Direct in vivo gene editing of lung stem cells for durable therapy of genetic lung disease

Abstract

Described herein are compositions and methods for potent and long-lasting gene editing in a cell. The gene editing may result in an increase in function of a gene product. The cell can be of a particular cell type, such as a basal cell, a ciliated cell, or a secretory cell. In some cases, the cell can be a lung cell of a particular cell type. The presently disclosed compositions comprise a lipid composition, which can comprise an ionizable cationic lipid, a sterol, a phospholipid, and a selective organ targeting lipid. Also described herein are methods for treating a disease or disorder, such as a lung disease or disorder, involving the presently disclosed compositions.

Description

DESCRIPTIONDIRECT IN VIVO GENE EDITING OF LUNG STEM CELLS FOR DURABLETHERAPY OF GENETIC LUNG DISEASE

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 661,013, filed on June 17, 2024, the entire contents of which are hereby incorporated by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH ORDEVELOPMENT

[0002] This invention was made with government support under contract number R01 EB025192-01A1 awarded by the National Institutes of Health National Institute of Biomedical Imaging and Bioengineering. The government has certain rights in the invention.REFERENCE TO A SEQUENCE LISTING

[0003] This application contains a Sequence Listing XML, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said Sequence Listing XML, created on June 17, 2025, is named UTFDP4298WO.xml and is 16,611 bytes in size.BACKGROUNDField

[0004] The present invention relates generally to the fields of nucleic acid delivery compositions. For example, in certain aspects, it relates to compositions formulated for delivery of a combination of mRNA and sgRNA nucleic acids comprising a lipid nanoparticle comprising at least one ionizable lipid; wherein the nucleic acids are encapsulated within the lipid nanoparticle. For another example, more particularly, it relates to lipid nanoparticle compositions for delivery of such combinations for the treatment of diseases or disorders.2. Description of Related Art

[0005] Gene editing is anticipated to revolutionize the field of medicine by creating durable therapies across a wide spectrum of diseases (Wang & Doudna, 2023; Ran et al., 2013; Hodges & Conlon, 2019). Direct delivery of gene editors to target cells using synthetic nanoparticle- or virus-based systems could facilitate efficient and precise gene editingdirectly within the patient's body, bypassing the complexities, risks, and costs associated with ex vivo procedures (Hajj & Whitehead, 2017; Wei et al., 2020; Mitchell et al., 2021; Raguram et al., 2022). Although progress has been made targeting differentiated cells such as hepatocytes (Gillmore et al., 2021) and T cells (Rurik et al., 2022), nanoparticle delivery of gene editors to stem cells in vivo has remained elusive. Achieving durable therapeutic responses likely requires editing in tissue-resident stem cells to overcome the loss of corrected DNA in differentiated cells that regularly turnover (Hodges & Conlon, 2019; Xu et al., 2017).

[0006] Genetic lung diseases constitute a large unmet medical need (King et al., 2020; Suzuki et al., 2020) that could be addressed by corrective strategies if major delivery challenges were overcome. Effective delivery vehicles must protect mRNA encoding genome editors from degradation, achieve cell-targeted delivery, minimize off-target editing, and overcome physiological barriers including mucus, macrophages, and endothelial tissues (McCarron et al., 2023). More than a billion doses of lipid nanoparticle (LNP)-mRNA COVID-19 vaccines have been administered intramuscularly worldwide, demonstrating high safety and efficacy sustained through repeatable dosing (Polack et al., 2020; Baden et al., 2020). Treatment of genetic lung diseases, including cystic fibrosis (CF), would benefit from direct intravenous (IV) LNP delivery to bypass formidable local intratracheal (Li et al., 2023) and inhalation (Patel et al., 2019) barriers that include thick, sticky mucus (Ratjen et al., 2015) and poor access to stem cells at the base of the epithelium. Yet, LNPs predominantly accumulate in the liver when administered IV, which hampers extrahepatic therapeutic utility (Dilliard & Siegwart, 2023).

[0007] Gene editing technologies, including CRISPR / Cas, represent a revolutionary approach for gene correction that if successfully developed to correct CFTR mutations would be a transformative advance resulting in long lasting therapies for CF patients, including those with loss-of-function mutations. A key bottleneck is the lack of delivery strategies required to enable targeted editing in specific cells, especially cells in the lungs. To date, successful in vivo editing has been mediated mainly by viral vectors, which present challenges for clinical translation due to potential immunogenicity, concerns about rare but dangerous integration events, and inability to re-dose. Non-viral lipid nanoparticle (LNP) delivery offers advantages in those respects, but advances have to date been limited to targets in the liver.

[0008] Therefore, there remains an outstanding need for compositions and methods for achieving effective and durable therapeutic responses that overcome the above-mentioned difficulties faced by technologies known in the art.SUMMARY

[0009] In some aspects, the present disclosure relates to compositions that may be used to deliver gene editing compositions to lung cells such as lung stem cells. These compositions may result in long term editing of the genome of these lung cells. These compositions may result in editing for at least 1 week, at least 1 month, at least 3 month, at least 6 months, or more than 1 year.

[0010] In one aspect, the present disclosure provides compositions comprising:(A) a lipid nanoparticle comprising:(1) an ionizable cationic lipid;(2) a sterol;(3) a phospholipid;(4) a polymer conjugated lipid; and(5) a permanently cationic lipid; wherein the lipid nanoparticle comprises a molar ratio of the permanently cationic lipid from about 32 to about 42.5 relative to the entire lipid nanoparticle; and(B) a nucleic acid composition comprising:(1) a mRNA; and(2) a single guide RNA encoding for a gene expressed in lung cells; wherein the nucleic acid composition is encapsulated in the lipid nanoparticle.

[0011] In some embodiments, the composition comprises a molar ratio of the ionizable cationic lipid from about 18 to about 26. In further embodiments, the molar ratio of the ionizable cationic lipid is from about 20 to about 24. In still further embodiments, the composition comprises a molar ratio of the sterol from about 8 to about 16.

[0012] In some embodiments the molar ratio of the sterol is from about 10 to about 14. In some embodiments, the composition comprises a molar ratio of the phospholipid from about 8 to about 16. In further embodiments, the molar ratio of the phospholipid is from about 10 to about 14. In some embodiments, the composition comprises a molar ratio of the polymer conjugated lipid from about 0.5 to about 8. In further embodiments, the molar ratio of the polymer conjugated lipid is from about 2 to about 6. In some embodiments, the molar ratio of the permanently cationic lipid is from about 38 to about 42.

[0013] In some embodiments, the ionizable cationic lipid is a dendron. In some embodiments, the ionizable cationic lipid is a compound of the formula:or a pharmaceutically acceptable salt thereof, wherein: (a) the core comprises a structural formula (XCore):, wherein: Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or - CR3aR3b-; R2is independently at each occurrence R1gor -L2-NR1eR1f; R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted alkyl; R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted alkyl; L0, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene]-[heterocycloalkyl]- [alkylene], [alkylene]-(arylene)-[alkylene] (e.g., [alkylene]-phenylene- [alkylene]), heterocycloalkyl, and arylene; or, alternatively, part of L1form a heterocycloalkyl with one of R1cand R1d; and x1is 0, 1, 2, 3, 4, 5, or 6; and (b) each branch of the plurality (N) of branches independently comprises a structural formula (XBranch):wherein: * indicates a point of attachment of the branch to the core; g is 1, 2, 3, or 4; Z = 2(g-1); G=0, when g=1; or when g≠1;(c) each diacyl group independently comprises a structural formula, wherein: * indicates a point of attachment of the diacyl group at the proximal end thereof; ** indicates a point of attachment of the diacyl group at the distal end thereof; Y3is independently at each occurrence an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene; A1and A2are each independently at each occurrence -O-, -S-, or -NR4-, wherein: R4is hydrogen or optionally substituted alkyl; m1and m2are each independently at each occurrence 1, 2, or 3; and R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted alkyl; and (d) each linker group independently comprises a structural formula, wherein: ** indicates a point of attachment of the linker to a proximal diacyl group; *** indicates a point of attachment of the linker to a distal diacyl group; and Y1is independently at each occurrence an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene; and (e) each terminating group is independently selected from optionally substituted alkylthiol, and optionally substituted alkenylthiol.

[0014] In some embodiments, the ionizable cationic lipid is a compound selected from:,,or pharmaceutically acceptable salts thereof.

[0015] In some emdodiments, the phospholipid comprises one or two long chain alkyl or alkenyl groups, a glycerol or a sphingosine, one or two phosphate groups, and a small organic molecule, wherein the small organic molecule is an amino acid, a sugar, or an amino substituted alkoxy group.

[0016] In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC) or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).In some embodiments, the sterol is cholesterol. In some embodiments, the polymer conjugated lipid is a PEG conjugated lipid. In some embodiments, polymer conjugated lipid comprises a polyethylene glycol (PEG) component from about 1000 to about 10,000 daltons. In some embodiments, the polymer conjugated lipid is a PEGylated diacylglycerol.

[0017] In further embodiments, the polymer conjugated lipid is further defined by the formula:wherein: R12and R13are each independently alkyl(C≤24), alkenyl(C≤24), or a substituted version of either of these groups; Reis hydrogen, alkyl(C≤8), or substituted alkyl(C≤8); andx is 1-250.

[0018] In some embodiments, the permanently cationic lipid is further defined as:wherein: R1and R2are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; R3, R3′, and R3′′ are each independently alkyl(C≤6)or substituted alkyl(C≤6); X−is a monovalent anion.

[0019] In further embodiments, the permanently cationic lipid is further defined as:wherein: R4and R4′ are each independently alkyl(C6-C24), alkenyl(C6-C24), or a substituted version of either group; R4′′ is alkyl(C≤24), alkenyl(C≤24), or a substituted version of either group; R4′′′ is alkyl(C1-C8), alkenyl(C2-C8), or a substituted version of either group; and X2is a monovalent anion.

[0020] In some embodiments, the mRNA encodes for a Cre recombinase. In some embodiments, the mRNA encodes for Cas9. In some embodiments, the mRNA encodes for an adenine base editor. In some embodiments the sgRNA encodes for a gene that is defective in a disease state, such as a lung disease. In some embodiments, the sgRNA encodes for a gene associated with a genetic lung disease. In some embodiments, the sgRNA encodes for a wild type version of the gene that is defective in the disease state.

