Multifunctionalized nanoparticles for the delivery of oligonucleotides and uses thereof

Abstract

The invention provides a nanoparticle comprising a poly(beta-aminoester) polymer of formula (V), (V) or a pharmaceutically acceptable salt thereof with one or more NO donor moieties and one or more cell-targeting moieties, and an oligonucleotide. The invention also provides pharmaceutical compositions comprising the nanoparticles, and uses thereof, in particular for use in liver diseases.

Description

[0001] Multifunctionalized nanoparticles for the delivery of oligonucleotides and uses thereof

[0002] This application claims the benefit of European Patent Application 24382665.8 filed June 19th, 2024.

[0003] Technical Field

[0004] The invention relates to nanoparticles comprising poly(beta-aminoester) polymer for the delivery of oligonucleotides. The invention also relates to compositions comprising said nanoparticles, methods for their production, and the nanoparticles and compositions for use in therapy.

[0005] Background Art

[0006] The liver is a vital organ responsible for numerous metabolic processes, including detoxification, nutrient storage, and bile production. Liver diseases represent a significant global health burden, with a wide range of causes including viral infections (hepatitis B and C), alcohol abuse, and metabolic disorders.

[0007] Metabolic dysfunction associated steatotic liver disease (MASLD) (Chan, W. K., et al., (2023)) is a particularly concerning condition, characterized by excessive fat accumulation in the liver. MASLD is closely associated with obesity, diabetes, and metabolic syndrome. Its prevalence is rising, mirroring the global increase in these related conditions.

[0008] While early stages of MASLD may be asymptomatic, the disease can progress to metabolic dysfunction associated steatohepatitis (MASH), marked by inflammation, liver cell damage, and fibrosis (scarring). MASH can ultimately lead to cirrhosis, liver failure, and hepatocellular carcinoma (liver cancer).

[0009] Currently, lifestyle interventions focusing on weight loss and healthy diet are the primary recommendations but can be difficult to maintain. The lack of effective pharmacological treatments highlights an urgent need for novel therapies to address this growing health crisis.

[0010] Summary of Invention

[0011] The inventors have surprisingly obtained a nanoparticle that combines different therapeutic approaches for the effective treatment of multifactorial diseases. The present invention provides nanoparticles comprising pBAEs with nitric oxide release and cell-targeted binding for the delivery of oligonucleotides, useful in a variety of medical applications, in particular for the treatment of liver diseases.

[0012] The invention herein provides nanoparticles which are characterized by comprising a pBAE polymer, a NO donor moiety, a cell-targeting moiety, and an oligonucleotide, which provide a striking improvement in the efficacy of the treatment of certain diseases and conditions.

[0013] In fact, the inventors have succeeded in combining the different elements (i.e. cell-targeting moiety, NO donor moiety, and an oligonucleotide) in the same nanoparticle.

[0014] The invention shows particularly surprising promising results for the treatment of liver diseases when carrying a siRNA for the downregulation of the PTTG1 gene. The PTTG1 gene, also known as the Pituitary Tumor- Transforming Gene 1, is a gene that produces a protein called securin. Securin is a protein involved in control of the metaphase-anaphase transition and anaphase onset. Following bi-orientation of chromosome pairs and inactivation of the spindle checkpoint system, the underlying regulatory system, which includes securin, produces an abrupt stimulus that induces highly synchronous chromosome separation in anaphase.

[0015] Thus, in a first aspect the present invention provides a nanoparticle comprising

[0016] A) a poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof wherein l_3 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; or, alternatively at least one of L3 is and T2 is selected from H, alkyl, and wherein LT is independently selected from the group consisting of:

[0017] 0, S, NRX, and a bond, wherein Rxis independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl, and the remaining L3 groups are independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene;

[0018] L4 is independently selected from the group consisting of formula (i) and (ii)

[0019] L5 and Le are independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; each R3 is independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, heteroaryl, polyalkylene glycols, a moiety having a hydroxyl group (-OH), a moiety having an amine group (-NH2), a moiety having a zwitterionic polymer, a nitric oxide donor moiety, and a cell-targeting moiety, wherein:

[0020] - said polyalkylene glycol is either bound directly to the nitrogen atom to which R3 is attached or bound to the nitrogen atom to which R3 is attached via a linker moiety, wherein said linker moiety is an alkylene, cycloalkylene, alkenylene, cycloalkenylene, heteroalkylene, heterocycloalkylene, arylene or heteroarylene group;

[0021] - the moiety having a hydroxyl group (-OH) is selected from the group consisting of -(CH2)POH, and - (CH2)2(OCH2CH2)qOH;

[0022] - the moiety having an amino group (-NH2) is selected from the group consisting of -(CH2)PNH2, and - (CH2)2(OCH2CH2)qNH2;

[0023] - the NO donor moiety is selected from the group consisting of an organic nitrate of formula -O(CO)- (CH2)f-ONO2, wherein f is selected from 1 to 9; and an S-nitrosothiol of formula -0(C0)-(CH2)g-SN0, wherein g is selected from 1 to 15; and

[0024] - the moiety having a zwitterionic polymer is one of formula (II)

[0025] (R4)r-PZ-R9— (II) wherein R4 represents R4 -C(=S)-S-; R4' represents an aryl, heteroaryl, alkyl, -SR5, -NReRz or -ORs; R5 represents aryl, heteroaryl or alkyl; Re and Rz are the same or different and represent hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; Rs represents hydrogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; R9 is a linker moiety which binds the PZ to the -N- of the substituent of formula (i) or (ii), wherein the linker moiety is selected from the group of alkylene, cycloalkylene, alkenylene, cycloalkenylene, heteroalkylene, heterocycloalkylene, arylene and heteroarylene group; and PZ represents a zwitterionic polymer comprising one or more zwitterionic monomers; n is an integer from 5 to 1000, p is an integer from 1 to 20, q is an integer from 1 to 10, and r is an integer from 0 to 1 ; each Li and L2 is independently selected from the group consisting of:

[0026] 0, S, NRX, and a bond; wherein Rxis independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and R3 and L5 being as defined above; and R1, R2 and Ry are independently selected from a positively charged oligopeptide at pH 7 and Ry, Rybeing selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and provided that at least one of R1, R2 and RT is a net positively charged oligopeptide at pH 7; provided that the nanoparticle comprises at least one poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety, and at least one poly (betaaminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a cell-targeting moiety; or, alternatively, the nanoparticle comprises at least one pol (beta-ami noester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety and a cell-targeting moiety; and

[0027] B) an oligonucleotide.

[0028] Alternatively, the first aspect refers to a nanoparticle comprising

[0029] A) a poly(beta-aminoester) polymer of formula (I) or a pharmaceutically acceptable salt thereof wherein

[0030] L3 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; or, alternatively at least one of L3 is wherein T1 is and T2 is selected from H, alkyl, and wherein LT is independently selected from the group consisting of:

[0031] 0, S, NRX, and a bond, wherein Rxis independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl, and the remaining L3 groups are independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene;

[0032] L4 is independently selected from the group consisting of formula (i) and (ii)

[0033] L5 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; each R3 is independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, heteroaryl, polyalkylene glycols, a moiety having a hydroxyl group (-OH), a moiety having an amine group (-NH2), a moiety having a zwitterionic polymer, a nitric oxide donor moiety, and a cell-targeting moiety, wherein:

[0034] - said polyalkylene glycol is either bound directly to the nitrogen atom to which R3 is attached or bound to the nitrogen atom to which R3 is attached via a linker moiety, wherein said linker moiety is an alkylene, cycloalkylene, alkenylene, cycloalkenylene, heteroalkylene, heterocycloalkylene, arylene or heteroarylene group;

[0035] - the moiety having a hydroxyl group (-OH) is selected from the group consisting of -(CH2)POH, and - (CH2)2(OCH2CH2)qOH;

[0036] - the moiety having an amino group (-NH2) is selected from the group consisting of -(CH2)PNH2, and - (CH2)2(OCH2CH2)qNH2;

[0037] - the NO donor moiety is selected from the group consisting of an organic nitrate of formula -O(CO)- (CH2)f-ONO2, wherein f is selected from 1 to 9; and an S-nitrosothiol of formula -O(CO)-(CH2)g-SNO, wherein g is selected from 1 to 15; and

[0038] - the moiety having a zwitterionic polymer is one of formula (II)

[0039] (R4)r-PZ-R9— (II) wherein R4 represents R4 -C(=S)-S-; R4' represents an aryl, heteroaryl, alkyl, -SR5, -NReRz or -ORs; R5 represents aryl, heteroaryl or alkyl; Re and Rz are the same or different and represent hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; Rs represents hydrogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; R9 is a linker moiety which binds the PZ to the -N- of the substituent of formula (i) or (ii), wherein the linker moiety is selected from the group of alkylene, cycloalkylene, alkenylene, cycloalkenylene, heteroalkylene, heterocycloalkylene, arylene and heteroarylene group; and PZ represents a zwitterionic polymer comprising one or more zwitterionic monomers; n is an integer from 5 to 1000, p is an integer from 1 to 20, q is an integer from 1 to 10, and r is an integer from 0 to 1 ; each Li and l_2 is independently selected from the group consisting of:

[0040] 0, S, NRX, and a bond; wherein Rxis independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and R3 and L5 being as defined above; and

[0041] R1, R2 and Ry are independently selected from a positively charged oligopeptide at pH 7 and Ry, Rybeing selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and provided that at least one of R1, R2 and RT is a net positively charged oligopeptide at pH 7; provided that the nanoparticle comprises at least one poly (beta-ami noester) polymer of formula (I) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety, and at least one poly (beta- ami noester) polymer of formula (I) or a pharmaceutically acceptable salt thereof comprising a cell-targeting moiety; or, alternatively, the nanoparticle comprises at least one pol (beta-ami noester) polymer of formula (I) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety and a cell-targeting moiety; and

[0042] B) an oligonucleotide.

[0043] In a second aspect the present invention provides a process for preparing the nanoparticle as defined in the first aspect of the invention, the process comprising the steps of:

[0044] - providing an oligonucleotide as defined in the first aspect;

[0045] - providing a polymer as defined in the first aspect; and

[0046] - contacting the oligonucleotide and the polymer(s) under suitable conditions to form nanoparticles.

[0047] In a third aspect the present invention provides a nanoparticle obtainable by the process of the second aspect of the invention.

[0048] In a fourth aspect the present invention provides a pharmaceutical composition comprising (a) a therapeutically effective amount of the nanoparticle, as defined in the first and third aspects of the invention, and (b) one or more pharmaceutically acceptable excipients or carriers. In a fifth aspect the present invention provides the pharmaceutical composition as defined in the fourth aspect of the invention, or the nanoparticle as defined in the first and third aspects of the invention for use in therapy.

[0049] This aspect of the invention can also be formulated as the nanoparticle as defined above for the manufacture of a medicament. The present invention also relates to a method for treating a mammal in need thereof, including a human, the method comprising administering a therapeutically effective amount of the nanoparticle as defined above, together with pharmaceutically acceptable excipients and / or carriers.

[0050] Brief description of Drawings

[0051] Figure 1 (Fig. 1) shows the synthetic pathway to produce K72-NO by synthesis of nitroxichexanoic acid and further coupling it to C32 polymer by esterification of the hydroxyl groups.

[0052] Figure 2 (Fig. 2) shows the hemodynamic effects of liver-targeted Pttgl siRNA / NO donor pBAE nanoparticles in Mean Arterial Pressure. The white column refers to scrambled / vehicle (animals which received a noncoding RNA fragment and animals which received the pBAE nanoparticles without siRNA and NO donor) and the black column refers to Pttg 1 siRNA / NO donor pBAE NPs (animals which received the Pttgl siRNA / NO donor pBAE nanoparticles). The y-axis is the pressure in mmHg.

[0053] Figure 3 (Fig. 3) shows the hemodynamic effects of liver-targeted Pttgl siRNA / NO donor pBAE nanoparticles in Portal Pressure. The white column refers to scrambled / vehicle and the black column refers to Pttg 1 siRNA / NO donor pBAE NPs. The y-axis is the pressure in mmHg.

[0054] Figure 4A (Fig. 4A) shows the effects scrambled / vehicle in hepatic collagen content. Stained in Sirius red. Figure 4B (Fig. 4B) shows the effects of liver-targeted Pttgl siRNA / NO donor pBAE nanoparticles in hepatic collagen content. Stained in Sirius red.

[0055] Figure 5 (Fig 5.) shows the collagen content. The white column refers to scrambled / vehicle and the black column refers to Pttg 1 siRNA / NO donor pBAE NPs. The y-axis is the Fibrotic area in %.

[0056] Figure 6A (Fig. 6A) shows the effects scrambled / vehicle on liver steatosis.

[0057] Figure 6B (Fig. 6B) shows the effects of liver-targeted Pttgl siRNA / NO donor pBAE nanoparticles on liver steatosis.

[0058] Figure 7A (Fig. 7A) shows the effects on Fact content in % (y-axis). The black dots (left set of data) refer to the scrambled / vehicle and the white dots (right set of data) refer to the Pttgl siRNA / NO donor pBAE nanoparticles. Figure 7B (Fig. 7B) shows the effects on Fat size in squared micrometers ( m2) (y-axis). The black dots (left set of data) refer to the scrambled / vehicle and the white dots (right set of data) refer to the Pttg 1 siRNA / NO donor pBAE nanoparticles.

[0059] Detailed description of the invention

[0060] All terms as used herein in this application, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions terms as used in the present application are as set forth below and are intended to apply uniformly throughout the specification and claims unless an otherwise expressly set out definition provides a broader definition.

[0061] It is noted that, as used in this specification and the appended claims, the singular forms "a”, "an”, and "the” include plural referents unless the context clearly dictates otherwise.

[0062] For the purposes of the present invention, any ranges given include both the lower and the upper end-points of the range.

[0063] The term "about" or "around” as used herein refers to a range of values ± 10% of a specified value. For example, the expression "about 10" or "around 10” includes ± 10% of 10, i.e., from 9 to 11.

[0064] The present invention provides in a first aspect, nanoparticles comprising a pBAE polymer, an R3 group covalently modified with a NO donor as defined above, an R3 group covalently modified with a cell-targeting moiety as defined above, and an oligonucleotide.

[0065] This means that the nanoparticles of the invention can be formed by a plurality of polymers of formula (V) or, alternatively, formula (I) as defined above; provided that at least one NO donor moiety is present in any R3group of any of the polymers of formula (V) or, alternatively, formula (I) comprised in the nanoparticle, and at least one cell-targeting moiety is present in any R3 group of any of the polymers of formula (V) or, alternatively, formula (I) comprised in the nanoparticle. The NO donor moiety and the cell-targeting moiety can be located in R3 positions of a same at least one polymer of formula (V) or, alternatively, formula (I), or in R3 positions of a different at least one polymer of formula (V) or, alternatively, formula (I).

[0066] Thus, in a particular embodiment, optionally in combination with any one of the embodiments provided above or below, the nitric oxide donor moiety and the cell-targeting moiety are in the same at least one poly (betaaminoester) polymer of formula (V) or, alternatively, formula (I); or in a different at least one poly(beta- aminoester) polymer of formula (V) or, alternatively, formula (I). More in particular, the nitric oxide donor moiety and the cell-targeting moiety are in a different at least one poly(beta-aminoester) polymer of formula (V) or, alternatively, formula (I) or a pharmaceutically acceptable salt thereof. In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, the nanoparticle comprises at least two polymers of formula (V) or, alternatively, formula (I), provided that one of the at least two polymers comprises a NO donor moiety in an R3 group, and the other one of the at least two polymers comprises a cell-targeting moiety. In a more particular embodiment, the at least one polymer comprising a NO donor moiety in an R3 group does not comprise a cell-targeting moiety; and the at least one polymer comprising a cell-targeting moiety in an R3 group does not comprise a NO donor moiety in an R3 group.

[0067] Apart from the NO donor and the cell-targeting moieties, the nanoparticles of the invention can also comprise an R3 group covalently modified with a moiety having a zwitterionic polymer of formula (II) as defined above.

[0068] This means that the nanoparticles of the invention can be formed by a plurality of polymers of formula (V) or, alternatively, formula (I) as defined above; provided that at least one NO donor moiety is present in any R3 group of any of the polymers of formula (V) or, alternatively, formula (I) comprised in the nanoparticle, at least one cell-targeting moiety is present in any R3 group of any of the polymers of formula (V) or, alternatively, formula (I) comprised in the nanoparticle, and at least one moiety having a zwitterionic polymer of formula (II) is present in any R3 group of any of the polymers of formula (V) or, alternatively, formula (I) comprised in the nanoparticle. The NO donor moiety, the cell-targeting moiety, and the moiety having a zwitterionic polymer of formula (II) can be located in R3 positions of a same at least one polymer of formula (V) or, alternatively, formula (I), or in R3 positions of a different at least one polymer of formula (V) or, alternatively, formula (I).

[0069] Thus, in another embodiment of the first aspect, optionally in combination with any one of the embodiments provided above or below, the nanoparticle comprises at least one polymer of formula (V) or, alternatively, formula (I) or a pharmaceutically acceptable salt thereof comprising a moiety having a zwitterionic polymer of formula (II) as defined above.

[0070] In a particular embodiment, optionally in combination with any one of the embodiments provided above or below, when the moiety having a zwitterionic polymer of formula (II) is present, it can be located in the same at least one polymer of formula (V) or, alternatively, formula (I) comprising the NO donor moiety, in the same at least one polymer of formula (V) or, alternatively, formula (I) comprising the cell-targeting moiety, or in the same at least one polymer of formula (V) or, alternatively, formula (I) comprising the NO donor moiety and the cell-targeting moiety; or in a different at least one polymer of formula (V) or, alternatively, formula (I).

[0071] Thus, in a particular embodiment of the first aspect, optionally in combination with any one of the embodiments provided above or below, the NO donor moiety, the cell-targeting moiety, and, when present, the moiety having a zwitterionic polymer of formula (II) are located in the same at least one polymer of formula (V) or, alternatively, formula (I) or in different at least one polymer of formula (V) or, alternatively, formula (I). More in particular, they are located in different polymers of formula (V) or, alternatively, formula (I).

[0072] In a particular embodiment, optionally in combination with any one of the embodiments provided above or below, the nitric oxide donor moiety, the cell-targeting moiety, and the moiety having a zwitterionic polymer of formula (II) can be in the same at least one poly(beta-aminoester) polymer of formula (V) or, alternatively, formula (I) or a pharmaceutically acceptable salt thereof; or in a different at least one poly(beta-aminoester) polymer of formula (V) or, alternatively, formula (I) or a pharmaceutically acceptable salt thereof. More in particular, the nitric oxide donor moiety, the cell-targeting moiety, and the moiety having a zwitterionic polymer of formula (II) are located in a different at least one poly(beta-aminoester) polymer of formula (V) or, alternatively, formula (I) or a pharmaceutically acceptable salt thereof.

