can further comprise an active agent, wherein the active agent comprises a neuroprotective agent or a chemoprotective agent; and water, wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 45 seconds to about 30 minutes at a temperature of about 37 °C. In some embodiments, pH is used to influence the gelation time. A reference product, DURASEAL®, marketed as a spine sealant, includes pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate and trilysine. DURASEAL®, prepared by the manufacturer’s instructions, has a pH of about 10, and crosslinking typically occurs rapidly, and this product can form a gel in 3 seconds or less (see, e.g., Example 1). As described herein, adjusting the trilysine component to a pH of about 5.5 to about 8.5 (e.g., about 5.5 to 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.5, about 5.5 to about 6.0, about 6.5 to about 7.0, about 6.5 to about 7.5, about 6.5 to about 8.0, about 7.0 to about 8.5, about 7.5 to about 8.5, or about 8.0 to about 8.5) can result in longer gelation times, such as those described hereinabove. In some embodiments, a polymer composition or an extended release otic composition can have a pH of about 5.5 to about 8.5 (e.g., about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, Attorney Docket No: 50051-0031WO1 about 5.5 to about 6.5, about 5.5 to about 6.0, about 6.5 to about 7.0, about 6.5 to about 7.5, about 6.5 to about 8.0, about 7.0 to about 8.5, about 7.5 to about 8.5, or about 8.0 to about 8.5) In some embodiments, a polymer composition or an extended release otic composition can have a pH of about 5.0 to about 7.7 (e.g., about 5.0 to about 5.5, about 5.0 to about 6.0, about 5.0 to about 6.5, about 5.0 to about 7.0, about 5.0 to about 7.5, about 5.5 to about 7.7, about 6.0 to about 7.7, about 6.5 to about 7.7, about 7.0 to about 7.7, about 6.0 to about 7.0, about 6.6 to about 7.7, about 6.8 and about 7.7, about 6.6 to about 6.8). In some embodiments, a polymer composition or an extended release otic composition can have a pH of about 7.2. In some embodiments, a polymer composition or an extended release otic composition can have a pH of about 5.5 to about 6.5 (e.g., about 5.7 to about 6.2, or about 6.0). The pH of a polymer composition or an extended release otic composition can be adjusted by the addition of an acid (e.g., HCl, phosphoric acid), abase (e.g., NaOH, KOH), and / or a buffer (e.g., phosphate (e.g., in the form of phosphate (e.g., sodium phosphate (e.g., monobasic and / or dibasic), phosphoric acid, or a combination thereof), borate (e.g., sodium borate (e.g., decahydrate)), or a combination thereof), as appropriate. In some embodiments, the pH of a polymer composition or an extended release otic composition, when gelled, can be measured indirectly, through equilibration with purified distilled water. In some embodiments, a gel formed from a polymer composition or an extended release otic composition as described herein can have a pH of about 5.5 to about 8.5 (e.g., about 5.5 to 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.5, about 5.5 to about 6.0, about 6.5 to about 7.0, about 6.5 to about 7.5, about 6.5 to about 8.0, about 7.0 to about 8.5, about 7.5 to about 8.5, or about 8.0 to about 8.5). In some embodiments, a gel formed from a polymer composition or an extended release otic composition as described herein can have a pH of about 6.0 to about 7.7 (e.g., about 6.0 to about 7.0, about 6.6 to about 7.7, about 6.8 to about 7.7, about 6.6 and about 6.8). In some such embodiments, the pH of the gelled polymer composition or extended release otic composition can be about 6.0 to about 6.5 (e.g., about 6.1 to about 6.4). In some embodiments, temperature is used to influence the gelation time. In some such embodiments, the polymer composition can be prepared as a chilled composition and / or from one or more chilled components. The crosslinking density of the gel can be influenced by the overall molecular weight of the crosslinker and functional polymer and the number of functional groups available per Attorney Docket No: 50051-0031WO1 molecule. A lower molecular weight of functional polymer, such as about 600 Da, will typically yield higher crosslinking density as compared to a higher molecular weight, such as 10,000 Da. The crosslinking density also can also be influenced by the overall percent solids of the crosslinker and functional polymer solutions. Increasing the percent solids increases the probability that an electrophilic group will combine with a nucleophilic group prior to inactivation by hydrolysis. Yet another method to influence crosslink density is by adjusting the stoichiometry of nucleophilic groups to electrophilic groups. A one to one ratio generally leads to the highest crosslink density. Excipients Extended release otic compositions or polymer compositions as described herein can contain excipients such as pH buffers, tonicity agents, mucoadhesive agents, stabilizing agents, preservatives, carriers, and penetration enhancers. In some embodiments, excipients that can be incorporated into the polymer compositions or extended release otic compositions include diluents, buffers, dispersing agents or viscosity modifying agents, solubilizers, stabilizers, and osmolarity modifying agents. The term “diluent” refers to chemical compounds that can be used to dilute a component (e.g., a functional polymer, crosslinker, and / or active agent) of a polymer composition or extended release otic composition (e.g., prior to delivery). In some embodiments, a diluent is with the auris media and / or auris interna. The term “dispersing agents,” and / or “viscosity modulating agents” and / or “thickening agents” refer to materials that enhance dispersion of particulate matter in a solution or modify the viscosity of a solution or suspension. Examples of dispersing agents / materials include, but are not limited to, hydrophilic polymers, electrolytes, TWEEN® 60 or TWEEN® 80, PEG, polyvinylpyrrolidone (PVP; also known as povidone and commercially known as Kollidon®, and PLASDONE® ), and the carbohydrate-based dispersing agents such as, for example, modified celluloses such as hydroxypropyl celluloses (e.g., HPC, HPC-SL, and HPC-L), hydroxypropyl methylcelluloses (e.g., HPMC K100, HPMC K4M, HPMC K15M, and HPMC K100M), carboxymethylcellulose, carboxymethylcellulose sodium, methylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate stearate (HPMCAS), polyvinyl alcohol (PVA), vinyl Attorney Docket No: 50051-0031WO1 pyrrolidone / vinyl acetate copolymer (S630), 4-(1,1,3,3-tetramethylbutyl)-phenol polymer with ethylene oxide and formaldehyde (also known as tyloxapol), polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, polyvinylpyrrolidone / vinyl acetate copolymer (S-630), and polyethylene glycol, having a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400. In some embodiments, the amount of thickening agent is about 1%, 5%, about 10%, or about 15% of the total weight of the composition. In some instances, dispersants improve composition physical stability by inhibiting drug crystallization. The term “solubilizer” refers to auris-acceptable compounds such as triacetin, triethylcitrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium docusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropylmethyl cellulose, hydroxypropyl cyclodextrins and other cyclodextrins, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, TRANSCUTOL®, propylene glycol, and dimethyl isosorbide, ethanol, and other organic solvents. Amphiphilic molecules such as poloxamers and tweens can also serve as solubilizers. In some embodiments, sustained reservoirs of solubilizer can be obtained when these solubilizers are at concentrations above the critical micelle concentration (CMC) or above their solubility (e.g. bile salts). In some embodiments, a solubilizer includes one or more of propylene glycol, PEG300, ethanol, and cyclodextrins, poloxamer 407 and poloxamer 188. Various physical or viscosity modifiers can be used to enhance mechanical strength and stability of a polymer composition or an extended release otic composition. In some embodiments, particles (e.g., microparticles or nanoparticles) of an active agent can be used to increase mechanical stability of the hydrogel. Particles may be suspended in the hydrogel, or covalently or coupled to the polymer by ionic or hydrophobic interactions. In some embodiments, other viscosity modifiers, stabilizers, and / or permeation enhancers can be included in a polymer composition or an extended release otic composition. Non-limiting examples of viscosity modifiers include polymers such as dextrans or other polysaccharides, PLURONICs (also referred to as poloxamers, are a class of synthetic block copolymers which consist of hydrophilic poly(ethylene oxide) (PEO) and hydrophobic poly(propylene oxide) (PPO), arranged in an A-B-A triblock structure, thus giving PEO-PPO-PEO), emulsifiers and micelles. Micelles of permeation enhancers and / or solubilizers can, in some embodiments, be Attorney Docket No: 50051-0031WO1 used to achieve sustained concentrations in the formulation. In some embodiments, micelles of Poloxamer 407 and / or Poloxamer 188 can be used as a solubilizer, for example at a concentration of about 1% to about 10% (e.g., about 1% to about 2%, about 1% to about 3%, about 1% to about 5%, about 1% to about 8%, about 2% to about 10%, about 3% to about 10%, about 5% to about 10%, or about 8% to about 10%) by weight of the polymer composition or extended release otic composition. In some embodiments, the concentration of a poloxamer does not contribute to gel formation or create high viscosity. In some embodiments, a polymer composition or extended release otic composition as described herein does not include a poloxamer. In some instances, an active agent may be present in a metastable solid form, such as an amorphous particle, a polymorph, or a salt form where a different solid form has lower solubility; e.g., a free base crystalline form. In some embodiments, an excipient such as polyvinylpyrrolidone and poloxamer 407 may serve as a solubilizer and as a dispersant to inhibit drug crystallization. The term “stabilizer” refers to compounds such as antioxidants, buffers, acids, and preservatives that are typically compatible with the environment of the auris media and / or auris interna. Stabilizers can include agents that improve the compatibility of excipients with a container, or a delivery system, including a syringe or a glass bottle, that improves the stability of a component of an extended release otic composition or polymer composition, or improve composition stability, for example, to avoid a change in phase. A tonicity agent can be included in some embodiments in order to achieve a particular tonicity. In general, the endolymph has a higher osmolality than the perilymph. For example, the endolymph has an osmolality of about 304 mOsm / kg H2O, while the perilymph has an osmolality of about 294 mOsm / kg H2O. In some forms, the polymer compositions or extended release otic compositions described herein provide an osmolality of about 100 mOsm / kg to about 1000 mOsm / kg, (e.g., about 150 mOsm / kg to about 450 mOsm / kg, about 200 mOsm / kg to about 400 mOsm / kg, about 240 mOsm / kg to about 350 mOsm / kg, about 250 mOsm / kg to about 350 mOsm / kg, about 270 mOsm / kg to about 320 mOsm / kg, about 280 mOsm / kg to about 320 mOsm / kg, about 100 mOsm / kg to about 200 mOsm / kg, about 100 mOsm / kg to about 300 mOsm / kg, about 100 mOsm / kg to about 500 mOsm / kg, about 100 mOsm / kg to about 700 mOsm / kg, about 100 Attorney Docket No: 50051-0031WO1 mOsm / kg to about 900 mOsm / kg, about 200 mOsm / kg to about 1000 mOsm / kg, about 300 mOsm / kg to about 1000 mOsm / kg, about 500 mOsm / kg to about 1000 mOsm / kg, about 700 mOsm / kg to about 1000 mOsm / kg, about 900 mOsm / kg to about 1000 mOsm / kg, or about 300 to about 600 mOsmol / kg). In some forms, the polymer compositions or extended release otic compositions described herein provide an osmolality of about 550 mOsm / kg to about 600 mOsm / kg (e.g., about 560 to about 590 mOsm / kg). For example, the polymer composition can be in the form of a gel and have an osmolality of about 150 mOsmol / kg to about 400 mOsmol / kg. In some forms, the polymer compositions or extended release otic compositions described herein have an osmolality of about 280 mOsm / kg. In some forms, the polymer compositions or extended release otic compositions described herein have an osmolarity of about 100 mOsm / L to about 1000 mOsm / L (e.g., about 200 mOsm / L to about 400 mOsm / L, about 240 mOsm / L to about 350 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 270 mOsm / L to about 320 mOsm / L, about 280 mOsm / L to about 320 mOsm / L, about 100 mOsm / L to about 200 mOsm / L, about 100 mOsm / L to about 300 mOsm / L, about 100 mOsm / L to about 500 mOsm / L, about 100 mOsm / L to about 700 mOsm / L, about 100 mOsm / L to about 900 mOsm / L, about 200 mOsm / L to about 1000 mOsm / L, about 300 mOsm / L to about 1000 mOsm / L, about 500 mOsm / L to about 1000 mOsm / L, about 700 mOsm / L to about 1000 mOsm / L, or about 900 mOsm / L to about 1000 mOsm / L). In some forms, the osmolarity of the composition is designed such that the gel is hypotonic with the targeted otic structure (e.g., the endolymph, perilymph, or the like). In some forms, the osmolarity of the composition is designed such that the gel is isotonic with the targeted otic structure (e.g., endolymph, perilymph, or the like). In some forms, the osmolarity of the composition is designed such that the gel is hypertonic with the targeted otic structure (e.g., the endolymph, perilymph, or the like). Osmolarity / osmolality can be adjusted, for example, by the use of appropriate salt concentrations (e.g., concentration of potassium salts) or the use of tonicity agents, which can render the compositions endolymph-compatible and / or perilymph-compatible (e.g., the gel is isotonic with the endolymph and / or perilymph). In some instances, endolymph-compatible and / or perilymph-compatible extended release otic compositions or polymer compositions can cause minimal disturbance to the environment of the inner ear and cause minimum discomfort (e.g., vertigo and / or nausea) to a subject (e.g., a mammal) upon administration. Attorney Docket No: 50051-0031WO1 In some forms, a gel formed by an extended release otic composition or polymer composition can be isotonic with the perilymph. Isotonic compositions can, in some cases, be formed by the inclusion of a tonicity agent in an extended release otic composition or polymer composition. Suitable tonicity agents include, but are not limited to, any pharmaceutically acceptable sugar, salt, or any combinations or mixtures thereof, such as, but not limited to, dextrose, glycerin, mannitol, sorbitol, sodium chloride, and other electrolytes. Sodium chloride or other tonicity agents can be optionally used to adjust tonicity, if necessary. Representative salts include those having sodium, potassium, or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate, or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite, and ammonium sulfate. In the case of phosphate buffers, it will be understood that sodium phosphate monobasic and sodium phosphate dibasic are typically used in combination to achieve a particular pH, and collectively, they can be called “sodium phosphate”. In some cases, for example, when borate is also used, phosphoric acid can be used to further alter the pH. In some embodiments, a tonicity agent can be is sodium chloride. In some embodiments, a gel formed by an extended release otic composition or polymer composition can be slightly hypotonic so that water is pulled from the formulation into the tissue to increase contact and adhesion with the tissue. Extended release otic compositions or polymer compositions can, in some embodiments, include one or more pH-adjusting agents or buffering agents. Non-limiting examples of pH adjusting agents or buffers include acetate, bicarbonate, ammonium chloride, citrate, phosphate, borate, pharmaceutically acceptable salts thereof, and combinations or mixtures thereof. Non- limiting examples of water-soluble buffering agents are alkali or alkaline earth metal carbonates, phosphates, bicarbonates, citrates, borates, acetates, succinates, and the like, such as sodium phosphate, citrate, borate, acetate, bicarbonate, carbonate, and HEPES. In some embodiments, Tromethamine (TRIS) is not used in polymer compositions or extended release otic compositions where a primary amine is a functional group. In some embodiments, an extended release otic composition or polymer composition can include sodium borate decahydrate in an amount of about 0.01% to about 3.0% (e.g., about 0.01% to about 0.1%, about 0.01% to about 0.5%, about 0.01% to about 1.0%, about 0.01% to about 2.0%, about 0.1% to about 3.0%, about 0.5% to about 3.0%, about 1.0% to about 3.0%, Attorney Docket No: 50051-0031WO1 about 2.0% to about 3.0%, about 0.05% to about 2.0%, or about 0.5% to about 1.5%) by weight. In some embodiments, an extended release otic composition or polymer composition can include sodium borate decahydrate in an amount of about 0.05% to about 2.0% (e.g., about 0.5% to about 1.5%, or about 1.2%) by weight. In some embodiments, an extended release otic composition or polymer composition can include sodium phosphate in an amount of about 0.01% to about 3.0% (e.g., about 0.01% to about 0.1%, about 0.01% to about 0.5%, about 0.01% to about 1.0%, about 0.01% to about 2.0%, about 0.1% to about 3.0%, about 0.5% to about 3.0%, about 1.0% to about 3.0%, about 2.0% to about 3.0%, about 0.05% to about 2.0%, or about 0.5% to about 1.5%) by weight. In some embodiments, an extended release otic composition or polymer composition can include sodium phosphate in an amount of about 0.05% to about 2.0% (e.g., about 0.5% to about 1.5%, or about 1.1%) by weight. In some embodiments, an extended release otic composition or polymer composition can include phosphoric acid in an amount of about 0.01% to about 3.0% (e.g., about 0.01% to about 0.1%, about 0.01% to about 0.5%, about 0.01% to about 1.0%, about 0.01% to about 2.0%, about 0.1% to about 3.0%, about 0.5% to about 3.0%, about 1.0% to about 3.0%, about 2.0% to about 3.0%, about 0.05% to about 2.0%, or about 0.5% to about 1.5%) by weight. In some embodiments, an extended release otic composition or polymer composition can include phosphoric acid in an amount of about 0.05% to about 2.0% (e.g., about 0.5% to about 1.5%, or about 0.9%) by weight. In some forms, the compositions include a mucoadhesive. In some cases, a mucoadhesive facilitates adhesion to a portion of the ear, such as the round window membrane. Mucoadhesive agents include, but are not limited to, carbomers, such as CARBOPOL® 934P, polyvinylpyrrolidone polymer (PVP); a water-swellable, but water-insoluble, cross-linked carboxy-functional polymer; a crosslinked poly(acrylic acid) (e.g. CARBOPOL® 947P); a carbomer homopolymer; a carbomer copolymer; a hydrophilic polysaccharide gum; maltodextrin; a cross-linked alginate gum gel, hydroxypropyl methylcellulose, and a water- dispersible polycarboxylated vinyl polymer. Mucoadhesive agents are described in U.S. Patent 8,828,980 to Lichter, et al, incorporated herein by reference in its entirety. Examples of surfactants include, but are not limited to, sodium lauryl sulfate, sodium