[0021] In some embodiments, the composition is further defined as a composition comprising: (1) an ionizable cationic lipid; wherein the ionizable cationic lipid is a dendron having a core comprising the following structure:and a terminal group comprising an alkyl chain of 8 carbon atoms; and is present in a molar ratio from about 21 to about 22; (2) a sterol; wherein the sterol is cholesterol and is present in a molar ratio from about 23 to about 25; (3) a phospholipid; wherein the phospholipid is 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE) and is present in a molar ratio from about 11 to about 13; (4) a polymer conjugated lipid; wherein the polymer conjugated lipid is DMG-PEG and is present in a molar ratio from about 3 to about 5; and (5) a permanently cationic lipid; wherein the permanently cationic lipid is DOTAP and is present in the molar ratio from about 38 to about 42; and (B) a nucleic acid composition comprising: (1) a mRNA; wherein the mRNA encodes for an adenine base editor; and (2) a single guide RNA encoding for a wild type gene expressed in lung cells; wherein the nucleic acid composition is encapsulated in the lipid nanoparticle.

[0022] In another aspect, the present disclosure provides methods of editing the genome of a lung stem cell comprising contacting the lung stem cell with a composition according to any one of the embodiments provided above in a therapeutically effective amount. In some embodiments, the genome of the lung stem cell contains a gene with a mutation that causes a disease state. In some embodiments, the method results in the editing of the genome to the wild type gene. In some embodiments, the method results in the editing of the genome to result in a gene product that contains at least 25% of the activity of the wild type gene product. In further embodiments, the gene product contains at least 50% of the activity of the wild type gene product. In some embodiments, the gene product has the same activity as the wild type gene product. In some embodiments, the method results in the editing of at least 20% of the lung stem cells after 120 days. In some embodiments, at least 50% of the lung stem cells were edited. In some embodiments, the method results in the editing of one ormore other lung cells. In further embodiments, the one or more other lung cells are endothelial cells, epithelial cells, immune cells, alveolar type 1 cells, alveolar type 2 cells, goblet cells, ciliated cells, club cells, and ionocytes. In some embodiments, at least 20% of the one or more lung cells are edited. In further embodiments, at least 50% of the one or more lung cells are edited. In some embodiments, the lung stem cells are editing in vivo. In some embodiments, the editing of the genome results in an edited genome that is present after 30 days. In further embodiments, the edited genome is present after 90 days. In still further embodiments, the edited genome is present after 1 year. In some embodiments, the lung stem cell is a lung basal cell.

[0023] In some embodiments, the method may be used to treat a disease or disorder in vivo. In some embodiments, the disease or disorder is a genetic disease or disorder. In some embodiments, the disease or disorder is a genetic lung disease or disorder. In some embodiments, the method edits the genome of a lung stem cell in a patient. In some embodiments, the patient is a mammal. In further embodiments, the mammal is a human.

[0024] In another aspect, the present disclosure provides methods of inducing a permanent change in the genome of a lung cell comprising contacting the lung cell with a composition according to any one of the embodiments disclosed above in a therapeutically effective amount. In some embodiments, the lung cell is a lung stem cell. In some embodiments, the method induces a permanent change in the genome of one or more other lung cells. In some embodiments, the one or more other lung cells are endothelial cells, epithelial cells, immune cells, alveolar type 1 cells, alveolar type 2 cells, goblet cells, ciliated cells, club cells, and ionocytes. In some embodiments, the permanent change in the genome of the lung cell is retained for at least 30 days. In further embodiments, the permanent change is retained for at least 60 days. In still embodiments, the permanent change is retained for at least 90 days. In even further embodiments, the permanent change is retained for at least one year. In some embodiments, at least 20% of the lung cells have been edited. In further embodiments, at least 40% of the lung cells have been edited. In still further embodiments, at least 60% of the lung cells have been edited. In yet further embodiments, at least 80% of the lung cells have been edited. In some embodiments, the change in the genome of the lung cell results in the increase of function of one or more gene products relative to the wild type gene product. In some embodiments, the change in the genome of the lung cell results in an increase in function of one or more gene products of at least 20%. In some embodiments, the change in the genome of the lung cell results in an increase in function of one or more gene products ofat least 40%. In some embodiments, the change in the genome of the lung cell results in an increase in function of one or more gene products of at least 80%.

[0025] In some embodiments, the methods result in no measurable change in the function of one or more other tissue types. In some embodiments, the one or more other tissue types is liver, heart, spleen, or kidney.

[0026] In still yet another aspect, the present disclosure provides methods of treating a lung disease or disorder in a patient in need thereof comprising contacting the patient with a therapeutically effective amount of a composition described herein.

[0027] In some embodiments, the lung disease or disorder is a genetic lung disease or disorder. In some embodiments, the genetic lung disease or disorder is associated with gene that results in a non-functional gene product. In some embodiments, the lung disease or disorder is cystic fibrosis. In some embodiments, the gene product is cystic fibrosis transmembrane conductance regulator. In some embodiments, the lung disease or disorder is a cancer of the lungs, bronchi, pharynx, trachea, sinus, larynx, bronchiole, or nose. In some embodiments, the lung disease or disorder is hereditary emphysema or chronic obstructive pulmonary disease (COPD). In some embodiments, the lung disease or disorder is pulmonary fibrosis, alpha-1 antitrypsin deficiency, sarcoidosis, pulmonary arterial hypertension, lymphangioleiomyomatosis, familial interstitial pneumonia, pleiotropic clinical presentation, including Hermansky-Pudlak syndrome, neurofibromatosis, tuberous sclerosis, Niemann-Pick disease, Gaucher disease, familial hypocalciuric hypercalcemia, familial SP-C mutation, or dyskeratosis congenita. In some embodiments, the patient is a mammal such as a human.

[0028] In another aspect, the present disclosure provides methods of treating a genetic lung disease or disorder in a patient in need thereof comprising contacting the patient with a therapeutically effective amount of a composition described herein. In some embodiments, the genetic lung disease or disorder is cystic fibrosis, hereditary emphysema, or chronic obstructive pulmonary disease (COPD). In some embodiments, the genetic lung disease or disorder is cystic fibrosis. In some embodiments, the patient in need thereof has a CFTR mutation selected from the group consisting of ΔF508, G542X, N1303K, W1282X, E56K, G178R, S549R, K1060T, G1244E, P67L, E193K, G551D, A1067T, S1251N, R74W, L206W, G551S, G1069R, S1255P, D110E, R347H, D579G, R1070Q, D1270N, D110H, R352Q, S945L, R1070W, G1349D, R117C, A455E, S977F, F1074L, R117H, S549N, F1052V, and D1152H. In some embodiments, the mutation is ΔF508, G542X, G551D, N1303K, or W1282X.

[0029] In still yet another aspect, the present disclosure provides methods of treating cystic fibrosis in a patient in need thereof comprising contacting the patient with a therapeutically effective amount of a composition described herein.

[0030] In some embodiments, the methods comprise further administering one or more additional therapeutic agents. In some embodiments, the composition has been administered once. In some embodiments, the composition has been administered two or more times.

[0031] In another aspect, the present disclosure provides methods of increasing the function of a cystic fibrosis transmembrane conductance regulator (CFTR) in a patient comprising administering to the patient a therapeutically effective amount of a composition described herein.

[0032] In yet another aspect, the present disclosure provides methods of editing the genome of a lung cell to correct a mutation in the gene that encodes for the cystic fibrosis transmembrane conductance regulator (CFTR) protein in a patient comprising administering to the patient a therapeutically effective amount of a composition described herein.

[0033] In still yet another aspect, the present disclosure provides methods of editing a genome of a cell with one or two copies of a gene that encodes for a defective cystic fibrosis transmembrane conductance regulator (CFTR) protein in a patient comprising administering to the patient a therapeutically effective amount of a composition described herein, wherein the therapeutic effective amount results in the change in the genome of the cell to a functional cystic fibrosis transmembrane conductance regulator (CFTR) protein.

[0034] The terms “comprise” (and any form of comprise, such as “comprises” and “comprising”), “have” (and any form of have, such as “has” and “having”), “contain” (and any form of contain, such as “contains” and “containing”), and “include” (and any form of include, such as “includes” and “including”) are open-ended linking verbs. As a result, a method, composition, kit, or system that “comprises,” “has,” “contains,” or “includes” one or more recited steps or elements possesses those recited steps or elements, but is not limited to possessing only those steps or elements; it may possess (i.e., cover) elements or steps that are not recited. Likewise, an element of a method, composition, kit, or system that “comprises,” “has,” “contains,” or “includes” one or more recited features possesses those features, but is not limited to possessing only those features; it may possess features that are not recited.

[0035] Any embodiment of any of the present methods, composition, kit, and systems may consist of or consist essentially of—rather than comprise / include / contain / have—the described steps and / or features. Thus, in any of the claims, the term “consisting of” or “consisting essentially of” may be substituted for any of the open-ended linking verbs recitedabove, in order to change the scope of a given claim from what it would otherwise be using the open-ended linking verb.

[0036] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.”

[0037] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. Note that simply because a particular compound is ascribed to one particular generic formula doesn’t mean that it cannot also belong to another generic formula.BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0039] FIGS. 1A-1K show that direct in vivo gene editing was achieved in mouse lungs and persisted for one year. (FIG. 1A) Schematic representation of LNP-mediated gene editor delivery into lung cells after systemic administration. (FIG. 1B) Diagram showing the experimental procedure used to evaluate the efficiency of lung cell editing in Ai14 tdTom reporter mice, in which Cre recombinase can excise the loxP flanked stop cassette, thereby enabling fluorescent tdTom protein expression. Mice were injected with LNP-Cre at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio) with two sequential doses, 48 hours apart. Mice treated with PBS were used as negative control. (FIG. 1C) Ex vivo fluorescence imaging analyses of mouse lungs 2, 7, 21, 42, 60, 120, 180, 360, and 660 days after the last injection. Quantitative analysis of ex vivo lung images was shown as average radiance (FIG. 1D) and as total flux (FIG. 1E). Time-course flow cytometry analyses showing the percentage of tdTom-positive (tdTOM+) cells reported among (FIG.1F) lung cells, (FIG. 1G) endothelial cells, (FIG. 1H) immune cells, (FIG. 1I) epithelial cells, (FIG. 1J) NGFR+stem cells, and (FIG. 1K) KRT5+stem cells. Data are mean + / - SEM (n = 3 biologically independent replicates) for treated groups.

[0040] FIG. 2 illustrates the flow cytometry gating strategy for lung endothelial, epithelial, and immune cells. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) total lung cells, endothelial cells (CD31 positive), epithelial cells (EpCAM positive), or immune cells (CD45 positive) expressing tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3).

[0041] FIG. 3 illustrates the flow cytometry gating strategy for lung stem cells. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung stem cells (EpCAM positive, NGFR positive) and lung stem cells (EpCAM positive, KRT5 or CK5 positive) expressing tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3).