[0073] And also, in another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, the nanoparticle comprises at least two polymers of formula (V) or, alternatively, formula (I), provided that one of the at least one polymer comprises a NO donor moiety and a cell-targeting moiety, and the other one of the at least one polymer comprises a moiety having a zwitterionic polymer of formula (II), or one of the at least one polymer comprises a NO donor moiety and a moiety having a zwitterionic polymer of formula (II), and the other one of the at least one polymer comprises a cell-targeting moiety, or one of the at least one polymer comprises a moiety having a zwitterionic polymer of formula (II) and a cell-targeting moiety, and the other one of the at least one polymer comprises a NO donor moiety.

[0074] In a more particular embodiment, optionally in combination with any of the embodiments provided above or below, the nanoparticle comprises at least two polymers of formula (V) or, alternatively, formula (I), provided that one of the at least one polymer comprises a NO donor moiety and a cell-targeting moiety and does not comprise a moiety having a zwitterionic polymer of formula (II), and the other one of the at least one polymer comprises a moiety having a zwitterionic polymer of formula (II) and does not comprise a NO donor moiety and a cell-targeting moiety; or one of the at least one polymer comprises a NO donor moiety and a moiety having a zwitterionic polymer of formula (II) and does not comprise a cell-targeting moiety, and the other one of the at least one polymer comprises a cell-targeting moiety and does not comprise a NO donor moiety and a moiety having a zwitterionic polymer of formula (II); or one of the at least one polymer comprises a moiety having a zwitterionic polymer of formula (II) and a cell-targeting moiety and does not comprise a NO donor moiety, and the other one of the at least one polymer comprises a NO donor moiety and does not comprise a moiety having a zwitterionic polymer of formula (II) and a cell-targeting moiety. And also in another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, the nanoparticle comprises at least three polymers of formula (V) or, alternatively, formula (I), provided that one of the at least three polymers comprises a NO donor moiety in an R3 group, another one of the at least three polymers comprises a cell-targeting moiety, and the other one of the at least three polymers comprises a moiety having a zwitterionic polymer of formula (II). In a more particular embodiment, the at least one polymer comprising a NO donor moiety in an R3 group does not comprise a celltargeting moiety and a moiety having a zwitterionic polymer of formula (II); the at least one polymer comprising a cell-targeting moiety in an R3 group does not comprise a NO donor moiety and a moiety having a zwitterionic polymer of formula (II); and the at least one polymer comprising a moiety having a zwitterionic polymer of formula (II) in an R3 group does not comprise a NO donor moiety and a cell-targeting moiety.

[0075] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

[0076] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, or at least 30% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

[0077] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below at least 5% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

[0078] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below at least 10% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

[0079] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below at least 15% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

[0080] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below at least 20% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

[0081] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below at least 25% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

[0082] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, from 20 to 80%, from 30 to 70%, from 35 to 65% or from 40 to 50% of the R3 groups of the nanoparticle are a NO donor moiety, and from 0.25% to 30%, from 0.5 to 25%, from 5 to 30%, from 5 to 25, from 5 to 20%, from 5 to 15%, from 5 to 10%, or from 0.5 to 25% of the R3 groups of the nanoparticle are a cell-targeting moiety.

[0083] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, from 30 to 70% of the R3 groups of the nanoparticle are a NO donor moiety, and from 0.5% to 5% of the R3 groups of the nanoparticle are a cell-targeting moiety.

[0084] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, from 30 to 70% of the R3 groups of the nanoparticle are a NO donor moiety, and from 5 to 25% of the R3 groups of the nanoparticle are a cell-targeting moiety.

[0085] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, from 20 to 80%, from 30 to 70%, from 35 to 65% or from 40 to 50% of the R3 groups of the nanoparticle are a NO donor moiety, from 0.5 to 30%, 25%, from 0.5 to 5%, from 5 to 10%, from 5 to 15%, from 5 to 20%, from 5 to 25%, from 0.5 to 25% or from 5 to 30% of the R3 groups of the nanoparticle are a cell-targeting moiety, and from 10 to 80%, from 15 to 75%, from 20 to 70%, from 25 to 65%, from 30 to 60%, from 35 to 55%, or from 40 to 50% of the R3 groups of the nanoparticle are a moiety having a zwitterionic polymer of formula (II).

[0086] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, from 30 to 70% of the R3 groups of the nanoparticle are a NO donor moiety, from 0.5 to 5% of the R3 groups of the nanoparticle are a cell-targeting moiety, and from 20 to 70% of the R3 groups of the nanoparticle are a moiety having a zwitterionic polymer of formula (II).

[0087] In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, 30 to 70% of the R3 groups of the nanoparticle are a NO donor moiety, from 5 to 25% of the R3 groups of the nanoparticle are a cell-targeting moiety, and from 20 to 70% of the R3 groups of the nanoparticle are a moiety having a zwitterionic polymer of formula (II). In another embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, the remaining R3 groups which are other than a NO donor moiety, a cell-targeting moiety, or a moiety having a zwitterionic polymer of formula (II), represent a moiety having an amino group as defined above.

[0088] The % of R3 groups in the polymer of formula (V) or, alternatively, formula (I) representing either a moiety having a zwitterionic polymer of formula (II) as defined above, or a NO donor moiety as defined above, or a cell-targeting moiety as defined above, is calculated dividing the number of R3 groups respectively meaning the moiety having a zwitterionic polymer of formula (II), or the NO donor moiety, or the cell-targeting moiety, by the total number of groups R3 forming part of the polymer of formula (V) or, alternatively, formula (I). The number of R3 groups is determined by 1H-NMR, integrating the signal(s) of carbon atom of R3 located more distal from pBAE backbone.

[0089] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the remaining R3 groups forming part of the nanoparticle which are other than a moiety having a zwitterionic polymer, or a NO donor moiety, or a cell-targeting moiety, are the same or different and are selected from: -(CH2)POH, -(CH2)2(OCH2CH2)qOH, -(CH2)PNH2, and -(CH2)2(OCH2CH2)qNH2, wherein p and q are as defined above. In one embodiment, optionally in combination with any of the embodiments provided above or below, p and q represent from 1 to 10.

[0090] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below the Li and / or L2 linking the or each oligopeptide to the polymer is a bond.

[0091] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, Ry is selected from a group consisting of hydrogen, -(CH2)mNH2, - (CH2)mNHMe, -(CH2)mOH, -(CH2)mCH3, -(CH2)2(OCH2CH2)mNH2, -(CH2)2(OCH2CH2)mOH or - (CH2)2(OCH2CH2)mCH3 wherein m is an integer from 1 to 20.

[0092] In one embodiment of the first aspect of the invention, L3 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; particularly L3 represents alkylene. In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, L4 represents

[0093] (i) , wherein R3 is as defined above. and a moiety having a zwitterionic polymer in a R3 group.

[0094] The expression “Li represent a bond” means that the polymer of formula (V) or, alternatively, formula (I) is one wherein: polymer chain

[0095] The expression "l_2 represent a bond” means that the polymer of formula (V) or, alternatively, formula (I) is one wherein: polymer chain

[0096] Chemical groups

[0097] The term "halogen” (or "halo”) includes fluorine, chlorine, bromine and iodine.

[0098] The term "alkyl” includes monovalent, straight or branched, saturated, acyclic hydrocarbyl groups. Alkyl is suitably Ci- alkyl, or Ci-ealkyl, or Cualkyl, such as methyl, ethyl, n-propyl, i-propyl or t-butyl groups. Alkyl may be substituted.

[0099] The term “cycloalky I” includes monovalent, saturated, cyclic hydrocarbyl groups. Cycloalkyl is suitably C3- locycloalkyl, or Cs-ecycloalkyl such as cyclopentyl and cyclohexyl. Cycloalkyl may be substituted.

[0100] The term "alkoxy” means alkyl-O-.

[0101] The term "alkylamino” means alkyl-NH-.

[0102] The term "alkenyl” includes monovalent, straight or branched, unsaturated, acyclic hydrocarbyl groups having at least one carbon-carbon double bond and, suitably, no carbon-carbon triple bonds. Alkenyl is suitably C2- walkenyl, or C^alkenyl, or C^alkenyl. Alkenyl may be substituted. The term “cycloalkenyl” includes monovalent, partially unsaturated, cyclic hydrocarbyl groups having at least one carbon-carbon double bond and, suitably, no carbon-carbon triple bonds. Cycloalkenyl is suitably C3- locycloalkenyl, or Cs-iocycloalkenyl, e.g. cyclohexenyl or benzocyclohexyl. Cycloalkenyl may be substituted.

[0103] The term “alkynyl” includes monovalent, straight or branched, unsaturated, acyclic hydrocarbyl groups having at least one carbon-carbon triple bond and, suitably, no carbon-carbon double bonds. Alkynyl is suitably C2- walkynyl, or C^alkynyl, or C^alkynyl. Alkynyl may be substituted.

[0104] The term "alkylene” includes divalent, straight or branched, saturated, acyclic hydrocarbyl groups. Alkylene is suitably Ci- alky lene, or Chalky lene, or Chalky lene, such as methylene, ethylene, n-propylene, i-propylene or t-butylene groups. Alkylene may be substituted.

[0105] The term "alkenylene” includes divalent, straight or branched, unsaturated, acyclic hydrocarbyl groups having at least one carbon-carbon double bond and, suitably, no carbon-carbon triple bonds. Alkenylene is suitably C2-ioalkenylene, or C^alkenylene, or C^alkenylene. Alkenylene may be substituted.

[0106] The term “heteroalkyl” includes alkyl groups, for example, Ci-esalkyl groups, Ci- alkyl groups or Ci- alkyl groups, in which up to twenty carbon atoms, or up to ten carbon atoms, or up to two carbon atoms, or one carbon atom, are each replaced independently by 0, S(0)tor N, provided at least one of the alkyl carbon atoms remains. The heteroalkyl group may be C-linked or hetero-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through 0, S(0)tor N, wherein t is defined below. Heteroalkyl may be substituted.

[0107] The term "heterocycloalkyl" includes cycloalkyl groups in which up to ten carbon atoms, or up to two carbon atoms, or one carbon atom, are each replaced independently by 0, S(0)tor N, provided at least one of the cycloalkyl carbon atoms remains. Examples of heterocycloalkyl groups include oxiranyl, thiaranyl, aziridinyl, oxetanyl, thiatanyl, azetidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, 1 ,4-dioxanyl, 1 ,4-oxathianyl, morpholinyl, 1,4-dithianyl, piperazinyl, 1,4- azathianyl, oxepanyl, thiepanyl, azepanyl, 1,4-dioxepanyl, 1 ,4-oxathiepanyl, 1,4-oxaazepanyl, 1 ,4-dithiepanyl, 1 ,4-thieazepanyl and 1,4-diazepanyl. The heterocycloalkyl group may be C-linked or N-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through a nitrogen atom. Heterocycloalkyl may be substituted.

[0108] The term "heteroalkenyl" includes alkenyl groups, for example, Ci-esalkeny I groups, Ci- alkeny I groups or Ci. walkenyl groups, in which up to twenty carbon atoms, or up to ten carbon atoms, or up to two carbon atoms, or one carbon atom, are each replaced independently by 0, S(0)tor N, provided at least one of the alkenyl carbon atoms remains. The heteroalkenyl group may be C-linked or hetero-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through 0, S(0)tor N. Heteralkenyl may be substituted. The term "heterocycloalkenyl" includes cycloalkenyl groups in which up to three carbon atoms, or up to two carbon atoms, or one carbon atom, are each replaced independently by 0, S(0)tor N, provided at least one of the cycloalkenyl carbon atoms remains. Examples of heterocycloalkenyl groups include 3,4-dihydro-2H- pyranyl, 5-6-dihydro-2H-pyranyl, 2H-pyranyl, 1 ,2,3,4-tetrahydropyridinyl and 1 ,2,5,6-tetrahydropyridinyl. The heterocycloalkenyl group may be C-linked or N-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through a nitrogen atom. Heterocycloalkenyl may be substituted.

[0109] The term "heteroalky ny I" includes alkynyl groups, for example, Ci-65alky ny I groups, Ci-izalky ny I groups or Ci. walkynyl groups, in which up to twenty carbon atoms, or in which up to ten carbon atoms, or up to two carbon atoms, or one carbon atom, are each replaced independently by 0, S(0)tor N, provided at least one of the alkynyl carbon atoms remains. The heteroalkynyl group may be C-linked or hetero-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through 0, S(0)tor N. Heteroalkynyl may be substituted.

[0110] The term "heteroalkylene" includes alkylene groups, for example, Ci-65alky lene groups, Ci- alky lene groups or Ci-ioalky lene groups, in which up to twenty carbon atoms, or in which up to ten carbon atoms, or up to two carbon atoms, or one carbon atom, are each replaced independently by 0, S(0)tor N, provided at least one of the alkylene carbon atoms remains. Heteroalkynylene may be substituted.

[0111] The term "heteroalkenylene" includes alkenylene groups, for example, C esalkeny lene groups, Ci. alkenylene groups or Ci-ioalkenylene groups, in which up to twenty carbon atoms, or in which up to ten carbon atoms, or up to two carbon atoms, or one carbon atom, are each replaced independently by 0, S(0)tor N, provided at least one of the alkenylene carbon atoms remains. Heteroalkenylene may be substituted.

[0112] The term "aryl" includes monovalent, aromatic, cyclic hydrocarbyl groups, such as phenyl or naphthyl (e.g. 1- naphthyl or 2-naphthyl). In general, the aryl groups may be monocyclic or polycyclic fused ring aromatic groups. Preferred aryl are Ce-Cuaryl. Aryl may be substituted.

[0113] Other examples of aryl groups are monovalent derivatives of aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, chrysene, coronene, fluoranthene, fluorene, as-indacene, s- indacene, indene, naphthalene, ovalene, perylene, phenalene, phenanthrene, picene, pleiadene, pyrene, pyranthrene and rubicene.

[0114] The term “arylalkyl” means alkyl substituted with an aryl group, e.g. benzyl.

[0115] The term "arylene” means a divalent, aromatic, cyclic hydrocarbyl groups, such as phenylene or naphthylene (e.g. 1 -naphthylene or 2-naphthylene). In general, the arylene groups may be monocyclic or polycyclic fused ring aromatic groups. Preferred arylenes are Ce-Cuarylene. Arylene may be substituted.

[0116] The term "heteroaryl” includes aryl groups in which one or more carbon atoms are each replaced by heteroatoms independently selected from 0, S, N, and NRN, where RNis defined below (and in one embodiment is H or alkyl (e.g. Ci-ealkyl)). Heteroaryl may be substituted.

[0117] In general, the heteroaryl groups may be monocyclic or polycyclic (e.g. bicyclic) fused ring heteroaromatic groups. Typically, heteroaryl groups contain 5-14 ring members (preferably 5-10 members) wherein 1, 2, 3 or 4 ring members are independently selected from 0, S, N, and NRN. A heteroaryl group is suitably a 5, 6, 9 or 10 membered, e.g. 5-membered monocyclic, 6-membered monocyclic, 9-membered fused-ring bicyclic or 10- membered fused-ring bicyclic.

[0118] Monocyclic heteroaromatic groups include heteroaromatic groups containing 5-6 ring members wherein 1, 2, 3 or 4 ring members are independently selected from 0, S, N, and NRN.

[0119] 5-Membered monocyclic heteroaryl groups may contain 1 ring member which is an -NRN- group, an -0- atom or an -S- atom and, optionally, 1-3 ring members (e.g. 1 or 2 ring members) which are =N- atoms (where the remainder of the 5 ring members are carbon atoms).

[0120] Examples of 5-membered monocyclic heteroaryl groups are pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, isoxazolyl, oxazolyl, isothiazolyl, thiazolyl, 1,2,3 triazolyl, 1,2,4 triazolyl, 1,2,3 oxadiazolyl, 1,2,4 oxadiazolyl, 1,2,5 oxadiazolyl, 1,3,4 oxadiazolyl, 1,3,4 thiadiazolyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazinyl, 1,3,5 triazinyl, 1,2,4 triazinyl, 1,2,3 triazinyl and tetrazolyl.

[0121] Examples of 6-membered monocyclic heteroaryl groups are pyridinyl, pyridazinyl, pyrimidinyl and pyrazinyl.

[0122] 6-Membered monocyclic heteroaryl groups may contain 1 or 2 ring members which are =N- atoms (where the remainder of the 6 ring members are carbon atoms).

[0123] Bicyclic heteroaromatic groups include fused-ring heteroaromatic groups containing 9-14 ring members wherein 1, 2, 3, 4 or more ring members are independently selected from 0, S, N, and NRN.

[0124] 9-Membered bicyclic heteroaryl groups may contain 1 ring member which is an -NRN- group, an-0- atom or an -S- atom and, optionally, 1-3 ring members (e.g. 1 or 2 ring members) which are =N- atoms (where the remainder of the 9 ring members are carbon atoms).

[0125] Examples of 9-membered fused-ring bicyclic heteroaryl groups are benzofuranyl, benzothiophenyl, indolyl, benzimidazolyl, indazolyl, benzotriazolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[4,5-b]pyridinyl, imidazo[4,5-c]pyridinyl, pyrazolo[4,3-d]pyridinyl, pyrazolo[4,3- c]pyridinyl, pyrazolo[3,4-c]pyridinyl, pyrazolo[3,4-b]pyridinyl, isoindolyl, indazolyl, purinyl, indolininyl, imidazo[1 ,2-a]pyridinyl, imidazo[1 ,5-a]pyridinyl, pyrazolo[1 ,2-a]pyridinyl, pyrrolo[1,2-b]pyridazinyl and imidazo[1 , 2-c]py rimidiny I .

[0126] 10-Membered bicyclic heteroaryl groups may contain 1-3 ring members which are =N- atoms (where the remainder of the 10 ring members are carbon atoms).

[0127] Examples of 10-membered fused-ring bicyclic heteroaryl groups are quinolinyl, isoquinolinyl, cinnolinyl, quinazolinyl, quinoxalinyl, phthalazinyl, 1 ,6-naphthyridinyl, 1 ,7-naphthyridinyl, 1,8-naphthyridinyl, 1,5- naphthyridinyl, 2,6-naphthyridinyl, 2,7-naphthyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[4,3-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrido[2,3-d]pyrimidinyl, pyrido[2,3-b]pyrazinyl, pyrido[3,4-b]pyrazinyl, pyrimido[5,4- d]pyrimidinyl, pyrazino[2,3-b]pyrazinyl and pyrimido[4,5-d]pyrimidinyl.

[0128] The term "heteroarylene” means divalent aryl groups in which one or more carbon atoms are each replaced by heteroatoms independently selected from 0, S, N, and NRN, where RNis defined below (and in one embodiment is H or alkyl (e.g. Ci-ealkyl)). Heteroarylene may be substituted.

[0129] The term “heteroary lalky I” means alkyl substituted with a heteroaryl group.