decussate, TWEEN®60 (polyethylene glycol sorbitan monostearate) or TWEEN®80 Attorney Docket No: 50051-0031WO1(polyethylene glycol sorbitan monooleate), triacetin, D- -tocopheryl polyethylene glycolsuccinate (vitamin E TPGS), phospholipids, lecithins, phosphatidyl cholines (c8-c18), phosphatidylethanolamines (c8-c18), phosphatidylglycerols (c8-c18), sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, bile salts, and glyceryl monostearate, Extended release otic compositions or polymer compositions can, in some embodiments, include penetration enhancers that allow for delivery of the active agents across a barrier, such as the oval window or the round window of the ear. Typically, the penetration enhancers are auris- compatible. Penetration enhancers include sodium lauryl sulfate, sodium octyl sulfate, sodium dodecyl sulfate, ocytl-trimethyl-ammonium bromine, dodecyl-trimethyl ammonium bromide, sodium laurate, polyoxyethylene-20-cetyl ether, laureth-9, sodium dodecylsulfate, dioctyl sodium sulfosuccinate, polyoxyethylene-9-lauryl ether (PLE), TWEEN® 20, TWEEN® 80, nonylphenol ethoxylate (NP-POE), polysorbates, bile salts, fatty acids and derivatives, chelating agents (such as EDTA, citric acid, and salicylates, sulfoxides (such as dimethyl sulfoxide (DMSO) and decylmethyl sulfoxide), and alcohols (such as ethanol, isopropanol, glycerol, and propanediol. In some cases, permeation enhancers are partially soluble fatty acids such as oleic acid present at concentrations high enough to form a suspension and, hence, micro-reservoir for sustained presence of permeation enhancer. In some embodiments, an extended release composition includes a permeation enhancer that is depleted after providing an initial higher release of an active agent. In some forms, extended release otic compositions or polymer compositions can include a preservative. Exemplary preservatives are also described in U.S. Patent 8,828,980 to Lichter, et al, herein incorporated by reference in its entirety. Suitable preservatives include, but are not limited to, benzoic acid, boric acid, p-hydroxybenzoates, alcohols, quaternary compounds, stabilized chlorine dioxide, mercurials, such as merfen and thiomersal, or a combination thereof. In some embodiments, a preservative can include butylated hydroxytoluene (BHT). In some embodiments, an extended release otic composition or polymer composition can include BHT in an amount of about 0% to about 0.01% (e.g., about 0.0005% to about 0.01%, about 0.001% to about 0.01%, or about 0.005% to about 0.01%). In some embodiments, a preservative can include BHT. In some embodiments, an extended release otic composition or polymer composition can include BHT in an amount of about 0% to about 0.01% (e.g., about 0.0005% to about 0.01%, about 0.001% to about 0.01%, or about 0.005% to about 0.01%). In some Attorney Docket No: 50051-0031WO1 embodiments, an extended release otic composition or polymer composition can include BHT in an amount of about 0% to about 0.005% (e.g., about 0.001% to about 0.003% or about 0.002%). III. Administration of the Polymers and Crosslinking Polymer compositions or extended release otic compositions can be administered using any appropriate method. Also provided herein are methods of preparing a polymer composition or an extended release otic composition. In some embodiments, a polymer composition or an extended release otic composition can be prepared by: combining a solution or suspension of a functional polymer and a solution or suspension of a crosslinker. In some embodiments, a solution or suspension of a functional polymer and a solution or suspension of a crosslinker are combined during administration of the polymer composition or extended release otic composition (e.g., when using a dual syringe apparatus). In some embodiments, a polymer composition or an extended release otic composition can be prepared by: combining a solution or suspension of a functional polymer and a solution or suspension of a crosslinker, such that the combination has a pH of about 5.5 to about 8.5. In some cases, the functional polymer is a solid (e.g., a lyophilized powder) and is reconstituted at or near the time of use. Accordingly, in some embodiments, a polymer composition or an extended release otic composition can be prepared by: (a) making a solution or suspension of the functional polymer, (b) making a solution or suspension of the crosslinker, and (c) combining the solution or suspension of the functional polymer and the solution or suspension of the crosslinker. In some cases, the crosslinker is provided as a solution. Accordingly, in some embodiments, a polymer composition or an extended release otic composition can be prepared by: (a) making a solution or suspension of the functional polymer, and (b) combining the solution or suspension of the functional polymer with a solution or suspension of the crosslinker. In some embodiments, a polymer composition or an extended release otic composition can be prepared by: (a) making a solution or suspension of the functional polymer, (b) altering the pH of a solution or suspension of the crosslinker, and (c) combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker. In some embodiments, making a solution or suspension of the functional polymer or of the crosslinker can include adjusting the pH of the solution or suspension. In some Attorney Docket No: 50051-0031WO1 embodiments, adjusting the pH of a solution or a suspension of the functional polymer can include adjusting the pH to about 1.6 to about 4.0. In some embodiments, adjusting the pH of a solution or suspension of the crosslinker can include adjusting the pH to about 5.5 to about 8.5. In some embodiments, a solution or suspension of a functional polymer and a solution or suspension of a crosslinker are combined during administration of the polymer composition or extended release otic composition (e.g., when using a dual syringe apparatus). In some cases, the functional polymer is provided as a solution or suspension. Accordingly, in some embodiments, a polymer composition or an extended release otic composition can be prepared by: (a) making a solution or suspension of the crosslinker, and (b) combining the solution or suspension of the functional polymer and the solution or suspension of the crosslinker. In some cases, the crosslinker is provided as a solution. In some embodiments, a polymer composition or an extended release otic composition can be prepared by combining the solution or suspension of the functional polymer with a solution or suspension of the crosslinker. In some embodiments, a polymer composition or an extended release otic composition can be prepared by: (a) making a solution or suspension of the crosslinker, (b) altering the pH of a solution or suspension of the functional polymer, and (c) combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker. In some embodiments, making a solution or suspension of the functional polymer or of the crosslinker can include adjusting the pH of the solution or suspension. In some embodiments, adjusting the pH of a solution or a suspension of the functional polymer can include adjusting the pH to about 1.6 to about 4.0. In some embodiments, adjusting the pH of a solution or suspension of the crosslinker can include adjusting the pH to about 5.5 to about 8.5. In some embodiments, a solution or suspension of a functional polymer and a solution or suspension of a crosslinker are combined during administration of the polymer composition or extended release otic composition (e.g., when using a dual syringe apparatus). In some embodiments, an extended release otic composition can be prepared from components: (i) a solid form (e.g., powder) of an active agent (e.g., dexamethasone), (ii) a diluent solution, (iii) a solid form (e.g., powder) of a functional polymer (e.g., NHS-PEG), and (iv) a solution of a crosslinker (e.g., trilysine). In some embodiments, an extended release otic composition can be prepared by (a) combining an active agent (e.g., dexamethasone) with a solution of a crosslinker (e.g., trilysine) to form a first mixture, (b) combining the functional Attorney Docket No: 50051-0031WO1 polymer with the diluent solution to form a second mixture, and (c) combining the first mixture and the second mixture. In some embodiments, an active agent can be included in the solution or suspension of the functional polymer; in the solution or suspension of the crosslinker; provided in a separate solution or suspension; provided as a separate solid (e.g., dry powder); provided as a solid (e.g., dry powder) and combined with functional polymer (e.g., prior to forming a solution or suspension of the functional polymer), provided as a solid (e.g., dry powder) and combined with crosslinker (e.g., prior to forming a solution or suspension of the crosslinker), or a combination thereof. In some embodiments where an active agent is provided in a separate solution, suspension, or as a solid (e.g., a dry powder), combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker can further include combining the solution, suspension, or solid form (e.g., dry powder) of the active agent. In some embodiments, combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker occurs less than 60 minutes (e.g., less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, or less than 10 minutes) after making a solution or suspension of the functional polymer. Also provided herein are methods of administering a polymer composition or an extended release otic composition. In some embodiments, a polymer composition or an extended release otic composition can be administered by (i) preparing a polymer composition or extended release composition, e.g., by any of the methods described herein, and (ii), administering the polymer composition or extended release otic composition to a subject. In some embodiments, a polymer composition or an extended release otic composition can be administered by (i) preparing a polymer composition or extended release otic composition by combining a solution or suspension of a functional polymer and a solution or suspension of a crosslinker, and (ii), administering the polymer composition or extended release otic composition to a subject. In some embodiments, a polymer composition or an extended release otic composition can be administered by (i) preparing a polymer composition or extended release composition by combining a solution or suspension of a functional polymer and a solution or suspension of a crosslinker, such that the combination has a pH of about 5.5 to about 8.5, and (ii), administering the polymer composition or extended release otic composition to a subject. In some embodiments, the preparing of a polymer composition or extended release otic Attorney Docket No: 50051-0031WO1 composition occurs during the administering, for example, when using a dual syringe apparatus containing separate reservoirs of functional polymer and crosslinker. In some embodiments, a polymer composition or an extended release otic composition can be administered by (i) preparing a polymer composition or extended release otic composition by (a) making a solution or suspension of the functional polymer, (b) making a solution or suspension of the crosslinker, and (c) combining the solution or suspension of the functional polymer and the solution or suspension of the crosslinker, and (ii), administering the polymer composition or extended release otic composition to a subject. In some embodiments, a polymer composition or an extended release otic composition can be administered by (i) preparing a polymer composition or extended release composition by (a) making a solution or suspension of the functional polymer, and (b) combining the solution or suspension of the functional polymer with a solution or suspension of the crosslinker, and (ii), administering the polymer composition or extended release otic composition to a subject. In some embodiments, a polymer composition or an extended release otic composition can be administered by (i) preparing a polymer composition or extended release composition by (a) making a solution or suspension of the functional polymer, (b) altering the pH of a solution or suspension of the crosslinker, and (c) combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker, and (ii), administering the polymer composition or extended release otic composition to a subject. In some embodiments, a polymer composition or an extended release otic composition can be administered by (i) preparing a polymer composition or extended release composition by (a) making a solution or suspension of the crosslinker, and (b) combining the solution or suspension of the crosslinker with a solution or suspension of the functional polymer, and (ii), administering the polymer composition or extended release otic composition to a subject. In some embodiments, a polymer composition or an extended release otic composition can be administered by (i) preparing a polymer composition or extended release composition by (a) making a solution or suspension of the crosslinker, (b) altering the pH of a solution or suspension of the functional polymer, and (c) combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker, and (ii), administering the polymer composition or extended release otic composition to a subject. Attorney Docket No: 50051-0031WO1 In some embodiments of administering a polymer composition or an extended release otic composition, an active agent can be included in the solution or suspension of the functional polymer; in the solution or suspension of the crosslinker; provided in a separate solution or suspension; provided as a separate solid (e.g., dry powder); or provided as a solid (e.g., dry powder) combined with functional polymer (e.g., prior to forming a solution or suspension of the functional polymer), or a combination thereof. In some embodiments where an active agent is provided in a separate solution, suspension, or as a solid (e.g., a dry powder), combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker can further include combining the solution, suspension, or solid form (e.g., dry powder) of the active agent. In some embodiments, combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker occurs less than 60 minutes (e.g., less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, or less than 10 minutes) after making a solution or suspension of the functional polymer. In some embodiments, step (ii) occurs less than 10 minutes (e.g., less than 9 minutes, less than 8 minutes, less than 7 minutes, less than 6 minutes, less than 5 minutes, less than 4 minutes, less than 3 minutes, less than 2 minutes, or less than 1 minute) after combining the solution or suspension of the functional polymer with the solution or suspension of the crosslinker. In the case of intrinsic gelation due to the presence of crosslinking agents, it can be important to control the timing of chemical crosslinking and administration. It will be appreciated that the timing of step (ii) is related to the gelation time of the extended release otic composition or polymer composition as described hereinabove. Typically, the timing of step (ii) is such that administration of the extended release otic composition or polymer composition is not yet a gel. In some embodiments, gelation can be initiated upon application of an external factor, such as light or other external energy before, during, or after administration. In some embodiments, a polymer composition or an extended release otic composition can be administered to a subject followed by initiation of the crosslinking reaction. Extended release otic compositions can be administered to the middle ear of a subject in need thereof, for example, by trans-tympanic injection. In some embodiments, the extended release otic compositions are administered on or near the round window membrane via trans- Attorney Docket No: 50051-0031WO1 tympanic injection. Extended release otic compositions, in some embodiments, may also be administered on or near the round window or the crista fenestrae cochleae through entry via a post-auricular incision and surgical manipulation into or near the round window or the crista fenestrae cochleae area. In some embodiments, when administered to the ear of a subject, the extended release otic composition does not engulf any of the ossicles. In some embodiments, when administered to the ear of a subject, the extended release otic composition does not contact any of the ossicles. In some cases, administering can include using a syringe and small diameter needle, (e.g., 23G to 30G or smaller), wherein the needle is inserted through the tympanic membrane and guided to the area of the round window or crista fenestrae cochleae. The composition is then deposited on or near the round window or crista fenestrae cochleae. In some embodiments, when being administered, an extended release otic composition is a liquid. In some embodiments, before administration, an extended release otic composition is not exposed to a temperature above about 26 °C. In some embodiments, during administration, the extended release otic composition has a temperature of about 20 °C to about 25 °C. In some embodiments, the administering comprises administering such that the extended release otic composition fills the round window niche. In some embodiments, the administering comprises administering such that the extended release otic composition is in contact with the round window membrane In some embodiments, an extended release otic composition can also be administered into the tympanic cavity or applied on the tympanic membrane or onto or in the auditory canal by injection, direct instillation or perfusion of the inner ear compartments, or in surgical procedures including, cochleostomy, labyrinthotomy, mastoidectomy, stapedectomy, or endolymphatic sacculotomy. In some embodiments, the administering can include administering a therapeutically effective dose. In some embodiments, the administering can include administering a prophylactically effective dose. In some embodiments, administering can include administering about 5 to about 500 microliters (e.g., about 5 μL to about 400 μL, about 5 μL to about 300 μL, about 5 μL to about 200 μL, about 5 μL to about 100 μL, about 5 μL to about 50 μL, about 5 μL to about 25 μL, about 5 μL to about 10 μL, about 10 μL to about 500 μL, about 25 μL to about 500 μL, about 50 μL to about 500 μL, about 100 μL to about 500 μL, about 200 μL to about 500 μL, about 300 μL to about 500 μL, about 400 μL to about 500 μL, about 25 μL to about 300 μL, Attorney Docket No: 50051-0031WO1 about 50 μL to about 200 μL, about 30 μL to about 70 μL, or about 40 μL to about 60 μL). In some embodiments, administering can include administering about 50 μL, about 100 μL, or about 200 μL. In some embodiments, the administering can include administering 3 mg dexamethasone in a volume of 50 μL of an extended release otic composition including 6% by weight of dexamethasone. In some cases, a gel formed from a polymer composition or extended release otic composition as described herein can exhibit a swelling of less than about 100% (e.g., less than less than about 80%, less than about 70%, less than about 60%, less than about 50%, or less than about 40%), within 1 day of being administered to the ear of a subject. In some embodiments, administering can include the use of a particular instrument, such as an inline mixer (sometimes also called a static mixer) downstream of a dual syringe injector, which can, in some cases, mix the components and minimize the time between initial mixing and administration to the target site. In some embodiments, methodologies and devices for performing in situ gelation, developed for other adhesive or sealant systems such as fibrin glue or sealant applications, may be used with the polymer compositions or extended release otic compositions described herein. See, for example, U.S. Patent Nos.4,874,368; 4,631,055; 4,735,616; 4,359,049; 4,978,336; 5,116,315; 4,902,281; 4,932,942; PCT WO 91 / 09641; and R. A. Tange, “Fibrin Sealant” in Operative Medicine: Otolaryngology, volume 1 (1986), each of which is herein incorporated by reference in its entirety. In some embodiments, before administering a polymer composition or an extended release otic composition as provided herein, an anesthetic can be applied to the ear drum and / or ear canal of the subject. For example, before administering, an anesthetic (e.g., EMLA® cream) can be applied to the ear drum and / or ear canal of the subject about 5 minutes to about 1 hour (e.g., about 5 minutes to about 50 minutes, about 5 minutes to about 40 minutes, about 5 minutes to about 30 minutes, about 5 minutes to about 20 minutes, about 5 minutes to about 10 minutes, about 10 minutes to about 1 hour, about 20 minutes to about 1 hour, about 30 minutes to about 1 hour, about 40 minutes to about 1 hour, or about 50 minutes to about 1 hour) before the administering. In some embodiments, before administering, an anesthetic (e.g., EMLA® cream) can be applied to the ear drum and / or ear canal of the subject immediately before the administering. Attorney Docket No: 50051-0031WO1 In some embodiments, administration can be visualized, for example, using an endoscope. Without being bound by any particular theory, it is believed that visualization can help with placement of an extended release otic composition in a desired location (e.g., on the round window membrane) and / or help to avoid placement of an extended release otic composition at an undesired location (e.g., engulfing one or more ossicles). In some embodiments, an extended release otic composition can be administered in a single dose or in multiple doses. Certain factors may influence the dosage required to effectively treat or prevent a disorder, including, but not limited to, the severity of the disease or disorder, previous preventions, the general health and / or age of the subject, and other diseases present. It will also be appreciated that the effective dosage of the extended release otic composition used for prevention may increase or decrease over the course of a particular prevention. Changes in dosage may result and become apparent from the results of assays. Before, during or after administration, polymer compositions or extended release otic composition effects a transition from a liquid state to a gel state. In some embodiments, the gel provides a therapeutically effective concentration of an active agent for a period of between about 5 days to about 6 months (e.g., about 5 days to about 1 week, about 5 days to about 2 weeks, about 5 days to about 3 weeks, about 5 days to about 1 month, about 5 days to about 2 months, about 5 days to about 3 months, about 5 days to about 4 months, about 5 days to about 5 months, about 1 week to about 6 months, about 2 weeks to about 6 months, about 3 weeks to about 6 months, about 1 month to about 6 months, about 2 months to about 6 months, about 3 months to about 6 months, about 4 months to about 6 months, about 5 months to about 6 months, about 2 weeks to about 2 months, or about 1 month to about 3 months) In some embodiments, the gel provides a therapeutically effective concentration of an active agent for at least 1 week (e.g., at least about 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months). In some cases, the subject to be treated is an adult or pediatric human undergoing treatments that can cause hearing loss, such as chemotherapy, hearing loss due to aging, hearing loss due to repeated exposure to loud noises, and other disorders damaging the cilia in the inner ear such as autoimmune disorders, infection, excess fluid or pressure. In some embodiments, the subject to be treated is an adult human. In some embodiments, the subject to be treated has a diagnosis of unilateral Definite Meniere's disease defined by the Attorney Docket No: 50051-0031WO1 Classification Committee of the Bárány Society or the American Academy of Otolaryngology- Head and Neck Surgery (AAO-HNS). In some embodiments, the subject to be treated has reported two or more episodes of definitive vertigo (lasting 20 minutes or more) in the month prior to screening for administration of an extended release otic composition. In some embodiments, the subject has documented acquired asymmetric sensorineural hearing loss, as reported by the patient or documented by audiometric testing. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has ongoing chronic inflammatory or infectious middle ear disease. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has an active infection in the ear, sinuses, or upper respiratory system. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has current tympanic membrane perforation. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has active benign paroxysmal positional vertigo (BPPV) symptoms. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has a history of superior canal dehiscence. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has a history of drop attacks (Tumarkin’s Otolithic Crisis). In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has a history of vestibular migraine. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has a history of endolymphatic sac surgery. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has a history of middle ear surgery (other than tympanostomy tubes). In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has retrocochlear pathology affecting the auditory or vestibular systems (e.g., acoustic neuroma, multiple sclerosis). In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has a significant abnormality of the ear canal or tympanic membrane that would preclude IT injection. In some embodiments, a subject is not administered an extended release otic composition as provided herein if the subject has history of immunodeficiency disease or autoimmune disease. Attorney Docket No: 50051-0031WO1 Accordingly, provided herein are methods of treating a subject with an otic disease or disorder. In some embodiments, provided herein are methods of treating a subject with an otic disease or disorder including administering a therapeutically effective dose of an extended release otic composition as described herein. In some embodiments, provided herein are methods of treating a subject with an otic disease or disorder including administering a therapeutically effective dose of an extended release otic composition as described herein to an ear of a subject in need thereof. In some embodiments, provided herein are methods of treating a subject with an otic disease or disorder including (i) identifying the subject as having the otic disease or disorder, and (ii) administering a therapeutically effective dose of an extended release otic composition as described herein to an affected ear of the subject. In some embodiments, the otic disease or disorder can be selected from the group consisting of MD, AIED, SSNHL, NIHL, age-related hearing loss, sensorineural hearing loss associated with diabetes, tinnitus, an autoimmune disorder, an infection, excess fluid or pressure, hearing loss due to chemotherapy, and combinations thereof. In addition, provided herein are methods of treating Ménière’s Disease, the methods including administering to an ear of a subject in need thereof a therapeutically effective dose of an extended release otic composition as described herein. Also provided are methods of treating Ménière’s Disease, the methods including (i) identifying a subject as having Ménière’s Disease; and (ii) administering a therapeutically effective dose of an extended release otic composition as described herein to an affected ear of the subject. In some embodiments, prior to administering an extended release otic composition, the subject is evaluated. For example, prior to administering an extended release otic composition, the subject can be evaluated for a baseline level of endolymphatic hydrops, perilymphatic enhancement, or both, for example, as assessed by delayed intravenous gadolinium contrast enhanced 3T MRI. In some cases, the subject is evaluated for a baseline level of endolymphatic hydrops. In some embodiments, the subject is evaluated for a baseline level of perilymphatic enhancement. In some embodiments, the subject is evaluated for a baseline level of both endolymphatic hydrops and perilymphatic enhancement. In some embodiments, prior to administering an extended release otic composition, the subject can be evaluated for a baseline level of severity and / or frequency of vertigo episodes. In some embodiments, prior to administering an extended release otic composition, the hearing of the subject can be evaluated Attorney Docket No: 50051-0031WO1 for a baseline (e.g., using audiometric evaluation). In some embodiments, prior to administering an extended release otic composition, the subject can be evaluated for a baseline dizziness handicap inventory (DHI) score and / or a tinnitus handicap inventory (THI) score. In some cases, the subject is evaluated on the same day that the extended release otic composition is administered. In some cases, the subject is evaluated about 1 day to about 6 weeks (e.g., about 1 day to about 1 week, about 1 day to about 2 weeks, about 1 day to about 3 weeks, about 1 day to about 4 weeks, about 1 day to about 5 weeks, about 1 week to about 6 weeks, about 3 weeks to about 6 weeks, about 4 weeks to about 6 weeks, about 5 weeks to about 6 weeks, or about 3 weeks to about 5 weeks) before the extended release otic composition is administered. In some embodiments, the subject is evaluated after administering an extended release otic composition. For example, after administering an extended release otic compositions, the subject can be evaluated for a level of endolymphatic hydrops, perilymphatic enhancement, or both, for example, as assessed by delayed intravenous gadolinium contrast enhanced 3T MRI. In some cases, the subject is evaluated for a level of endolymphatic hydrops. In some embodiments, the subject is evaluated for a level of perilymphatic enhancement. In some embodiments, the subject is evaluated for a level of both endolymphatic hydrops and perilymphatic enhancement. In some embodiments, the subject can be evaluated for a level of severity and / or frequency of vertigo episodes. In some embodiments, the hearing of the subject can be evaluated (e.g., using audiometric evaluation). In some embodiments, the subject can be evaluated for a dizziness DHI score and / or a THI score. In some cases, the subject is evaluated about 1 week to about 4 weeks (e.g., about 1 week to about 2 weeks, about 1 week to about 3 weeks, about 2 weeks to about 4 weeks, or about 3 weeks to about 4 weeks) after the extended release otic composition is administered. In some cases, the subject is evaluated about 2 weeks after the extended release otic composition is administered. In some embodiments, the subject exhibits an improvement in one or more evaluations after administration of an extended release otic composition as provided herein. For example, in some embodiments, the subject can exhibit an improvement in a level of endolymphatic hydrops, perilymphatic enhancement, or both, for example, as assessed by delayed intravenous gadolinium contrast-enhanced 3T MRI. In some cases, the subject can exhibit an improvement in the level of endolymphatic hydrops, e.g., compared to a baseline level. In some embodiments, the subject can exhibit an improvement in the level of perilymphatic enhancement, e.g., Attorney Docket No: 50051-0031WO1 compared to a baseline level. In some embodiments, the subject can exhibit an improvement in the level of both endolymphatic hydrops and perilymphatic enhancement, e.g., compared to baseline levels. In some embodiments, the subject can exhibit an improvement in the level of severity and / or frequency of vertigo episodes, e.g., compared to a baseline level. In some embodiments, the subject can exhibit an improvement in hearing (e.g., using audiometric evaluation), e.g., compared to a baseline level. In some embodiments, the subject can exhibit an improvement in a DHI score and / or a THI score, e.g., compared to baseline score(s). In some embodiments, vertigo episodes can be evaluated by the subject keeping a daily vertigo diary of the severity and frequency of vertigo episodes. In some embodiments, post- administration average vertigo severity and frequency (e.g., averaged over the previous 4 weeks) can be compared to baseline vertigo severity and frequency (e.g., averaged over the 4 weeks prior to administration). In some embodiments, hearing can be assessed by audiometric examination. In some embodiments, hearing can be assessed using pure tone audiometry at 125, 250, 500, 1000, 2000, 4000, and 8000 Hz and / or word recognition score. In some embodiments, a change from baseline in hearing by pure tone audiometry at 125, 250, 500, 1000, 2000, 4000, and 8000 Hz and word recognition score can be characterized using descriptive statistics. In some embodiments, changes in patient DHI and THI scores from baseline to a post- administration evaluation (e.g., on about Day 29 and / or about Day 85) can be evaluated and characterized using descriptive statistics. For subjects who receive MRIs, change from baseline in endolymphatic hydrops and perilymphatic enhancement as assessed by delayed intravenous gadolinium contrast-enhanced 3T MRI scan can be evaluated post-administration (e.g., on about Day 15). The amount and extent of distribution of a polymer composition or extended release otic composition in the middle ear of a subject post-administration (e.g., on about Day 15) can also be evaluated. IV. Otic Diseases and Disorders Otic disorders with underlying microvascular etiology, including MD, AIED, SSNHL, NIHL, age-related hearing loss, sensorineural hearing loss associated with diabetes, tinnitus, an autoimmune disorder, an infection, excess fluid or pressure, hearing loss due to chemotherapy, Attorney Docket No: 50051-0031WO1 EH, and similar ear disorders have no treatment, other than for some of the symptoms, nor a cure. Ménière’s Disease is a chronic, incurable inner ear disorder with recurrent debilitating symptoms that affect hearing and balance. It is named for French physician Prosper Ménière who, in 1861, first identified and described the symptoms of this medical condition. Researchers are unsure of what causes the buildup of fluid in the inner ear that results in MD. Some believe it is related to vascular insufficiencies, others say it might be due to autoimmune conditions, viral infections, allergic reactions or that the disease may initiate from a trauma. MD appears to have a hereditary component, so a gene mutation may be connected to the regulation of inner ear fluid. Although the etiology of MD remains unclear, EH is generally considered the pathologic hallmark of MD and it has been proposed that MD is an immune-mediated endolymphatic sac disorder, as reported by Devantier, 2019. Though EH historically was confirmed pathologically postmortem, it has become possible to visualize EH in living patients with the introduction of 3T magnetic resonance imaging (MRI). Naganawa et al.2010 developed an IV-gadolinium (Gd) enhanced inner ear MRI that visualized EH in patients with MD. The IV-Gd enhanced inner ear MRI is minimally invasive, has a relatively short waiting time (4 hours) and can visualize both inner ears simultaneously, which enables identification of asymptomatic EH in the opposite ear. Cho YS et al. (2018) conducted a clinical study that aimed to investigate the usefulness of the IV-Gd enhanced inner ear MRI in diagnosing MD to find a correlation between the degree of EH and the audiovestibular tests. The results demonstrate appropriate correlations with auditory vestibular functional testing which show the usefulness of IV-Gd inner ear MRI as a diagnostic method for visualizing the EH in MD. Despite these findings, EH is currently not part of the diagnostic criteria for definite MD. In some cases, MRI can be a tool for the prediction of treatment outcome. In some embodiments, MRI can determine the presence or absence of otic disorders. For example, MRI can detect the presence or absence of EH. The presence or absence of EH can, in some examples, predict response to treatment. For example, the absence of EH in a subject, as determined by MRI, can predict a better outcome for treatment as compared to the detection of EH in a subject via MRI. In some embodiments, a subject may be identified as having EH by an MRI. In some embodiments, a treatment for an otic disorder may be provided to the subject based, in part, on the detected ER. In some embodiments, a subject may be identified as not having EH by an MRI. Attorney Docket No: 50051-0031WO1 In some embodiments, a treatment for an otic disorder may be provided to the subject based, in part, on the absence of EH. In some embodiments, a treatment for a subject having been identified as having MH, may be administered based on the presence or absence of EH via an MRI scan. Autoimmune Inner Ear Disease is a rare disorder, appearing in both adults and children, caused by an immune system response. The inner ear can be the direct target of the immune response, but it can be additionally damaged by a deposition of circulating immune complexes or by systemic immune-mediated diseases. The clinical expression of immune-mediated inner ear disease shows a progressive bilateral and asymmetric SNHL profile. Cochlear symptoms are often associated with vestibular disorders. In about 50% of the AIED patients, hearing loss is also associated with vestibular symptoms, such as imbalance and motion intolerance, ataxia and positional or episodic vertigo. Hearing loss due to chemotherapy can occur when ototoxic drugs, such as cisplatin or carboplatin, damage the structures of the inner ear. These drugs can lead to the destruction of hair cells in the cochlea, which are important for translating sound vibrations into neural signals that the brain can interpret. The damage often begins in the high-frequency range and may progressively affect lower frequencies over time. Patients might experience tinnitus (ringing in the ears), difficulties in understanding speech, and a general reduction in hearing sensitivity. The severity of hearing loss can vary depending on the dosage, duration of treatment, and individual susceptibility. Sensorineural Hearing Loss is due to impaired ability of the cochlea to effectively transduce pressure waves into neural signaling. SNHL is typically associated with exposure to loud noise, aging, head trauma, exposure to ototoxic drugs, infection, autoimmune disease, Meniere's disease, genetic mutations, and tumors of the auditory nerve. Noise-induced hearing loss is caused by exposure to loud and / or long-lasting sounds. Hearing loss-may occur from prolonged exposure to loud noises, such as heavy