[0042] FIGS. 4A-4H provide evidence of durable in vivo gene editing in mouse lung with LNP-Cas9 of the present disclosure. (FIG. 4A) Schematic representation of experimentalprocedure used to evaluate the efficiency of lung cell editing in Ai14 tdTomato reporter mice, in which Cas9 / sgTOM1 can delete the stop cassette enabling tdTomato fluoresce protein expression. (FIG.4B) The location of sgTOM1 on the stop cassette. Lung SORT LNPs were used to co-deliver Cas9 mRNA and sgTOM1 (LNP-Cas9). Mice were intravenously injected with LNP-Cas9 at 2 mg / kg total RNA (Cas9 mRNA: sgTOM1=2:1, wt / wt; total lipid to total RNA=20:1, wt / wt) with three sequential doses, one week apart. Mice treated with PBS was used as negative control. Time-course flow cytometry analyses 7, 21, 60, and 240 days after the last injection showing the percentage of tdTomato-positivie (tdTom+) cell was reported among (FIG. 4C) total lung cells, (FIG. 4D) lung endothelial cells, (FIG.4E) lung immune cells, (FIG. 4F) lung epithelial cells, (FIG. 4G) NGFR+lung stem cells, and (FIG. 4H) KRT5+lung stem cells. Similar to the result of Cre editing, tdTom+cells retained persistent expression across the lungs including 38.7% of endothelial cells, 32.5% of epithelial cells, 6.1% of immune cells, 16.7% of NGFR+lung stem cells, and 7.2% of KRT5+lung stem cells for up to 240 days. Data are presented as individual data points or mean + / - SEM, (n = 3 biologically independent replicates).

[0043] FIGS. 5A-5E provide evidence that minimal toxicity was observed after LNP-Cas9 treatments. In vivo toxicity of Lung SORT LNPs were evaluated by measuring liver function parameters, ALT (FIG.5A) and AST (FIG.5B) and kidney function parameters, BUN (FIG. 5C) and CREA (FIG.5D) in mouse serum 7, 21, 60, 120, and 240 days after three sequential doses of LNP-Cas9, one week apart (2 mg / kg total RNA, i.v., total lipid / total RNA=20:1) (n = 3 biologically independent replicates). PBS-treated mice were used as a negative control. Data are presented as individual data points or mean + / - SEM. (FIG. 5E) Histopathology evaluation was performed by H&E staining of heart and spleen tissues 7, 60, and 120 days after LNP-Cas9 treatment. PBS-treated mice were used as a negative control. Scale bar: 100 µm.

[0044] FIGS. 6A-6G show Lung SORT LNP-mediated editing in tracheal and bronchus regions. To examine whether Lung SORT LNPs facilitate mRNA delivery to the tracheal region of the lung and enable cell editing, LNP-Cre were intravenously administered to Ai14 mice in two successive doses, each being 2 mg / kg total RNA, 48 hours apart. (FIG.6A) The tracheas and bronchus regions were extracted 48 hours following the final injection, and tdTom expression (tdTom+) across various cell types was quantified using flow cytometry. The composition of cells markedly differed between the trachea and bronchus regions of the lung. The trachea harbored more immune cells (55.8%) and fewer epithelial (13.7%) and endothelial cells (8.4%) compared to the bronchus (35.4% immune cells, 28.7% epithelialcells, and 23.5% endothelial cells). Percentages of total edited cells (FIG. 6B), endothelial cells (FIG.6C), immune cells (FIG.6D), epithelial cells (FIG.6E), NGFR+stem cells (FIG. 6F), and KRT5+stem cells (FIG. 6G) in the trachea compared to the bronchus region. Data are presented as mean + / - SEM in FIG.6B-6G (n = 5 biologically independent replicates).

[0045] FIGS. 7A & 7B show gene editing in endothelial beds of various organs with LNP- Cre. LNP-Cre was intravenously administered to Ai14 mice in two successive doses, 2 mg / kg total RNA, 48 hours apart. tdTom expression (tdTom+) across CD31+endothelial beds of various organs (FIG.7A) and total cells of various organs (FIG.7B) were quantified by flow cytometry. Tested organs include heart, lung, liver, spleen, kidney, pancreas, stomach, duodenum, jejunum, ileum, cecum, colon, and rectum. PBS-treated mice were used as negative control. Data are presented as mean + / - SEM (n = 3 independent replicates).

[0046] FIGS. 8A-8B show Lung SORT LNP-mediated editing in lung immune cells. To study whether Lung SORT LNPs facilitate efficient mRNA delivery to various lung immune cells, LNP-Cre were intravenously administered to Ai14 mice in two successive doses, each being 2 mg / kg total RNA, 48 hours apart. (FIG. 8A) Flow cytometry gating strategy for various lung immune cells. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung immune cells (CD45 positive) including B cells (B220 positive), CD4 T cells (CD3 positive CD4 positive), CD8 T cells (CD3 positive CD8 positive), dendritic cells (CD11c positive), neutrophils (Ly-6G positive) and macrophages (F4 / 80 positive) were analyzed by flow cytometry to evaluate tdTomato expression level (tdTomato positive). PBS treated mice were served as negative control. (FIG. 8B) The results showed that 22.6% of neutrophils, 41.7% of macrophage, 32.4% of dendritic cells, 14.9% B cells, 14.9% CD4+T cells and 14.5% of CD8+T cells were edited. Data are presented as mean + / - SEM (n=3 biologically independent replicates).

[0047] FIGS. 9A-9D show data related to Lung SORT LNP-mediated editing in P. aeruginosa infected mouse lungs. To examine whether Lung SORT LNPs retain high delivery efficacy in infected and inflamed lungs, Ai14 mice were randomly allocated to P. aeruginosa infection group or non-infection group. (FIG. 9A) Mice in infection group were inoculated intranasally with 50 μl of P. aeruginosa at 3.5 x 105 CFU to generate acute infection model. LNP-Cre were intravenously administered to Ai14 mice, 2 mg / kg total RNA, 9 h post infection. Neutrophil invasion was observed in infected lungs 9 h after the intranasal infection compared to non-infected lungs (FIG. 9B). VtnR abundance (FIG. 9C) and tdTom expression (tdTom+) across various cell types in infected and non-infected mouse lung (FIG. 9D) were measured using flow cytometry. No significant difference was observed in VtnRabundance and editing efficiency among various tested lung cell types except immune cells between infected and non-infected lungs. PBS-treated infected mice were used as negative control. Data are presented as mean + / - SEM (n = 3 independent replicates), Unpaired t-test. P values < 0.05 were considered statistically significant.

[0048] FIGS. 10A-10B show gene editing in mouse lung endothelial progenitor cells with LNP-Cre. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs were collected at 2, 7, 21, 42, 60, 120, 180, 270, 360, and 660 days after the last injection. (FIG. 10A) Flow cytometry gating strategy for lung endothelial progenitor cells. Single cells prepared from Ai14 mouse lungs inclusive of tracheas were gated. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung endothelial progenitor cells (CD45 negative, CD31 positive, CD157 positive) expressing tdTomato fluorescence (tdTomato positive) were analyzed by flow cytometry. (FIG. 10B) Gene editing in mouse lung hematopoietic lung endothelial progenitor cells were obtained from three mice per each time point. PBS treated mice were served as negative control. Data are presented as individual data points or mean + / - SEM (n=3 biologically independent replicates).

[0049] FIGS. 11A-11C show evidence of gene editing in mouse lung hematopoietic progenitor cells with LNP-Cre. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs inclusive of tracheas were collected at 2, 7, 21, 42, 60, 120, 180, 270, 360, and 660 days after the last injection. (FIG. 11A) Flow cytometry gating strategy for lung hematopoietic progenitor cells. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung multipotent progenitor cells (lineage negative, CD45 positive, Sca1 negative, c-kit positive) or lung hematopoietic stem cells (lineage negative, CD45 positive, Sca1 positive, c-kit positive) expressing tdTomato fluorescence (tdTomato positive) were analyzed by flow cytometry. Gene editing in mouse lung hematopoietic lung multipotent progenitor cells (FIG. 11B) and lung hematopoietic stem cells (FIG. 11C) were obtained from three mice per each time point. PBS treated mice were served as negative control. Data are presented as individual data points or mean + / - SEM (n=3 biologically independent replicates).

[0050] FIGS. 12A-12K demonstrate that Lung SORT LNPs mediated efficient delivery into diverse lung cells types with enhanced delivery to vitronectin receptor-expressing cells. (FIG. 12A) Representative immunofluorescence images of lung sections from LNP-Cre- treated Ai14 reporter mice (2, 7, 60, 120, 270, and 360 days post-treatment) to assess LNP-mediated editing in mature lung epithelial cells (HOPX for AT1 cells, ABCA3 for AT2 cells, MUC5AC for goblet cells, tubulin for ciliated cells, and SCGB1A1 for club cells). PBS- treated mice served as negative controls. Scale bar = 30 μm. Markers (white); tdTom (red); nuclei (blue). (FIG. 12B) Quantification of LNP-Cre-mediated editing in mature lung epithelium based on immunofluorescence images. Results were obtained from 5-6 random segments per whole slide. Data presented as mean + / - SEM. Representative whole slide immunofluorescence images from PBS-treated (FIG.12C) and LNP-Cre-treated (FIG.12D) mice; DAPI (blue), tdTom (red). Scale bar = 1 mm. (FIG. 12E) Representative tissuecyte image of a LNP-Cre-treated mouse's lung whole left lobe. Scale bar = 1 mm. VtnR (CD51+CD61+) abundance (FIG. 12F) and quantification of tdTom positivity in VtnR+(CD51+CD61+) cells and VtnR- (CD51-CD61-) fraction in lung endothelial cells (FIG.12G), immune cells (FIG. 12H), epithelial cells (FIG. 12I), NGFR+cells (FIG. 12J), and KRT5+stem cells (FIG. 12K). Data are mean + / - SEM (n = 3 biologically independent replicates). Unpaired t-test. P values < 0.05 were considered statistically significant.

[0051] FIGS. 13A & 13B show the gene editing and persistence of gene editing in mouse lung ionocytes following systemic LNP-Cre administration. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs were collected 2 days and 660 days after the last injection. (A) Flow cytometry gating strategy for lung ionocytes. (FIG. 13A) FOXI1 positive lung ionocytes were gated and analyzed for the expression of tdtomato fluorescence. (FIG. 13B) Editing levels, correlated with tdtomato expression in mouse lung ionocytes, were measured from three mice at each time point. PBS treated mice served as the negative control. Data are presented as mean + / - SEM (n=3 biologically independent replicates).

[0052] FIGS. 14A & 14B show the quantitative TissueCyte analysis of mTmG mice lung following LNP-Cre treatment. (FIG. 14A) Schematic representation of LNP-Cre mediated eGFP fluorescence protein expression replacing the red fluorescence in lung cells after systemic administrations. A mouse was injected intravenously with a single LNP-Cre treatment at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The mouse lung was collected two days after the injection. PBS-treated mTmG mouse was used as negative control. (FIG.14B) Quantitative analysis of GFP positive (GFP+) area % in LNP-Cre treated mTmG mouse lung left lobe by TissueCyte 3D imaging and analysis. Data are presented as individual data points (n=1).