[0130] Examples of acyl groups include alkyl-C(=O)-, cycloalkyl-C(=O)-, alkenyl-C(=O)-, cycloalkenyl-C(=O)-, heteroalkyl-C(=O)-, heterocycloalkyl-C(=O)-, aryl-C(=O)- or heteroaryl-C(=O)-, in particular, alkyl-C(=O)- and aryl-C(=O)-.

[0131] Unless indicated explicitly otherwise, where combinations of groups are referred to herein as one moiety, e.g. arylalkyl, the last mentioned group contains the atom by which the moiety is attached to the rest of the molecule.

[0132] Where reference is made to a carbon atom of an alkyl group or other group being replaced by 0, S(O)tor N, what is intended is that: replaced by — N —

[0133] -CH= is replaced by -N=;

[0134] EC-H is replaced by EN; or

[0135] -CH2- is replaced by -O-, -S(O)t- or -NRN-.

[0136] By way of clarification, in relation to the above mentioned heteroatom containing groups (such as heteroalkyl etc.), where a numerical of carbon atoms is given, for instance Ca-eheteroalkyl, what is intended is a group based on Chalky I in which one of more of the 3-6 chain carbon atoms is replaced by 0, S(0)tor N. Accordingly, a Cs-eheteroalkyl group, for example, will contain less than 3-6 chain carbon atoms.

[0137] Where mentioned above, RNis H, alkyl, cycloalkyl, aryl, heteroaryl, -C(O)-alkyl, -C(O)-aryl, -C(O)-heteroaryl, - S(O)t-alkyl, -S(O)t-aryl or -S(O)t-heteroaryl. RNmay, in particular, be H, alkyl (e.g. Ci-ealkyl) or cycloalkyl (e.g. Ca-ecycloalkyl).

[0138] Where mentioned above, t is independently 0, 1 or 2, for example 2. Typically, t is 0.

[0139] Where a group has at least 2 positions which may be substituted, the group may be substituted by both ends of an alkylene or heteroalkylene chain to form a cyclic moiety.

[0140] Optionally substituted groups (e.g. alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, alkylene, alkenylene, heteroalkyl, heterocycloalkyl, heteroalkenyl, heterocycloalkenyl, heteroalkynyl, heteroalkylene, heteroalkenylene, aryl, arylalkyl, arylheteroalkyl, heteroaryl, heteroarylalkyl or heteroarylheteroalkyl groups etc.) may be substituted or unsubstituted, or may be unsubstituted. Typically, substitution involves the notional replacement of a hydrogen atom with a substituent group, or two hydrogen atoms in the case of substitution by =O.

[0141] Where substituted, there will generally be 1 to 3 substituents, or 1 or 2 substituents, or 1 substituent.

[0142] The optional substituent(s) is / are independently halogen, trihalomethyl, trihaloethyl,-OH, -NH2, -NO2, -CN, - N+(Ci-6alkyl)2O’, -C , -SOCi-ealkyl, -SO2Ci-6alkyl, -SOsCi-ealkyl, -OC(=O)OCi-6alkyl, - C(=O)H, -C(=O)Ci. =0, -NH(Ci.6alkyl), -N(Ci.6alkyl)2, -C(=O)NH2, -C(=O)N(Ci.6alkyl)2, -N(Ci.6alkyl)C(=O) (=O)N(Ci.6alkyl)2, -OC(=O)N(Ci.6alkyl)2, -N(Ci.6alkyl)C(=O)Ci.6alkyl, -C(=S)N(Ci. Ci.6alkyl, -SO2N(Ci.6alkyl)2, -N(Ci.6alkyl)SO2Ci.6alkyl, -N(Ci. 6alkyl)C(=S)N(Ci-6a Ci-6alkyl)2, -Ci-ealkyl, -Ci-eheteroalkyl, -Cs ecycloalkyl, -C3- eheterocycloalkyl, - enyl, -Cs-ecycloalkenyl, -Cs eheterocycloalkenyl, -C^alkynyl, -C2- eheteroalkynyl, -Zu-Ci-6alkyl,-Zu- Cs ecycloalkyl, -Zu-C2-6alkenyl, -Zu-C3-6cycloalkenyl or -Zu-C2-6alkynyl, wherein Zuis independently 0, S, NH or N(Ci-ealkyl).

[0143] In another embodiment, the optional substituent(s) is / are independently halogen, trihalomethyl, trihaloethyl, - NO2, -CN, -N+(Ci.6alkyl)2O-, -C02H, -SO3H, -SOCi.6alkyl, -SO2Ci.6alkyl, -C(=0)H, -C(=O)Ci.6alkyl, =0, -N(Ci. ealkyl)2, -C(=O)NH2, -Ci-ealkyl, -Cs ecycloalkyl, -Cs eheterocycloalkyl, -ZuCi-ealkyl or-zu-C3-6cycloalkyl, wherein Zuis defined above.

[0144] In another embodiment, the optional substituent(s) is / are independently halogen, trihalomethyl, -NO2, -CN, - CO2H, -C(=O)Ci-6alkyl, =0, -N(Ci-ealkyl)2, -C(=0)NH2, -Ci-ealkyl, -Cs ecycloalkyl, -Cs eheterocycloalkyl, -ZuCi. ealkyl or-Zu-C3-ecycloalkyl, wherein Zuis defined above.

[0145] In another embodiment, the optional substituent(s) is / are independently halogen, -NO2, -CN, -CO2H, =0, - N(Ci-ealkyl)2, -Ci-ealkyl, -Ca-ecycloalkyl or -Cs-eheterocycloalkyl.

[0146] In another embodiment, the optional substituent(s) is / are independently halogen, -OH, NH2, NH(Ci-ealkyl), - N(Ci-ealkyl)2, -Ci-ealkyl, -Cs ecycloalkyl or -Cs-eheterocycloalkyl.

[0147] The term "polyalkylene glycol” (PAG) refers to compounds having the general formula H-[0-CyH2y]x-0H, such as H-[O-CH2-CH2]X-OH (polyethylene glycol or PEG) and H-[O-CH(CH3)-CH2]x-OH (polypropylene glycol). When found in a compound of the invention the PAG is bound by the bond between a carbon atom and one of the terminal hydroxyl groups e.g. in the case of PEG the substituent would be H-[O-CH2-CH2]X-. The polyalkylene glycols used in the compounds of the invention, unless otherwise defined, may have a molecular weight of from 500 to 20,000 g / mol, preferably from 1 ,000 to 10,000 g / mol, more preferably from 2,000 to 5,000 g / mol, more preferably from 2,000 to 3,500 g / mol.

[0148] As used herein, the term "polymer of Formula I” pharmaceutically acceptable derivatives thereof and polymorphs, isomers and isotopically labelled variants thereof.

[0149] The term "pharmaceutically acceptable derivative” includes any pharmaceutically acceptable salt, solvate, hydrate or prodrug of a polymer of formula (V) or, alternatively, formula (I). The pharmaceutically acceptable derivatives suitably refer to pharmaceutically acceptable salts, solvates or hydrates of a polymer of formula (V) or, alternatively, formula (I).

[0150] As used herein, the term "pharmaceutical acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutical acceptable salts are well known in the art. Examples of pharmaceutical acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, trifluoroacetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutical acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulphate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulphate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulphate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulphate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulphate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulphate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, and ammonium. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutical acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulphate, phosphate, nitrate, lower alkyl sulfonate and aryl sulfonate.

[0151] Polymers of formula (V) or, alternatively, formula (I) contain basic, e.g. amino, groups are capable of forming pharmaceutically acceptable salts with acids. Pharmaceutically acceptable acid addition salts of the polymers of formula (V) or, alternatively, formula (I) may include, but are not limited to, those of inorganic acids such as hydrohalic acids {e.g. hydrochloric, hydrobromic and hydroiodic acid), sulfuric acid, nitric acid and phosphoric acids. Pharmaceutically acceptable acid addition salts of the polymers of formula (V) or, alternatively, formula (I) may include, but are not limited to, those of organic acids such as aliphatic, aromatic, carboxylic and sulfonic classes of organic acids, examples of which include: aliphatic monocarboxylic acids such as formic acid, acetic acid, propionic acid or butyric acid; aliphatic hydroxy acids such as lactic acid, citric acid, tartaric acid or malic acid; dicarboxylic acids such as maleic acid or succinic acid; aromatic carboxylic acids such as benzoic acid, p-chlorobenzoic acid, phenylacetic acid, diphenylacetic acid or triphenylacetic acid; aromatic hydroxyl acids such as o-hydroxybenzoic acid, p-hydroxybenzoic acid, 1-hydroxynaphthalene-2-carboxylic acid or 3-hydroxynaphthalene-2-carboxylic acid; and sulfonic acids such as methanesulfonic acid, ethanesulfonic acid or benzenesulfonic acid. Other pharmaceutically acceptable acid addition salts of the polymers of formula (V) or, alternatively, formula (I) include, but are not limited to, those of glycolic acid, glucuronic acid, furoic acid, glutamic acid, anthranilic acid, salicylic acid, mandelic acid, embonic (pamoic) acid, pantothenic acid, stearic acid, sulfanilic acid, algenic acid and galacturonic acid. Wherein the polymer of Formula I comprises a plurality of basic groups, multiple centres may be protonated to provide multiple salts, e.g. di- or tri-salts of compounds of formula (V) or, alternatively, formula (I). For example, a hydrohalic acid salt of a polymer of formula (V) or, alternatively, formula (I) as described herein may be a monohydrohalide, dihydrohalide or trihydrohalide, etc. The salts include but are not limited to those resulting from addition of any of the acids disclosed above. In one embodiment of the polymer of formula (V) or, alternatively, formula (I), two basic groups form acid addition salts. In a further embodiment, the two addition salt counterions are the same species, e.g. dihydrochloride, dihydrosulphide etc. Typically, the pharmaceutically acceptable salt is a hydrochloride salt, such as a dihydrochloride salt.

[0152] Polymers of formula (V) or, alternatively, formula (I) which contain acidic, e.g. carboxyl, groups are capable of forming pharmaceutically acceptable salts with bases. Pharmaceutically acceptable basic salts of the polymers of formula (V) or, alternatively, formula (I) may include, but are not limited to, metal salts such as alkali metal or alkaline earth metal salts {e.g. sodium, potassium, magnesium or calcium salts) and zinc or aluminium salts. Pharmaceutically acceptable basic salts of the polymers of formula (V) or, alternatively, formula (I) may include, but are not limited to, salts formed with ammonia or pharmaceutically acceptable organic amines or heterocyclic bases such as ethanolamines (e.g. diethanolamine), benzylamines, N-methyl- glucamine, amino acids (e.g. lysine) or pyridine.

[0153] Hemisalts of acids and bases may also be formed, e.g. hemisulphate salts.

[0154] Pharmaceutically acceptable salts of polymers of Formula I may be prepared by methods well-known in the art.

[0155] The polymers of formula (V) or, alternatively, formula (I) may exist in both unsolvated and solvated forms. The term "solvate” includes molecular complexes comprising the polymer and one or more pharmaceutically acceptable solvent molecules such as water or C1-6 alcohols, e.g. ethanol. The term "hydrate” means a "solvate” where the solvent is water.

[0156] The polymers may exist in solid states from amorphous through to crystalline forms. All such solid forms are included within the invention.

[0157] The polymers may exist in one or more geometrical, optical, enantiomeric, diastereomeric and tautomeric forms, including but not limited to cis- and frans-forms, E- and Z-forms, R-, S- and meso-forms, keto- and enol-forms. All such isomeric forms are included within the invention. The isomeric forms may be in isomerically pure or enriched form, as well as in mixtures of isomers (e.g. racemic or diastereomeric mixtures).

[0158] The invention includes pharmaceutically acceptable isotopically-labelled polymers of formula (V) or, alternatively, formula (I) wherein one or more atoms are replaced by atoms having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature.

[0159] Examples of isotopes suitable for inclusion in the compounds of the invention include isotopes of hydrogen, such as2H and3H, carbon, such as11C,13C and14C, chlorine, such as36CI, fluorine, such as18F, iodine, such as123l and125l, nitrogen, such as13N and15N, oxygen, such as150,17O and18O, phosphorus, such as32P, and sulphur, such as35S. Certain isotopically-labelled polymers of formula (V) or, alternatively, formula (I), for example, those incorporating a radioactive isotope, are useful in drug and / or substrate tissue distribution studies. The radioactive isotopes3H and14C are particularly useful for this purpose in view of their ease of incorporation and ready means of detection.

[0160] Substitution with positron emitting isotopes, such as11C,18F,15O and13N, can be useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy.

[0161] Isotopically-labelled polymers of formula (V) or, alternatively, formula (I) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein using an appropriate isotopically-labelled reagent in place of the non-labelled reagent previously employed.

[0162] It will be appreciated that the polymers, as described herein, may be substituted with any number of substituents or functional moieties. The terms substituted, whether preceded by the term "optionally” or not, and substituent, as used herein, refer to the ability, as appreciated by one skilled in this art, to change one functional group for another functional group provided that the valency of all atoms is maintained. When more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. The substituents may also be further substituted (e.g., an aryl group substituent may have another substituent off it, such as another aryl group, which is further substituted with fluorine at one or more positions).

[0163] The term thiohydroxyl or thiol, as used herein, refers to a group of the formula -SH.

[0164] Physical parameters of the nanoparticle

[0165] The nanoparticles are biocompatible and sufficiently resistant to their environment of use that a sufficient amount of the nanoparticles remain substantially intact after entry into the mammalian body so as to be able to reach the desired target and achieve the desired physiological effect. The polymers described herein are biocompatible and preferably biodegradable.

[0166] Herein, the term ‘biocompatible' describes as substance which may be inserted or injected into a living subject without causing an adverse response. For example, it does not cause inflammation or acute rejection by the immune system that cannot be adequately controlled. It will be recognized that "biocompatible” is a relative term, and some degree of immune response is to be expected even for substances that are highly compatible with living tissue. An in vitro test to assess the biocompatibility of a substance is to expose it to cells; biocompatible substances will typically not result in significant cell death (for example, >20%) at moderate concentrations (for example, 29 pg / 10<4 >cells).

[0167] Herein, the term 'biodegradable' describes a polymer which degrades in a physiological environment to form monomers and / or other non-polymeric moieties that can be reused by cells or disposed of without significant toxic effect. Degradation may be biological, for example, by enzymatic activity or cellular machinery, or may be chemical, typically a chemical process that takes place under physiological conditions. Degradation of a polymer may occur at varying rates, with a half-life in the order of days, weeks, months, or years, depending on the polymer or copolymer used. The components preferably do not induce inflammation or other adverse effects in vivo. In certain preferred embodiments, the chemical reactions relied upon to break down the biodegradable compounds are uncatalysed. Herein, the term "nanoparticles” refers to a solid particle with a diameter of from about 1 to about 1000 nm, particularly from 50 to 800nm, particularly from 100 to 500 nm. The mean diameter of the nanoparticles of the present invention may be determined by methods known in the art, preferably by dynamic light scattering or transmission electron microscopy. In particular, the invention relates to nanoparticles that are solid particles with a diameter of from about 1 to about 1000nm when analysed by dynamic light scattering at a scattering angle of 173° and at a temperature of 25°C, using a sample appropriately diluted with filtered water and a suitable instrument such as the Zetasizer™ instruments from Malvern Instruments (UK). Where a particle is said to have a diameter of x nm, there will generally be a distribution of particles about this mean, but at least 50% by number (e.g. >60%, >70%, >80%, >90%, or more) of the particles will have a diameter within the range x±20%.

[0168] Oligopeptide

[0169] In one embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, Ri and R2 are both oligopeptides.

[0170] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, R1 and R2 represent the same oligopeptide.

[0171] According to the present invention, an "oligopeptide” comprises a string of at least three amino acids linked together by peptide bonds. Such peptides can contain only natural amino acids, although non-natural amino acids (i.e., compounds that do not occur in nature but that can be incorporated into a polypeptide chain) and / or amino acid analogues as are known in the art may alternatively be employed. Also, one or more of the amino acids in such peptides may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, or a linker for conjugation, functionalization, or other modification, etc.

[0172] In one embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the oligopeptides in the polymers defined herein typically comprise from 3 to 20 amino acid residues, particularly from 3 to 10 amino acid residues, more particularly from 3 to 6 amino acid residues. Alternatively, the oligopeptides in the polymers defined herein may comprise from 4 to 20 amino acid residues, particularly from 4 to 10 amino acid residues, more particularly from 4 to 6 amino acid residues.

[0173] In one embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide may be hydrophobic. The or each oligopeptide may comprise naturally occurring amino acids that are hydrophobic such as valine, leucine, isoleucine, methionine, tryptophan, phenylalanine, cysteine, tyrosine and alanine; in particular, the or each oligopeptide may comprise valine, leucine, isoleucine, methionine, tryptophan and phenylalanine. In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide may be hydrophilic. The or each oligopeptide may comprise naturally occurring amino acids that are hydrophilic such as serine, threonine, cysteine, asparagine and glutamine, and may further comprise naturally occurring amino acids that are charged at pH7.

[0174] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide has a net positive charge at pH 7. The or each oligopeptide may comprise naturally occurring amino acids that are positively charged at pH 7, that is, lysine, arginine and histidine. In one embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide consists of homooligopeptides consisting of naturally occurring amino acids that are positively charged at pH 7, that is, lysine, arginine and / or histidine, each of the homooligopeptides may be terminated with a cysteine. For example, the or each oligopeptide may be selected from the group consisting of polylysine, polyarginine, and polyhistidine, each of which may be terminated with cysteine. In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide consists of three lysins and one cysteine residues. I.e., the or each oligopeptide is of sequence CKKK (SEQ ID NO: 13). In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide consists of two lysins and one cysteine residues. I.e., the or each oligopeptide is of sequence CKK. In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide is terminated with a cysteine reside, which binds the oligopeptide to the polymer of formula (V) or, alternatively, formula (I) through the sulphur (S) of the cysteine residue.

[0175] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide of the nanoparticle may comprise from 2 to 20 amino acid residues selected from lysine, arginine, and histidine, and 1 cysteine residue. For example, the or each oligopeptide can be of sequence CKKK (SEQ ID NO: 13), and be bond to the polymer of formula (V) or, alternatively, formula (I) through the sulphur of the C residue. In another example, the or each oligopeptide can be of sequence CKK, and be bond to the polymer of formula (V) or, alternatively, formula (I) through the sulphur of the C residue.

[0176] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the or each oligopeptide is a compound of Formula III: wherein p is an integer from 2 to 19, typically from 3 to 9 or from 3 to 5, and wherein Rais selected at each occurrence from the group consisting of H2NC(=NH)-NH(CH2)3-, H2N(CH2)4-, and (1 H-imidazol-4-yl)-CH2-; and the wavy line points out that the oligopeptide is bound to the pBAE backbone through -S-.

[0177] Where the or each oligopeptide is a compound of Formula III, the Li and / or l_2 (and / or LT, when present) linking the or each oligopeptide to the polymer is a bond and the terminal cysteine residue provides a means of coupling the or each oligopeptide to the acrylate terminated compound of the pBAE backbone. The thiol functionality provides faster, more efficient and more easily controlled addition to the double bond through a Michael addition reaction. By contrast, where the or each oligopeptide is terminated in an amine functionality for coupling, an excess of this compound is required in the coupling step.