machinery, loud music, airplanes or gunfire. Long, repeated or impulse exposure to sounds at or above 85 decibels can cause hearing loss. NIHL causes damage to the hair cells and / or the auditory nerve. Symptoms of MD, AIED, SNHL, NIHL and other ear disorders include vertigo, hearing loss, ear ringing (tinnitus), and ear pressure. The vertigo may cause severe nausea and imbalance. Hearing loss may become permanent. Attorney Docket No: 50051-0031WO1 There is no treatment, other than for some of the symptoms, nor a cure. Drugs for motion sickness or nausea may help manage the symptoms. This disclosure also provides methods of treating otic diseases and disorders using a tyrosine kinase inhibitor (e.g., a VEGF inhibitor). Accordingly, provided herein is a method of treating an otic disease or disorder in a subject, the method including identifying a subject as having an otic disease or disorder, and administering a therapeutically effective amount of tyrosine kinase inhibitor to the subject. Non-limiting examples of otic diseases and disorders include Ménière’s Disease, autoimmune inner ear disease, sensorineural hearing loss (e.g., sudden sensorineural hearing loss or sensorineural hearing loss is associated with diabetes), noise-induced hearing loss, age-related hearing loss, tinnitus, an autoimmune disorder, an infection, excess fluid or pressure, and hearing loss due to chemotherapy. In some embodiments, a method of treating noise-induced hearing loss includes administering a therapeutically effective amount of any of the extended release otic compositions described herein to an ear of a subject in need thereof. For example, a method of treating noise- induced hearing loss in a subject can comprise (i) identifying a subject as having noise-induced hearing loss; and (ii) administering a therapeutically effective amount of any of the extended release otic compositions to an affected ear of the subject. In some embodiments, a method of treating age-related hearing loss includes administering a therapeutically effective amount of any of the extended release otic compositions described herein to an ear of a subject in need thereof. For example, a method of treating age- related hearing loss in a subject can comprise (i) identifying a subject as having noise-induced hearing loss; and (ii) administering a therapeutically effective amount of any of the extended release otic compositions to an affected ear of the subject. In some embodiments, a method of treating chemotherapy related hearing loss includes administering a therapeutically effective amount of any of the extended release otic compositions described herein to an ear of a subject in need thereof. For example, a method of treating chemotherapy related hearing loss in a subject can comprise (i) identifying a subject as having noise-induced hearing loss; and (ii) administering a therapeutically effective amount of any of the extended release otic compositions to an affected ear of the subject. Attorney Docket No: 50051-0031WO1 In some cases, the tyrosine kinase inhibitor can be a VEGF inhibitor (e.g., any of the VEGF inhibitors described herein. In some embodiments, tyrosine kinase inhibitor is administered in an amount sufficient to reduce edema and lymphatic dysfunction in an affected ear. A tyrosine kinase inhibitor can be administered in any appropriate form or by any appropriate route. In some embodiments, the tyrosine kinase inhibitor can be administered systemically. In some embodiments, the tyrosine kinase inhibitor can be administered locally (e.g., to the middle or inner ear, for example, by transtympanic injection). In some cases, the tyrosine kinase inhibitor can be provided in the form of a hydrogel. Non-limiting examples of hydrogels are provided in U.S. Patent Nos.9,066,865 and 10,561,736, each of which are incorporated herein by reference in their entirety. As another example, a tyrosine kinase inhibitor can be provided in the form of any of the extended release otic compositions described herein. Exemplary Embodiments Embodiment 1 is a polymer composition comprising: about 5% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer comprises a first functional group; about 0.05% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker comprises a second functional group; and water, wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 45 seconds to about 60 minutes at a temperature of about 20 °C. Embodiment 2 is a polymer composition comprising: about 5% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer comprises a first functional group; about 0.05% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker comprises a second functional group; and water, Attorney Docket No: 50051-0031WO1 wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 10 seconds to about 30 minutes at a temperature of about 37 °C. Embodiment 3 is the polymer composition of embodiment 1 or embodiment 2, wherein the gel, when formed in the middle ear, has a residence time of at least 5 days. Embodiment 4 is the polymer composition of any one of embodiments 1-3, wherein the gel has a gel duration of at least 5 days at 37°C. Embodiment 5 is the polymer composition of any one of embodiments 1-4, wherein the polymer composition has a pH of about 5.5 to about 8.5. Embodiment 6 is the polymer composition of any one of embodiments 1-5, wherein the gel, following equilibration in phosphate-buffered saline (PBS) for 1 day, swells less than 100%. Embodiment 7 is the polymer composition of any one of embodiments 1-6, wherein the gel is elastic. Embodiment 8 is the polymer composition of any one of embodiments 1-7, wherein the gel is mucoadhesive. Embodiment 9 is the polymer composition of any one of embodiments 1-8, wherein the polymer composition has a viscosity of about 1 mPa·s to about 1000 mPa·s. Embodiment 10 is the polymer composition of any one of embodiments 1-9, wherein the polymer composition comprises about 6% to about 12% by weight of the polymer composition of the functional polymer. Embodiment 11 is the polymer composition of any one of embodiments 1-10, wherein the polymer composition comprises about 0.1% to about 0.3% by weight of the polymer composition of the crosslinker. Embodiment 12 is the polymer composition of any one of embodiments 1-11, wherein the polymer composition has a gelation time of about 8 minutes to about 12 minutes at a temperature of about 20 °C. Embodiment 13 is the polymer composition of any one of embodiments 1-12, wherein the gel has an osmolality of about 300 mOsmol / kg to about 600 mOsmol / kg. Embodiment 14 is the polymer composition of any one of embodiments 1-13, wherein the gel has a pH of about 6.0 to about 6.5. Attorney Docket No: 50051-0031WO1 Embodiment 15 is the polymer composition of any one of embodiments 1-14, wherein the ratio of the first functional group to the second functional group is about 0.8:1.2 to about 1.2:0.8. Embodiment 16 is the polymer composition of any one of embodiments 1-15, wherein the ratio of the first functional group to the second functional group is about 1:1. Embodiment 17 is the polymer composition of any one of embodiments 1-16, wherein the first functional group comprises a succinimidyl ester. Embodiment 18 is the polymer composition of any one of embodiments 1-17, wherein the functional group is selected from the group consisting of a succinimidyl succinate, a succinimidyl glutarate, a succinimidyl adipate, a succinimidyl glutaramide, a succinimidyl carbonate, a succinimidyl carboxymethyl ester, or a combination thereof. Embodiment 19 is the polymer composition of any one of embodiments 1-18, wherein the second functional group comprises a primary amine. Embodiment 20 is the polymer composition of any one of embodiments 1-19, wherein the functional polymer is pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate. Embodiment 21 is the polymer composition of any one of embodiments 1-20, wherein the crosslinker comprises polylysine, or a salt thereof. Embodiment 22 is the polymer composition of any one of embodiments 1-21, wherein the crosslinker comprises trilysine, or a salt thereof. Embodiment 23 is an extended release otic composition comprising: the polymer composition of any one of the embodiments 1-22; and an active agent. Embodiment 24 is the extended release otic composition of embodiment 23, wherein the active agent is selected from the group consisting of a therapeutic agent, a prophylactic agent, a diagnostic or visualization agent, and combinations thereof. Embodiment 25 is the extended release otic composition of embodiment 24, wherein the therapeutic agent or prophylactic agent is selected from the group consisting of a protein, a carbohydrate, a nucleic acid, a small molecule, and combinations thereof. Embodiment 26 is the extended release otic composition of any one of embodiments 23- 25, wherein the active agent is a tyrosine kinase inhibitor. Attorney Docket No: 50051-0031WO1 Embodiment 27 is the extended release otic composition of any one of embodiments 23- 26, wherein the active agent comprises a glucocorticoid. Embodiment 28 is the extended release otic composition of embodiment 27, wherein the active agent comprises dexamethasone. Embodiment 29 is the extended release otic composition of any one of embodiments 23- 25, wherein the active agent comprises a neuroprotective agent. Embodiment 30 is the extended release otic composition of embodiment 29, wherein the neuroprotective agent is BDNF, NT3, NGF, a neurotrophin, an agonist of TrkB, and / or an agonist of TrkC. Embodiment 31 is the extended release otic composition of embodiment 29, wherein the neuroprotective agent is a ROCK inhibitor selected from netarsudil, Y-27632, ripasudil, fasudil, and netarsudil-M1. Embodiment 32 is the extended release otic composition of embodiment 31, wherein the neuroprotective agent is netarsudil. Embodiment 33 is the extended release otic composition of embodiment 31, wherein the neuroprotective agent is Y-27632. Embodiment 34 is the extended release otic composition of any one of embodiments 23- 25, wherein the active agent comprises a chemoprotective agent. Embodiment 35 is the extended release otic composition of embodiment 34, wherein the chemoprotective agent is 6-Phenyl-2-thiouracil. 36 is the extended release otic composition of any one of embodiments 23-35, wherein the active agent is present in an amount of about 0.5% to about 15% by weight of the polymer composition. Embodiment 37 is an extended release otic composition comprising: about 5% to about 15% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.05% to about 0.6% by weight of trilysine or a salt thereof; about 0.01% to about 40% by weight of dexamethasone; and water. Embodiment 38 is an extended release otic composition comprising: about 8.3% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.2% by weight of trilysine or a salt thereof; Attorney Docket No: 50051-0031WO1 about 6% by weight of dexamethasone; and water. Embodiment 39 is the extended release otic composition of embodiment 37 or embodiment 38, further comprising: about 0.01% to about 3.0% by weight of sodium borate decahydrate; about 0.01% to about 3.0% by weight of sodium phosphate; about 0.01% to about 3.0% by weight of phosphoric acid; about 0% to about 0.5% of FD&C Blue #1; and about 0% to about 0.01% by weight of butylated hydroxytoluene. Embodiment 40 is the extended release otic composition of embodiment 37 or embodiment 38, further comprising: about 1.2% by weight of sodium borate decahydrate; about 1.1% to about 3.0% by weight of sodium phosphate; about 0.9% to about 3.0% by weight of phosphoric acid; about 0.01% of FD&C Blue #1; and about 0.002% by weight of butylated hydroxytoluene. Embodiment 41 is the extended release otic composition of embodiment 37 or embodiment 38, further comprising: about 0.01% to about 6.0% by weight of sodium phosphate; about 0% to about 0.5% of FD&C Blue #1; and about 0% to about 0.01% by weight of butylated hydroxytoluene. Embodiment 42 is the extended release otic composition of embodiment 37 or embodiment 38, further comprising: about 0.05% to about 6.0% by weight of sodium phosphate; about 0.01% of FD&C Blue #1; and about 0.002% by weight of butylated hydroxytoluene. Embodiment 43 is a gel formed by the polymer composition of any one of embodiments 1-22 or the extended release otic composition of any one of embodiments 23-42. Embodiment 44 is a method of manufacture of a medicament comprising the extended release otic composition of any one of embodiments 23-42 for the treatment of an otic disease or disorder. Attorney Docket No: 50051-0031WO1 Embodiment 45 is a method of treating an otic disease or disorder in a subject, the method comprising: identifying a subject as having an otic disease or disorder; and administering a therapeutically effective amount of the extended release otic composition of any one of embodiments 23-33 to an affected ear of the subject. Embodiment 46 is a method of treating an otic disease or disorder in a subject in need thereof, the method comprising: administering a therapeutically effective amount of the extended release otic composition of any one of embodiments 23-33 to an ear of the subject. Embodiment 47 is the method of any one of embodiments 44-46, wherein the otic disease or disorder is selected from the group consisting of Ménière’s Disease (MD), Autoimmune Inner Ear Disease (AIED), sudden sensorineural hearing loss (SSNHL), noise-induced hearing loss (NIHL), age-related hearing loss, sensorineural hearing loss associated with diabetes, tinnitus, an autoimmune disorder, an infection, excess fluid or pressure, hearing loss due to chemotherapy, and combinations thereof. Embodiment 48 is a method of treating Ménière’s Disease in a subject, the method comprising: administering a therapeutically effective amount of the extended release otic composition of any one of embodiments 23-42 to an ear of a subject in need thereof. Embodiment 49 is a method of treating Ménière’s Disease in a subject, the method comprising: (i) identifying a subject as having Ménière’s Disease; (ii) administering a therapeutically effective amount of the extended release otic composition of any one of embodiments 1-42 to an affected ear of the subject. Embodiment 50 is the method of any one of embodiments 45-49, wherein the administering comprises administering about 40 μL to about 60 μL of the extended release otic composition. Embodiment 51 is the method of any one of embodiments 45-50, wherein the administering comprises administering such that the extended release otic composition is in contact with the round window membrane. Embodiment 52 is a method of treating an otic disorder in a subject, the method comprising: Attorney Docket No: 50051-0031WO1 (i) identifying the presence or absence of the subject having endolymphatic hydrops (EH); (ii) administering a therapeutically effective amount of the extended release otic composition of any one of embodiments 1-42 to an affected ear of the subject. Embodiment 53 is the method of embodiment 52, wherein administering a therapeutically effective amount is based at least in part on the presence or absence of EH and / or Perilymphatic Enhancement. Embodiment 54 is the method of embodiment 52 or embodiment 53, wherein the presence of EH is determined in the subject. Embodiment 55 is the method of embodiment 52 or embodiment 53, wherein the absence is EH is determined in the subject. Embodiment 56 is the method of any one of embodiments 52-55, wherein the otic disorder is Ménière’s Disease. Embodiment 57 is the method of any one of embodiments 52-56, wherein the identifying the presence of absence of EH is determined via MRI. Embodiment 58 is a method of treating an otic disorder in a subject, the method comprising: (i) identifying a subject as having an otic disorder; (ii) administering a therapeutically effective amount of the extended release otic composition of any one of embodiments 1-42 to an affected ear of the subject. Embodiment 59 is the method of embodiment 58, wherein administering the therapeutically effective amount of the extended release otic composition modulates one or more genes. Embodiment 60 is the method of embodiment 59, wherein the one or more genes are Nrlp3, Tlr1, Tlr2, Tlr4, Tlr7, Tlr9, Ccl3, Ccl5, Ccl12, Cxcl10, Il1a, Il1b, Il6, Il18, Cd14, Lbp, FoxP3, Il10, Ccr6, C3, Cd8a, iNos, Itgam, Rag1, Tjp1, Cdh5, Marveld2, and Serpinf1. Embodiment 61. The method of embodiment 59, wherein the one or more genes are -catenin, TCF, LEF, Rho, Rac, JNK, PKC, CaMKII, NFAT, NICD, CSL, MAML, HES, and HEY. Embodiment 62 is the method of any one of embodiments 58-61, wherein, prior to (i), the method further comprises administering a pretreatment dose of the extended release otic composition of any one of embodiments 1-42. Attorney Docket No: 50051-0031WO1 The present invention will be further understood by reference to the following non- limiting examples. EXAMPLES Example 1: Impact of Drug Particle Concentration on Gelation Time Materials and Methods PEG-trilysine polymer trilysine solution was pH adjusted with 1 N HCl as described in Example 1. Micronized dexamethasone (Dex; Spectrum Chemical DE121) was then added to the pH-adjusted trilysine solution and vortexed. One hundred microliters of the pH-adjusted trilysine drug suspension was then added to 100 microliters of the PEG-trilysine polymer PEG solution in a glass vial for stir bar test of gelation time. The time post addition when the stir bar ceased rotation was recorded. Results While addition of HCl to the trilysine polymer solution dilutes the trilysine and yields less than 1:1 stoichiometry when added to PEG-trilysine polymer PEG solution, the addition of drug particles further dilutes and reduces the stoichiometry. Table 3: Gelation time of pH adjusted trilysine containing up to 6 wt% dexamethasone As shown in Table 3, the fraction of original trilysine solution in pH 8.4 modified trilysine contains 85% of the original trilysine solution and addition of 12 wt% dexamethasone lowers the amount of original trilysine solution to 75%. As also shown in Table 3, adding up to 12 wt% dexamethasone to the pH 8.4 trilysine solution did not have a substantial impact on the gelation time measured by the stir bar test. Attorney Docket No: 50051-0031WO1 Example 2: Drug Release and Erosion testing for 0 to 6 wt% Dexamethasone in pH modified PEG-trilysine polymer. Materials and Methods In vitro testing of drug release and gel erosion was performed using 200 μL of gel sample in inserts (CORNING TRANSWELL® 3414 inserts with 0.4 μm pore polycarbonate membranes). The inserts were submerged in 45 mL of receptor fluid (pH 7.4 PBS, SIGMA- ALDRICH® P5368) in an incubator at 37°C to simulate the delivery of drug to potential fluid in the middle ear. The large receptor volume was chosen to keep the drug concentration low (i.e., sink conditions) so that saturation of the receptor solution does not limit the drug release rate. The test measures the maximum drug release rate to PBS for the test configuration: 0.33 cm2area exposed directly to PBS and drug release through membrane with 0.33 cm2area. In addition, swelling and erosion were monitored gravimetrically. PEG-trilysine polymer samples were prepared in triplicate using pH-adjusted trilysine solution and 0, 1, 3, and 6 wt% dexamethasone as described in Example 3. The two components were combined in a microcentrifuge tube and mixed by vortexing prior to dispensing