[0053] FIGS. 15A & 15B show the protein corona composition adsorbed onto Lung SORT LNP surface determined by unbiased mass spectrometry proteomics. The most abundantproteins were ranked and plotted as a heat map (FIG. 15A) and classified into physiological classes of the identified proteins (FIG.15B).

[0054] FIGS. 16A-16D provide evidence that vitronectin regulates SORT and non-SORT LNP efficacy in vitronectin receptor (VtnR) expressing cells in vitro. (FIG.16A) SORT and non-SORT LNPs (DLin-MC3-DMA LNPs) were preincubated with 0.25 g Vtn / g lipid prior to treating Vtn-negative liver cancer cells (Huh-7), Vtn-expressing kidney cancer cells (A- 498), and Vtn-expressing human lung epithelial (16HBE14o-) cells to measure functional mRNA delivery (bioluminescence). (FIG. 16B) The activity of functional luciferase translated from mRNA delivered by uncoated LNPs (labeled “-”) or Vtn-coated LNPs (labeled “+”) in relevant cell lines (25 ng mRNA, 24 h, n = 4). (FIG. 16C) Cells were saturated with 0.2 μg Vtn / mL prior to treatment with Vtn-coated SORT and non-SORT LNPs (which do not bind Vtn) to assess functional mRNA delivery (bioluminescence). (FIG. 16D) The activity of functional luciferase translated from mRNA delivered by Vtn-coated LNPs in cells with or without Vtn saturation. (25 ng mRNA, 24 h, n = 4). Statistical significance was determined using an unpaired t test. P values < 0.05 were considered statistically significant. Data are shown as mean + / - SEM.

[0055] FIG. 17 shows the flow cytometry gating strategy for vitronectin receptor. Single cells prepared from Ai14 mouse organs were gated. Viable (Ghost Red negative) total cells, vitronectin receptor expressing (CD51 positive CD61 positive) endothelial cells (CD31 positive), immune cells (CD45 positive), epithelial cells (EpCAM positive), lung stem cells (EpCAM positive NGFR positive or EpCAM positive KRT5 positive) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3).

[0056] FIGS. 18A & 18B provides data related to LNP delivery in VtnR-expressing lung endothelial cells, lung multipotent progenitor cells, and lung hematopoietic stem cells. VtnR (CD51+CD61+) abundance (FIG. 18A) and quantification of tdTom positivity in VtnR+(CD51+CD61+) cells and VtnR- (CD51-CD61-) fraction in lung endothelial cells, lung multipotent progenitor cells, and lung hematopoietic stem cells (FIG. 18B). Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs were collected 2 days after the last injection. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) total lung cells, vitronectin receptor expressing (CD51 positive CD61 positive) endothelial progenitor cells (CD31 positive CD157 positive), lung resident multipotent immune progenitor cells (lineage negative, CD45 positive, Sca1 negative, c-kit positive), or lung resident hematopoietic stem cells (lineage negative, CD45 positive, Sca1 positive, c-kitpositive) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry. Lung endothelial cells (22.4%), lung multipotent progenitor cells (22.5%), and lung hematopoietic stem cells (38.6%) all exhibit high levels of VtnR expression. Lung SORT LNPs transfect a very high fraction of endothelial and lung hematopoietic stem cells, which may mask any potential contribution of VtnR versus other receptor interactions. Data are mean + / - SEM (n = 3 independent replicates).

[0057] FIGS. 19A-19C are plots profiling VtnR expression in mouse tissues and LNP delivery in VtnR-expressing lung endothelial and non-endothelial cells. VtnR (CD51+CD61+) abundance (FIG. 19A) and quantification of tdTom positivity in VtnR+(CD51+CD61+) cells and VtnR- (CD51-CD61-) fraction in endothelial cells or non-endothelial cells across various organs (FIG.19B). Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). Organs were collected 2 days after the last injection. Single cells prepared from Ai14 mouse organs were gated. Viable (Ghost Red negative) total cells, vitronectin receptor expressing (CD51 positive CD61 positive) endothelial cells (CD31 positive) or non-endothelial cells (CD31 negative) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry. Comparing to heart (3.0%), liver (2.5%), spleen (3.7%), kidney (1.1%), pancreas (1.4%), duodenum (2.2%), ovaries / testes (4.3%), lung exhibit highest level of VtnR expression (24.4%). Endothelial cells of all tested organs displayed no preference for tdTom in VtnR+or VtnR- fraction. However, in non-endothelial cell population, tdTom expression was enriched within the VtnR+fraction compared to the VtnR- fraction in heart (24.8% vs 2.9%), lung (23.3% vs 2.9%), liver (88.8% vs 52.3%), spleen (10.4% vs 4.6%) and kidney (24.6% vs 2.7%). Data are mean ± SEM (n = 3 independent replicates), unpaired t-test. P values < 0.05 were considered statistically significant.

[0058] FIGS. 20A & 20B provide evidence of efficient adenine base editing in 16HBEge R553X cells. (FIG. 20A) LNP-ABE (ABE mRNA:sgR553X=2:1 by weight, 1.5 μg total RNA per well) mediated high level base editing efficiency (>95%) in 16HBEge R553X cells at the target T7position. The A•T to G•C conversion on T7position was analyzed using EditR analysis with Sanger sequencing data. (FIG. 20B) The stoichiometry of ABE mRNA and sgR553X was investigated by measuring the editing level after transfecting 16HBEge cell using a series of LNP-ABE (0.8 μg total RNA per well) with altered ABE mRNA to sgRNA weight ratios. Data are shown as mean + / - SEM (n=2 independent samples).

[0059] FIGS. 21A-21O provide evidence that efficient adenine base editing was achieved in lung basal cells in patient-derived human bronchial epithelial (HBE) cells and CF mousemodel. (FIG. 21A) Workflow for differentiation of HBEs from a healthy donor and a CF person with CFTRR553X / F508delinto airway epithelium and base editing strategy to correct CF R553X mutation (SEQ ID NOs: 13-16). Untreated CF HBE cells were used as negative control, and HBE from a healthy donor with wild-type CFTR gene was used for comparison. (FIG.21B) LNP-ABE-mediated 60% of allelic base editing in both undifferentiated P2 (n=1) and fully differentiated P3 culture (n=4). (FIG. 21C) The frequency of desired product (the box highlighted in blue) and bystander editing was evaluated using NGS sequencing. (FIG. 21D) Efficacy of LNP-ABE with or without Trikafta in CFTR protein restoration in CFTRR553X / F508delHBE culture measured by capillary western blotting. (FIG. 21E) Band B and (FIG.21F) Band C intensities from (FIG.21D) were normalized to vinculin (20 μg / mL) as an internal standard. Data are mean  + / - SEM of n = 3 independent replicates, one-way ANOVA. P values < 0.05 were considered statistically significant. (FIG. 21G) Quantitative data for average current calculated from area under the curve (AUC) representing CFTR activity further confirmed CFTR restoration. Data are mean  + / - SEM of n = 4. one-way ANOVA. P values < 0.05 were considered statistically significant. (FIG. 21H) CFTR function in HBE culture from non-cystic fibrosis individuals who are wild type for the CFTR gene (n = 4 independent replicates). (FIG. 21I) Workflow of R553X correction in intestinal organoids using LNP-ABEs and the mechanism of forskolin-induced swelling (FIS) assay. Intestinal stem cells were isolated from R553X homozygous mice to generate intestinal organoids as an ex vivo model to evaluate CFTR function restoration following LNP-ABE treatment. Forskolin-induced CFTR activation can facilitate ion / water transportation leading to organoid swelling. No swelling was observed from untreated group (FIG. 21J), while LNP-ABE treated group (FIG. 21K) exhibited 80% of intestinal organoid swelling. Scale bar: 1000 μm. (FIG. 21M) Approximately 50% base editing was confirmed using DNA sequencing. Data are presented as mean + / - SEM of n=8 independent replicates in L and M. Unpaired t-test. P values < 0.05 were considered statistically significant. (FIG. 21N) Workflow for assessing LNP-ABE-mediated base editing in mouse lung basal cells after a single administration. CF heterozygous R553X mice were injected intravenously with LNP-ABE (1.5 mg / kg total RNA, ABE mRNA:sgR553X=2:1, weight ratio. Mice were euthanized 10 days after the injection. Whole lung tissue, trachea, and isolated lung NGFR+basal stem cells populations were used for DNA extraction, PCR amplification, and NGS sequencing. (FIG. 21O) Base editing efficiency of all adenines within the target protospacer in three lung populations (n = 4 independent replicates). Data are presented as mean + / - SEM.

[0060] FIGS. 22A & 22B show the raw data of gel images of CFTR (FIG. 22A) and Vinculin as internal standard (FIG.22B) from JessTMcapillary western blotting.

[0061] FIGS. 23A & 23B provide evidence of apical and basolateral delivery of LNP-tdTom in P3 differentiated HBE R553X / F508del cultures. Cells were then treated with 12 μg LNP- tdTom (12 μg tdTomato mRNA per well) either to the apical side in liquid bolus or to the basolateral side. Untreated HBE cells were used as control. (FIG.23A) Single cells prepared from inserts were gated. Viable (Scarlet 723 negative) basal cells (KRT5 positive), club cells (SCGB1A1 positive), goblet cells (MUC5AC positive), and ciliated cells (Acetyl-Tubulin positive) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry. (FIG. 23B) Quantitative analysis of tdTom+cells in HBE basal and differentiated cell populations (n=3). Data are shown as mean + / - SEM. Unpaired t-test. P values < 0.05 were considered statistically significant.DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0062] In one aspect, the present disclosure provides lipid nanoparticle compositions for use in the delivery of one or more of each of the following nucleic acids: (1) a mRNA and (2) a sgRNA; and a lipid nanoparticle comprising at least one ionizable cationic lipid; wherein the each of the nucleic acids are encapsulated within the lipid nanoparticle. These compositions may be used to treat diseases and disorders for which an mRNA and / or sgRNA would be useful, such as diseases or disorders associated with a mutation in one or more genes.