[0178] Alternatively, the or each oligopeptide may comprise a mixture of naturally occurring amino acids that are positively charged at pH 7 and naturally occurring amino acids that are negatively charged at pH 7. The or each oligopeptide may comprise naturally occurring amino acids that are negatively charged at pH 7, that is, aspartic acid and glutamic acid. For example, the or each oligopeptide may be selected from polyaspartic acid and polyglutamic acid, each of which may be terminated with cysteine. In this embodiment, the or each oligopeptide may be a compound of Formula lllbis: wherein p' is an integer from 2 to 19, typically from 3 to 9 or from 3 to 5, and wherein Ra' is HO2C(CH2)2- or HO2C-CH2-. In this case, the Li and / or L2 linking the or each oligopeptide to the polymer is a bond as the terminal cysteine residue provides a means of coupling the or each oligopeptide to the acrylate terminated pBAE backbone. Cell-targeting moiety

[0179] In the context of the present invention, the term "cell-targeting moiety” means a moiety that binds a cell. In certain embodiments, cell-targeting ligands are selective for one or more particular cell type. In certain embodiments, cell-targeting moieties selectively bind a receptor, such as a cell surface receptor.

[0180] Illustrative non-limitative examples of cell-targeting moieties include, but are not limited to, an antibody, a receptor ligand, a hormone, a vitamin, and an antigen, however, the present invention is not limited by the nature of the targeting agent. In some embodiments, the cell-targeting moiety is a receptor ligand, such as a ligand for CFTR, EGFR, the estrogen receptor, FGR2, folate receptor, IL-2 receptor, glycoprotein, the retinol binding protein and VEGFR.

[0181] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the receptor ligand is a carbohydrate (such as a lectin) or a sugar (such as mannose or galactose).

[0182] In another particular embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the cell-targeting moiety is a liver-targeting moiety.

[0183] More in particular, the cell-targeting moiety is retinol.

[0184] In another embodiment, optionally in combination with any of the embodiments provided above or below, the cell-targeting moiety comprises a targeting group linker.

[0185] In another embodiment, optionally in combination with any of the embodiments provided above or below, the cell-targeting group linker comprises one or more groups selected from among: phosphate, amide, ether, ester, pyrrolidine, disulfide, and methylene.

[0186] In another embodiment, optionally in combination with any of the embodiments provided above or below, the cell-targeting moiety is bound to R3. The binding of the cell-targeting moiety to R3 can be performed following well-known protocols. The skilled person, using their general knowledge, is able to select the most appropriate conditions / reagents, depending on the particular cell-targeting moiety and the particular meaning of R3. For example, the cell-targeting moiety can be firstly modified to incorporate a thiol group, preferably at a terminal position, and then, reacting the thiol derivative with the polymer of formula (V) or, alternatively, formula (I), under appropriate conditions to promote the generation of a -S-S-. The reaction can be based on the aminolysis on the Z group of the compound of formula (IV) by preparing a thiol-derivative which reacts with the cell-targeting moiety previously thiol-functionalized. Reaction conditions and reagents useful to perform the aminolysis are widely known for those skilled in the art (Hess A. et al., 2020; Boyer C. et al., 2009). wherein

[0187] Z represents an aryl, heteroaryl, alkyl, -SR5’, -NRe'R or -ORs';

[0188] Rs’ represents aryl, heteroaryl or alkyl;

[0189] Re' and R are the same or different and represent hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl;

[0190] Rs' represents hydrogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and

[0191] R9’ is a linker which binds the -S- of the thio-based compound to the -N- of the group of formula (I) or (II); n is an integer from 5 to 1000, p is an integer from 1 to 20, q is an integer from 1 to 10,

[0192] NO donor moiety

[0193] In the context of the present invention, the terms "moiety for nitric oxide release” or "NO donor” refer to a chemical entity that has the capability to release nitric oxide. NO stands for Nitric Oxide. In certain embodiments, these moieties are specifically designed to release nitric oxide under specific conditions or in response to particular stimuli.

[0194] Illustrative non-limitative examples of NO donors include, but are not limited to, organic nitrates, organic nitrites, thionitrites or S-nitrosothiols, and diazediumdiolate or NONOates.

[0195] Organic nitrates present excellent stability, lack of reactivity with other moieties and biotransformation to nitric oxide requiring ALDH2 or highly specified enzymes. Nitrooxy groups have a great potential to generate mid to long-term delivery strategies due to nitric oxide release depends on exposure to enzymes rather than environmental conditions such as temperature, pH or catalysis.

[0196] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the NO donor moiety is selected from the group consisting of an organic nitrate of formula -O(CO)-CH2)f-ONO2, wherein f is selected from 1 to 9; and a S-nitrosothiol of formula -O(CO)-(CH2)g-SNO, wherein g is selected from 1 to 15.

[0197] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the NO donor moiety of the first aspect is of formula -O(CO)-(CH2)f-ONO2, wherein f is an integer selected from 1 to 5; particularly, f is selected from 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9. More in particular, f is 5. In other words, the NO donor moiety of the first aspect is a nitrooxy-terminated organic acid with 2 to 6 carbon atoms linked to the polymer of formula 1 through the hydroxy group. In a particular embodiment, optionally in combination with any of the embodiments provided above or below, it has 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 carbon atoms. More in particular it has 6 carbon atoms. In other words, the NO donor moiety is a nitrooxy-terminated hexanoic (named K72-NO).

[0198] Thionitrites or S-nitrosothiols (SNO) S-nitrosothiols are interesting moieties to incorporate nitric oxide delivery because of its important biological roles in nitric oxide metabolism. S-nitrosothiols are synthetized by the reaction of thiols with nitric oxide or nitrosation compounds being an endogenous system to extend the effects of short living nitric oxide and stabilizing it into molecules such as S-Nitrosoglutathione that modulates nitric oxide expression, excretion and distribution.

[0199] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the NO donor moiety of the first aspect is of formula -O(CO)-(CH2)g-SNO, wherein g is an integer selected from 1 to 10. In a particular embodiment, g is selected from 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 10, or 11, or 12, or 13, or 14, or 15. More in particular, g is 10.

[0200] In other words, the NO donor moiety of the first aspect is a mercapto terminated organic acid with 2 to 11 carbon atoms. In a particular embodiment, optionally in combination with any of the embodiments provided above or below, it has 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16 carbon atoms. More in particular it has 11 carbon atoms. In other words, the NO donor moiety is a nitrosoundecanoic acid (named T64-SNO).

[0201] Moiety having a zwitterionic polymer

[0202] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the moiety having a zwitterionic polymer is one wherein r represents 1.

[0203] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the moiety having a zwitterionic polymer is one where RT represents an aryl, alkyl or -S-R5, wherein R5 is as defined above; particularly, R4' represents an aryl, alkyl, -S-aryl or -S-alkyl.

[0204] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the moiety having a zwitterionic polymer is one where R9 represents - alkylene-C(O)-O-alkylene-, wherein the alkylene is optionally substituted (as defined in any of the above embodiments); particularly R9 represents -(Cyy’)-(CH2)s-C(O)-O-(CH2)u-*, wherein Ry and Ry' are independently selected from hydrogen, halogen, trihalomethyl, trihaloethyl, -NO2, -CN, -N+(Ci-6alkyl)2O’ , -CO2H, -SO3H, -SOCi.6alkyl, -SO2Ci.6alkyl, -C(=0)H, -C(=O)Ci.6alkyl,

[0205] =0, -N(Ci-6alkyl)2, -C(=0)NH2, -Ci-ealkyl, -Cs-ecycloalkyl, -Cs-eheterocycloalkyl, -ZuCi-ealkyl or-zu-C3-6cycloalkyl, wherein Zuis defined above; * indicates the binding of R9 to the -N- of the substituent of formula (i); and s and u are integers from 1 to 20. In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, Ry and Ry' are independently selected from hydrogen, CN, and alkyl. In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, u represents from 1 to 10. In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, s represents from 1 to 10.

[0206] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the zwitterionic polymer PZ consists of zwitterionic monomers.

[0207] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the zwitterionic polymer PZ consists of from 2 to 100 monomers, particularly from 10 to 90 monomers, more particularly from 15 to 80 monomers.

[0208] The zwitterionic monomers can be derived from zwitterionic species with proton-donating end groups (i.e. proton donors) or accepting end groups (i.e. proton acceptors) which are functionalized with polymerizable olefinic groups. In some cases, a zwitterionic group of a monomer can be formed by a carboxylic acid group, a sulfonic acid group, or a phosphoric acid group. In some cases, a monomer can include a zwitterionic group composed of an acrylate, a methacrylate, an acrylamide, or a methacrylamide. In some cases, a cation of a zwitterionic group can be formed by an (cyclo)aliphatic or aromatic amine, an amidine, or a guanidine. In some cases, a cation of a zwitterionic group can be a quaternary amine. In some cases, the proton donor end groups can be hydroxyl moieties. In some cases, proton accepting end groups can be amino moieties.

[0209] In another embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the one or more zwitterionic monomers comprise(s) a positively charged nitrogen group and a negatively charged group distal to the positively charged nitrogen group on the zwitterion such that there is a separation by at least one carbon atom; particularly from 2 to 3 carbon atoms.

[0210] In some cases, a cation and an anion of a zwitterionic group can be part of the same pendant group of the monomer unit.

[0211] In one embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the one or more zwitterionic monomers are betaine monomers, such as carboxybetaines, phosphobetaines and sulfobetaines. Illustrative non-limitative examples are carboxybetaine methacrylamide (CBMAA); sulfobetaine metacrylate; N,N-dimethyl-N-acryloyloxyethyl-N-(3-sulfopropyl)- ammonium betaine; N,N-dimethyl-N-acrylamidopropyl-N-(2-carboxymethyl)-ammonium betaine; N, N-dimethyl- N-acrylamidopropyl-N-(3-sulfopropyl)-ammonium betaine; N,N-dimethyl-N-acrylamidopropyl-N-(2- carboxymethyl)-ammonium betaine; 2-(methylthio)ethyl methacryloyl-S-(sulfopropyl)-sulfonium betaine; 1-(3- sulfopropyl)-2-vinylpyridinium betaine; N-(4-sulfobutyl)-N-methyl-N, N-diallylamine ammonium betaine (MDABS); and N, N-diallyl-N-methyl-N-(2-sulfoethyl)ammonium betaine. In one embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the one or more monomers are the same or different and represent sulfobetaines.

[0212] Other suitable zwitterionic monomers that may be used to form zwitterionic include, but are not limited to, 2- Methacryloyloxyethyl phosphorylcholine; [3-(Methacryloylamino)propyl]dimethyl(3-sulfopropyl)ammonium hydroxide inner salt (also known as 3-(dimethyl{3-[(2-methylacryloyl)amino]propyl}ammonio)propane-1- sulfonate), [2-(Methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide (also known as dimethy I- [2-(2-methylprop-2-enoyloxy)ethyl]-(3-sulfopropyl)azanium); 2-[(2-acryloylethyl)dimethylammonio]ethyl 2- methyl phosphate; 2-(acryloyloxyethyl)-2'-(trimethylammonium)ethyl phosphate; [(2- acryloylethyl)dimethylammonio]methyl phosphonic acid; 2-methacryloyloxyethyl phosphorylcholine (MPC); 2- [(3-acrylamidopropyl)dimethylammonio]ethyl 2'-isopropyl phosphate (AAPI); 1-vinyl-3-(3- sulfopropyl)imidazolium hydroxide; and (2-acryloxyethyl)carboxymethyl methylsulfonium chloride as well as any derivative, salt, copolymer and combinations thereof.

[0213] In one embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the zwitterionic polymer PZ is a homopolymer, which means that it is composed by the same zwitterionic monomer. In an alternative embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the zwitterionic polymer PZ is a heteropolymer, which means that it is composed of two or more different zwitterionic monomers, creating random-, block-, or alternating-copolymer systems.

[0214] In some cases, zwitterionic monomers can be used to prepare linear architectures, combs, stars, brushes, hyperbranched / arborescent, and crosslinked gel systems may also be used. The length of the graft and density of the graft chains can be optimized.

[0215] In the context of this disclosure, the term "oligonucleotide” refers to an oligomer of nucleotide. Nucleotides consist of a naturally occurring nitrogenous base or nucleobase (purines (adenine and guanine) and pyrimidines (cytosine, uracil, and thymine)) which is covalently bond to the T position of a 5-carbon sugar (deoxyribose or ribose) which is in turn covalently bond at its 5' position to a phosphate. Oligonucleotides are generally classified as deoxyribooligonucleotides or ribooligonucleotides, which are respectively oligomers of “deoxyribonucleotides” or "ribonucleotides”. An oligonucleotide formed by deoxyribonucleotides may be referred as "DNA oligonucleotide”, "DNA molecules” or simply as "DNA”; and an oligonucleotide formed by ribonucleotides may be referred as "RNA oligonucleotide”, "RNA molecules” or simply "RNA”. A deoxyribooligonucleotide consists of a deoxyribonucleotide (containing adenine or guanine as purines, or cytosine or thymine as pyrimidines) repeating structure wherein the phosphate of a deoxyribonucleotide covalently bonds to the 3' carbon of the deoxyribose of another deoxyribonucleotide, form an alternating, unbranched polymer. A ribooligonucleotide (containing adenine or guanine as purines, or cytosine or uracil as pyrimidines) consists of a similar repeating structure where the 5-carbon sugar is ribose. The structure created by the union of phosphates and sugars of the different nucleotides of an oligonucleotide is called the sugar-phosphate backbone, i.e. the oligonucleotide contains a sugar-phosphate backbone or phosphate backbone. In the context of this disclosure a "thymine nucleotide”, an "uracil nucleotide”, a "guanine nucleotide”, a "cytosine nucleotide” or an "adenine nucleotide” refer to the nucleotide that contains the correspondent nitrogenous base, in particular the nucleotides that contain these bases and that are part of the DNA or RNA.

[0216] In the context of this disclosure, oligonucleotide sequences are represented by strand in the 5' to 3' direction from left to right, and the first nucleotide presented in the sequence is residue position number 1 .

[0217] The term "oligonucleotide” also includes oligomers comprising monomers other than deoxy adenosine 3'- monophosphate, deoxyguanosine 3'-monophosphate, deoxycytidine 3'-monophosphate, deoxythymidine 3'- monophosphate, adenosine 3'-monophosphate, guanosine 3'-monophosphate, cytidine 3'-monophosphate, or uridine 3'-monophosphate, but are functionally and structurally similar thereto. These are also referred to as oligonucleotide analogues, modified oligonucleotides, or DNA / RNA-like oligonucleotides. Such oligonucleotides may be naturally-occurring or not and are sometimes preferred over native forms because of properties such as, for example, enhanced binding ability, enhanced cellular uptake, reduced immunogenicity, and increased stability in the presence of nucleases.

[0218] An oligonucleotide analogue is indeed composed by nucleotide analogues (or modified nucleotides, or RNA / DNA-like nucleotides), which may have one or more of the three parts of it (phosphate, pentose sugar or nucleobase) altered compared to the above-mentioned "standard” nucleotides. The following paragraphs describe non-limiting modifications to the oligonucleotide of the first aspect of the invention.

[0219] The backbone of an oligonucleotide can be modified. A common modification is the substitution of the phosphate backbone for a phosphoroti ated backbone. In some embodiments, the oligonucleotide contains a phosphorothioated backbone (i.e. modifying the phosphodiester linkage to phosphorothioate of a sugar- phosphate backbone). In a particular embodiment, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or all of the oligonucleotide bases have a phosphorothioated backbone. Oligonucleotides that contain phosphorothioated backbones provide an increased resistance to nucleases compared to unmodified oligonucleotides (containing 100% phosphodiester backbone).

[0220] In some embodiments, the oligonucleotide comprises modifications to help enhance their properties. Hence, in some embodiments the oligonucleotide may be modified by the substitution of at least one nucleotide with at least one modified nucleotide, ideally so that the in vivo and in vitro stability of the oligonucleotide is enhanced as compared to a corresponding unmodified oligonucleotide. In some embodiments, the oligonucleotide comprises 2'-deoxy guanosine, 2'-deoxy adenosine, 2'-0-methylguanosine, 2'-0-methyl (e.g., 2'-O-methylcytidine, 2'-0-methylpseudouridine, 2'-0-methyluridine, 2'-0-methyladenosine (2prime-O- methyladenosine as referred in the sequence listing), 2'-0-methylguanosine) ribonucleotide, 2'- amino, 2'-thio and 2'-fluoro modified ribonucleotide, 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'- fluoro-guanosine, 2'-fluoro- adenosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino- adenosine, 2'-amino-guanosine, 2'-amino-butyryl- pyrene-uridine, 2'-amino-adenosine, 5-iodo-uridine, ribo- thymidine, 5-bromo-uridine, 2-aminopurine, 5- methyl-cytidine , 5-fluoro-cytidine, and 5- fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, and / or 5-amino- allyl-uridine.

[0221] In some embodiments, the oligonucleotide includes derivatization of the 5 position, for instance being selected from 5-(2-amino) propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine; derivatization of the 6 position, for instance 6-(2-amino)propyl uridine; derivatization of the 8-position for adenosine and / or guanosines, for instance 8- bromo guanosine, 8-chloro guanosine, or 8-fluoroguanosine. In other embodiments, the oligonucleotide comprises nucleotide analogues such as deaza nucleotides, e.g., 7-deaza- adenosine; 0- and N-modified (for instance alkylated, such as N6-methyl adenosine) nucleotides; and other heterocyclically modified nucleotide analogues.

[0222] In other embodiments, the oligonucleotide comprises a modified sugar portion. Examples of modifications to the sugar portion of the nucleotides which may be employed include the 2' OH-group being replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, H2, NHR, NR2, or COOR, wherein R is substituted or unsubstituted C1 -06 alkyl, alkenyl, alkynyl, aryl and so on. The phosphate group of the nucleotide may also be modified, such as by substituting one or more of the oxygens of the phosphate group with sulphur (for instance by employing phosphorothioates). Modifications may decrease the rate of hydrolysis of polynucleotides comprising the modified bases, for example by inhibiting degradation by exonucleases. In one preferred instance, the oligonucleotide is resistant to ribonucleases. Oligonucleotide which may be employed includes those with modifications to promote such resistance, for instance an oligonucleotide of the invention may have particularly been modified with a 2'- O-methyl group (e.g., 2'-0-methylcytidine, 2'-0- methylpseudouridine, 2'-0- methylguanosine, 2'-0-methyluridine, 2'-0-methyladenosine, 2'-0-methyl). In certain embodiments, the oligonucleotide contains a modification to increase resistance to ribonucleases and a phosphorothioate backbone. In other embodiments, the oligonucleotide contains peptide nucleic acid (PNA), Morpholino nucleic acid, glycol nucleic acid (GNA), threose nucleic acid (TNA), hexitol nucleic acids (HNA). In other embodiments, the oligonucleotide contains locked nucleic acids (LNA) (an oligonucleotide comprising at least one 2'-C,4'-C-oxy- methylene-linked bicyclic ribonucleotide monomer), 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5- carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1- methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'- methoxycarboxymethyluraci 1, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5- methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3- amino- 3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.