an aliquot into each insert. At study initiation, samples were submerged in receptor solution and stored at 37°C. Periodically, samples of receptor solution were removed and assayed for drug concentration to determine drug release. At intervals no greater than 9 days, the samples were also moved to new vials of receptor solution. Before sampling or moving inserts, the receptor vials were manually inverted several times to ensure a uniform receptor fluid. Sample weights were recorded periodically after removing excess fluid with a lab tissue. Percent swelling was calculated as the change in sample weight divided by initial sample weight. Initial sample weights reflect swelling and initial degree of crosslinking. Results As the study proceeded, sample weights were affected by changes due to degradation by hydrolysis. Sample weights first increased as the gel with initial 90% water absorbed water due to contact with receptor fluid. Samples continued to gain weight as the gel was degraded and swelled more due to fewer crosslinks, while gel erosion contributed to reduction in weight. Eventually the gel completely eroded and dissolved into the receptor fluid. As the gel eroded, the remaining solid drug particles tended to settle and flow out of the inserts if the inserts were Attorney Docket No: 50051-0031WO1 oriented on their sides and during the manual mixing process before moving inserts to a new vial. Results in Figure 2A show samples at Day 4 had initial swelling of 64 to 95% and those values were not strongly dependent on the amount of dexamethasone. All twelve inserts contained gel for at least 15 days. By Day 19, four samples had weight loss from significant erosion. Further evaluation showed the samples with shorter gel duration appeared to be correlated with pot life (time since PEG reconstitution) of the PEG solution rather than dexamethasone content; e.g., samples with longer time since PEG reconstitution have fewer crosslinks and degrade more easily. Drug release from the dexamethasone containing samples is shown in Figure 2B. The 1% Dex samples were fully depleted of drug by Day 15 while 3% and 6% gels had cumulative release of 48% and 30%, respectively. Once the gel has degraded to a fluid consistency, the remaining drug particles settled and spread out of the insert into the receptor fluid. This resulted in higher amounts of drug released into receptor fluid as demonstrated by the increase in drug release for one of the 6% Dex samples at Day 19. Observations of clear versus turbid gel were consistent with the measured amounts of drug released. The 1% Dex samples initially had clear gel primarily at the surface exposed directly to PBS and less so at the membrane surface side. Eventually there were no turbid regions of gel in these samples. In the other extreme, only a small amount of clear gel was observed on the PBS exposed surface of the 6% Dex samples. Example 3: Tissue Adhesion of 0 to 6 wt% Dexamethasone in pH-modified PEG-trilysine polymer. Materials and Methods A qualitative assessment of adhesion to tissue was performed by applying samples to raw turkey breast meat. In parallel with preparation of samples in Example 4, the remaining material was pipetted onto the surface of the turkey meat and a small wooden stick was applied on top. After a few minutes of gelation time, the adhesion was assessed by pulling on the wooden stick. Testing was performed in triplicate using samples with 0, 1, 3, and 6 wt% final dexamethasone content in PEG-trilysine polymer trilysine adjusted to pH 8.4. Attorney Docket No: 50051-0031WO1 Results Better adhesion was found for 3 and 6 wt% Dex samples compared to 0 and 1 wt% Dex samples. In addition, the gels with higher drug content had better cohesion, demonstrating the drug particles can improve gel mechanical properties similar to filler particles that can strengthen viscoelastic materials. Example 4: Gelation Time for Higher Dexamethasone Content PEG-trilysine polymer Materials and Methods PEG-trilysine polymer samples prepared from 20% Dexamethasone in pH 8.4 adjusted PEG-trilysine polymer trilysine were tested for gelation time by the stir bar test. Sample preparation and testing procedure were similar to that described in Example 1. Results Gelation times were slightly longer for 10% Dex samples than 6% Dex samples as shown by Table 4. Table 4: Gelation time of pH adjusted trilysine containing 6 or 10 wt% dexamethasone The dilution of PEG-trilysine polymer trilysine by addition of 1 N HCl and dexamethasone corresponds to about 68% of the original trilysine in the pH adjusted trilysine drug suspension. The corresponding deviation from 1:1 stoichiometry may be approaching levels insufficient for robust gel formation. Attorney Docket No: 50051-0031WO1 Example 5: Drug Release and Erosion testing for 6 wt% Dexamethasone in pH modified PEG-trilysine polymer Materials and Methods In vitro testing of drug release and gel erosion was performed as described in Example 4. Samples were prepared from pH 8.4 adjusted PEG-trilysine polymer trilysine with 12 wt% dexamethasone and the final samples contained 6 wt% dexamethasone. The pH-modified trilysine drug suspension was combined with PEG-trilysine polymer PEG solution using a blending connector with static mixer (Nordson FibriJet® SA-3678). Each blending connector was used to fill six inserts with sample. Results Data for each group of six is designated by the Pot Life of the PEG solution at time of use; i.e., time since PEG was reconstituted. The group with pot life of 67 minutes had higher initial swelling and shorter gel duration than the groups with pot life less than 30 minutes, as shown by Figure 3. Cumulative drug release, shown by Figure 4, was very reproducible, irrespective of pot life until the gel was found eroded in the 67 minute pot life group at Day 17. The PEG-trilysine polymer package insert specifies using the PEG solution before the pot life is 60 minutes so that crosslinking occurs before some of the PEG has degraded. These results demonstrate the tests were able to differentiate between samples with varying degrees of crosslinking. All samples prepared from PEG with pot life less than 30 minutes had gel duration of at least 24 days and were completely eroded at the next time point. These were submerged in PBS receptor solution during storage at 37°C. Aliquots of formulation were stored at 37°C without PBS in closed microcentrifuge tubes within a moist chamber to avoid dehydration. The two samples prepared with PEG pot life of 30 minutes had gel durations of 60 and more than 80 days when the samples were not in contact with PBS. Example 6: Intratympanic single dosage of dexamethasone formulated as SPT-2101 protects LPS-induced damage in the blood-labyrinth barrier A LPS injection was used to induce BLB alterations to further characterize the molecular and cellular mechanisms involved in disease progression and to test a formulation of dexamethasone. The formulation allowed a single local dose treatment. BLB permeability was Attorney Docket No: 50051-0031WO1 evaluated by gadolinium dynamic contrast-enhanced magnetic resonance imaging (Gd-MRI) and Evans blue (EB) incorporation into the cochlea. LPS-treated rats showed increased cochlear signal enhancement in Gd-MRI, as well as higher cochlear EB concentration than controls. LPS injections increased the expression of LPS receptors Tlr2 and Cd14, pro-inflammatory cytokines as Il1b, its receptors as ll1lr, and injury mediators Nfkb and iNos with specific time course patterns. Repeated dosage of systemic dexamethasone and a single shot of SPT-2101, but not of systemic dexamethasone, sufficed to recover BLB permeability as assessed by Gd-MRI. Furthermore, SPT-2101 was able to reduce cochlear inflammation and normalize gene expression. Materials and Methods Experimental animals. Albino Wistar rats (RjHan:WI strain, male gender, 5-6 weeks of age, 150-225 g) were obtained from a commercial provider (Janvier Labs, Le Genest-Saint-Isle, France) and housed in cages in controlled standard environmental conditions (12 hour cycle of light and darkness, temperature of 22°C) and with food and drinking water ad libitum. The rats were randomly allocated in four experimental groups: control group (without LPS or SPT-2101 administration); LPS group (rats receiving systemic LPS); LPS plus SPT-2101 (rats LPS-injected and treated with intratympanic SPT-2101); and LPS plus vehicle (rats LPS- injected and treated with intratympanic vehicle). LPS and SPT-2101 preparation and administration. The LPS was Lipopolysaccharides from Escherichia coli O55:B5 (Ref. L2880, Sigma Aldrich, St. Louis, MO, USA) was dissolved 5 mg / ml in saline and preserved at 4ºC until use. Rats were intraperitoneal injected with LPS for two consecutive days, first day at 5 mg / kg and at 10 mg / kg 24 hours later (Figure 1A). LPS secondary effects (inactivity, lethargy, dyspnea, and diarrhea) were observed rapidly after the first injection, with a 20% mortality rate in the first 24 hours. The SPT-2101 solution was prepared immediately before use and maintained at 4ºC until administration to avoid jellification. The SPT-2101 solution was prepared dissolving dexamethasone power in trilysine and then in polyethilenglycol (PEG), followed by agitation. Both trilysine and PEG solvents were obtained from DuraSeal® Xact Spinal Sealant System Attorney Docket No: 50051-0031WO1 (Integra Lifesciences, Princeton, NJ, USA), a CE and FDA approved sealant for dural closure. Vehicle was prepared in the same way but without dexamethasone (only trilysine and PEG in the same proportion). SPT-2101 or vehicle were administered by unilateral intratympanic injection three days before LPS challenge. Briefly, rats were anesthetized with isoflurane (Isoflo; Ecuphar, Barcelona, Spain) plus buprenorphine (Buprex; Indivior, Chesterfield, Virginia, USA) analgesia, and placed in lateral recumbence with the head elevated 40 degrees relative to the floor to position the middle ear correctly for the solution to flow to the round window niche. An incision was made in the vertical part of the external auditory canal to better visualize the tympanic membrane. SPT-2101 or vehicle (30 μL) were injected in the dorsocaudal region of the tympanic membrane (pars tensa), using a Hamilton®microsyringe and a 34G needle, with the tip angled and with the bevel positioned facing the round window niche. After injection, the rat remained in the same position for 20 minutes until the product was completely jellified. Hearing assessment. Auditory function was evaluated by registering the auditory brainstem responses (ABR) to sound stimuli with an evoked potential workstation (BioSigRZ Auditory Workstation, Tucker Davis Technologies (TDT), Miami, FL). Briefly, rats were anesthetized with isoflurane (5% induction and 1.5% maintenance) and placed on a heating pad (T-Pad; Gaymar, NY, USA) connected to a water pump (TP500; Gaymar) within a homemade sound-attenuated chamber. Click and tone burst (8–40 kHz) stimuli were delivered by a magnetic speaker (MF1; TDT) located 5 cm from the ear, from 90 to 10 dB SPL in 5–10 dB SPL steps. Electroencephalographic responses were registered with subdermal electrodes (TE / S50716-001; Technomed, Maastricht, The Netherlands) located at the vertex (register), mastoid region (reference), and back (ground), amplified and averaged. ABR testing was performed before local SPT-2101 / vehicle and / or systemic LPS administration (baseline) and 72 hours after first LPS injection. ABR thresholds were defined as the minimum sound level that elicited a clearly identifiable ABR wave pattern, with mean peak amplitude above 200 nV- in response to click and tone stimuli were determined on the resultant recordings. Attorney Docket No: 50051-0031WO1 Magnetic resonance imaging (MRI). Cochlear vascular permeability was evaluated in vivo by MRI with Gadolinium-based contrast agent administered intravenously. MRI generated images were acquired on a horizontal 7.0-Tesla Bruker Biospec® system (Bruker Medical Gmbh, Ettlingen, Germany) with a 40 mm inner diameter radiofrequency coil (m2m Imaging Corp) and a maximum gradient strength of 36 G / cm, using ParaVision 6.0.1 software operating on a Linux environment. Rats were MRI- scanned 72 hours after first LPS injection (6 days after intratympanic administration of SPT- 2101 or vehicle). (Figure 1A). Briefly, rats were anesthetized with isofluorane (4% induction and 1.5% maintenance) and placed in a heated probe to maintain body temperature at 37°C. Respiratory rate and body temperature were monitored by a gating system designed for small animals (SA Instruments, Inc., Stony Brook, NY, USA). T1 and T2-w images were first acquired to aid in positioning the inner ear tissues in the magnet, and to identify the regions of interest (ROIs). Then a dynamic contrast enhanced-MRI (DCE-MRI), which involves the acquisition of a series of images before and after the injection of a paramagnetic contrast agent, were performed. 360 T1-w MRI generated images (45 acquisition cycles of 0.85 min duration and containing 8 slices each) were taken continuously during a 40 minute period. A single 0.3 mmol / kg IV bolus of contrast agent (Gadobutrol, Gadovist®; Bayer, Leverkusen, Germany) was administered after the first 5 minutes of DCE-MRI (corresponding to ~7th cycle) and continued for 35 minutes more, to follow-up Gadobutrol distribution in the inner ear and surrounding tissues. MRI data analysis were performed with Fiji software (Schindelin, 2012). First, three routes of injection (right and left cochlea and external reference, a tube containing 0.1 M Gadobutrol, placed adjacent to the rat’s head and clearly visible in T1-w coronal images) were identified and delimited in the scout MRI images using the free-hand Fiji tool. The MRI slices containing the cochleae in each cycle along the acquisition (45 images) were selected and mean signal intensities of the 3 ROIs were determined on individual slices using the “multi-measure” Fiji plugin, and then normalized values (compared to external reference) were calculated. The signal enhancement in the cochlear ROIs were defined as the ratio of the signal intensity in a specific MRI cycle respect to the signal intensity obtained in the first cycle, and reflects time dependent modifications in the tissue signal intensity due to varying tissue levels of Gadobutrol. Attorney Docket No: 50051-0031WO1 Evans blue quantification. Blood-perilymph barrier altered permeability was also assessed in LPS injected rats by quantification of Evans Blue tracer in cochlear tissue after intravenous administration. Briefly, Evans blue (E2129; Sigma Aldrich) solution (2% in saline) was prepared and injected (2 ml / kg) into the tail vein of isoflurane anesthetized rats, 1-2, 25, or 72 hours after LPS first injection. One hour later, tracer injected rats were sacrificed with sodium pentobarbital overdose (Dolethal, Vetoquinol, Spain; 150 mg / kg) and perfused with 300 ml PBS to remove the tracer from the circulatory system. Inner ear samples were immediately harvested, weighed and stored at -80ºC until use. A trichloroacetic acid solution (1:1 vol in saline) was added to the sample in proportion 3:1 and then homogenized using a Tissue Lyser LT (Qiagen, Gilden, Germany), at 50 Hz for 6 min. The supernatant was separated by centrifugation (103 G for 20 minutes), collected and then diluted 1:3 vol in 95% ethanol. Flourescence in the supernatant was measured with Glomax™ Luminometer and Microplate Reader (Promega, Madison, WI, USA) (excitation wavelength 620 nm, emission wavelength 680 nm), and Evans blue concentration calculated comparing with reference Evans blue solutions (0.1 to 100 μg / ml). Then, concentration in the inner ear was estimated from the concentration in the supernatant data, knowing the total volume of supernatant extracted and the weight of the tissue. Cochlear histology and immunofluorescence. Rats (n=3-4 per experimental group ) were sacrificed by pentobarbital overdose 72 hours after first LPS injection and intracardially perfused with 0.1 M PBS and then with 4% paraformaldehyde (PFA; Merck, Darmstadt, Germany) in 0.1 M PBS. Dissected inner ears were post-fixed with 4% PFA, decalcified in 5% EDTA (Sigma-Aldrich) for 4 weeks prior to i) embedding in either paraffin or Tissue -Tek® OCT compound (Sakura Finetek, Alphen aan den Rijn, Netherlands ), or ii) organ of Corti / stria vascularis whole mount dissection. Cochlear sections. Paraffin (5 μm) sections parallel to the modiolus were obtained on a RM2155 microtome (Leica Microsystems, Deerfield, IL, USA) and stained with hematoxylin–eosin for cochlear cytoarchitecture evaluation. Images were acquired with a Zeiss AxioPhot microscope (Carl Zeiss, Jena, Germany) and captured with an Olympus DP70 digital camera (Melville, NY, USA). Attorney Docket No: 50051-0031WO1 Gross cochlear cytoarchitecture and quantification of was evaluated in midmodiolar paraffin sections. Stria vascularis dimensions (length, central width, maximum width and area) were calculated with the Fiji straight and segmented line tools. Frozen Tissue-Tek® sections (10 m) parallel to the modiolus were obtained on a Cryocut 1950 (Leica Microsystems) and used for immunodetection. Briefly, sections were permeabilized with 1% Triton X-100 (Merck), blocked with 5% donkey serum (Sigma-Aldrich), and incubated overnight at 4 °C with rabbit anti-iNOS (1:250, PA3-030A; Invitrogen, Waltham, MA, USA) and goat anti-IBA-1 (1:100, ab5076; Abcam, Cambridge, UK). Sections were then incubated with the corresponding Alexa Fluor secondary antibodies (Donkey Alexa 488 anti- rabbit (1:200, A21206; Invitrogen) and Donkey Alexa 546 anti-goat (1:200, A11056; Invitrogen), respectively) and with Alexa Fluor 647 Phalloidin (1:200, A22287; Thermo Fisher, Waltham, MA, USA) for 1 hour at room temperature. The sections were mounted with Vectashield Mounting Medium with DAPI (Vector Laboratories, Newark, CA, USA). Images were taken with an epifluorescence (Nikon 90i, Tokyo, Japan) and a confocal laser-scanning microscope (Zeiss LSM710, Carl Zeiss ). Total IBA1 intensity in the spiral ligament and spiral ganglion, and mean iNOS intensity in the spiral ganglion, respectively, were quantified with Fiji software for each cochlear turn in serial cryosections prepared from at least three mice per experimental group. Organ of Corti and stria vascularis whole mount preparations. For cochlear intra-strial fluid-blood barrier evaluation, lateral walls comprising the stria vascularis were carefully dissected from decalcified cochleae and permeabilized with 1% Triton X-100 (Merck), blocked with 10% normal donkey serum (Sigma-Aldrich) diluted in 0.1 M PBS, 0.5% Triton X-100 for 1 hour and incubated overnight at 4°C with rabbit anti-Desmin (1:50, AB32362; Abcam, Cambridge, MA) and lectin Griffonia simplicifolia IB4 (GS-IB4) conjugated to Alexa Fluor 568 (1:50, I21412, Life Technologies, Eugene, OR, USA) diluted in 0.1 M PBS, 1% donkey serum, 0.1% Triton X-100. Washes in 0.1 M PBS, 0.5% Tween 20 were followed by incubation with the corresponding Alexa Fluor secondary antibodies (1:100, A22287; Thermo Fisher Scientific) for 2 hours at room temperature and after washing in 0.1 M PBS, lateral walls were incubated with DAPI (1:1000; Thermo Fisher Scientific) and mounted with Fluoromount gold (SouthernBiotech, 0100-01, Birmingham, AL, USA). Stack images were acquired with a Zeiss LSM710 confocal laser-scanning microscope (Carl