[0063] Provided herein are lipid compositions that facilitate successful delivery of Cre recombinase (Cre) mRNA, Cas9 mRNA / single guide RNA (sgRNA), and ABE mRNA / sgRNA to all major lung cell types, including lung stem cells. Long-term persistence of edited cells was quantified for 22 months, highlighting the durable nature of the edits, which has not been achieved by methods known in the art. Furthermore, that the degree of editing was consistently maintained across the lungs during this entire period suggests further differentiation to mature cells. The presently disclosed invention has applications for treatment of, for example, congenital diseases, such as cystic fibrosis (CF). For example, described in a section that follows is base editing mediated by presently disclosed lipid compositions to effectively correct the R553X nonsense mutation in mouse lung stem cells and restored cystic fibrosis transmembrane conductance regulator (CFTR) expression and function in organoids derived from mouse intestinal stem cells and in primary human bronchial epithelia derived from people with CF. The present disclosure supports the use of the present disclosure for creation of long-lasting therapies in, for example, genetic lung diseases. A. CRISPR Systems

[0064] Gene editing is a technology that allows for the modification of target genes within living cells. Recently, harnessing the bacterial immune system of CRISPR to perform on demand gene editing revolutionized the way scientists approach genomic editing. The Cas9 protein of the CRISPR system, which is an RNA guided DNA endonuclease, can be engineered to target new sites with relative ease by altering its guide RNA sequence. This discovery has made sequence specific gene editing functionally effective.

[0065] In general, “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g.tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), and / or other sequences and transcripts from a CRISPR locus.

[0066] The CRISPR / Cas nuclease or CRISPR / Cas nuclease system can include a non-coding RNA molecule (guide) RNA, which sequence-specifically binds to DNA, and a Cas protein (e.g., Cas9), with nuclease functionality (e.g., two nuclease domains). One or more elements of a CRISPR system can derive from a type I, type II, or type III CRISPR system, e.g., derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes.

[0067] The CRISPR system can induce double stranded breaks (DSBs) at the target site, followed by disruptions as discussed herein. In other embodiments, Cas9 variants, deemed “nickases,” are used to nick a single strand at the target site. Paired nickases can be used, e.g., to improve specificity, each directed by a pair of different gRNAs targeting sequences such that upon introduction of the nicks simultaneously, a 5' overhang is introduced. In other embodiments, catalytically inactive Cas9 is fused to a heterologous effector domain such as a transcriptional repressor (e.g., KRAB) or activator, to affect gene expression. Alternatively, a CRISPR system with a catalytically inactivate Cas9 further comprises a transcriptional repressor or activator fused to a ribosomal binding protein.

[0068] In some aspects, a Cas nuclease and gRNA (including a fusion of crRNA specific for the target sequence and fixed tracrRNA) are introduced into the cell. In general, target sites at the 5' end of the gRNA target the Cas nuclease to the target site, e.g., the gene, using complementary base pairing. The target site may be selected based on its location immediately 5' of a protospacer adjacent motif (PAM) sequence, such as typically NGG, or NAG. In this respect, the gRNA is targeted to the desired sequence by modifying the first 20, 19, 18, 17, 16, 15, 14, 14, 12, 11, or 10 nucleotides of the guide RNA to correspond to the target DNA sequence. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence. Typically, “target sequence” generally refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between the target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.

[0069] The target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. The target sequence may be located in the nucleus or cytoplasm of the cell, such as within an organelle of the cell. Generally, a sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an “editing template” or “editing polynucleotide” or “editing sequence.” In some aspects, an exogenous template polynucleotide may be referred to as a DNA template. In some aspects, the recombination is homologous recombination.

[0070] Typically, in the context of an endogenous CRISPR system, formation of the CRISPR complex (comprising the guide sequence hybridized to the target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. The tract sequence, which may comprise or consist of all or a portion of a wild-type tract sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tract sequence), may also form part of the CRISPR complex, such as by hybridization along at least a portion of the tract sequence to all or a portion of a tract mate sequence that is operably linked to the guide sequence. The tract sequence has sufficient complementarity to a tract mate sequence to hybridize and participate in formation of the CRISPR complex, such as at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tract mate sequence when optimally aligned.

[0071] The elements of the CRISPR system can be introduced into a cell such that expression of the elements of the CRISPR system direct formation of the CRISPR complex at one or more target sites. Components can be delivered to cells as proteins and / or RNA. For example, a Cas enzyme can be delivered as an mRNA encoding the Cas enzyme, the guide RNA can be delivered as an sgRNA, and the DNA template for HDR can be delivered as a DNA.

[0072] Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2.

[0073] The CRISPR enzyme can be Cas9 (e.g., from S. pyogenes or S. pneumonia). The CRISPR enzyme can direct cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the targetsequence. The vector can encode a CRISPR enzyme that is mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). In some embodiments, a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce HDR.

[0074] In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.

[0075] Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), Clustal W, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).

[0076] The CRISPR enzyme may be part of a fusion protein comprising one or more heterologous protein domains. A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione-5- transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta galactosidase, beta- glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescentprotein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP). A CRISPR enzyme may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GAL4A DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in US 20110059502, incorporated herein by reference. B. Ionizable Lipids

[0077] In some aspects of the present disclosure, composition containing compounds containing lipophilic and cationic components, wherein the cationic component is ionizable, are provided. In some embodiments, these cationic ionizable lipids are dendrimers, which are a polymer exhibiting regular dendritic branching, formed by the sequential or generational addition of branched layers to or from a core and are characterized by a core, at least one interior branched layer, and a surface branched layer. (See Petar R. Dvornic and Donald A. Tomalia in Chem. in Britain, 641-645, August 1994.) In other embodiments, the term “dendrimer” as used herein is intended to include, but is not limited to, a molecular architecture with an interior core, interior layers (or “generations”) of repeating units regularly attached to this initiator core, and an exterior surface of terminal groups attached to the outermost generation. A “dendron” is a species of dendrimer having branches emanating from a focal point which is or can be joined to a core, either directly or through a linking moiety to form a larger dendrimer. In some embodiments, the dendrimer structures have radiating repeating groups from a central core which doubles with each repeating unit for each branch. In some embodiments, the dendrimers described herein may be described as a small molecule, medium-sized molecules, lipids, or lipid-like material. These terms may be used to described compounds described herein which have a dendron like appearance (e.g., molecules which radiate from a single focal point).

[0078] While dendrimers are polymers, dendrimers may be preferable to traditional polymers because they have a controllable structure, a single molecular weight, numerous and controllable surface functionalities, and traditionally adopt a globular conformation after reaching a specific generation. Dendrimers can be prepared by sequentially reactions of each repeating unit to produce monodisperse, tree-like and / or generational structure polymeric structures. Individual dendrimers consist of a central core molecule, with a dendritic wedgeattached to one or more functional sites on that central core. The dendrimeric surface layer can have a variety of functional groups disposed thereon including anionic, cationic, hydrophilic, or lipophilic groups, according to the assembly monomers used during the preparation. In some embodiments, the ionizable cationic lipid is a dendrimer or dendron further defined by the formula: Core-Repeating Unit-Terminating Group (D-I) wherein the core is linked to the repeating unit by removing one or more hydrogen atoms from the core and replacing the atom with the repeating unit and wherein: the core has the formula:wherein: X1is amino or alkylamino(C≤12), dialkylamino(C≤12), heterocycloalkyl(C≤12), heteroaryl(C≤12), or a substituted version thereof; R1is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; and a is 1, 2, 3, 4, 5, or 6; or the core has the formula:wherein: X2is N(R5)y; R5is hydrogen, alkyl(C≤18), or substituted alkyl(C≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3; R2is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3; or the core has the formula:wherein:X3is −NR6−, wherein R6is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), −O−, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups; R3and R4are each independently amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; or a group of the formula: −N(Rf)f(CH2CH2N(Rc))eRd,wherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3; Rc, Rd, and Rfare each independently hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); c and d are each independently 1, 2, 3, 4, 5, or 6; or the core is alkylamine(C≤18), dialkylamine(C≤36), heterocycloalkane(C≤12), or a substituted version of any of these groups; wherein the repeating unit comprises a degradable diacyl and a linker; the degradable diacyl group has the formula:wherein: A1and A2are each independently −O− , -S-, or −NRa−, wherein: Rais hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); Y3is alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; or a group of the formula:wherein: X3and X4are alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; Y5is a covalent bond, alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; and R9is alkyl(C≤8)or substituted alkyl(C≤8); the linker group has the formula:wherein: Y1is alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; and wherein when the repeating unit comprises a linker group, then the linker group comprises an independent degradable diacyl group attached to both the nitrogen and the sulfur atoms of the linker group if n is greater than 1, wherein the first group in the repeating unit is a degradable diacyl group, wherein for each linker group, the next repeating unit comprises two degradable diacyl groups attached to the nitrogen atom of the linker group; and wherein n is the number of linker groups present in the repeating unit; and the terminating group has the formula:wherein: Y4is alkanediyl(C≤18)or an alkanediyl(C≤18)wherein one or more of the hydrogen atoms on the alkanediyl(C≤18)has been replaced with −OH, −F, −Cl, −Br, −I, −SH, −OCH3, −OCH2CH3, −SCH3, or −OC(O)CH3; R10is hydrogen, carboxy, hydroxy, or aryl(C≤12), alkylamino(C≤12), dialkylamino(C≤12), N-heterocycloalkyl(C≤12), −C(O)N(R11)−alkanediyl(C≤6)−heterocycloalkyl(C≤12), −C(O)−alkyl- amino(C≤12), −C(O)−dialkylamino(C≤12), −C(O)−N-heterocyclo- alkyl(C≤12), wherein:R11is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); wherein the final degradable diacyl in the chain is attached to a terminating group; n is 0, 1, 2, 3, 4, 5, or 6; or a pharmaceutically acceptable salt thereof.

[0079] In some embodiments, the terminating group is further defined by the formula:wherein: Y4is alkanediyl(C≤18); and R10is hydrogen.

[0080] In some embodiments, A1and A2are each independently −O− or −NRa−.

[0081] In some embodiments of the dendrimer or dendron of formula (D-I), the core is further defined by the formula:wherein: X2is N(R5)y; R5is hydrogen or alkyl(C≤8), or substituted alkyl(C≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3; R2is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3.

[0082] In some embodiments of the dendrimer or dendron of formula (D-I), the core is further defined by the formula:wherein: X3is −NR6−, wherein R6is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), −O−, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups;R3and R4are each independently amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; or a group of the formula: −N(Rf)f(CH2CH2N(Rc))eRd,wherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3; Rc, Rd, and Rfare each independently hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); c and d are each independently 1, 2, 3, 4, 5, or 6.

[0083] In some embodiments of the dendrimer or dendron of formula (I), the terminating group is represented by the formula:wherein: Y4is alkanediyl(C≤18); and R10is hydrogen.

[0084] In some embodiments of the dendrimer or dendron of formula (D-I), the core is further defined as:.

[0085] In some embodiments of the dendrimer or dendron of formula (D-I), the degradable diacyl is further defined as:.