[0223] In some embodiments, the oligonucleotide includes modifications to the phosphate backbone such as methyl phosphonates, methyl phosphorothioates, phosphoromorpholidates, phosphoropiperazidates, phosphoramidates and boranophosphate bond. In some embodiments, the oligonucleotide contains a 2' lower alkyl moiety (e.g., C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1- propenyl, 2-propenyl, and isopropyl).

[0224] In another embodiment, optionally in combination with any of the embodiments provided above or below, one or more ends of the nucleic acid may be modified with one or more selected from the group consisting of cholesterol, tocopherol, a fatty acid having 10-24 carbon atoms, and any analogue, derivative and metabolite thereof.

[0225] The oligonucleotide may be present within the nanoparticle of the first aspect or on the surface of the nanoparticle of the first aspect. Typically, the oligonucleotide is present within the nanoparticles. The interaction between the oligonucleotide and the nanoparticle is typically non-covalent, for example, hydrogen bonding, electrostatic interaction or physical encapsulation. Typically, the interaction is electrostatic.

[0226] Nanoparticles of the present disclosure may be formed with high oligonucleotide content and high encapsulation efficiency.

[0227] Herein, the oligonucleotide encapsulation efficiency refers to the oligonucleotide incorporated into the nanoparticles as a weight percentage of the total oligonucleotide used in the method of preparation of the oligonucleotide-containing nanoparticles. It is typically up to and including 95%, more typically from 70% to 95%. Herein, oligonucleotide entrapment refers to the weight percentage of the active agent in the oligonucleotide- loaded nanoparticles. Oligonucleotide entrapment is preferably at least 2 wt %, more preferably at least 5 wt %, more preferably at least 10 wt % and typically in the range of from 2 wt % to 20 wt %, more preferably from 5 wt % to 20 wt %, more preferably from 10 wt % to 20 wt %.

[0228] As used herein, the term "length” in reference to a nucleotide sequence (e.g., "X nucleotides in length” or "X nt in length”) refers to the number of nucleotide residues in the sequence, regardless of whether the sequence is single-stranded or double-stranded. In the case of a double-stranded nucleic acid, the "length” refers to the number of base pairs, such that a double-stranded sequence of X base pairs in length corresponds to two complementary strands, each X nucleotides in length. Thus, the term "X nucleotides in length” encompasses both a single-stranded oligonucleotide of X nucleotides and a double-stranded nucleic acid of X base pairs.

[0229] In one embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is from 10 to 30 nucleotides in length, particularly from 15 to 25, more in particular from 18 to 24 nucleotides in length, more particularly it is from 19 to 23, or from 20 to 22 nucleotides in length.

[0230] In one embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, particularly at least 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. In a more particular embodiment, the oligonucleotide is at least 20 nucleotides in length. In a more particular embodiment, the oligonucleotide is at least 21 nucleotides in length.

[0231] In one embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, particularly 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. More particularly the oligonucleotide is 18, 19, 20, 21, 22 or 23 nucleotides in length. More in particular the oligonucleotide is 19, 20, 21 or 22 nucleotides in length. More in particular the oligonucleotide is 21 nucleotides in length.

[0232] The terms "hybridizes,” "hybridization,” "hybridize to”, and the like, are terms of art that refer to the pairing of nucleobases in complementary strands of oligonucleotides (e.g., an antisense oligomer and a selected / target sequence in a pre-mRNA molecule). While embodiments of this disclosure are not limited to a particular pairing mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases or nitrogenous bases. For example, the natural nucleobase adenine is complementary to the natural nucleobases thymidine and uracil, which pair through the formation of hydrogen bonds. Similarly, the natural base guanine is complementary to the natural nucleobases cytosine and 5-methyl cytosine. An oligonucleotide complementary to a certain target sequence is understood as an oligonucleotide having a sequence that will bind to the target sequence. Complementarity can be 100%, when all of the nucleotides bind to the target sequence, or less that 100%.

[0233] It may be that the region of the oligonucleotide capable of hybridizing to the target transcript has a length as described herein, or at least that length, but there are also additional nucleotides at the 5' and / or 3' ends of the oligonucleotide (overhangs), though in other instances no overhangs are present and the whole length of the oligonucleotide hybridizes with the target. In general, oligonucleotide sequences which are 100% complementary to a portion of the target RNA may particularly be employed. In some instances, though, sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence may be present. For example, oligonucleotide sequences with insertions, deletions, and single point mutations relative to the target sequence may also be effective for reducing the target gene expression. Thus, in some embodiments, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is at least partially complementary to the target sequence within the mRNA transcript. This is, more in particular, that in some embodiments, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or 100% complementary to the target sequence within the mRNA transcript. In particular embodiments, the oligonucleotide is at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to the target sequence. In more particular embodiments, the oligonucleotide is 100% complementary to the target sequence.

[0234] A complimentary nucleotide is a nucleotide that binds with the target sequence, thus it can also be expressed as an oligonucleotide that comprises a sequence that has identity with respect to the reverse complimentary of a target sequence within a transcript mRNA. Identity is of 100% or, alternatively, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with respect to the reverse complimentary of the target sequence within the transcript mRNA.

[0235] In an embodiment, optionally in combination with any one of the embodiments provided above or below, the oligonucleotide of the invention comprises a sequence which is complementary to the target sequence. In another embodiment, optionally in combination with any one of the embodiments provided above or below, the oligonucleotide of the invention consists of a sequence which is complementary to the target sequence.

[0236] Sequence identity, including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the field. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (I ,e. , % homology = # of identical positions / total # of positions* 100), optionally penalizing the score for the number of gaps introduced and / or length of gaps introduced.

[0237] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the alignment generated over a certain portion of the sequence aligned having sufficient identity but not over portions having low degree of identity (i.e., a local alignment). A preferred, non- limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264- 68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al, (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the entire length of the sequences aligned (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for the global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0238] The skilled person may determine whether an oligonucleotide downregulates the expression of an allele by methods well known in the state of the art. For example, this may be done or this is achieved by Droplet Digital PCT (ddPCR) technique.

[0239] The oligonucleotide of the invention is complementary to (and thus hybridize with) a region of the RNA transcript of a gene, in particular to the mRNA.

[0240] By hybridizing with the target sequences of the mRNA sequences, the oligonucleotide of the present disclosure is able to reduce or inhibit the expression of the encoded gene or, in other words, the translation to protein of the mRNA.

[0241] In one embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 nucleotides of the target sequence within the transcript; in particular it is complementary to at least 20, 21, 22, 23, 24 or 25 nucleotides; more particularly it is complementary to at least 21, 22, 23 or 24 nucleotides; and even more particularly it is complementary to at least 21 nucleotides of the target transcript.

[0242] In one embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is complementary to 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 nucleotides of the target sequence within the transcript; in particular it is complementary to 20, 21, 22, 23, 24 or 25 nucleotides; more particularly it is complementary to 21, 22, 23 or 24 nucleotides; and even more particularly it is complementary to 21 nucleotides of the target transcript.

[0243] In one embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is complementary to from 9 to 31, 10 to 30, 11 to 29, 12 to 28, 13 to 27, 14 to 26, 15 to 25, 16 to 24, or from 17 to 23 nucleotides of the target sequence within the transcript, more in particular from 20 to 25; in particular it is complementary to from 19 to 25, 20 to 24 or 21 to 23 nucleotides; more particularly it is complementary to from 21 to 23 nucleotides of the target transcript.

[0244] In particular embodiments, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is at least partially complementary or complementary to consecutive nucleotides of the target sequence within the transcript.

[0245] The oligonucleotide of the present invention may contain deoxyribonucleotides or ribonucleotides. In an embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide comprises DNA or RNA. In a more particular embodiments, the oligonucleotide consists of DNA or RNA.

[0246] Also, the oligonucleotide of the present invention may be formed only by deoxyribonucleotides. Alternatively, the oligonucleotide may be formed only by ribonucleotides. Thus, in a particular embodiment, the oligonucleotide comprises DNA. In a particular embodiment the oligonucleotide comprises RNA. In a more particular embodiment, the oligonucleotide consists of DNA. In a more particular embodiment, the oligonucleotide consists of RNA.

[0247] The oligonucleotide of the present invention can also contain both deoxyribonucleotides and ribonucleotides. Thus, in particular embodiments, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a DNA-RNA chimera. In other words, the oligonucleotide comprises deoxyribonucleotides and ribonucleotides. More particularly, the oligonucleotide consists of deoxyribonucleotides and ribonucleotides.

[0248] The oligonucleotides described herein can be single-stranded or double-stranded. In some embodiments the oligonucleotide of the first aspect is single-stranded. Single-stranded oligonucleotides include, e.g., mRNA, ribozymes, mature miRNA, guide RNA, and triplex-forming oligonucleotides and antisense oligonucleotides (AONs or ASOs) such as gapmers.

[0249] In a particular embodiment, the oligonucleotide is a single-stranded oligonucleotide selected from the group consisting of mRNA, ribozymes, mature miRNA, guide RNA, and triplex-forming oligonucleotides and antisense oligonucleotides. In a particular embodiment, the antisense oligonucleotide is a gapmer.

[0250] In one embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a miRNA. miRNAs are involved in RNA silencing and post-transcriptional regulation of gene expression. miRNAs base-pair to complementary sequences in mRNA molecules, then gene silence said mRNA molecules by one or more of the processes of cleavage of mRNA strand into two pieces, destabilization of mRNA by shortening its poly(A) tail, or translation of mRNA into proteins. Thus, in a particular embodiment, the sequence of the miRNA comprises a portion that corresponds with that of a portion of the mRNA transcript. In particular, the portion will usually be 100% complementary to the target portion within the allele comprising the mutation but lower levels of complementarity (e.g. 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more) may also be used. In a particular embodiment, MicroRNA (miRNA) are from 16 to 27 nucleotides, more in particular from 20 to 24 nucleotides, even more in particular from 21 to 23 nucleotides.

[0251] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide as defined in the first aspect is an antisense oligonucleotide (AON or ASO).

[0252] The AONs act by binding to target pre-mRNA or mRNA via Watson-Crick base pairing and inducing downregulation of gene expression by different mechanisms such as through mRNA cleavage, Rnase H- mediated mRNA degradation or steric hindrance.

[0253] Gapmers are chimerical single-stranded AONs that are compounded by a central block of DNA nucleotides (DNA gap), flanked by strands of RNA. Thus, in a particular embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a gapmer. In other words, the oligonucleotide of the first aspect consists of nucleotides arranged in the structure 5'-A-B-C-3', wherein “B” is a DNA gap of deoxyribonucleotides, and "A” and "C” are flanking RNA blocks of ribonucleotides.

[0254] The RNase H is an enzyme family which in almost all organisms degrades DNA-RNA hybrids as a defense against viral infection. Gapmers mechanism of gene-silencing action relies on the degradation through the action of Rnase-H in the protein synthesis process: the DNA sequence of a gene is first transcribed into mRNA, the gapmer binds to the mRNA target, and the "gapmer DNA”-"mRNA” duplex is degraded by the Rnase H1, which avoids the translation to protein (i.e. silencing the expression of the correspondent gene).

[0255] In other embodiments, the oligonucleotide of the aspect one is double stranded. Examples of double-stranded oligonucleotides include, e.g., plasmids, siRNA, short hairpin RNA (shRNA) and other RNAi agents such as pre-miRNA.

[0256] In a particular embodiment, the oligonucleotide is a double-stranded oligonucleotide selected from the group consisting of plasmids, siRNA, short hairpin RNA (shRNA) and other IRNA.

[0257] In one embodiment, the oligonucleotide is a small interfering RNA (siRNA). An siRNA acts by activating the RNAi-induced suppression complex. Once the siRNA molecules according to the present disclosure enter into the cell it gets incorporated into other proteins to form the RISC complex, and once the siRNA is part of said complex, the siRNA is unwound to form single stranded siRNA (the strand that is thermodynamically less stable due to its base pairing at the 5' end is chosen to remain part of the RISC complex). The single stranded siRNA which is part of the RISC complex can now scan and find a complementary mRNA, hybridize to it, and induce its cleavage and posterior degradation, and thus silencing the gene that encodes that mRNA.

[0258] As used herein, the term "small interfering RNA” or "siRNA” refers to a double-stranded RNA oligonucleotide that mediates gene silencing via the RNA interference (RNAi) pathway. A siRNA comprises two strands: a sense strand (also referred to as the "passenger strand") and an antisense strand (also referred to as the "guide strand"). The sense strand has the same sequence as the target sequence of the mRNA transcript (except that uracil replaces thymine), while the antisense strand is complementary to the target sequence of the mRNA transcript.

[0259] The two strands of the siRNA form a duplex of typically about 19 to 27 base pairs, optionally including one or more single-stranded overhangs, commonly at the 3' ends (e.g., 2-nucleotide 3'overhangs). Although not double-stranded along their entire length, siRNAs are considered double-stranded RNA oligonucleotides for the purposes of this application, as they comprise a double-stranded region sufficient for RNAi activity.

[0260] As above indicated, in the RNAi pathway, the siRNA duplex is incorporated into the RNA-induced silencing complex (RISC), where the antisense (guide) strand is selectively retained and directs RISC to the complementary mRNA target for cleavage or translational repression. The sense (passenger) strand is typically degraded during this process.

[0261] Thus, in one embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a siRNA. Securin is the protein encoded by the gene PTTG1. It is almost undetectable in adult livers but is highly expressed in hepatocarcinoma and in liver fibrosis. PTTG1 expression is associated with DLK1, and mRNA of both selectively increase in fibrotic liver paralleling fibrosis progression. Interfering PTTG1 mRNA results in reduced liver fibrotic area and decrease portal pressure, and also in the decrease of DLK1 and collagen I and III transcription, among other genes. Hence, PTTG1 disruption decreases DLK1 transcription and attenuates collagen deposition, and it is thus a target for the prevention and / or treatment of liver fibrosis. Securin is of SEQ ID NO: 14 (NCBI reference NP_001269311 .1)

[0262] Thus, in one embodiment, optionally in combination with any of the embodiments provided above or below, it is provided an oligonucleotide that is complementary to a target sequence of a PTTG1 transcript mRNA or a mRNA comprising a PTTG1 coding sequence (CDS) (SEQ ID NO: 4). Thus, more in particular, the oligonucleotide is complementary to a target sequence of a sequence selected from the group consisting of SEQ ID NO: 1 (NCBI reference NM_001282382.1 version 1 with update date as of April 2, 2024), SEQ ID NO: 2 ((NCBI reference NM_001282383.1 version 1 with update date as of April 2, 2024), SEQ ID NO: 3 ((NCBI reference NM_004219.4 version 3 with update date as of November 18, 2018), and SEQ ID NO: 4.

[0263] In a particular embodiment of the invention, optionally in combination with any of the embodiments provided above or below, the oligonucleotide of the present invention is a siRNA complementary to a target sequence of a PTTG1 mRNA. More in particular, complementary to a target sequence comprised within a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0264] In a particular embodiment of the invention, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a siRNA with siRNA ID s17653 provided by Thermofisher Scientific ®.

[0265] More in particular, the oligonucleotide comprises a sequence complementary to a target sequence comprised within a sequence of SEQ ID NO: 1. More in particular, the target sequence is delimited by the nucleotides at positions 458 to 480 inclusive of SEQ ID NO: 1 (SEQ ID NO: 5); at positions 458 to 479 inclusive of SEQ ID NO: 1 (SEQ ID NO: 6); or at positions 458 to 478 inclusive of SEQ ID NO: 1 (SEQ ID NO: 7). In particular at positions 458 to 478 inclusive of SEQ ID NO: 1 (SEQ ID NO: 7).

[0266] More in particular, the oligonucleotide is complementary to a target sequence comprised within a sequence of SEQ ID NO: 2. More in particular, the target sequence is delimited by the nucleotides at positions 312 to 334 inclusive of SEQ ID NO: 2 (SEQ ID NO: 5); at positions 312 to 333 inclusive of SEQ ID NO: 2 (SEQ ID NO: 6); or at positions 312 to 332 inclusive of SEQ ID NO: 2 (SEQ ID NO: 7). In particular at positions 312 to 332 inclusive of SEQ ID NO: 2 (SEQ ID NO: 7).

[0267] More in particular, the oligonucleotide is complementary to a target sequence comprised within a sequence of SEQ ID NO: 3. More in particular, the target sequence is delimited by the nucleotides at positions 151 to 173 inclusive of SEQ ID NO: 3 (SEQ ID NO: 5); at positions 151 to 172 inclusive of SEQ ID NO: 3 (SEQ ID NO: 6); or at positions 151 to 171 inclusive of SEQ ID NO: 3 (SEQ ID NO: 7). In particular at positions 151 to 171 inclusive of SEQ ID NO: 3 (SEQ ID NO: 7).

[0268] In other particular embodiments, the target sequence is within an exon selected from the group consisting of exon 2 (SEQ ID NO: 29), exon 5 (SEQ ID NO: 27), and exon 6 (SEQ ID NO: 28) of a PTTG1 transcript mRNA of sequence as set forth in SEQ ID NO: 3; an exon selected from the group consisting of exon 2 (SEQ ID NO: 29), exon 5 (SEQ ID NO: 27), and exon 6 (SEQ ID NO: 30) of a PTTG1 transcript mRNA of sequence as set forth in SEQ ID NO: 20; an exon selected from the group consisting of exon 1 (SEQ ID NO: 26), exon 4 (SEQ ID NO: 27), and exon 5 (SEQ ID NO: 28) of a PTTG1 transcript mRNA of sequence as set forth in SEQ ID NO: 1; an exon selected from the group consisting of exon 2 (SEQ ID NO: 29), exon 5 (SEQ ID NO: 27), and exon 6 (SEQ ID NO: 28) of a PTTG1 transcript mRNA of sequence as set forth in SEQ ID NO: 2; or a coding sequence (CDS) of sequence as set forth in SEQ ID NO: 4.

[0269] In particular embodiments, the oligonucleotide comprises a strand at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91, at least 92%, at least 93%, at least 94%, or 100% complementary to a target sequence of SEQ ID NO: 15. More in particular it is at least 84%, at least 89%, at least 94%, or 100% complementary to a target sequence of SEQ ID NO: 15. More in particular, at least 89% complementary to a target sequence of SEQ ID NO: 15. More in particular, at least 94% complementary to a target sequence of SEQ ID NO: 15. And even more in particular, 100% complementary to a target sequence of SEQ ID NO: 15.