Zeiss) at the specified cochlear regions with a Attorney Docket No: 50051-0031WO1 glycerol-immersion objective (40X). Desmin coverage was carried out with Fiji software delimitating in first instance capillaries area, stained with GS-IB4, using an intensity threshold and obtaining a ROI that comprises only the capillary network. Desmin area overlapping capillaries were calculated applying an intensity threshold for desmin positive staining after importing aforementioned ROI and deleting all signal outside the ROI. Desmin coverage of capillaries, shown as percentage, was calculated as the ratio between overlapped desmin / GS-IB4 area and total GS-IB4 area. For the evaluation of the organ of Corti, cochleogram, hair cell and synapses quantification were performed in decalcified cochleae divided into 5 half-turns from apex to base as reported. The organ of Corti was carefully dissected from each half-turn and permeabilized with 1% Triton X-100 (Merck), blocked with 7% normal goat serum (Sigma-Aldrich), and incubated for 19 hours at 37°C with the hair cell marker rabbit anti-Myo7a (1:150, PT-25-6790; Proteus, Ramona, CA, USA), the synaptic ribbon marker mouse anti-CtBP2 (1:200, 612044; BD Biosciences, Franklin Lakes, NJ, USA) and the glutamate receptor postsynaptic marker mouse anti-GluR2 / 3 (1:1000, MAB397; Millipore, Burlington, MA, USA). Sections were then incubated with the corresponding Alexa Fluor secondary antibodies Goat Alexa Pacific Blue anti-rabbit (1:200, P10994; Invitrogen), Goat Alexa 488 anti-mouse-IgG1 (1:500, A-21121; Thermo Fisher) and Goat Alexa 555 anti-mouse-IgG2a (1:500, A-21137; Thermo Fisher), respectively, for 1 hour at 37°C. The half-turns were finally incubated with TO-PRO3 (1:750, T- 3605; Invitrogen) and mounted with Prolong Diamond reagent (Thermo Fisher), and low magnification fluorescent images were taken in a Nikon 90i epifluorescence microscope. These images were used for cochleogram plotting using a custom Fiji plugin, as reported by Liberman et al. (2014). Representative fluorescent tile scan and z-stack images were acquired with a Zeiss LSM710 confocal laser-scanning microscope (Carl Zeiss) at the specified cochlear regions with a glycerol-immersion objective (63×). IHC and OHC numbers were counted in 200 m of the basilar membrane in the 4 (apical), 16 (middle), and 32–40 (basal) kHz regions located 15%- 20%, 30%–35%, and 80%–90%, respectively, from the apex. Co-localized presynaptic ribbons and postsynaptic glutamate receptor patches were counted from each confocal z-stack using IMARIS software (Bitplane Inc., Saint Paul, MN, USA). A spot of each signal (CtBP2 and GluR2 / 3) was created in independent channels using an XY diameter of 0.8 m for CtBP2 and GluR2 / 3, a corrected PSF Z diameter of 1.5 m, background subtraction function, and manually Attorney Docket No: 50051-0031WO1 adjusting the intensity criterion to capture all the elements of interest. Spot co-localization measurements were used to analyze pairing of presynaptic and postsynaptic elements. A threshold was set at 1 m to define the juxtaposition of two different puncta. The computed results were corroborated by visual inspection of the puncta. Gene expression analysis. Inner ears were dissected following rat euthanasia with pentobarbital overdose. Cochleae were separated from vestibules and immediately immersed in RNAlater® solution (Sigma- Aldrich). RNA extraction, quality determination and cDNA synthesis were performed using standard techniques. Quantitative amplification in individual cochlear extracts were performed in triplicate on a Quant Studio 7 Flex PCR System (Applied Biosystems, Foster City, CA, USA) using either commercial TaqMan probes (Refs Foxp3, Il10 y Tbp) or gene specific primers (shown below). Data analysis was carried out with QuantStudio™ Real-Time PCR software 1.3 (Applied Biosystems). Tbp gene was used as housekeeping gene and differential expression(RQ) between groups was calculated by 2 Ct method using control rats as calibrator sample.A gene expression analysis using PCR array “RT² Profiler™ PCR Array Rat Innate & Adaptive Immune Responses” (QIAGEN, Cat. no. PARN-052Z) was performed in pooled cochlear RNA extracts (3 cochleae from different animals per group) to generate cDNA, and then quantitative amplification was done in duplicates with RT² SYBR® Green qPCR Mastermix (Cat. no. 330529). Data were analyzed on web portal at Geneglobe with CT cut-off set to 35. Average mean from Hprt1 and Rplp1 CTs was used as the normalization factor based on an automatic selection from housekeeping panel of reference genes. Heatmapper web-enabled tool (Babicki,2016) was used to generate the heatmap from average mean 2 Ct values for each condition andtime-point. Primers designed for real-time RT-qPCR experiments with SYBR Green Gene Forward Primer (5'-3') Reverse Primer (5'-3') AGAAAAGATCTCACACTCCGAAGA TGGATAAGTCCCACGTTAAAGAA C3 A CT GACAAGTGGTGTGGTGTTGTAGA Casp11 GTCCGCATGAGCCATGTG GT Attorney Docket No: 50051-0031WO1 Ccl3 GCGCCATATGGAGCTGACA AATTTGCCGTCCATAGGAGAAG Ccl5 GCAGCAAGTGCTCCAACCTT TCACCTTCTGATTTTTCCAGTCTCT Ccl12 GCTGGACCAGATTCAGTGTTCA GTGGATCTTCTGCTTAGCGACAT Ccr6 CGTCCAGGCGACCAAATCT TGACCTTACTGTGCGTCAGTGTT Cd8a GGCTCAGTGGAGGGAATGG CCAAGGGTGCCCAGATGTAA Cd14 GCTGCTCCCACTCTCAGAATCT TGTCAAAGGCAACAGCAACAA AAGGGAACATCTATAATGAGAAAG Cdh5 GGTTACCCCTAGAATCCAATTCG AACTG Cse TTATCCTGGGCTACCGTCTCA CCGTGCACTGACGTTTGG Cxcl10 GGGCCATAGGAAAACTTGAAATC TTGTGGCAATGATCTCAACATG Flk1 TTGTACAGCAAGAACAGAGCTCAAC TCAAGGTGCTCAAAAACATCTTTG GCTAACCGTCTTATTGGTTCCTTC Flt1 GATTCCAGCAGCAACATAGGAAA T Il1a TTCTGCCATTGACCATCTGTCT TGAAGTGAGCCATAGCTTGCA CTTGTCTCTCCTTGTACAAAGCTC Il1b CCACCTCAATGGACAGAACATAAG AT Ilri GCCCACGGAATGAGACGAT CGTGACGTTGCAGATCAGTTG AAGTCGGAGGCTTAATTACATATGT Il6 TGCCATTGCACAACTCTTTTCT TC Il18 AAACCCGCCTGTGTTCGA TGGGATTCGTTGGCTGTTC Inos GAGGAGAGAGATCCGGTTCACA CCGCATTAGCACAGAAGCAA GAATAGATTCAGACATGAACGATGC Itgam CGCGGTTCCTCGAGATGA T Lbp TCTGCCAGTCACAGCGGATA GCCGCCACCAAACTGTAGTC Marveld CCAACGGCAAAGTGAATGG GGTACCAGAGGCGGTGACTTAT 2 TGGAGTGAGTCAAAGCAGTATTCNf b CATGGCAGACGACGATCCTTAA Nrlp3 GTGTGTTTTCCCAGACCCTCAT GAAGAGACCTCGGCAGAAGCT Plgf GCCAACATCACTATGCAGATCTTAA TGTCATCTCCACGTAGGAATGTG Rag1 CAAGGTCATGGGCAGCTATTG TGCAGGTCAGTAGGGAAGCA Attorney Docket No: 50051-0031WO1 Serpinf1 AGACCCTAAGGCCATCTTACGAT TCAAAGGCAGCTTGCAGTTG Tbp CCCACATCACTGTTTCATGG CCGTAAGGCATCATTGGACT Tgfb GGAGAGCCCTGGATACCAACTA GCTGCCGTACACAGCAGTTC TCCTATATACCTTTGCTGGGTCTA Tjp1 GAGGCACCTCACACGATGCT CA Tlr1 TTCCCACCCCTCCTCTGATT CCCGCTGTTATGGACCTGAT ATAGAGGTGAAAGACCTGGAGCT Tlr2 GTCTCCAGGTCAAATCTCAGAGGAT G CATGCATTGGTAGGTAATATTAGG Tlr4 GGACTCTGATCATGGCATTGTTC AAGT Tlr7 CATTCCTGAAATGCCTCAATTTG TGGAGTTCACTGCCATTAAGAGTT Tlr9 TGATGTGGGTGGGAATTGC TCTGCCGGCATTCTGTACAG Vegf-a CAGAAGTCCCATGAAGTGATCAAG TCAATCGGACGGCAGTAGCT Vegf-b GTACTGGATCATGAGGATCTGCAT TGGAGTGTGTGCCCATTGG The primers were designed using Primer Express 3.0 software and the mouse gene sequences available on the Ensembl genome database. Protein extraction and Western blotting. Whole cochlea protein extracts from were prepared from one cochlea of each animal. Samples were homogenized in ice-cold RIPA buffer supplemented with 0.01% phosphatase (#P5726) and protease inhibitors (#P8340) (Sigma-Aldrich) using a bead homogenization equipment (Tissuelyser LT; Qiagen). Extracts were centrifuged at 14000 G for 10 min and 4°C. Supernatant was transferred to new microtubes and aliquots were readily used for western blotting analysis. Protein concentration was quantified using the Bradford Assay (Bio-Rad Laboratories, Hercules, CA, USA) and equal amounts of protein were resolved using denaturing sodium dodecyl sulphate-polyacrylamide gel electrophoresis (8% SDS-PAGE), followed by transfer to PVDF membranes using a Bio-Rad Trans Blot TURBO (Bio-Rad Laboratories). After incubation with 5% bovine serum albumin or non-fat dried milk in 0.1% Tween - 1 mM TBS, membranes were probed overnight at 4°C with the primary antibodies and then with the corresponding peroxidase-conjugated secondary antibody for 1 hour at RT. Primary antibodies Attorney Docket No: 50051-0031WO1used were as follows: mouse anti-NfkB p65 (1:1000; #sc-8008), rabbit anti-IkB- (1:1000; sc-371 ), mouse anti-vinculin (1:20000; sc-73614) (all from Santa Cruz Biotechnology, Dallas, TX, USA), rabbit anti-NLRP3 (D4D8T) (1:1000; 15101; Cell Signaling Technology, Danvers, MA, USA) and rabbit anti NRF2 (1:1000; in house). Immunoreactive bands were revealed using the Clarity™ Western ECL Substrate (Bio-Rad Laboratories) and images were captured with the ImageQuant LAS4000 mini digital camera (GE Healthcare, Fairfield, CT, USA). Band densities were quantified using Image Quant TL software 8.1 (GE Healthcare Bio-Sciences). Statistical analysis. ABR, MRI, EB and LPS time-course RT-qPCR data were analyzed and plotted with SPSS v27 software (IBM, Armonk, NY). General histology and immunofluorescence, PCR array and RT-qPCR (except LPS time-course) data were analyzed and plotted with Graphpad Prism (GraphPad Software, San Diego, CA, USA). Data were expressed as mean ± SEM. Statistical significance was analyzed by either one-way ANOVA, Kruskal Wallis or Man-Withney test following Shapiro Wilk’s and Brown-Forsythe’s tests to determine normality and homogeneity of variances respectively (* p < 0.05; ** p< 0.01; *** p< 0.001). Results SPT-2101 treatment protects the alteration of cochlear permeability induced by LPS. The study evaluated the effects of SPT-2101 treatment on cochlear permeability and auditory function after systemic LPS injection (FIGS.5A-5E). Wistar rats received two intraperitoneal injections of LPS (denoted by ), 5 mg / kg followed by 10 mg / kg 24 hours (denoted by ) later, to reproduce the consequences of bacterial infection on cochlear inflammation and BLB leakage. To evaluate cochlear permeability, a DCE-MRI acquisition with gadolinium was obtained 3 days after the first LPS injection. SPT-2101 treatment (denoted by †) was administered by intratympanic injection 3 days before LPS challenge (FIG.5A). MRI T1-weighted signal intensity increased in cochlear tissues and fluids immediately after gadolinium injection in control animals, followed by a gradual decrease over the course of 45 minutes (FIG. 5B). The LPS-challenged animals showed a similar strong initial MRI signal increase and a much stronger signal enhancement over the scanned period. These results were Attorney Docket No: 50051-0031WO1 indicative of increased gadolinium extravasation as a consequence of altered BLB permeability (FIG. 5B). The increase of MRI signal enhancement was observed from the first hour after LPS administration and was potentiated after the second LPs dose, as shown in the DCE-MRI time- course study (FIGS.6A-6C), indicating that the alteration in the permeability of the BLB occurred soon after the endotoxin challenge. Local SPT-2101 pretreatment drastically reduced the MRI signal enhancement, indicating that pretreatment reduces gadolinium leakage and a protective effect on strial permeability (FIG. 5B). The study in control LPS-injected animals receiving only vehicle showed a DCE-MRI profile similar to that observed with LPS-injected rats. The comparison of the four experimental groups of MRI signal enhancement in a representative cycle (30) of the experimental groups showed statistically significant differences among LPS and LPS plus vehicle groups compared to controls and a reduction by SPT-2101 (FIG.5C). To confirm the alteration of cochlear permeability observed by MRI, Evan´s blue levels were quantified following intravenous dye administration (FIG.5D). The results showed a strong significant increase of X-fold in Evan´s blue levels after the second LPS injection, but not after the initial sensitization. LPS injection also induced an all-frequencies non-statistically significant X-fold increase in the ABR thresholds 72 hours after injection, compared to baseline values; in contrast, SPT-2101 treatment further normalized threshold shifts (FIG.5E). SPT-2101 treatment reduces the alterations induced by LPS in the blood-labyrinth-barrier. The study assessed if LPS had induced changes in strial morphology or in the cellular components of the BLB, especially in the pericytes, leading to impairing the functional integrity of the stria vascularis. General cytoarchitecture and morphometry was assessed in paraffin sections and showed that LPS injection caused the enlargement of the stria vascularis. Thus, the stria vascularis area showed a significant increase of X-fold (p<0.05) with respect to control rats in the middle turn (FIG. 7A). Pretreatment with SPT-2101 seemed to prevent strial enlargement (FIG.7A), to further confirm this result, the structure of the BLB was studied in whole mount strial explants that were incubated with antibodies to detect vascular capillaries (anti-GS-IB4) and pericytes (anti- desmin). The morphology of strial pericytes following LPS challenge transformed from flat Attorney Docket No: 50051-0031WO1 slender cells to a round morphology. In response to LPS, pericytes reduced the physical contact with the strial capillaries and peeled away from the capillary wall. To evaluate this effect, pericyte coverage of the strial capillaries was estimated by quantification of Desmin / GSIB4 co- localization in control, LPS and LPS plus SPT-2101 rats. LPS induced pericyte activation and increased capillaries area coverage due to branching, compared to control rats (FIG.7B and FIG. 7C), with significant differences between control and LPS groups. To further confirm if SPT-2101 prevented strial injury, the expression levels of tight- junction genes (Tjp1, Cdh5 and Marveld2) and pigment epithelium derived factor (Serpinf1) were analyzed by RT-qPCR in control, LPS, and LPS plus SPT-2101 rats 72 hours after LPS injection (FIG. 7D). LPS induced the expression of tight-junction genes, with significant differences found in Cdh25 compared to control rats X-fold; p<0.01). SPT-2101 treatment recovered control values. Serpinf1 levels were significantly reduced (X-fold; p<0.001) when SPT-2101 was administered compared to LPS-injected rats. The morphological evaluation of other cochlear structures indicated no gross alterations in the organ of Corti or spiral ganglion (FIG.8A). To confirm that LPS caused no further cochlear alterations, whole-mount preparations of the organ of Corti were used to quantify hair cells and evaluate synapsis (FIG.8B). These data confirmed that LPS alters the BLB without evident neurosensory cell loss. LPS-induced changes in the expression of inflammatory genes that were modulated by SPT-2101 treatment. Systemic injections of LPS induce inflammatory responses in the cochlea that include the activation of the innate immune system, the recruitment of monocytes, and macrophages into the inner ear, and the release of inflammatory cytokines. The study assessed the molecular mechanisms linking LPS-induced cochlear inflammation and BLB altered permeability. The study assessed the gene expression analysis of 84 innate and adaptative immune response genes in control and LPS-injected rats at the time points 4, 25, and 72 hours after the first LPS dose. LPS induced the increased expression of gene clusters with a time course pattern. The time course pattern differentiated the stages of gene expression 4, 25, and 72 hours after the first LPS challenge (FIG. 9A). In control rats with no endotoxin administration, transcripts studied showed low z-scores values with the exception of Rag1, Il2, Il4 and Il5. Four hours after the first LPS Attorney Docket No: 50051-0031WO1 injection, the increased expression of more than 50% of the genes studied was observed, including toll like receptors (Tlr2 and Tlr3) and classical proinflammatory cytokines (Il1a, Il6, Tnf and Il1r1), among others. One hour after the second LPS challenge (i.e., the 25th hour), genes Il1b, Il10, Nfkbia, and Ccl12 remained overexpressed. The genes Il18, Lyz2, Infa1, Tlr4, Tlr5, Tlr9 and Mpo were overexpressed 72 hours after LPS challenge. Candidate genes (were further studied by RT-qPCR in all the experimental groups, control, LPS and LPS plus SPT-2101.) See Table 5. Table 5. RT-qPCR gene expression levels of candidate genes selected from the RT² Profiler™ PCR Array Rat Innate & Adaptive Immune Responses (FIG.9A). Attorney Docket No: 50051-0031WO1 Table 5 shows RNA from 3 days after LPS injection of rats untreated (LPS) or treated with intratympanic SPT-2101 was subjected to RT followed by quantitative PCR. Expression levelswere calculated as 2 Ct (RQ) from at least triplicate measurements using Tbp as a referencegene and normalized to levels in control rats without LPS. The column on the right shows fold change between LPS-injected and treated with SPT-2101 versus LPS-injected rats. SEM (Standard error mean) (n= at least 3 rats per experimental condition). (FIG.9B). SPT-2101 treatment was able to normalize the expression of toll like receptors (Tlr2 and Tlr4), cytokines (Ccl2 and Il1b), and the response to LPS gene Cd14, all were induced by LPS challenge at the time point 72 hours. These data indicate that the observed SPT-2101 protection of BLB integrity occurs at the level of reducing LPS-induction of its receptors and thus decreasing cochlear inflammation. SPT-2101 reduces the presence of activated macrophages in the cochlea after LPS challenge. IBA1 levels is an index of cochlear migrating macrophages that was decreased by SPT- 2101 in the spiral ligament and spiral ganglion, thus further confirming SPT-2101 anti- inflammatory actions and protection against LPS (FIG. 10A, and FIG. 10B). Attorney Docket No: 50051-0031WO1 Example 7. Evaluate the association endolymphatic hydrops (EH) visualization and otic disease pathology. Evaluate the association of EH visualization with perilymphatic enhancement (PE) by including 3D-FLAIR MRI as an exploratory endpoint in this initial clinical study. The study included MRI imaging of the inner ear as an exploratory outcome measure. Characterization of endolymphatic hydrops and perilymphatic enhancement in this study provided objective characterization of disease pathology and offered insights that may improve future trial design and patient selection. Materials and Methods Overview. MRI was obtained at baseline in patients, 2 weeks post-treatment, and 8-12 weeks post- treatment. The following assessments were measured as exploratory outcomes: Change from baseline in endolymphatic hydrops and perilymphatic enhancement as assessed by delayed intravenous gadolinium contrast enhanced 3T MRI scanning at 2 weeks post-treatment and 8-12 weeks post treatment. Amount and extent of distribution of investigational formulation in middle ear at 2 weeks post-treatment and at 8-12 weeks post treatment. See. FIG.11. Procedure for MRI: • Place a fiducial marker (e.g. Vitamin-E capsule) on one side of the head as a reference for signal intensity. • Perform MRI imaging using a 3-tesla Siemens scanner. • Patient receives IV injection gadobutrol (Gadovist) at a dose of 0.2mmol / kg or 0.2ml / kg. • Patient then returns 4-6 hours later for imaging. MRI imaging parameters • All imaging was performed 4-6 hours post IV injection of Gadovist. • Localizer scans, including coronal & sagittal HASTE imaging to allow positioning of the main sequences. • Two High T2-weighted 3D FLAIR sequences in the axial plane to cover the Inner ear structures. These are identical, other than the Inversion Time (TI). The horizontal Attorney Docket No: 50051-0031WO1 semicircular canals were used