[0086] In some embodiments of the dendrimer or dendron of formula (D-I), the linker is further defined as wherein Y1is alkanediyl(C≤8)or substitutedalkanediyl(C≤8).

[0087] In some embodiments of the dendrimer or dendron of formula (D-I), the dendrimer or dendron is selected from the group consisting of:,and pharmaceutically acceptable salts thereof. B. Dendrimers or dendrons of Formula (X)

[0088] A. In some embodiments of the lipid composition, the ionizable cationic lipid is a dendrimer or dendron of the formula. In some embodiments, the ionizable cationic lipid is a dendrimer or dendron of the formula

[0089] B. In some embodiments of the lipid composition, the ionizable cationic lipid is a dendrimer or dendron of a generation (g) having a structural formula:or a pharmaceutically acceptable salt thereof, wherein: (a) the core comprises a structural formula (XCore):wherein: Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or - CR3aR3b-; R2is independently at each occurrence R1gor -L2-NR1eR1f; R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted (e.g., C1-C6, such as C1-C3) alkyl; R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted (e.g., C1-C12) alkyl; L0, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene]-[heterocycloalkyl]-[alkylene], [alkylene]-(arylene)-[alkylene], heterocycloalkyl, and arylene; or, alternatively, part of L1form a (e.g., C4-C6) heterocycloalkyl (e.g., containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of R1cand R1d; and x1is 0, 1, 2, 3, 4, 5, or 6; and (b) each branch of the plurality (N) of branches independently comprises a structural formula (XBranch):wherein: * indicates a point of attachment of the branch to the core; g is 1, 2, 3, or 4; Z = 2(g-1);G=0, when g=1; or Gwhen g≠1; (c) each diacyl group independently comprises a structural formulawherein: * indicates a point of attachment of the diacyl group at the proximal end thereof; ** indicates a point of attachment of the diacyl group at the distal end thereof; Y3is independently at each occurrence an optionally substituted (e.g., C1-C12); alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene; A1and A2are each independently at each occurrence -O-, -S-, or -NR4- , wherein: R4is hydrogen or optionally substituted (e.g., C1-C6) alkyl; m1and m2are each independently at each occurrence 1, 2, or 3; and R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted (e.g., C1-C8) alkyl; and (d) each linker group independently comprises a structural formula, wherein: ** indicates a point of attachment of the linker to a proximal diacyl group; *** indicates a point of attachment of the linker to a distal diacyl group; and Y1is independently at each occurrence an optionally substituted (e.g., C1-C12) alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene; and(e) each terminating group is independently selected from optionally substituted (e.g., C1-C18, such as C4-C18) alkylthiol, and optionally substituted (e.g., C1- C18, such as C4-C18) alkenylthiol.

[0090] In some embodiments of XCore, Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or -CR3aR3b. In some embodiments of XCoreQ is independently at each occurrence a covalent bond. In some embodiments of XCoreQ is independently at each occurrence an -O-. In some embodiments of XCoreQ is independently at each occurrence a - S-. In some embodiments of XCoreQ is independently at each occurrence a -NR2and R2is independently at each occurrence R1gor -L2-NR1eR1f. In some embodiments of XCoreQ is independently at each occurrence a -CR3aR3bR3a, and R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted alkyl (e.g., C1-C6, such as C1-C3).

[0091] In some embodiments of XCore, R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted alkyl. In some embodiments of XCore, R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch, hydrogen. In some embodiments of XCore, R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch an optionally substituted alkyl (e.g., C1-C12).

[0092] In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene]- [heterocycloalkyl]-[alkylene], [alkylene]-(arylene)-[alkylene], heterocycloalkyl, and arylene; or, alternatively, part of L1form a heterocycloalkyl (e.g., C4-C6and containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of R1cand R1d. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a covalent bond. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a hydrogen. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be an alkylene (e.g., C1-C12, such as C1-C6or C1-C3). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a heteroalkylene (e.g., C1-C12, such as C1-C8or C1-C6). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a heteroalkylene (e.g., C2-C8alkyleneoxide, such as oligo(ethyleneoxide)). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a [alkylene]-[heterocycloalkyl]-[alkylene] [(e.g., C1-C6) alkylene]-[(e.g., C4-C6) heterocycloalkyl]-[(e.g., C1-C6) alkylene]. In some embodiments of XCore, L0, L1, and L2areeach independently at each occurrence can be a [alkylene]-(arylene)-[alkylene] [(e.g., C1-C6) alkylene]-(arylene)-[(e.g., C1-C6) alkylene]. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a [alkylene]-(arylene)-[alkylene] (e.g., [(e.g., C1-C6) alkylene]-phenylene-[(e.g., C1-C6) alkylene]). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a heterocycloalkyl (e.g., C4- C6heterocycloalkyl). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be an arylene (e.g., phenylene). In some embodiments of XCore, part of L1form a heterocycloalkyl with one of R1cand R1d. In some embodiments of XCore, part of L1form a heterocycloalkyl (e.g., C4-C6heterocycloalkyl) with one of R1cand R1dand the heterocycloalkyl can contain one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur.

[0093] In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence selected from a covalent bond, C1-C6alkylene (e.g., C1-C3alkylene), C2-C12(e.g., C2-C8) alkyleneoxide (e.g., oligo(ethyleneoxide), such as -(CH2CH2O)1-4-(CH2CH2)-), [(C1- C4) alkylene]-[(C4-C6) heterocycloalkyl]-[(C1-C4) alkylene] (e.g.,[(C1-C4) alkylene]-phenylene-[(C1-C4) alkylene] (e.g.,In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence selected from C1-C6alkylene (e.g., C1-C3alkylene), -(C1-C3alkylene-O)1-4-(C1-C3alkylene), -(C1-C3alkylene)-phenylene-(C1-C3alkylene)-, and -(C1-C3alkylene)-piperazinyl-(C1-C3alkylene)-. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence C1- C6alkylene (e.g., C1-C3alkylene). In some embodiments, L0, L1, and L2are each independently at each occurrence C2-C12(e.g., C2-C8) alkyleneoxide (e.g., -(C1-C3alkylene- O)1-4-(C1-C3alkylene)). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence selected from [(C1-C4) alkylene]-[(C4-C6) heterocycloalkyl]-[(C1-C4) alkylene] (e.g., -(C1-C3alkylene)-phenylene-(C1-C3 alkylene)-) and [(C1-C4) alkylene]-[(C4- C6) heterocycloalkyl]-[(C1-C4) alkylene] (e.g., -(C1-C3alkylene)-piperazinyl-(C1-C3alkylene)-).

[0094] In some embodiments of XCore,x1is 0, 1, 2, 3, 4, 5, or 6. In some embodiments of XCore, x1is 0. In some embodiments of XCore, x1is 1. In some embodiments of XCore, x1is 2.In some embodiments of XCore,x1is 0, 3. In some embodiments of XCorex1is 4. In some embodiments of XCorex1is 5. In some embodiments of XCore,x1is 6.

[0095] In some embodiments of XCore, the core comprises a structural formula:In some embodiments of XCore, the core comprises a structural formula:.. In some embodiments of XCore, the core comprises a structural formula:some embodiments of XCore, the core comprises a structural formula:(e.g.,In some embodiments of XCore, the core comprises a structural formula:. In some embodiments of XCore, the core comprises a structural formula:In some embodiments of XCore, the core comprises a structural formula:(e.g.,such asIn some embodiments of XCore, the core comprises a structural formula:, wherein Q’ is -NR2- or -CR3aR3b-; q1 and q2 are each independently 1 or 2. In some embodiments of XCore, the core comprises a structural formula:In some embodiments of XCore, the core comprises a structural formulawherein ring A is an optionally substitutedaryl or an optionally substituted (e.g., C3-C12, such as C3-C5) heteroaryl. In some embodiments of XCore, the core comprises has a structural formula.

[0096] In some embodiments of XCore, the core comprises a structural formula set forth in Table A and pharmaceutically acceptable salts thereof, wherein * indicates a point of attachment of the core to a branch of the plurality of branches. In some embodiments, the example cores of Table. A are not limited to the stereoisomers (i.e., enantiomers, diastereomers) listed. Table A. Example core structures

[0097] In some embodiments of XCore, the core comprises a structural formula selected from the group consisting of:,pharmaceutically acceptable salts thereof, wherein * indicates a point of attachment of the core to a branch of the plurality of branches or H. In some embodiments, wherein * indicates a point of attachment of the core to a branch of the plurality of branches.

[0098] In some embodiments of XCore, the core has the structure, wherein * indicates a point of attachment of the core to a branch of the plurality of branches or H. In some embodiments, at least 2 branches are attached to the core. In some embodiments, at least 3 branches are attached to the core. In some embodiments, at least 4 branches are attached to the core.

[0099] In some embodiments of XCore, the core has the structure, wherein * indicates a point of attachment of the core to a branch of the plurality of branches or H. In some embodiments, at least 4 branches are attached to the core. In some embodiments, at least 5 branches are attached to the core. In some embodiments, at least 6 branches are attached to the core.

[0100] In some embodiments, the plurality (N) of branches comprises at least 3 branches, at least 4 branches, at least 5 branches. In some embodiments, the plurality (N) of branches comprises at least 3 branches. In some embodiments, the plurality (N) of branches comprises at least 4 branches. In some embodiments, the plurality (N) of branches comprises at least 5 branches.

[0101] In some embodiments of XBranch, g is 1, 2, 3, or 4. In some embodiments of XBranch, g is 1. In some embodiments of XBranch, g is 2. In some embodiments of XBranch, g is 3. In some embodiments of XBranch, g is 4.

[0102] In some embodiments of XBranch, Z = 2(g-1) and when g=1, G=0. In some embodiments of XBranch, Z = 2(g-1) andwhen g≠1.

[0103] In some embodiments of XBranch, g=1, G=0, Z=1, and each branch of the plurality of branches comprises a structural formula each branch of the plurality of branches comprises a structural formula

[0104] In some embodiments of XBranch, g=2, G=1, Z=2, and each branch of the plurality of branches comprises a structural formula

[0105] In some embodiments of XBranch, g=3, G=3, Z=4, and each branch of the plurality of branches comprises a structural formula

[0106] In some embodiments of XBranch, g=4, G=7, Z=8, and each branch of the plurality of branches comprises a structural formula.

[0107] In some embodiments, the dendrimers or dendrons described herein with ageneration (g) = 1 has the structure: .

[0108] In some embodiments, the dendrimers or dendrons described herein with a generation (g) = 1 has the structure:

[0109] An example formulation of the dendrimers or dendrons described herein for generations 1-4 is shown in Table B. The number of diacyl groups, linker groups, and terminating groups can be calculated based on g. Table B. Formulation of Dendrimer or Dendron Groups Based on Generation (g)

[0110] In some embodiments, the diacyl group independently comprises a structural formula* indicates a point of attachment of the diacyl group at the proximal end thereof, and ** indicates a point of attachment of the diacyl group at the distal end thereof.