[0270] SEQ ID NO: 15 is the sequence delimited by the nucleotides at positions 447 to 465 inclusive of SEQ ID NO: 1; at positions 301 to 319 inclusive of SEQ ID NO: 2; at positions 140 to 158 inclusive of SEQ ID NO: 3; at positions 44 to 62 inclusive of SEQ ID NO: 4; and at positions 92 to 110 inclusive of SEQ ID NO: 20 (NCBI reference NM_004219.4 version 4 with update date as of April 28, 2025).

[0271] In particular embodiments, the oligonucleotide is a siRNA comprising an antisense strand comprising a sequence at least 89%, at least 90%, at least 91, at least 92%, at least 93%, at least 94%, or 100% identical to a sequence of SEQ ID NO: 18, optionally with a 3'overhang (i.e. a short stretch of unpaired nucleotides at the 3'end of a strand; which in siRNAs it is typically 2 nucleotides and helps in the recognition by dicer, the efficient loading into RISC, and improving gene silencing). More in particular wherein the 3'overhang is two nucleotides in length. In more particular embodiments, the oligonucleotide is a siRNA comprising a strand consisting of a sequence of SEQ ID NO: 19.

[0272] Alternatively formulated, in particular embodiments, the oligonucleotide is a siRNA comprising a sense strand comprising a sequence at least 89%, at least 90%, at least 91, at least 92%, at least 93%, at least 94%, or 100% identical to a sequence of SEQ ID NO: 16, optionally with a 3'overhang. More in particular wherein the 3'overhang is two nucleotides in length. In more particular embodiments, the oligonucleotide is a siRNA comprising a strand consisting of a sequence of SEQ ID NO: 17.

[0273] In more particular embodiments, the oligonucleotide is a siRNA consisting of the duplex formed by these two strands (antisense strand and sense strand), optionally including the specified overhangs. And in particular including the specified overhangs.

[0274] In particular embodiments, the oligonucleotide consists of a double-stranded RNA molecule comprising: a sense strand (also known as passenger strand) consisting of a sequence of SEQ ID NO: 16, optionally comprising a 3'overhang; and an antisense strand (also known as guide strand) consisting of a sequence of SEQ ID NO: 18, optionally comprising a 3' overhang.

[0275] More in particular, the 3'overhang of the sense strand and the 3'overhang of the guide strand comprise 2 nucleotides; even more in particular the 3'overhang of the sense strand consists of TT, and the 3'overhang of the antisense strand consists of CT.

[0276] In other words, the oligonucleotide is a siRNA comprising a sense strand comprising a SEQ ID NO: 16 and an antisense strand comprising a SEQ ID NO: 18, each strand optionally comprising a 3'overhang; more in particular each 3'overhang consisting of 2 nucleotides. Even more in particular the sense strand consists of a SEQ ID NO: 17 and the antisense strand consists of a SEQ ID NO: 19 .

[0277] In other words, in a particular embodiment of the invention, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a siRNA with siRNA ID s17655 provided by Thermofisher Scientific ®. In other words, the oligonucleotide is a siRNA corresponding to PubChem Substance ID 160721778 (version 4, modified on 02 March 2014), as listed in the PubChem database of the National Center for Biotechnology Information (NCBI).

[0278] More in particular, the oligonucleotide comprises a sequence complementary to a target sequence comprised within a sequence of SEQ ID NO: 1. More in particular, the target sequence is delimited by the nucleotides at positions 455 to 478 inclusive of SEQ ID NO: 1 (SEQ ID NO:8); at positions 455 to 477 inclusive of SEQ ID NO: 1 (SEQ ID NO: 9); or at positions 455 to 476 inclusive of SEQ ID NO: 1 (SEQ ID NO: 10). In particular at positions 455 to 476 inclusive of SEQ ID NO: 1 (SEQ ID NO: 10).

[0279] More in particular, the oligonucleotide is complementary to a target sequence comprised within a sequence of SEQ ID NO: 2. More in particular, the target sequence is delimited by the nucleotides at positions 309 to 332 inclusive of SEQ ID NO: 2 (SEQ ID NO: 8); at positions 309 to 331 inclusive of SEQ ID NO: 2 (SEQ ID NO: 9); or at positions 309 to 330 inclusive of SEQ ID NO: 2 (SEQ ID NO: 10). In particular at positions 309 to 330 inclusive of SEQ ID NO: 2 (SEQ ID NO: 10). More in particular, the oligonucleotide is complementary to a target sequence comprised within a sequence of SEQ ID NO: 3. More in particular, the target sequence is delimited by the nucleotides at positions 148 to 171 inclusive of SEQ ID NO: 3 (SEQ ID NO: 8); at positions 148 to 170 inclusive of SEQ ID NO: 3 (SEQ ID NO: 9); or at positions 148 to 169 inclusive of SEQ ID NO: 3 (SEQ ID NO: 10). In particular at positions 148 to 169 inclusive of SEQ ID NO: 3 (SEQ ID NO: 10).

[0280] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a siRNA complementary to a sequence of SEQ ID NO: 7.

[0281] In a particular embodiment, the oligonucleotide is a siRNA which comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a sequence of SEQ ID NO: 7. In a particular embodiment the oligonucleotide is a siRNA which comprises a sequence 100% complementary to a sequence of SEQ ID NO: 7.

[0282] In a particular embodiment, the oligonucleotide is a siRNA which consists of a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a sequence of SEQ ID NO: 7. In a particular embodiment the oligonucleotide is a siRNA which consists of a sequence of SEQ ID NO: 7.

[0283] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a siRNA which comprises the sequence of SEQ ID NO: 11.

[0284] In a particular embodiment, the oligonucleotide is a siRNA which comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to a sequence of SEQ ID NO: 11. In a particular embodiment the oligonucleotide is a siRNA which comprises a sequence of SEQ ID NO: 11.

[0285] In a particular embodiment, the oligonucleotide is a siRNA which consists of a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to a sequence of SEQ ID NO: 11. In a particular embodiment, the oligonucleotide is a siRNA which consists of a sequence of SEQ ID NO: 11.

[0286] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a siRNA complementary to a sequence of SEQ ID NO: 10.

[0287] In a particular embodiment, the oligonucleotide is a siRNA which comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a sequence of SEQ ID NO: 10. In a particular embodiment the oligonucleotide is a siRNA which comprises a sequence 100% complementary to a sequence of SEQ ID NO: 10.

[0288] In a particular embodiment, the oligonucleotide is a siRNA which consists of a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a sequence of SEQ ID NO: 10. In a particular embodiment the oligonucleotide is a siRNA which consists of a sequence of SEQ ID NO: 10.

[0289] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a siRNA which comprises the sequence of SEQ ID NO: 12.

[0290] In a particular embodiment, the oligonucleotide is a siRNA which comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to a sequence of SEQ ID NO: 12. In a particular embodiment the oligonucleotide is a siRNA which comprises a sequence of SEQ ID NO: 12.

[0291] In a particular embodiment, the oligonucleotide is a siRNA which consists of a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to a sequence of SEQ ID NO: 12. In a particular embodiment, the oligonucleotide is a siRNA which consists of a sequence of SEQ ID NO: 12.

[0292] In other particular embodiments, the oligonucleotide comprises a strand at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91, at least 92%, at least 93%, at least 94%, or 100% complementary to a target sequence of SEQ ID NO: 21. More in particular it is at least 84%, at least 89%, at least 94%, or 100% complementary to a target sequence of SEQ ID NO: 21. More in particular, at least 89% complementary to a target sequence of SEQ ID NO: 21 . More in particular, at least 94% complementary to a target sequence of SEQ ID NO: 21. And even more in particular, 100% complementary to a target sequence of SEQ ID NO: 21.

[0293] SEQ ID NO: 21 is the sequence delimited by the nucleotides at positions 920 to 938 inclusive of SEQ ID NO: 1; at positions 774 to 792 inclusive of SEQ ID NO: 2; at positions 613 to 631 inclusive of SEQ ID NO: 3; at positions 51 to 535 inclusive of SEQ ID NO: 4; and at positions 565 to 583 inclusive of SEQ ID NO: 20 (NCBI reference NM_004219.4 version 4 with update date as of April 28, 2025).

[0294] In particular embodiments, the oligonucleotide is a siRNA comprising an antisense strand comprising a sequence at least 89%, at least 90%, at least 91, at least 92%, at least 93%, at least 94%, or 100% identical to sequence of SEQ ID NO: 24, optionally with a 3'overhang. More in particular wherein the 3'overhang is two nucleotides in length. In more particular embodiments, the oligonucleotide is a siRNA comprising a strand consisting of a sequence of SEQ ID NO: 25.

[0295] Alternatively formulated, in particular embodiments, the oligonucleotide is a siRNA comprising a sense strand comprising a sequence at least 89%, at least 90%, at least 91, at least 92%, at least 93%, at least 94%, or 100% identical to a sequence of SEQ ID NO: 22, optionally with a 3'overhang. More in particular wherein the 3'overhang is two nucleotides in length. In more particular embodiments, the oligonucleotide is a siRNA comprising a strand consisting of a sequence of SEQ ID NO: 23. In more particular embodiments, the oligonucleotide is a siRNA consisting of the duplex formed by these two strands (antisense strand and sense strand), optionally including the specified overhangs. And in particular including the specified overhangs.

[0296] In particular embodiments, the oligonucleotide consists of a double-stranded RNA molecule comprising: a sense strand (also known as passenger strand) consisting of a sequence of SEQ ID NO: 22 (CCATGGGAATCCAATCTGT), optionally comprising a 3' overhang; and an antisense strand (also known as guide strand) consisting of a sequence of SEQ ID NO: 24 (ACAGATTGGATTCCCATGG), optionally comprising a 3' overhang.

[0297] More in particular, the 3'overhang of the sense strand and the 3'overhang of the guide strand comprise 2 nucleotides; even more in particular the 3'overhang of the sense strand consists of TT, and the 3'overhang of the antisense strand consists of TG.

[0298] In other words, the oligonucleotide is a siRNA comprising a sense strand comprising a SEQ ID NO: 22 (CCATGGGAATCCAATCTGT) and an antisense strand comprising a SEQ ID NO: 24 (ACAGATTGGATTCCCATGG), each strand optionally comprising a 3'overhang; more in particular each 3'overhang consisting of 2 nucleotides. Even more in particular the sense strand consists of a SEQ ID NO: 23 (CCATGGGAATCCAATCTGTTT) and the antisense strand consists of a SEQ ID NO: 25 (ACAGATTGGATTCCCATGGTG).

[0299] In other words, in a particular embodiment of the invention, optionally in combination with any of the embodiments provided above or below, the oligonucleotide is a siRNA with siRNA ID s17654 provided by Thermofisher Scientific ®. In other words, the oligonucleotide is a siRNA corresponding to PubChem Substance ID 160721777 (version 4, modified on 02 March 2014), as listed in the PubChem database of the National Center for Biotechnology Information (NCBI).

[0300] In one embodiment of the first aspect of the invention, optionally in combination with any of the embodiments provided above or below, the nanoparticle carries a further compound of interest which is an active ingredient.

[0301] In a particular embodiment, optionally in combination with any of the embodiments provided above or below, the compound of interest, particularly the active ingredient, is negatively charged at biological pH.

[0302] In an alternative embodiment of the fourth aspect of the invention, optionally in combination with any of the embodiments provided above or below, the compound of interest, particularly the active ingredient, is positively charged at biological pH. The "positively charged at biological pH” in the context of the invention is meant to include any compound, particularly any pharmacologically active substance, that bear negative charges in the molecule in an aqueous solution at a biological pH (about 7).

[0303] The "negatively charged at biological pH” in the context of the invention is meant to include any compound, particularly any pharmacologically active substance, that bear negative charges in the molecule in an aqueous solution at a biological pH (about 7). In one embodiment, the anionic nature can be imparted from one or more functional groups selected from the group consisting of carboxyl, phosphate and sulphate groups.

[0304] In one embodiment of the present invention, optionally in combination with any of the embodiments provided above or below, the negatively charged compound of interest is a polyanionic small molecule, a nucleic acid, polypeptide or protein. As used herein, the term "small molecule” refers to organic compounds, whether naturally-occurring or artificially created (e.g., via chemical synthesis) that have relatively low molecular weight and that are not proteins, polypeptides, or polynucleotides. Typically, small molecules have a molecular weight of less than about 1500 g / mol. Examples of the polyanionic small molecules may include heparin, calcitonin, etc.

[0305] Same embodiments as per the oligonucleotide apply for the compound of interest being a nucleic acid.

[0306] In another embodiment, optionally in combination with any of the embodiments provided above or below, the nanoparticle comprises a polymeric shell comprising the polymer(s) of formula (V) or, alternatively, formula (I); and a core comprising the compound(s) encapsulated therein.

[0307] Formulation process

[0308] In a second aspect the present invention provides a process for preparing the nanoparticle as defined in the first aspect of the invention, the process comprising the steps of:

[0309] - providing an oligonucleotide as defined in the first aspect, and optionally a further compound of interest;

[0310] - providing a polymer as defined in the first aspect; and

[0311] - contacting the oligonucleotide and the polymer(s) under suitable conditions to form nanoparticles.

[0312] In other word, it is provided a method of encapsulating an oligonucleotide and optionally further compounds of interest, such as an active ingredient, in a matrix of polymers of formula I to form nanoparticles, the method comprising steps of: providing the oligonucleotide and optionally a compound of interest; providing the polymer(s) as defined in any of the above embodiments; and contacting the oligonucleotide and optionally the compound on interest, and the polymer under suitable conditions to form nanoparticles. The skilled person, using their general knowledge, can routinely adjust the parameters to obtain the nanoparticles.

[0313] Obtaining of the polymers of formula (V) or, alternatively, formula (I)

[0314] A polymer of formula (V) or, alternatively, formula (I) comprising a moiety having a zwitterionic polymer of formula (II) can be prepared as described in WO2023062114A1. Also, an example of the appropriate conditions to allow the preparation of a polymer comprising retinol as a cell-targeting moiety is provided in WO2023062114A1. Similarly, a polymer of formula (V) or, alternatively, formula (I) comprising a NO donor moiety can be prepared following the same procedures therein disclosed substituting either de moiety having a zwitterionic polymer or the cell-targeting moiety for a NO donor.

[0315] Nanoparticle obtainable by the obtention process

[0316] In the third aspect of the present invention, it is provided a nanoparticle obtainable by the process of the second aspect of the invention.

[0317] The term "obtainable" and "obtained" have the same meaning and are used interchangeably. In any case, the expression "obtainable" encompasses the term "obtained”.

[0318] Pharmaceutical Compositions

[0319] In a fourth aspect, the present invention provides a pharmaceutical composition comprising (a) a therapeutically effective amount of the nanoparticle, as defined in the first and third aspect of the invention, or the combination as defined in the fourth aspect, and (b) one or more pharmaceutically acceptable excipients or carriers.

[0320] The compositions of the invention comprise a therapeutically effective amount of the nanoparticles of the invention, when they incorporate an active ingredient, together with pharmaceutically acceptable excipients and / or carriers.

[0321] The expression "therapeutically effective amount” as used herein, refers to the amount of the nanoparticles of the invention that, when administered passes to blood stream and is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of the disease which is addressed. The particular dose of the nanoparticles administered according to this invention will of course be determined by the particular circumstances surrounding the case, including the compound administered, the route of administration, the particular condition being treated, and the similar considerations. The term "pharmaceutically acceptable” refers to that excipients or carriers suitable for use in the pharmaceutical technology for preparing compositions with medical use.

[0322] The expression "excipients and / or carriers” refers to acceptable materials, compositions or vehicles. Each component must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the composition. It must also be suitable for use in contact with the tissue or organ of humans and nonhuman animals without excessive toxicity, irritation, allergic response, immunogenicity or other problems or complications commensurate with a reasonable benefit / risk ratio. Examples of suitable acceptable excipients are solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like. Except insofar as any conventional excipient medium is incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition, its use is contemplated to be within the scope of this invention.

[0323] The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the nanoparticles into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, shaping and / or packaging the product into a desired single- or multi-dose unit.

[0324] A pharmaceutical composition of the invention may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the nanoparticles.

[0325] The relative amounts of the active ingredient (e.g. the oligonucleotide), the acceptable excipients, and / or any additional ingredients in the composition of the invention will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered.

[0326] Acceptable excipients used in the manufacture of these compositions include, but are not limited to, inert diluents, dispersing and / or granulating agents, surface active agents and / or emulsifiers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and / or oils. Such excipients may optionally be included in the inventive formulations. Excipients such as cocoa butter and suppository waxes, coloring agents, coating agents, sweetening, flavoring, and perfuming agents can be present in the composition, according to the judgment of the formulator. Uses of the nanoparticles and compositions of the invention

[0327] As mentioned above, an aspect of the invention relates to the nanoparticle of the first and third aspect, or the pharmaceutical composition as defined in the fourth aspect for use in therapy.

[0328] In a particular embodiment of the sixth aspect of the invention, the nanoparticle of the first or third aspect, or the composition of the fourth aspect, is for use in the prevention and / or treatment of liver diseases.

[0329] In a particular embodiment, the nanoparticle of the first or third aspect, or the composition of the fourth aspect, is for use in the prevention and / or treatment of a liver disease selected from fatty liver disease and hepatocarcinoma.

[0330] In a more particular embodiment, the fatty liver disease is selected from metabolic dysfunction associated steatotic liver disease and alcoholic fatty liver disease.

[0331] More in particular, the metabolic dysfunction associated steatotic liver disease is selected from metabolic dysfunction associated steatotic liver with a simple steatosis and metabolic dysfunction associated steatohepatitis (MASH).

[0332] In another embodiment, the nanoparticle of the first or third aspect, or the composition of the fourth aspect is for use in the treatment and / or prevention of hepatic steatosis in mammals. Preferably the mammal is a human. This hepatic steatosis may be associated to excessive alcohol intake, to obesity (with or without effects of insulin resistance) or to diabetes, hypertension and dyslipidemia (metabolic syndrome).

[0333] In a particular embodiment, the invention relates to the use of the nanoparticle and composition as defined above for the manufacture of a medicament for the treatment of liver diseases. In particular of a liver disease selected from fatty liver disease and hepatocarcinoma. In particular the fatty liver disease is selected from metabolic dysfunction associated steatotic liver and alcoholic fatty liver disease. In particular, the metabolic dysfunction associated steatotic liver disease is selected from metabolic dysfunction associated steatotic liver with a simple steatosis (MAFLD) and metabolic dysfunction associated steatohepatitis (MASH).

[0334] The present invention also refers to a method for the treatment of liver disease in a mammal in need thereof, including a human, liver disease selected from fatty liver disease and hepatocarcinoma, the method comprising administering a therapeutically effective amount of the nanoparticle of the first or third aspect, or the composition of the fourth aspect, together with pharmaceutically acceptable excipients and / or carriers. In particular the fatty liver disease selected from metabolic dysfunction associated steatotic liver and alcoholic fatty liver disease. In particular, the metabolic dysfunction associated steatotic liver disease selected from metabolic dysfunction associated steatotic liver with a simple steatosis and metabolic dysfunction associated steatohepatitis (MASH).