as a guide for alignment. A 3D T2 SPACE sequence to show anatomy of the inner ear structures. Same imaging plane as the FLAIR sequences. (Imaging parameters in table below) • Once the scans were completed, the 2050 TI FLAIR images were subtracted from the 2350 TI FLAIR images, with a 4000 scaling factor. The resultant images were used for the assessment of EH and perilymphatic signal enhancement. • Signal intensity in the tympanic cavity was assessed using the 3D T2 SPACE images. Table 6. MRI parameters. Results MRI scans were used to assess the presence or absence of EH (in the cochlea, utricle, or saccule) and to quantitate the degree of perilymphatic enhancement. Seven of the nine subjects (01-05, 01-07, 01-08, 01-09, 01-12, 01-13, 01-14) were assessed as having EH in the affected ear at baseline by a masked neuroradiologist. See Table 7. Four of the nine subjects (01-05, 01-07, 01-12, 01-13) had measurable perilymphatic enhancement at baseline, defined as a study ear: fellow ear ratio of signal intensity of greater than 1.4. The subject with the highest perilymphatic enhancement (01-07) had a measurable reduction from baseline at week 2 and week 12. See Table 8. Attorney Docket No: 50051-0031WO1 Table 7. Evaluation of EH of subjects at baseline, week 2 and week 12. Table 8. Evaluation of cochlear Perilymphatic Enhancement of subjects at baseline, week 2 and week 12. Attorney Docket No: 50051-0031WO1 Evaluate gel durability and placement accuracy. The durability and placement of gel treatment was assessed at baseline and at a two week time period. The injection volume was precisely controlled, achieving precise placement at a target location, which was confirmed by endoscopic view. The residence at the target location was confirmed on T2-weighted MRI images two weeks after placement. Example 8. Technical Evaluation of Formulation F07 with 2 wt% Lysozyme Formulation Description: The technical evaluation of the F07 formulation with 2 wt% lysozyme (LysZ) was conducted to assess its compatibility and performance within a PEG-KKK system. The Attorney Docket No: 50051-0031WO1 investigation involved comparing gelation characteristics, injectability, and other key parameters relevant to the formulation's potential as a sustained release system for proteins. Table 9: Explanation of formulation codes and their comprising components. Chemical compositions between formulations are equivalent and only vary by their format presentation. Materials and Methods: Lysozyme from chicken egg white (CAS: 12650-88-3) was sourced from Sigma. Components for the F07 product format, including 4ARM-SG 20K PEG and Trilysine buffer, were prepared in a 3-vial presentation. A control buffer solution with lysozyme instead of trilysine was also prepared to assess cross-reactivity. Gels were formed by mixing the PEG and trilysine components to create an Activated Injectable, which was then combined with lysozyme to yield a 2 wt% concentration. The control, containing only PEG and lysozyme, was prepared using the same technique. Gelation times at ambient temperature and 37°C were monitored from the time of mixing. Injectability was confirmed by passage through a 27G needle. Gel test articles were weighed and incubated at 37°C overnight. Swelling tests involved submerging samples in 50 mL PBS at 37°C and recording weights at intervals to calculate swelling ratios over time. Visual observations and gel duration, defined as the last measurable gel mass in the swelling test, were recorded. Results: Injectability: The formulation demonstrated successful injectability, confirmed by passage through a 27G needle. Attorney Docket No: 50051-0031WO1 Gelation Time: Average gelation time at 37°C was 3 minutes, while at ambient temperature it was 12.4 minutes. Gel Swelling Ratio: The swelling ratio was measured at 2.1. Gel Duration: The gel duration was recorded at 21 days. See Table 10: Table 10: Advantages: This study showed that a model protein, egg white lysozyme (LysZ) is compatible with the F07 PEG-KKK system, showing gelation performance similar to drug-less and DEX gels. The formulation allows for the sustained release of proteins, which is because of their solubility and large molecular weight. Soluble proteins are easily flushed out from the middle ear, and their large molecular weight results in slow transport across the round window membrane (RWM). A sustained residence time is crucial for achieving adequate levels in the inner ear. Performance Comparison with Drug-Less Gel This study will perform a comprehensive head-to-head performance comparison between the drug-containing gel and a drug-less gel. The investigation focuses on understanding the lack of cross-reactivity by testing the effects of pH in the diluent, stoichiometry, and intentional bioconjugation protocols. Optimization of Formulation The study will vary drug content and protein identification to optimize the formulation. The evaluation will aim to support the potential use of the F07 formulation with various therapeutic proteins for sustained protein release applications, particularly in scenarios where prolonged residence time is evaluated. Attorney Docket No: 50051-0031WO1 Testing Testing will include the application of BDNF to further validate the formulation. This comprehensive evaluation aim to enhance the efficacy and reliability of the F07 formulation for sustained protein release. Example 9: Protein Release from SPT Gels. Materials and Methods: 4ARM-SG 20K PEG and Trilysine buffer will be prepared as components for an F07 product format (3-vial presentation). Neurotrophins (NT) (e.g., BDNF, NGF, and / or NT3) are provided as a protein concentrate vial and incorporated with the gel component immediately prior to use. NT-loaded F07 gels will be set up in a transwell release setup (50 L). Triplicate transwell inserts are placed in a 24-well plate, and PBS solution is added to each chamber below the transwell membrane. The PBS solution in the lower chamber is collected as elution samples on pre-selected timepoints after submersion, and replenished with fresh buffer. The amount of NT in the elution samples was determined via ELISA. To test the bioactivity of the released protein, NT-loaded F07 gels will be set up using the same method described above. Elution samples will be collected on days 1, 3, 7, and 14. Elution samples are assessed by commercially available in vitro potency assays (e.g., for TrkB or TrkC) Subsequent testing will evaluate the efficacy of protein released from gel formulations in explant and in vivo models. Results The results will show if the F07 formulations release NT gradually over a period of time with a more even release profile compared to neat NT or previously attempted formulations. Released NT will be evaluated to determine if its bioactivity is maintained comparable to the control. The benefits of SPT gels in providing a sustained and controlled release of therapeutic proteins will enhance the effectiveness and stability of protein-based treatments. Attorney Docket No: 50051-0031WO1 Advantages: Proteins released from gels will demonstrate a more controlled release profile, mitigating burst release and ensuring sustained release over an extended period. This controlled release can protect the protein, enhancing its stability and bioactivity. The compatibility of the gel with therapeutic proteins will be evaluated to confirm that the released proteins maintain their bioactivity. Example 10: Netarsudil Formulation Results Materials and Methods: Netarsudil HCl was commercially sourced. 4ARM-SG 20K PEG and Netarsudil / Trilysine solution were prepared as components for an F06 product format (2-vial presentation). See Table 11. Netarsudil was added into the trilysine buffer before gel preparation. Gels were prepared by mixing the PEG and trilysine components to form an Activated Injectable. Gelation at 37°C was monitored and recorded from the time of mixing. Injectability was measured by confirmation of passage through a 27G needle. Gel test articles were prepared from the Activated Injectable, weighed, and incubated at 37°C overnight. Samples were fully submerged in 50 mL PBS and placed at 37°C. Samples were weighed at time intervals in the swelling test setup to allow calculation of a swelling ratio as a function of time. Visual observations of the gels were recorded. The gel duration was recorded as the last time point where there was measurable gel mass remaining in the swelling test. FIG.15A shows a gel made with 6% netarsudil after it has been submersed in PBS at 37°C for 7 days still containing drug and acting as a depot. FIG.15B shows netarsudil levels released from drug-containing gels after 1 and 7 days incubation in PBS at 37°C Table 11 shows netarsudil gelation performance. Attorney Docket No: 50051-0031WO1 Compatibility with Gel Chemistry: The pilot gel prepared with 0.1-2% netarsudil demonstrated gelation time, swelling, and duration as expected, similar to the dexamethasone formulation (SPT-2101). The 6% netarsudil pilot gel had slightly altered gel performance but still produced a long acting gel capable of releasing netarsudil greater than 7 days. Netarsudil, a ROCK inhibitor, has been shown to interact with the WNT signaling pathway for various cellular processes such as cell proliferation, differentiation, and migration. ROCK inhibitors like Netarsudil inhibit the activity of Rho kinase. This inhibition can impact the WNT pathway. For example, such inhibition can impact the WNT pathway by altering the stability and localization of -catenin, a component of the WNT signaling cascade. By affecting -catenin, ROCK inhibitors can influence gene expression and cellular behaviors that are regulated by the WNT pathway. This connection highlights the potential of ROCK inhibitors in therapeutic applications where modulation of the WNT pathway is beneficial. Further, ROCK inhibitors such as Netarsudil, have been linked to the Notch signaling pathway in cell differentiation, proliferation, and apoptosis. ROCK inhibitors, such as Netarsudil, can modulate cellular functions by affecting the cytoskeleton and influencing various signaling pathways, including Notch. The interaction with the Notch pathway occurs through the inhibition of ROCK activity, which can alter the expression and activity of Notch receptors and ligands. This modulation can impact processes like cell determination and tissue homeostasis. Studies have shown that ROCK inhibitors can influence the proteolytic cleavage of Notch receptors, thereby affecting the release and nuclear translocation of the Notch intracellular domain (NICD), which is important for Notch signaling activation. This connection highlights the therapeutic potential of ROCK inhibitors in diseases where Notch signaling is dysregulated. Attorney Docket No: 50051-0031WO1 Netarsudil has been shown to be compatible with the Spiral gel system, exhibiting performance similar to SPT-2101. Although netarsudil has some clinical experience, it represents a new chemical entity (NCE) for a novel pathway in the ear, specifically for neuroregeneration. This initial formulation study demonstrates the feasibility of using netarsudil in a sustained delivery system for therapeutic applications in hearing loss treatment. Example 11: Drug and gel duration for different formulations containing the SPT-5108 compound. Materials and Methods 6-Phenyl-2-thiouracil (6P2T) sourced from TCI. 4ARM-SG 20K PEG / 6P2T powder and Trilysine buffer. The components were prepared for an F05 product format (2-vial presentation) 4ARM-SG 20K PEG / 6P2T powder and Trilysine buffer were prepared as components for an F05 product format (2-vial presentation).. See table 12. Gels were prepared by mixing the powder and Trilysine components to form an Activated Injectable. Gelation monitored at ambient temperature and 37°C. Injectability confirmed through a 27G needle. Gel test articles incubated at 37°C and submerged in 50 mL PBS for swelling tests. Swelling ratio calculated by weighing samples at set intervals. Table 12 summarizes the results of drug and gel duration for different formulations containing the SPT-5108 compound. Attorney Docket No: 50051-0031WO1 The duration of drug release varies with different concentrations of SPT-5108, showing a concentration-dependent release profile. The 6% SPT-5108 formulation showed the shortest duration (4 days), while the 18% SPT-5108 formulation extended up to 10 days. Regardless of the formulation, the gel duration consistently lasted 21 days. This suggests that the gel matrix remains intact for a prolonged period, supporting extended drug release. FIG.16 shows that on Day 1, the gel appears as a compact structure. On day 7, the gel has significantly swollen, indicating its capacity to absorb surrounding fluids and maintain integrity over time. These visual observations are consistent with the data showing a 21-day gel duration. SPT-5108 Compatibility: The data shows that formulations with SPT-5108 provide a concentration-dependent drug duration, extending the release period up to 10 days with higher concentrations. Favorable Gel Performance: The gels demonstrated consistent performance across different formulations, maintaining structural integrity and exhibiting predictable swelling behavior. Gelation times, swelling, and pH values aligned with expected cumulative gel data. This study demonstrates that the SPT-5108 compound can be formulated in a Spiral gel to last more than 7 days, meeting the therapeutic requirement for chemotherapy cycles. Previously, this duration was unachievable, highlighting the formulation's innovation and potential for enhanced therapeutic application. Example 12: Secondary Release Elements and altered duration Gel Chemistries The focus of this study will be the exploration of secondary release mechanisms and alternative gel chemistries to extend the drug release duration beyond 10 days or to reduce gel duration to below 21 days. Adjustments to total solids and gel stoichiometry are implemented to align the gel duration with the drug delivery duration, facilitating repeated injections. This approach aims to enhance the effectiveness and practicality of the drug delivery system, providing extended release and improved patient outcomes. The advancements in secondary release elements and gel chemistries present significant potential for future applications in drug delivery systems. Attorney Docket No: 50051-0031WO1 Example 13: Pilot Pharmacokinetic (PK) Study Demonstrating Promising SPT-5108 Gel Performance. In this study, a 12% 6P2T gel formulation was administered to six guinea pigs via a single, unilateral trans-tympanic injection. The observation period lasted for one day, during which the guinea pigs' body weight and overall health were monitored. The results showed effective in vivo performance with no overt adverse safety reactions, as visually confirmed in FIG.17. Bioanalytical quantification was conducted on samples of plasma, perilymph, and cochlear epithelium. Key findings included elevated levels of 6P2T (~2x) in the perilymph and cochlear epithelium compared to Otonomy rat study reports, and significantly lower plasma levels (>6x), indicating reduced systemic absorption. The significance and advantages of this formulation are clear. The higher drug concentrations in target tissues, coupled with reduced systemic presence, are beneficial. Lower systemic levels are particularly advantageous as high systemic levels could chelate and counteract systemic cisplatin chemotherapy. Materials and Methods: The chemical 6-phenyl-2-thiouracil (6P2T) was sourced from TCI. The formulation components included 4ARM-SG 20K PEG / 6P2T powder and Trilysine buffer, prepared in a two-vial format. The gel was prepared by mixing the powder and trilysine components to form an Activated Injectable gel. The study protocol was approved by the Turner Scientific Institutional Animal Care and Use Committee. On Day 0, the guinea pigs received a 50 μL dose of the 12% SPT-108 gel. On Day 1, samples from the cochlear epithelium (FIG. 18A and 18B denoted by ), plasma (FIG.18A and 18B denoted by †), perilymph (FIG.18A and 18B denoted by ), and residual gel were collected and analyzed using liquid chromatography-mass spectrometry (LCMS) at Charles Rivers Laboratories. Observations included the middle ear condition at the time of sacrifice. FIG.17 shows the gel appearance 1-day post-administration. FIG. 18A presents 6P2T concentration levels in various tissues after 1 day in guinea pigs compared to the studies performed in rats. FIG.18B compares 6P2T levels with prior studies performed in rats, highlighting significant tissue concentration advantages. Attorney Docket No: 50051-0031WO1 This pilot PK study demonstrates that the 12% 6P2T gel formulation has promising in vivo performance, with higher drug levels in target tissues and lower systemic absorption. This is beneficial for avoiding chelation and maintaining chemotherapy efficacy. Example 14: Gel formulations with tuned mid-range duration. Materials and Methods: The formulation components included 4ARM-SG 20K PEG and Trilysine buffer, prepared in a two-vial format. The gels were prepared by mixing the powder and trilysine components to form an Activated Injectable. Formulation adjustments were made by altering the amounts of buffer included in the Trilysine component. Gelation was monitored at ambient temperature and 37 °C. Injectability was confirmed through a 27G needle. Gel test articles were incubated at 37 °C and 50 °C while submerged in 50 mL PBS for swelling and duration tests. The swelling ratio was calculated by weighing samples at set intervals. Results: The focus of this study was to reduce gel duration to below 21 days in order to enable repeat administration of mid-term formulations in the middle ear. Adjustments to total solids and gel stoichiometry were implemented to align the gel duration with the drug delivery duration (7-10 days), while maintaining suitable gelation performance, facilitating repeated injections (see Table 13 below). Table 13. Both approaches (stoichiometry adjustment with less trilysine, dilution of both excipients) Attorney Docket No: 50051-0031WO1 produced gels with shorter duration. This approach aims to enhance the effectiveness and practicality of the drug delivery system, especially with otoprotectant chelating molecules (e.g., thiouracil), providing appropriately timed depot residence and improved patient outcomes. Example 15: Rheological measurement of SPT-2101 gels during the gelation process Materials and Methods: The F05 formulation components included 4ARM-SG 20K PEG with Dexamethasone and Trilysine buffer, prepared in a two-vial format. The gels were prepared by mixing the powder and trilysine components to form an Activated Injectable. Rotational parallel plate (50 mm) constant shear (1 s-1) measurements were performed on an Anton Paar MCR 302 instrument.2 mL of sample was added to sample geometry (20 °C and 37 °C) at t = 180s. Upper measurement geometry (50 mm parallel plate) was lowered to 0.950 mm. Rotational measurement was started at t = 600s and tracked over the duration of the gelation reaction. Results: Resultant measurements (FIG. 19) shows viscosity values before gelation ~290 mPa.s and after gelation: at 37°C: >1900 Pa.s and at 20 °C: >1100 Pa.s. Gel times at 37 °C: 2 min, and at 20 °C: 17 min, are also able to calculated from the viscosity profiles, which importantly match other analytical testing.