[0111] In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted; alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene. In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted alkylene (e.g., C1-C12). In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted alkenylene (e.g., C1-C12). In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted arenylene (e.g., C1- C12).

[0112] In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -O-, -S-, or -NR4-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -O-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -S-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -NR4- and R4is hydrogen or optionally substituted alkyl (e.g., C1-C6). In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 1, 2, or 3. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 1. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 2. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 3. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted alkyl. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e,and R3fare each independently at each occurrence an optionally substituted (e.g., C1-C8) alkyl.

[0113] In some embodiments of the diacyl group, A1is -O- or -NH-. In some embodiments of the diacyl group, A1is -O-. In some embodiments of the diacyl group, A2is - O- or -NH-. In some embodiments of the diacyl group, A2is -O-. In some embodiments of the diacyl group, Y3is C1-C12(e.g., C1-C6, such as C1-C3) alkylene.

[0114] In some embodiments of the diacyl group, the diacyl group independently at each occurrence comprises a structural formula(e.g., such a3csand optionally R , R3d, R3e, and R3fare each independently at each occurrence hydrogen or C1-C3alkyl.

[0115] In some embodiments, linker group independently comprises a structural formula** indicates a point of attachment of the linker to a proximal diacyl group, and *** indicates a point of attachment of the linker to a distal diacyl group.

[0116] In some embodiments of the linker group of XBranchif present, Y1is independently at each occurrence an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene. In some embodiments of the linker group of XBranchif present, Y1is independently at each occurrence an optionally substituted alkylene (e.g., C1-C12). In some embodiments of the linker group of XBranchif present, Y1is independently at each occurrence an optionally substituted alkenylene (e.g., C1-C12). In some embodiments of the linker group of XBranchif present, Y1is independently at each occurrence an optionally substituted arenylene (e.g., C1-C12).

[0117] In some embodiments of the terminating group of XBranch, each terminating group is independently selected from optionally substituted alkylthiol and optionally substituted alkenylthiol. In some embodiments of the terminating group of XBranch, each terminating group is an optionally substituted alkylthiol (e.g., C1-C18, such as C4-C18). In some embodiments of the terminating group of XBranch, each terminating group is optionally substituted alkenylthiol (e.g., C1-C18, such as C4-C18).

[0118] In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18alkenylthiol or C1-C18alkylthiol, and the alkyl or alkenyl moiety is optionally substituted with one or more substituents each independently selected from halogen, C6-C12aryl, C1-C12alkylamino, C4-C6N-heterocycloalkyl , -OH, -C(O)OH, −C(O)N(C1-C3alkyl)−(C1-C6alkylene)−(C1-C12alkylamino), −C(O)N(C1-C3alkyl)−(C1-C6alkylene)−(C4-C6N-heterocycloalkyl), −C(O)−(C1-C12alkylamino), and −C(O)−(C4-C6N- heterocycloalkyl), and the C4-C6N-heterocycloalkyl moiety of any of the preceding substituents is optionally substituted with C1-C3alkyl or C1-C3hydroxyalkyl.

[0119] In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkenylthiol or C1-C18(e.g., C4-C18) alkylthiol, wherein the alkyl or alkenyl moiety is optionally substituted with one or more substituents each independently selected from halogen, C6-C12aryl (e.g., phenyl), C1-C12(e.g., C1-C8) alkylamino (e.g., C1-C6mono-alkylamino (such as -NHCH2CH2CH2CH3) or C1-C8di- alkylamino (such asC4-C6N-heterocycloalkyl(e.g., N-pyrrolidinylN-piperidinylN-azepanyl (-OH, -C(O)OH, −C(O)N(C1-C3alkyl)−(C1-C6alkylene)−(C1-C12alkylamino (e.g., mono- or di- alkylamino)) (e.g.,−C(O)N(C1-C3alkyl)−(C1-C6alkylene)−(C4-C6N- heterocycloalkyl) (e.g.,−C(O)−(C1-C12alkylamino (e.g., mono- or di- alkylamino)), and −C(O)−(C4-C6N-heterocycloalkyl) (e.g., whereinthe C4-C6N-heterocycloalkyl moiety of any of the preceding substituents is optionally substituted with C1-C3alkyl or C1-C3hydroxyalkyl. In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkylthiol, wherein the alkyl moiety is optionally substituted with one substituent -OH. In some embodiments of the terminating group of XBranch, each terminating group is independently C1- C18(e.g., C4-C18) alkylthiol, wherein the alkyl moiety is optionally substituted with onesubstituent selected from C1-C12(e.g., C1-C8) alkylamino (e.g., C1-C6mono-alkylamino (such as -NHCH2CH2CH2CH3) or C1-C8di-alkylamino (such asand C4-C6N-heterocycloalkyl (e.g., N-pyrrolidinyl (N-piperidinylN-azepanylIn some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkenylthiol or C1-C18(e.g., C4- C18) alkylthiol. In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkylthiol.

[0120] In some embodiments of the terminating group of XBranch, each terminating group is independently a structural set forth in Table C. In some embodiments, the dendrimers or dendrons described herein can comprise a terminating group or pharmaceutically acceptable salt, or thereof selected in Table C. In some embodiments, the example terminating group of Table C are not limiting of the stereoisomers (i.e., enantiomers, diastereomers) listed. Table C. Example terminating group / peripheries structures

[0121] In some embodiments, the dendrimer or dendron of Formula (X) is selected from those set forth in Table D and pharmaceutically acceptable salts thereof.Table D. Example Ionizable Cationic Lipo-dendrimers

[0122] Modifying the functional groups and / or the chemical properties of the core, repeating units, and the surface or terminating groups, their physical properties can be modulated. Some properties which can be varied include, but are not limited to, solubility, toxicity, immunogenicity and bioattachment capability. Dendrimers are often described by their generation or number of repeating units in the branches. A dendrimer consisting of only the core molecule is referred to as Generation 0, while each consecutive repeating unit along all branches is Generation 1, Generation 2, and so on until the terminating or surface group. In some embodiments, half generations are possible resulting from only the first condensation reaction with the amine and not the second condensation reaction with the thiol.

[0123] Preparation of dendrimers requires a level of synthetic control achieved through series of stepwise reactions comprising building the dendrimer by each consecutive group. Dendrimer synthesis can be of the convergent or divergent type. During divergent dendrimer synthesis, the molecule is assembled from the core to the periphery in a stepwise process involving attaching one generation to the previous and then changing functional groups for the next stage of reaction. Functional group transformation is necessary to prevent uncontrolled polymerization. Such polymerization would lead to a highly branched molecule that is not monodisperse and is otherwise known as a hyperbranched polymer. Due to steric effects, continuing to react dendrimer repeat units leads to a sphere shaped or globular molecule, until steric overcrowding prevents complete reaction at a specific generation anddestroys the molecule's monodispersity. Thus, in some embodiments, the dendrimers of G1- G10 generation are specifically contemplated. In some embodiments, the dendrimers comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeating units, or any range derivable therein. In some embodiments, the dendrimers used herein are G0, G1, G2, or G3. However, the number of possible generations (such as 11, 12, 13, 14, 15, 20, or 25) may be increased by reducing the spacing units in the branching polymer.

[0124] Additionally, dendrimers have two major chemical environments: the environment created by the specific surface groups on the termination generation and the interior of the dendritic structure which due to the higher order structure can be shielded from the bulk media and the surface groups. Because of these different chemical environments, dendrimers have found numerous different potential uses including in therapeutic applications.

[0125] In some aspects, the dendrimers that may be used in the present compositions are assembled using the differential reactivity of the acrylate and methacrylate groups with amines and thiols. The dendrimers may include secondary or tertiary amines and thioethers formed by the reaction of an acrylate group with a primary or secondary amine and a methacrylate with a mercapto group. Additionally, the repeating units of the dendrimers may contain groups which are degradable under physiological conditions. In some embodiments, these repeating units may contain one or more germinal diethers, esters, amides, or disulfides groups. In some embodiments, the core molecule is a monoamine which allows dendritic polymerization in only one direction. In other embodiments, the core molecule is a polyamine with multiple different dendritic branches which each may comprise one or more repeating units. The dendrimer may be formed by removing one or more hydrogen atoms from this core. In some embodiments, these hydrogen atoms are on a heteroatom such as a nitrogen atom. In some embodiments, the terminating group is a lipophilic groups such as a long chain alkyl or alkenyl group. In other embodiments, the terminating group is a long chain haloalkyl or haloalkenyl group. In other embodiments, the terminating group is an aliphatic or aromatic group containing an ionizable group such as an amine (−NH2) or a carboxylic acid (−CO2H). In still other embodiments, the terminating group is an aliphatic or aromatic group containing one or more hydrogen bond donors such as a hydroxide group, an amide group, or an ester.

[0126] In some embodiments, the compositions may further comprise a molar ratio of the ionizable lipids to the total lipid composition from about 15 to about 60. In some embodiments, the molar ratio is from about 10, about 15, about 20, about 25, about 30, aboutabout 35, about 40, about 45, about 50, about 55, to about 60 or any range derivable therein. In some embodiments, the molar ratio is from about 18 to about 26. In some embodiments, the molar ratio is from about 20 to about 24.

[0127] The cationic ionizable lipids of the present disclosure may contain one or more asymmetrically-substituted carbon or nitrogen atoms, and may be isolated in optically active or racemic form. Thus, all chiral, diastereomeric, racemic form, epimeric form, and all geometric isomeric forms of a chemical formula are intended, unless the specific stereochemistry or isomeric form is specifically indicated. Cationic ionizable lipids may occur as racemates and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers. In some embodiments, a single diastereomer is obtained. The chiral centers of the cationic ionizable lipids of the present disclosure can have the S or the R configuration. Furthermore, it is contemplated that one or more of the cationic ionizable lipids may be present as constitutional isomers. In some embodiments, the compounds have the same formula but different connectivity to the nitrogen atoms of the core. Without wishing to be bound by any theory, it is believed that such cationic ionizable lipids exist because the starting monomers react first with the primary amines and then statistically with any secondary amines present. Thus, the constitutional isomers may present the fully reacted primary amines and then a mixture of reacted secondary amines.

[0128] Chemical formulas used to represent cationic ionizable lipids of the present disclosure will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups. Similarly, many types of imine groups exist in equilibrium with enamine groups. Regardless of which tautomer is depicted for a given formula, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended.

[0129] The cationic ionizable lipids of the present disclosure may also have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.

[0130] In addition, atoms making up the cationic ionizable lipids of the present disclosure are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way ofgeneral example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include13C and14C.