[0335] Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise” encompasses the case of "consisting of”. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.

[0336] Clauses

[0337] For reasons of completeness, various aspects of the invention are set out in the following numbered clauses:

[0338] 1. A nanoparticle comprising:

[0339] A) a poly(beta-aminoester) polymer of formula (I) or a pharmaceutically acceptable salt thereof wherein l_3 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; or, alternatively at least one of L3 is wherein LT is independently selected from the group consisting of

[0340] 0, S, NRX, and a bond, wherein Rxis independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl, and the remaining L3 groups are independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; l_4 is independently selected from the group consisting of formula (i) and (ii)

[0341] L5 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; each R3 is independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, heteroaryl, polyalkylene glycols, a moiety having a hydroxyl group (-OH), a moiety having an amine group (-NH2), a moiety having a zwitterionic polymer, a nitric oxide donor moiety, and a cell-targeting moiety, wherein:

[0342] - said polyalkylene glycol is either bound directly to the nitrogen atom to which R3 is attached or bound to the nitrogen atom to which R3 is attached via a linker moiety, wherein said linker moiety is an alkylene, cycloalkylene, alkenylene, cycloalkenylene, heteroalkylene, heterocycloalkylene, arylene or heteroarylene group;

[0343] - the moiety having a hydroxyl group (-OH) is selected from the group consisting of -(CH2)POH, and - (CH2)2(OCH2CH2)qOH;

[0344] - the moiety having an amino group (-NH2) is selected from the group consisting of -(CH2)PNH2, and - (CH2)2(OCH2CH2)qNH2; - the NO donor moiety is selected from the group consisting of an organic nitrate of formula -O(CO)- (CH2)f-ONO2, wherein f is selected from 1 to 9; and a S-nitrosothiol of formula -O(CO)-(CH2)g-SNO, wherein g is selected from 1 to 15; and

[0345] - the moiety having a zwitterionic polymer is one of formula (II)

[0346] (R4)r-PZ-R9— (II) wherein R4 represents R4 -C(=S)-S-; R4' represents an aryl, heteroaryl, alkyl, -SR5, -NReRz or -ORs; R5 represents aryl, heteroaryl or alkyl; Re and Rz are the same or different and represent hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; Rs represents hydrogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; R9 is a linker moiety which binds the PZ to the -N- of the substituent of formula (i) or (ii), wherein the linker moiety is selected from the group of alkylene, cycloalkylene, alkenylene, cycloalkenylene, heteroalkylene, heterocycloalkylene, arylene and heteroarylene group; and PZ represents a zwitterionic polymer comprising one or more zwitterionic monomers; n is an integer from 5 to 1000, p is an integer from 1 to 20, q is an integer from 1 to 10, and r is an integer from 0 to 1 ; each Li and L2 is independently selected from the group consisting of:

[0347] O, S, NRX, and a bond; wherein Rxis independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and R3 and L5 being as defined above; and

[0348] R1, R2 and Ry are independently selected from a positively charged oligopeptide at pH 7 and Ry, Rybeing selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and provided that at least one of R1, R2 and RT is a net positively charged oligopeptide at pH 7; provided that the nanoparticle comprises at least one poly (beta-ami noester) polymer of formula (I) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety, and at least one poly (beta- aminoester) polymer of formula (I) or a pharmaceutically acceptable salt thereof comprising a cell-targeting moiety; or, alternatively, the nanoparticle comprises at least one poly(beta-aminoester) polymer of formula (I) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety and a cell-targeting moiety; and

[0349] B) an oligonucleotide.

[0350] 2. A nanoparticle according to clause 1, wherein L3 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene.

[0351] 3. A nanoparticle according to clause 2, wherein L3 is alkylene.

[0352] 4. The nanoparticle according to any one of clauses 1-3, which comprises at least one poly(beta-aminoester) polymer of formula (I) or a pharmaceutically acceptable salt thereof comprising a moiety having a zwitterionic polymer of formula (II).

[0353] 5. The nanoparticle according to any one of clauses 1-4, wherein the NO donor moiety, the cell-targeting moiety and, when present, the moiety having a zwitterionic polymer of formula (II) are in a different at least one poly(beta-aminoester) polymer of formula (I) or a pharmaceutically acceptable salt thereof.

[0354] 6. The nanoparticle according to any one of clauses 1-5, wherein at least 20% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

[0355] 7. The nanoparticle according to any one of clauses 1-6, wherein from 30 to 70% of the R3 groups of the nanoparticle are NO donor moieties, from 0.5 to 25% of the R3 groups are cell-targeting moieties; or alternatively, from 30 to 70% of the R3 groups are NO donor moieties, from 0.5 to 25% of the R3 groups are cell-targeting moieties, and from 20 to 70% of the R3 groups are moieties having a zwitterionic polymer of formula (II).

[0356] 8. The nanoparticle according to any one of clauses 1-7, wherein the NO donor moiety is an organic nitrate of formula -O(CO)-(CH2)f-ONO2, wherein f is 5.

[0357] 9. The nanoparticle according to any one of clauses 1-8, wherein the cell-targeting moiety is a liver-targeting moiety.

[0358] 10. The nanoparticle according to any one of clauses 1-9, wherein the liver-targeting moiety is retinol. 11. The nanoparticle according to any one of clauses 1-10, wherein the or each oligopeptide comprises from 2 to 20 amino acid residues selected from lysine, arginine, and histidine; and, optionally, a cysteine residue.

[0359] 12. The nanoparticle according to any one of clauses 1-11, wherein the or each oligopeptide is of sequence of SEQ ID NO: 13, and is bond to the poly(beta-aminoester) polymer of formula (I) or a pharmaceutically acceptable salt thereof through the sulfur of the C residue.

[0360] 13. The nanoparticle according to any one of clauses 1-12, wherein the oligonucleotide comprises a sequence at least 90% complementary to a sequence of SEQ ID NO: 5.

[0361] 14. The nanoparticle according to any one of clauses 1-13, wherein the oligonucleotide is a double-stranded RNA selected from the group consisting of a siRNA, a shRNAs, and a pre-miRNAs; in particular a siRNA.

[0362] 15. A pharmaceutical composition comprising a therapeutically effective amount of the nanoparticle as defined in any one of the clauses 1-14, together with one or more pharmaceutically acceptable excipients or carriers.

[0363] 16. The nanoparticle as defined in any one of the clauses 1-14 or the pharmaceutical composition as defined in claim 15 for use in therapy.

[0364] 17. The nanoparticle or the pharmaceutical composition for use in therapy according to clause 16, for use in the treatment of a liver diseases selected from the group consisting of hepatocarcinoma, liver steatosis, liver fibrosis, MASH, and MASLD.

[0365] Examples

[0366] Example 1

[0367] Materials: Unless noted all reagents were used from Sigma-Aldrich. CK3 was obtained from GL biochem without further purification. A large single batch of C32 was formed by the reaction of butanediol diacry late(1 eq) and 5-aminopentanol(1 .08 eq) at 80 degrees reacting for 24 hours.t

[0368] 1. Synthesis of pBAEs containing organic nitrates:

[0369] Nitrate containing pBAE was synthetized by reaction of n-bromoaliphatic carboxylic acid(1 eq) with AgNO3(1 .05 eq) in acetonitrile for 24h protected from light. Formed AgBr was filtered and the remaining solution was washed with ethyl acetate and water extraction and evaporation of the solvent. Esterification was undergone using C32 (1 eq), N, N'-Dicyclohexylcarbodiimide (DCC) (1.05 eq) and the n-nitrooxyaliphatic carboxylic acid (1 eq) in Tetrahydrofuran (THF) with Dimethylaminopyridine (DMAP) as catalyst(0.05 eq). Reaction was kept in ice for 30 minutes and further kept at room temperature for 48 hours. Solid Dicyclohexylurea (DCU) was filtered and yielded polymer was purified in ether and reacted with CK3 in Dimethylsulfoxide (DMSO) overnight and purified in Acetone / diethyl ether and kept in DMSO at -20 °C until use.1H-RMN (400 MHz, CD3OD, TMS) (ppm): 5= 7.26 (ddd, J = 17.3, 2.4, 1.5 Hz), 6.18 (dd, J = 10.4, 2.1 Hz), 5.87 (s), 4.59 - 4.44 (m), 4.28 - 4.16 (m), 4.18 - 4.05 (m), 3.56 (t, J = 6.6 Hz), 2.94 - 2.76 (m), 2.61 - 2.48 (m), 2.38 (qd, J = 7.6, 7.0, 4.6 Hz), 1 .83 - 1 .72 (m), 1 .70 - 1 .65 (m), 1 .55 (dd, J = 15.6, 8.2 Hz), 1.37 (dt, J = 8.7, 4.4 Hz), 1.24 (td, J = 7.1, 2.4 Hz). FTIR-ATR: 1619 cm-1(NO stretch), 1704 cm-1(C=O stretch, 1275 cm-1(N-0 stretch).

[0370] 2. Synthesis of SNO containing pBAE polymers:

[0371] SNO containing pBAE was synthetized by reacting tert-butyl nitrite and thiol containing organic acids at 1 :1.05 excess in acetone, reacted for 5 minutes and then rotavapored at low temperature protected from light. Esterification was conducted by reaction of C32 (1 eq), DOC (1 .0 eq), S-nitrosomercapto-organic acid (1 .0 eq) and DMAP (0.02 eq) as catalyzer in dichloromethane (DOM). Reaction was bubbled in argon, protected from light and allow to react in an ice bath for 2 hours. Purification was concluded by centrifugation at room temperature and further crystallization of DCC at -80 °C followed by DCU filtration. Purification was conducted by precipitation in ether of the polymers, dissolving in acetone and bubbling. Polymers were kept in acetone solution in the freezer until further use, color was used as a quick check for stability.1H-RMN (400 MHz, CD3OD, TMS) (ppm): 5 = 6.38 (ddd, J = 17.3, 2.4, 1.5 Hz, OH), 6.18 (dd, J = 10.4, 2.1 Hz, OH), 5.87 (s, OH), 4.59 - 4.44 (m, OH), 4.28 - 4.16 (m, OH), 4.18 - 4.05 (m, 1 H), 3.56 (t, J = 6.6 Hz, OH), 2.94 - 2.76 (m, OH), 2.61 - 2.48 (m, 1 H), 2.38 (qd, J = 7.6, 7.0, 4.6 Hz, OH), 1 .83 - 1 .72 (m, 1 H), 1 .70 - 1 .65 (m, OH), 1 .55 (dd, J = 15.6, 8.2 Hz, OH), 1.37 (dt, J = 8.7, 4.4 Hz, OH), 1.24 (td, J = 7.1, 2.4 Hz, OH). UV-Vis: 339 max, 506 max. FTIR-ATR: 1650 cm-1(NO stretch), 1124 cm-1(C=O stretch).

[0372] 3. Synthesis of pBAEs containing organic nitrites:

[0373] C32-CK3 (1 eq) was treated with tert-butyl nitrite (1.5 eq) at room temperature, reaction rapidly generated a phase of dark red and nitrogen oxide gases discouraging further exploration. 032 (1 eq) dissolved in chloroform and tertbutyl nitrite (5 eq) was added and allow to react for 30 minutes first in ice bath and then at room temperature, further addition of CK3 and polyamines was added in DMSO.

[0374] 4. Synthesis of pBAEs containing diazeniumdiolates: 032 (1.0 eq) was reacted in 10% DMSO with spermidine (2.2 eq) and DETA (2.2 eq) for 24h. Purification was performed by precipitation in diethylether / acetone mixture. The polymers were dried and dissolved in acetonitrile 10% and reacted in a high-pressure reactor (10 bar) with NO for 10 days, then solvent was evaporated and solid was further analyzed.

[0375] Example 2 - Synthesis of K72-NO polymer

[0376] Introduction: Incorporation of nitrooxy moieties were introduced by reaction of silver nitrate with primary halides. Reaction occurs by a SN2 substitution reaction of negatively charged nitrate to the alpha carbon to the halide. The reaction is strongly driven by the high insolubility of silver halides that contributes to displace equilibrium. Availability of organic acids terminated in bromine or iodide moieties contributed to simplify the reaction. A set of nitrooxy-terminated organic acids was synthetized ranging from 2 to 6 carbon atoms, selecting hexanoic (named as K72-NO in present work) as the preferred strategy based on previous experimentation. After modification of the hydroxyl moiety derivatization with amine or thiol containing amines allowed to end-modify the base polymers to complex with nucleic acids.

[0377] K72-NO synthesis: A new set of polymers based on previously synthetized non-viral vector and improved by end-modification of C32 pBAE has been developed. Synthesis is based on the extension of the C32 hydroxyl terminated side chains with alkyl chains terminated with nitrooxy moieties (K72-NO) to incorporate nitric oxide releasing properties. The lack of reactiveness of organic nitrate altogether with the specificity of Steglich reaction yielded a robust and reliable coupling reaction, the synthetic scheme can be observed in Figure 1. Development of nitrooxy terminated carboxylic acids used for coupling was accomplished by modifying available halogen terminated carboxylic acids with silver nitrate. Total yield of K72-NO was in the 50-60% after purification. Polymers obtained are highly viscous materials that are stable under dry conditions. Materials and methods - Synthesis of K72-NO polymer: Nitrate containing C32 was synthetized as previously described and used the same stock of materials for all the experiments described. K72-NO was kept in freezer dissolved in DMSO. As an example K72-NO spectral data is presented 1 H-RMN (400 MHz, CD3OD, TMS) (ppm): d= 6.38 (ddd, J = 17.3, 2.4, 1.5 Hz, OH), 6.18 (dd, J = 10.4, 2.1 Hz, OH), 5.87 (s, OH), 4.59 - 4.44 (m, OH), 4.28 - 4.16 (m, OH), 4.18 - 4.05 (m, 1 H), 3.56 (t, J = 6.6 Hz, OH), 2.94 - 2.76 (m, OH), 2.61 - 2.48 (m, 1 H), 2.38 (qd, J = 7.6, 7.0, 4.6 Hz, OH), 1.83 - 1.72 (m, 1 H), 1.70 - 1.65 (m, OH), 1.55 (dd, J = 15.6, 8.2 Hz, OH), 1.37 (dt, J = 8.7, 4.4 Hz, OH), 1.24 (td, J = 7.1, 2.4 Hz, OH). FTIR- ATR:1619cm- 1 (NOstretch), 1704cm- 1 (C=Ostretch),1275cm-1 (N-Ostretch).

[0378] Example 3: Polyplex preparation with K72-NO PBAEs and siRNA PTTG1

[0379] Introduction: This protocol describes the process used for the preparation of polyplexes (PX) using poly (p- aminoesters) (PBAEs) based on K72-NO and siRNA.

[0380] Materials:

[0381] - Sodium acetate stock (3M). Stored at 4°C.

[0382] - Sodium acetate (12,5mM). Filtered and stored at 4°C a maximum of 3 months.

[0383] - Sucrose 4% in HEPES 20mM. Filtered and stored at 4°C a maximum of 1 month.

[0384] - Water (RNAse free; prepared or directly DEPC acquired water).

[0385] - PBAEs stock (100 mg / mL) (example with a pBAE with 50% of side chains with OH and 50% with hexylamines). Stored at -20°C.

[0386] - siRNA PTTG1. Stored at -20°C aliquoted.

[0387] - Cooler.

[0388] Experimental procedure: The procedure should preferably be performed at constant temperature. 25°C was chosen.

[0389] 1. Thaw the K72-NO polymer with the desired peptide substitution and vortex.

[0390] 2. Pipet up and down the polymer and prepare the desired concentration in NaAc 12.5mM (V1). Mix pipetting up and down. Wait 10min.

[0391] 3. Prepare the siRNA PTTG1 at the desired concentration and mix by pipetting (V2). Prepare the complexes at 0.5 mg / mL of concentration, (do not vortex RNA. pDNA can be vortexed). 4. Vortex the K72-NO polymer at the final concentration to achieve a homogeneous solution between the polymer stock in DMSO and the acetate buffer. The final polymer concentration depends on the N / P ratio selected. The selected N / P ratio is 50 / 1, in which case, if the gene material concentration is 0.5 mg / mL, the final polymer concentration will be 25 mg / mL.

[0392] 5. Mix genetic material solution and K72-NO polymer solution in a ration 1 :1 (Vi=V1+V2). K72-NO polymer solution is loaded in an Eppendorf tube where the genetic material is added by pipetting up and down for mixing, (do not vortex RNA. pDNA can be vortexed). Notice that once prepared the PX, the siRNA concentration and PBAE concentration are half diluted.

[0393] 6. Incubate at 25°C for 30 min in a thermoblock.

[0394] 7. Precipitate 1 :2 on HEPES 20mM; sucrose 4% prepared water RNAse free by addig the sample to a pre- loaded Eppendorf with hepes. At this point the PX solution has been diluted 2X.

[0395] 8. At this point, nanoparticles have been formed and are stable for some hours.

[0396] Example 4

[0397] Synthesis and characterization of Pttgl siRNA NO donor Ret pBAE NPs pBAE are a class of robust and versatile cationic polymers that are composed of ester bonds that enable different genetic material complexation and easily degradable in physiological conditions and Ret as a targeting molecule. Polymers were obtained as described in examples above. The Pttgl siRNA (Ambion Invivo siRNA assay ID: s133880, 250 nmol, Thermofisher Scientific, Waltham, MA, USA) was added to the polymer solution at a molar ratio of 25:1 (pBAE / siRNA). To selectively deliver NO to the liver, organic nitrites were selected as NO releasing moieties, pBAE NPs as delivery vehicles. NO donor Ret pBAE NPs were formulated as described above. The physicochemical characteristics including average size (nm), surface charge (mV) and polydispersity index of Pttgl siRNA NO donor Ret pBAE NPs were evaluated using ZetaSizer Nano ZS (Malvern Instruments Ltd, Malvern, UK). Measurements were performed at least in triplicate and results are given as means ± S.E.

[0398] Induction of liver fibrosis and treatment with Pttgl siRNA NO donor Ret pBAE.

[0399] Studies were performed in 23 male adult Wistar rats (Charles-River, Saint Aubin les Elseuf, France). Animals were fed ad libitum with standard chow and water containing phenobarbital (0.3 g / l) as drinking fluid. Fibrosis was induced by carbon tetrachloride (CCI4) inhalation for 17 weeks as described in Claria J. and Jimenez W. (2005). Briefly, animals were exposed to a CCI4 vapor atmosphere twice a week, starting at 0.5 min per exposure. The duration of the exposure was increased by 1 min after every three sessions until it reached 5 min, which was used until the end of the investigation. Control rats were studied following a similar period of phenobarbital administration. Pttgl siRNA NO donor Ret pBAE (n=12) or vehicle (n=11) were dispersed in saline solution and intravenously (i.v.) given as a bolus (500 pl) every 10 days through the tail vein. Pttgl siRNA NO donor Ret pBAE (0.25 mg siRNA / kg body weight) or vehicle were injected from the 13th to the 17th week of CCI4 administration. On the 18th week, rats were anesthetized, and a hemodynamic study was performed as below described. Hemodynamic study.