Claims

Attorney Docket No: 50051-0031WO1 What is claimed is:

1. A polymer composition comprising: about 3% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer comprises a first functional group; about 0.03% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker comprises a second functional group; an active agent, wherein the active agent comprises a neuroprotective agent or a chemoprotective agent; and water, wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 45 seconds to about 30 minutes at a temperature of about 20 °C.

2. A polymer composition comprising: about 3% to about 15% by weight of the polymer composition of a functional polymer, wherein the functional polymer comprises a first functional group; about 0.03% to about 0.6% by weight of the polymer composition of a crosslinker, wherein the crosslinker comprises a second functional group; an active agent, wherein the active agent comprises a neuroprotective agent or a chemoprotective agent; and water, wherein a crosslinking reaction can occur between the first functional group and the second functional group to form a gel, and wherein the polymer composition has a gelation time of about 45 seconds to about 30 minutes at a temperature of about 37 °C.

3. The polymer composition of any one of claims 1-2, wherein the active agent is a neuroprotective agent selected from BDNF, NT3, NGF, a neurotrophin, an agonist of TrkB, and / or an agonist of TrkC.Attorney Docket No: 50051-0031WO1 4. The polymer composition of any one of claims 1-2, wherein the active agent is a neuroprotective agent comprising a ROCK inhibitor selected from netarsudil, Y-27632, ripasudil, fasudil, and netarsudil-M1.

5. The polymer composition of any one of claims 1-2, wherein the active agent is a neuroprotective agent comprising netarsudil.

6. The polymer composition of any one of claims 1-2, wherein the active agent is a neuroprotective agent comprisingY-27632.

7. The polymer composition of any one of claims 1-2, wherein the active agent comprises a chemoprotective agent.

8. The polymer composition of claim 7, wherein the chemoprotective agent is 6-Phenyl-2- thiouracil.

9. The polymer composition of any one of claims 1-9, wherein the active agent is present in an amount of about 0.5% to about 15% by weight of the polymer composition.

10. The polymer composition of any one of claims 1-9, wherein the gel, when formed in the middle ear, has a residence time of at least 5 days.

11. The polymer composition of any one of claims 1-10, wherein the gel has a gel duration of at least 5 days at 37 °C.

12. The polymer composition of any one of claims 1-11, wherein the polymer composition has a pH of about 5.5 to about 8.

5.

13. The polymer composition of any one of claims 1-12, wherein the gel, following equilibration in phosphate-buffered saline (PBS) for 1 day, swells less than 100%.Attorney Docket No: 50051-0031WO1 14. The polymer composition of any one of claims 1-13, wherein the gel is elastic.

15. The polymer composition of any one of claims 1-14, wherein the gel is mucoadhesive.

16. The polymer composition of any one of claims 1-15, wherein the polymer composition has a viscosity of about 1 mPa·s to about 1000 mPa·s.

17. The polymer composition of any one of claims 1-16, wherein the polymer composition comprises about 6% to about 12% by weight of the polymer composition of the functional polymer.

18. The polymer composition of any one of claims 1-17, wherein the polymer composition comprises about 0.1% to about 0.3% by weight of the polymer composition of the crosslinker.

19. The polymer composition of any one of claims 1-18, wherein the polymer composition has a gelation time of about 8 minutes to about 12 minutes at a temperature of about 20 °C.

20. The polymer composition of any one of claims 1-19, wherein the gel has an osmolality of about 300 mOsmol / kg to about 600 mOsmol / kg.

21. The polymer composition of any one of claims 1-20, wherein the gel has a pH of about 6.0 to about 6.

5.

22. The polymer composition of any one of claims 1-21, wherein a ratio of the first functional group to the second functional group is about 0.8:1.2 to about 1.2:0.

8.

23. The polymer composition of any one of claims 1-22, wherein a ratio of the first functional group to the second functional group is about 1:

1.

24. The polymer composition of any one of claims 1-23, wherein the first functional group comprises a succinimidyl ester.Attorney Docket No: 50051-0031WO1 25. The polymer composition of any one of claims 1-24, wherein the functional group is selected from the group consisting of a succinimidyl succinate, a succinimidyl glutarate, a succinimidyl adipate, a succinimidyl glutaramide, a succinimidyl carbonate, a succinimidyl carboxymethyl ester, or a combination thereof.

26. The polymer composition of any one of claims 1-25, wherein the second functional group comprises a primary amine.

27. The polymer composition of any one of claims 1-26, wherein the functional polymer is pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate.

28. The polymer composition of any one of claims 1-27, wherein the crosslinker comprises polylysine, or a salt thereof.

29. The polymer composition of any one of claims 1-28, wherein the crosslinker comprises trilysine, or a salt thereof.

30. An extended release otic composition comprising: about 5% to about 15% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.05% to about 0.6% by weight of trilysine or a salt thereof; about 0.01% to about 40% by weight of a chemoprotective agent; and water.

31. An extended release otic composition comprising: about 8.3% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.2% by weight of trilysine or a salt thereof; about 12% by weight of a chemoprotective agent; and water.Attorney Docket No: 50051-0031WO1 32. The extended release otic composition of any one of claims 30-31, wherein the chemoprotective agent is 6-Phenyl-2-thiouracil.

33. An extended release otic composition comprising: about 5% to about 15% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.05% to about 0.6% by weight of trilysine or a salt thereof; about 0.01% to about 40% by weight of a neuroprotective agent; and water.

34. An extended release otic composition comprising: about 8.3% of pentaerythritol poly(ethylene glycol) ether tetrasuccinimidyl glutarate; about 0.2% by weight of trilysine or a salt thereof; about 12% by weight of a neuroprotective agent; and water.

35. The extended release otic composition of any one of claims 33-34, wherein the neuroprotective agent comprises BDNF, NT3, NGF, a neurotrophin, an agonist of TrkB, and / or an agonist of TrkC.

36. The extended release otic composition of any one of claims 33-34, wherein the neuroprotective agent is a ROCK inhibitor comprising one of netarsudil, Y-27632, ripasudil, fasudil, and netarsudil-M1.

37. The extended release otic composition of any one of claims 33-34, wherein the neuroprotective agent is netarsudil.

38. The extended release otic composition of any one of claims 33-34, wherein the neuroprotective agent is Y-27632.Attorney Docket No: 50051-0031WO1 39. The extended release otic composition of any one of claims 30-38, further comprising: about 0.01% to about 3.0% by weight of sodium borate decahydrate; about 0.01% to about 3.0% by weight of sodium phosphate; about 0.01% to about 3.0% by weight of phosphoric acid; about 0% to about 0.5% of FD&C Blue #1; and about 0% to about 0.01% by weight of butylated hydroxytoluene.

40. The extended release otic composition of any one of claims 30-38, further comprising: about 1.2% by weight of sodium borate decahydrate; about 1.1% to about 3.0% by weight of sodium phosphate; about 0.9% to about 3.0% by weight of phosphoric acid; about 0.01% of FD&C Blue #1; and about 0.002% by weight of butylated hydroxytoluene.

41. The extended release otic composition of any one of claims 30-38, further comprising: about 0.01% to about 6.0% by weight of sodium phosphate; about 0% to about 0.5% of FD&C Blue #1; and about 0% to about 0.01% by weight of butylated hydroxytoluene.

42. The extended release otic composition of any one of claims 30-38, further comprising: about 0.05% to about 6.0% by weight of sodium phosphate; about 0.01% of FD&C Blue #1; and about 0.002% by weight of butylated hydroxytoluene.

43. A gel formed by the polymer composition of any one of claims 1-29 or the extended release otic composition of any one of claims 30-42.

44. Manufacture of a medicament comprising the extended release otic composition of any one of claims 30-42 for the treatment of an otic disease or disorder.

45. A method of treating an otic disease or disorder in a subject, the method comprising:Attorney Docket No: 50051-0031WO1 identifying a subject as having an otic disease or disorder; and administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an affected ear of the subject.

46. A method of treating an otic disease or disorder in a subject in need thereof, the method comprising administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an ear of the subject.

47. The method of any one of claims 44-46, wherein the otic disease or disorder is selected from the group consisting of Ménière’s Disease (MD), Autoimmune Inner Ear Disease (AIED), sudden sensorineural hearing loss (SSNHL), noise-induced hearing loss (NIHL), age-related hearing loss, sensorineural hearing loss associated with diabetes, tinnitus, an autoimmune disorder, an infection, excess fluid or pressure, hearing loss due to chemotherapy, and combinations thereof.

48. A method of treating noise-induced hearing loss (NIHL), the method comprising: administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an ear of a subject in need thereof.

49. A method of treating age-related hearing loss in a subject, the method comprising: administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an ear of a subject in need thereof.

50. A method of treating chemotherapy related hearing loss in a subject, the method comprising: administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an ear of a subject in need thereof.

51. A method of treating noise-induced hearing loss (NIHL) in a subject, the method comprising: (i) identifying a subject as having NIHL; andAttorney Docket No: 50051-0031WO1 (ii) administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an affected ear of the subject.

52. A method of treating age-related hearing loss in a subject, the method comprising: (i) identifying a subject as having age-related hearing loss; and (ii) administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an affected ear of the subject.

53. A method of treating chemotherapy related hearing loss in a subject, the method comprising: (i) identifying a subject as having chemotherapy related hearing loss; and (ii) administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an affected ear of the subject.

54. The method of any one of claims 45-53, wherein the administering comprises administering about 40 μL to about 60 μL of the extended release otic composition.

55. The method of any one of claims 45-54, wherein the administering comprises administering such that the extended release otic composition is in contact with the round window membrane.

56. The method of any one of claims 45-55, wherein the administering comprises administering such that the extended release otic composition fills the round window niche.

57. A method of treating an otic disorder in a subject, the method comprising: (i) identifying a presence or an absence of the subject having endolymphatic hydrops (EH); and (ii) administering a therapeutically effective amount of the extended release otic composition of any one of claims 30-42 to an affected ear of the subject.Attorney Docket No: 50051-0031WO1 58. The method of claim 57, wherein administering a therapeutically effective amount is based at least in part on the presence or absence of EH and / or Perilymphatic Enhancement.

59. The method of claim 57 or claim 58, wherein the presence of EH is determined in the subject.

60. The method of claim 57 or claim 58, wherein the absence is EH is determined in the subject.

61. The method of any one of claims 57-60, wherein the otic disorder is noise-induced hearing loss (NIHL), age-related hearing loss, or chemotherapy-related hearing loss.

62. The method of any one of claims 57-61, wherein identifying the presence of absence of EH is determined via MRI.

63. The method of any one of claims 45-62, wherein administering the therapeutically effective amount of the extended release otic composition modulates one or more genes.

64. The method of claim 63, wherein the one or more genes are Nrlp3, Tlr1, Tlr2, Tlr4, Tlr7, Tlr9, Ccl3, Ccl5, Ccl12, Cxcl10, Il1a, Il1b, Il6, Il18, Cd14, Lbp, FoxP3, Il10, Ccr6, C3, Cd8a, iNos, Itgam, Rag1, Tjp1, Cdh5, Marveld2, and Serpinf1.

65. The method of claim 64, wherein the one or more genes are -catenin, TCF, LEF, Rho, Rac, JNK, PKC, CaMKII, NFAT, NICD, CSL, MAML, HES, and HEY.

Citation Information

Patent Citations

  • Enhanced Ocular Neuroprotection and Neurostimulation

    US20070078077A1

  • Gelling solutions for administration of compounds to the inner ear

    US20230183475A1

  • Enzyme inhibitors, their synthesis and methods for use

    US5476855A