[0400] Fibrotic rats were anesthetized with Inactin® (50 mg / kg body weight, Sigma-Aldrich, Steinherim, Germany). Left femoral artery and vein were isolated and catheterized with a polyethylene PE-50 polyvinyl catheter. Then, the artery was connected to a transducer to measure mean arterial pressure (MAP) and recorded in a multichannel system (Powerlab, AD Instruments, Dunedin, New Zealand). Following a stabilization period of approximately 30 min after surgery, MAP was measured. Then, a midline abdominal incision of 2 cm was performed, and the portal vein was cannulated through the ileocolic vein to measure portal pressure (PP). Splanchnic perfusion pressure (SPP) was estimated as MAP minus PP. At the end of the hemodynamic study a blood sample from the femoral artery catheter was obtained. Thereafter, animals were euthanized by isoflurane overdose and liver samples were collected. Biopsies were snap frozen or fixed with 10% buffered formalin for paraffin embedding.

[0401] Morphometric measurement of fibrosis.

[0402] Liver sections (4 pm) were stained in 0.1% Sirius red F3B (Sigma-Aldrich, St. Louis, MO, USA) in saturated picric acid (Sigma-Aldrich) as described in Jimenez, W. et al. (1985). The relative fibrotic area, expressed as a percentage of total liver area, was assessed by analyzing 32 fields of Sirius red-stained liver sections per animal. Each field was acquired at 10X magnification (Nikon Eclipse E600, Kawasaki, Kanagawa, Japan) and then analyzed using the morphometry software ImageJ v 1.37. Results were analyzed using imaging software (ImageJ, NIH). To evaluate the relative fibrosis area, the measured collagen area was divided by the net field area and then multiplied by 100. Subtraction of the vascular luminal area from the total field area yielded the net fibrosis area. From each animal analyzed, the amount of fibrosis as percentage was measured and the average value presented.

[0403] Morphometric measurement of steatosis.

[0404] Hematoxilin & Eosin staining was performed in liver sections (4 pm) of all animals as previously described in Oro, D., et al. (2016). The relative steatoses area, expressed as a percentage of total liver area, was assessed by analyzing 10 fields of H&E stained liver sections per animal. Each field was acquired at 10X magnification (Nikon Eclipse E600, Kawasaki, Kanagawa, Japan) and then analyzed using the morphometry software ImageJ v 1.37. Results were analyzed using imaging software (ImageJ, NIH). To evaluate the relative fibrosis area, the measured fat area was divided by the net field area and then multiplied by 100. Subtraction of the vascular luminal area from the total field area yielded the net fat area.

[0405] Other measurements.

[0406] Standard parameters of renal and liver function (total proteins, albumin, alanine transaminase, aspartate transaminase, gamma-glutamyl transferase, bilirubin, lactate dehydrogenase, creatinine, glucose, total triglycerides and total cholesterol) were measured in serum samples in the BS-200E Chemistry Analyzer (Mindray Medical International Ltd, Shenzhen, China). Statistical analysis

[0407] Data were analyzed using GraphPad Prism 6 (GraphPad Software Inc., San Diego, USA). The Unpaired Student t-test or Mann-Whitney test was performed when appropriate. Results were shown as mean ± S.E. and considered significant when p < 0.05.

[0408] Ethics approval

[0409] The study followed the ethical guidelines stated by the "Guide for the Care and Use of Laboratory Animals” prepared by the National Academy of Sciences and published by the National Institutes of Health (8th edition 2011). The procedures were approved and performed according to the criteria of the Investigation and Ethics Committee of the Hospital Clinic and Animal Experimentation Committee of the University of Barcelona (Barcelona, Spain).

[0410] Results

[0411] There is a significant improvement in serological indicators of liver function as shown in Table 1.

[0412] Table 1 : body weight and standard liver and renal function in fibrotic rats (* refers to p<0.05; ** refers to p<0.01)

[0413] As shown in Figure 2, the systemic hemodynamics (Mean Arterial Pressure) show notable amelioration, despite the administration of a nitric oxide (NO) donor, which is a potent vasodilator. This indicates the treatment's liver-specific effects. Moreover, the treatment resulted in marked reduction in portal hypertension as shown in Figure 3. As shown in Figures 4A and 4B and Figure 5, a marked reduction in liver fibrosis is observed, even though the fibrosis induction protocol was maintained throughout the entire study period.

[0414] An unexpected outcome of the treatment is that it also resulted in a potent antisteatotic effect (around 50% reduction in fat content and size). This is shown in Figures 6A and 6B, and Figures 7A and 7B.

[0415] The beneficial effects on portal pressure (Figure 3) and liver collagen content (Figure 5) are among the most potent reported to date.

[0416] Citation List

[0417] Non-patent literature

[0418] Hess A. et al., "Aminolysis induced functionalization of (RAFT) polymer-dithioester with thiols and disulfides”, Polym. Chem., 2020,11, 7677-7684.

[0419] Boyer C. et al., "Modification of RAFT-polymers via thiol-ene reactions: A general route to functional polymers and new architectures”, Polym. Chem., 2009, 47(15), 3773-3794.

[0420] Karlin S, Altschul SF. Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc Natl Acad Sci U S A. 1990 Mar;87(6):2264-8. doi: 10.1073 / pnas.87.6.2264. PMID: 2315319; PMCID: PMC53667.

[0421] Karlin S and Altschul SF. Applications and statistics for multiple high-scoring segments in molecular sequences. Proc Natl Acad Sci U S A. 1993 Jun 15;90(12):5873-7. doi: 10.1073 / pnas.90.12.5873. PMID: 8390686; PMCID: PMC46825.

[0422] Altschul, et al. Basic local alignment search tool. Journal of Molecular Biology, Volume 215, Issue 3, 1990, Pages 403-410, ISSN 0022-2836, doi.org / 10.1016 / S0022-2836(05)80360-2

[0423] Altschul SF, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997 Sep 1 ;25(17):3389-402. doi: 10.1093 / nar / 25.17.3389. PMID: 9254694; PMCID: PMC146917.

[0424] Chan, W. K., Chuah, K. H., Rajaram, R. B., Lim, L. L, Ratnasingam, J., & Vethakkan, S. R. (2023). Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD): A State-of-the-Art Review. Journal of obesity & metabolic syndrome, 32(3), 197-213. https: / / doi.org / 10.7570 / iomes23052

[0425] Claria J, Jimenez W. Experimental models of cirrhosis and ascites. In: Ascites and Renal Dysfunction in Liver Disease: Pathogenesis Diagnosis and Treatment. 2nd edition. Blackwell Science. 2005;215-226.

[0426] Jimenez, W., Pares, A., Caballeria, J., Heredia, D., Bruguera, M., Torres, M., Rojkind, M., & Rodes, J. (1985). Measurement of fibrosis in needle liver biopsies: evaluation of a colorimetric method. Hepatology (Baltimore, Md.), 5(5), 815-818. https: / / doi.org / 10.1002 / hep.1840050517

[0427] Ord, D., Yudina, T., Fernandez-Varo, G., Casals, E., Reichenbach, V., Casals, G., Gonzalez de la Presa, B., Sandalinas, S., Carvajal, S., Puntes, V., & Jimenez, W. (2016). Cerium oxide nanoparticles reduce steatosis, portal hypertension and display anti-inflammatory properties in rats with liver fibrosis. Journal of hepatology, 64(3), 691-698. https: / / doi.Org / 10.1016 / i.ihep.2015.10.020

[0428] National Research Council. (2011). Guide for the care and use of laboratory animals (8th ed.). National Academies Press.

[0429] Patent literature WC2023062114A1 - Zwitterionic functionalized poly(beta-aminoester) polymers and uses thereof

Claims

Claims1. A nanoparticle comprising:A) a poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereofwhereinL3 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; or, alternatively at least one of L3 isand T2 is selected from H, alkyl, andwherein LT is independently selected from the group consisting of0, S, NRX, and a bond, wherein Rxis independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl, and the remaining L3 groups are independently selected from the group consisting of alkylene,alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; l_4 is independently selected from the group consisting of formula (i) and (ii)L5 and Le are independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene; each R3 is independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, heteroaryl, polyalkylene glycols, a moiety having a hydroxyl group (-OH), a moiety having an amine group (-NH2), a moiety having a zwitterionic polymer, a nitric oxide donor moiety, and a cell-targeting moiety, wherein:- said polyalkylene glycol is either bound directly to the nitrogen atom to which R3 is attached or bound to the nitrogen atom to which R3 is attached via a linker moiety, wherein said linker moiety is an alkylene, cycloalkylene, alkenylene, cycloalkenylene, heteroalkylene, heterocycloalkylene, arylene or heteroarylene group;- the moiety having a hydroxyl group (-OH) is selected from the group consisting of -(CH2)POH, and - (CH2)2(OCH2CH2)qOH;- the moiety having an amino group (-NH2) is selected from the group consisting of -(CH2)PNH2, and - (CH2)2(OCH2CH2)qNH2;- the NO donor moiety is selected from the group consisting of an organic nitrate of formula -O(CO)- (CH2)f-ONO2, wherein f is selected from 1 to 9; and a S-nitrosothiol of formula -O(CO)-(CH2)g-SNO, wherein g is selected from 1 to 15; and- the moiety having a zwitterionic polymer is one of formula (II)(R4)r-PZ-R9— (II) wherein R4 represents R4 -C(=S)-S-; R4' represents an aryl, heteroaryl, alkyl, -SR5, -NReRz or -ORs; R5 represents aryl, heteroaryl or alkyl; Re and Rz are the same or different and represent hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; Rs represents hydrogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; R9 is a linkermoiety which binds the PZ to the -N- of the substituent of formula (i) or (ii), wherein the linker moiety is selected from the group of alkylene, cycloalkylene, alkenylene, cycloalkenylene, heteroalkylene, heterocycloalkylene, arylene and heteroarylene group; and PZ represents a zwitterionic polymer comprising one or more zwitterionic monomers; n is an integer from 5 to 1000, p is an integer from 1 to 20, q is an integer from 1 to 10, and r is an integer from 0 to 1; each Li and l_2 is independently selected from the group consisting of:O, S, NRX, and a bond; wherein Rxis independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and R3 and L5 being as defined above; andR1, R2 and Ry are independently selected from a positively charged oligopeptide at pH 7 and Ry, Rybeing selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, heteroalkyl, heterocycloalkyl, acyl, aryl, and heteroaryl; and provided that at least one of R1, R2 and RT is a net positively charged oligopeptide at pH 7; provided that the nanoparticle comprises at least one poly (beta-ami noester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety, and at least one poly (betaaminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a cell-targeting moiety; or, alternatively, the nanoparticle comprises at least one poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety and a cell-targeting moiety; andB) an oligonucleotide for silencing the gene pituitary tumor-transforming 1 (PTTG1), wherein the oligonucleotide comprises a sequence of 16 to 23 nucleotides that is at least partially complementary to a target sequence within a PTTG1 transcript mRNA; and particularly wherein the oligonucleotide comprises a sequence of 19 nucleotides that is at least partially complementary to a target sequence within a PTTG1 transcript mRNA.

2. The nanoparticle according to claim 1, wherein the oligonucleotide is from 18 to 23 nucleotides in length; and particularly the oligonucleotide is 21 nucleotides in length.

3. The nanoparticle according to any one of claims 1-2, wherein the PTTG1 transcript mRNA is selected from the group consisting of a sequence of SEQ ID NO: 3, a sequence of SEQ ID NO: 20, a sequence of SEQ ID NO: 1, and a sequence of SEQ ID NO: 2.

4. The nanoparticle according to any one of claims 1-3, wherein the target sequence is within:- an exon selected from the group consisting of exon 2 (SEQ ID NO: 29), exon 5 (SEQ ID NO: 27), and exon 6 (SEQ ID NO: 28) of a PTTG1 transcript mRNA of sequence as set forth in SEQ ID NO: 3;- an exon selected from the group consisting of exon 2 (SEQ ID NO: 29), exon 5 (SEQ ID NO: 27), and exon 6 (SEQ ID NO: 30) of a PTTG1 transcript mRNA of sequence as set forth in SEQ ID NO: 20;- an exon selected from the group consisting of exon 1 (SEQ ID NO: 26), exon 4 (SEQ ID NO: 27), and exon 5 (SEQ ID NO: 28) of a PTTG1 transcript mRNA of sequence as set forth in SEQ ID NO: 1;- an exon selected from the group consisting of exon 2 (SEQ ID NO: 29), exon 5 (SEQ ID NO: 27), and exon 6 (SEQ ID NO: 28) of a PTTG1 transcript mRNA of sequence as set forth in SEQ ID NO: 2; or- a coding sequence (CDS) of sequence as set forth in SEQ ID NO: 4.

5. The nanoparticle according to any one of claims 1-4, wherein the target sequence is selected from the group consisting of a sequence of SEQ ID NO: 15, a sequence of SEQ ID NO: 21, and a sequence of SEQ ID NO: 5; and particularly wherein the target sequence is selected from the group consisting of a sequence of SEQ ID NO: 15 or of a sequence of SEQ ID NO: 21.

6. The nanoparticle according to any one of claims 1-5, wherein the sequence at least partially complementary is at least 85% complementary, at least 89% complementary, at least 94% complementary, or 100% complementary to the target sequence.

7. The nanoparticle according to any one of claims 1-5, wherein the sequence at least partially complementary is complementary to 16, to 17, to 18, to 19, to 20, or to 21 nucleotides of the target sequence; and particularly wherein the sequence at least partially complementary is complementary to 19 nucleotides of the target sequence.

8. The nanoparticle according to claims 7, wherein the nucleotides of the target sequence are consecutive.

9. The nanoparticle according to any one of claims 1-8, wherein the oligonucleotide comprises a sequence at least 89% identical, at least 94% identical, or 100% identical to a sequence selected from the group consisting of a sequence of SEQ ID NO: 18, a sequence of SEQ ID NO: 24, a sequence of SEQ ID NO: 11, and a sequence of SEQ ID NO: 12; and particularly wherein the oligonucleotide comprises a sequence at least 89%,at least 94% identical, or 100% identical to a sequence of SEQ ID NO: 18 or to a sequence of SEQ ID NO: 24.

10. The nanoparticle according to any one of claims 1-9, wherein the oligonucleotide comprises a sequence at least 94% identical to a sequence of SEQ ID NO: 18 or to a sequence of SEQ ID NO: 24.

11. The nanoparticle according to any one of claims 1-10, wherein the oligonucleotide comprises a sequence 100% identical to a sequence of SEQ ID NO: 18 or to a sequence of SEQ ID NO: 24.

12. The nanoparticle according to any one of claims 1-11, wherein the oligonucleotide is a double-stranded RNA oligonucleotide.

13. The nanoparticle according to any one of claims 1-12, wherein the oligonucleotide is a siRNA.

14. The nanoparticle according to claim 13, wherein the siRNA comprises a 3'overhang.

15. The nanoparticle according to claim 14, wherein the 3'overhang consists of 2 nucleotides.

16. The nanoparticle according to any one of claims 9-11, wherein the siRNA comprises an antisense strand consisting of 21 nucleotides.

17. The nanoparticle according to claim 16, wherein the antisense strand consists of- a sequence consisting of 19 nucleotides at least 89%, at least 94%, or 100% identical to a sequence of SEQ ID NO: 18; and- a 3'overhang consisting of the sequence CT.

18. The nanoparticle according to any one of claims 13-17, wherein the siRNA comprises an antisense strand consisting of a sequence of SEQ ID NO: 19.

19. The nanoparticle according to claim 16, wherein the antisense strand consists of- a sequence consisting of 19 nucleotides at least 89%, at least 94%, or 100% identical to a sequence of SEQ ID NO: 24; and- a 3'overhang consisting of the sequence TG.

20. The nanoparticle according to any one of claims 13-16 or 19, wherein the siRNA comprises an antisense strand consisting of a sequence of SEQ ID NO: 25.

21. The nanoparticle according to any one of claims 1-11, wherein the oligonucleotide is a single-stranded oligonucleotide; and particularly wherein the oligonucleotide is an antisense oligonucleotide.

22. The nanoparticle according to any one of claims 1-21, wherein L3 is independently selected from the group consisting of alkylene, alkenylene, heteroalkylene, heteroalkenylene, arylene, and heteroarylene.

23. The nanoparticle according to claim 22, wherein L3 is alkylene.

24. The nanoparticle according to any one of claims 1-23, which comprises at least one poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a moiety having a zwitterionic polymer of formula (II).

25. The nanoparticle according to any one of claims 1-24, wherein the nanoparticle comprises at least one poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a nitric oxide donor moiety, and at least one poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a cell-targeting moiety; and, when present, comprises at least one poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof comprising a moiety having a zwitterionic polymer of formula (II).

26. The nanoparticle according to any one of claims 1-25, wherein at least 20% of the R3 groups of the nanoparticle are selected from the group consisting of a NO donor moiety, a cell-targeting moiety, a moiety having a zwitterionic polymer of formula (II), or combinations thereof.

27. The nanoparticle according to any one of claims 1-26, wherein from 30 to 70% of the R3 groups of the nanoparticle are NO donor moieties, from 0.5 to 25% of the R3 groups are cell-targeting moieties; or alternatively, from 30 to 70% of the R3 groups are NO donor moieties, from 0.5 to 25% of the R3 groups are cell-targeting moieties, and from 20 to 70% of the R3 groups are moieties having a zwitterionic polymer of formula (II).

28. The nanoparticle according to any one of claims 1-27, wherein the NO donor moiety is an organic nitrate of formula -O(CO)-(CH2)f-ONO2, wherein f is 5.

29. The nanoparticle according to any one of claims 1-28, wherein the cell-targeting moiety is a liver-targeting moiety.

30. The nanoparticle according to any one of claims 1-29, wherein the liver-targeting moiety is retinol.

31. The nanoparticle according to any one of claims 1-30, wherein the or each oligopeptide comprises from 2 to 20 amino acid residues selected from lysine, arginine, and histidine; and, optionally, a cysteine residue.

32. The nanoparticle according to any one of claims 1-31, wherein the or each oligopeptide is of sequence of SEQ ID NO: 13, and is bond to the poly(beta-aminoester) polymer of formula (V) or a pharmaceutically acceptable salt thereof through the sulfur of the C residue.

33. A pharmaceutical composition comprising a therapeutically effective amount of the nanoparticle as defined in any one of the claims 1-32, together with one or more pharmaceutically acceptable excipients or carriers.

34. The nanoparticle as defined in any one of the claims 1-33 or the pharmaceutical composition as defined in claim 31 for use in therapy.

35. The nanoparticle or the pharmaceutical composition for use in therapy according to claim 34, for use in the treatment of a liver diseases selected from the group consisting of hepatocarcinoma, liver steatosis, liver fibrosis, MASH, and MASLD.

36. The nanoparticle or the pharmaceutical composition for use in therapy according to claim 35, for use in the treatment of liver steatosis.

Images