[0131] It should be recognized that the particular anion or cation forming a part of any salt form of a cationic ionizable lipids provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference. C. Selective Organ Targeting (SORT) Lipids

[0132] In some embodiments of the lipid composition of the present application, the lipid (e.g., nanoparticle) composition is preferentially delivered to a target organ. In some embodiments, the target organ is a lung, a lung tissue or a lung cell. As used herein, the term “preferentially delivered” is used to refer to a composition, upon being delivered, which is delivered to the target organ (e.g., lung), tissue, or cell in at least 25% (e.g., at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%) of the amount administered.

[0133] In some embodiments of the lipid composition, the lipid composition comprises one or more selective organ targeting (SORT) lipid which leads to the selective delivery of the composition to a particular organ. In some embodiments, the SORT lipid may have two or more alkyl or alkenyl chains of C6-C24.

[0134] In some embodiments of the lipid compositions, the SORT lipid comprises permanently positively charged moiety. The permanently positively charged moiety may be positively charged at a physiological pH such that the SORT lipid comprises a positive charge upon delivery of a polynucleotide to a cell. In some embodiments the positively charged moiety is quaternary amine or quaternary ammonium ion. In some embodiments, the SORT lipid comprises, or is otherwise complexed to or interacting with, a counterion.

[0135] In some embodiments of the lipid compositions, the SORT lipid is a permanently cationic lipid (i.e., comprising one or more hydrophobic components and a permanently cationic group). The permanently cationic lipid may contain a group which has a positive charge regardless of the pH. One permanently cationic group that may be used in the permanently cationic lipid is a quaternary ammonium group.

[0136] The permanently cationic lipid may comprise a structural formula:wherein: Y1, Y2, or Y3are each independently X1C(O)R1or X2N+R3R4R5;provided at least one of Y1, Y2, and Y3is X2N+R3R4R5; R1is C1-C24alkyl, C1-C24substituted alkyl, C1-C24alkenyl, C1-C24substituted alkenyl; X1is O or NRa, wherein Rais hydrogen, C1-C4alkyl, or C1-C4substituted alkyl; X2is C1-C6alkanediyl or C1-C6substituted alkanediyl; R3, R4, and R5are each independently C1-C24alkyl, C1-C24substituted alkyl, C1-C24alkenyl, C1-C24substituted alkenyl; and A1is an anion with a charge equal to the number of X2N+R3R4R5groups in the compound.

[0137] In some embodiments of the SORT lipids, the permanently cationic SORT lipid has a structural formula:wherein: R6-R9are each independently C1-C24alkyl, C1-C24substituted alkyl, C1-C24alkenyl, C1-C24substituted alkenyl; provided at least one of R6-R9is a group of C8-C24; and A2is a monovalent anion.

[0138] In some embodiments of the lipid compositions, the SORT lipid is ionizable cationic lipid (i.e., comprising one or more hydrophobic components and an ionizable cationic group). The ionizable positively charged moiety may be positively charged at a physiological pH. One ionizable cationic group that may be used in the ionizable cationic lipid is a tertiary ammine group. In some embodiments of the lipid compositions, the SORTlipid has a structural formula:wherein:R1and R2are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; and R3and R3′ are each independently alkyl(C≤6)or substituted alkyl(C≤6).

[0139] In some embodiments of the lipid compositions, the SORT lipid comprises a head group of a particular structure. In some embodiments, the SORT lipid comprises a headgroup having a structural formula:, wherein L is a linker; Z+is positively charged moiety and X- is a counterion. In some embodiment, the linker is a biodegradablelinker. The biodegradable linker may be degradable under physiological pH and temperature. The biodegradable linker may be degraded by proteins or enzymes from a subject. In some embodiments, the positively charged moiety is a quaternary ammonium ion or quaternary amine.

[0140] In some embodiments of the lipid compositions, the SORT lipid has a structural formula:, wherein R1and R2are each independently an optionally substituted C6-C24alkyl, or an optionally substituted C6-C24alkenyl.

[0141] In some embodiments of the lipid compositions, the SORT lipid has a structural formula:.

[0142] In some embodiments of the lipid compositions, the SORT lipid comprises a Linker (L). In some embodiments, L is, wherein: p and q are each independently 1, 2, or 3; and R4is an optionally substituted C1-C6alkyl

[0143] In some embodiments of the lipid compositions, the SORT lipid has a structural formula:wherein: R1and R2are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; R3, R3′, and R3′′ are each independently alkyl(C≤6)or substituted alkyl(C≤6); R4is alkyl(C≤6)or substituted alkyl(C≤6); and X−is a monovalent anion.

[0144] In some embodiments of the lipid compositions, the SORT lipid has a structural formula:wherein: R1and R2are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; R3, R3′, and R3′′ are each independently alkyl(C≤6)or substituted alkyl(C≤6); X−is a monovalent anion.

[0145] By way of example, and without being limited thereto, a SORT lipid of the structural formula of the immediately preceding paragraph is 1,2-dioleoyl-3- trimethylammonium-propane (18:1 DOTAP) (e.g., chloride salt).

[0146] In some embodiments of the lipid compositions, the SORT lipid has a structural formula:wherein: R4and R4′ are each independently alkyl(C6-C24), alkenyl(C6-C24), or a substituted version of either group; R4′′ is alkyl(C≤24), alkenyl(C≤24), or a substituted version of either group; R4′′′ is alkyl(C1-C8), alkenyl(C2-C8), or a substituted version of either group; and X2is a monovalent anion.

[0147] By way of example, and without being limited thereto, a SORT lipid of the structural formula of the immediately preceding paragraph is dimethyldioctadecylammonium (DDAB) (e.g., bromide salt).

[0148] In some embodiments of the lipid compositions, the SORT lipid has astructural formula:wherein:R1and R2are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; R3, R3′, and R3′′ are each independently alkyl(C≤6)or substituted alkyl(C≤6); and X−is a monovalent anion.

[0149] By way of example, and without being limited thereto, a SORT lipid of the structural formula of the immediately preceding paragraph is N-[1-(2, 3-dioleyloxy)propyl]- N,N,N-trimethylammonium chloride (DOTMA).

[0150] In some embodiments of the lipid compositions, the SORT lipid comprises one or more selected from the lipids set forth in Table 6. Table 6. Example SORT lipids

[0151] In some embodiments of the composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage from about 5% to about 65%, from about 10 % to about 60%, from about 15 % to about 55%, from about 20 % to about 50%, from about 25 % to about 45%, or from about 30 % to about 45% relative to the entire lipid nanoparticle. In some embodiments of the composition of the present disclosure, the lipid composition comprises the SORT lipid at a molar or weight percentage of about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%,about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, or any range derivable therein.

[0152] In some embodiments of the composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage from about 5% to about 65%, from about 10% to about 65%, from about 15% to about 65%, or from about 20% to about 65% relative to the entire lipid nanoparticle, the composition comprises the SORT lipid at a molar or weight percentage from about 5% to about 60%,

[0153] In some embodiments of the composition of the present application, the composition comprises the SORT lipid at a molar or weight percentage from about 5% to about 60%, from about 10% to about 60%, from about 15% to about 60%, from about 20% to about 60%, or from about 25% to about 60%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage from about 5% to about 55%, from about 10% to about 55%, from about 15% to about 55%, from about 20% to about 55%, from about 25% to about 55%, or from about 30% to about 55%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage from about 5% to about 50%, from about 10% to about 50%, from about 15% to about 50%, from about 20% to about 50%, from about 25% to about 50%, from about 30% to about 50%, from about 35% to about 50%, or from about 40% to about 50%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage from about 30% to about 60%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage from about 25% to about 60%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage from about 5% to about 20%, from about 5% to about 25%, from about 5% to about 30%, from about 5% to about 35%, or from about 5% to about 40%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage of at least (about) 5%, at least (about) 10%, at least (about) 15%, at least (about) 20%, at least (about) 25%, at least (about) 30%, at least (about) 35%, at least (about) 40%, at least (about) 45%, at least (about) 50%, at least (about) 55%, at least (about) 60%, or at least (about) 65%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage of at most (about) 5%, at most(about) 10%, at most (about) 15%, at most (about) 20%, at most (about) 25%, at most (about) 30%, at most (about) 35%, at most (about) 40%, at least (about) 45%, at most (about) 50%, at most (about) 55%, at most (about) 60%, or at most (about) 65%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the SORT lipid at a molar or weight percentage of (about) 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 65%, or of a range between (inclusive) any two of the foregoing values.

[0154] In some embodiments of the method, the SORT lipid effects delivery of the nucleic acid editing system to the cell of the subject characterized by a greater therapeutic effect compared to that achieved with a reference lipid composition. In some embodiments, the reference lipid composition does not comprise the SORT lipid. In some embodiments, the reference lipid composition does not comprise the amount of the SORT lipid. In some embodiments, the reference lipid comprises 13,16,20-tris(2-hydroxydodecyl)-13,16,20,23- tetraazapentatricontane-11,25-diol (“LF92”), a phospholipid, cholesterol, and a PEG-lipid.

[0155] In some embodiments of the method, the SORT lipid achieves about 1.1-fold to about 20-fold therapeutic effect compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves about 1.1-fold to about 10-fold therapeutic effect compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves about 1.1-fold to about 5-fold therapeutic effect compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves about 5-fold to about 10-fold therapeutic effect compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves about 10-fold to about 20-fold therapeutic effect compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, or at least about 20-fold therapeutic effect compared to that achieved with a reference lipid composition.

[0156] In some embodiments of the method, the SORT lipid achieves about 1.1-fold to about 20-fold therapeutic effect compared to that achieved with a reference lipid composition in cells selected from basal cell, secretory cell such as goblet cell and club cell,ciliated cell and any combination thereof. In some embodiments of the method, the SORT lipid achieves about 1.1-fold to about 10-fold greater therapeutic effect compared to that achieved with a reference lipid composition in cells selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof. In some embodiments of the method, the SORT lipid achieves about 1.1-fold to about 5-fold greater therapeutic effect compared to that achieved with a reference lipid composition in cells selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof. In some embodiments of the method, the SORT lipid achieves about 10- fold to about 20-fold greater therapeutic effect compared to that achieved with a reference lipid composition in cells selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof. In some embodiments of the method, the SORT lipid achieves at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15- fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19- fold, or at least about 20-fold therapeutic effect compared to that achieved with a reference lipid composition in cells selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof.

[0157] In some embodiments of the method, the SORT lipid effects delivery of the nucleic acid editing system to cells of the subject characterized by a therapeutic effect in a greater plurality of cells compared to that achieved with a reference lipid composition. In some embodiments, the reference lipid composition does not comprise the SORT lipid. In some embodiments, the reference lipid composition does not comprise the amount of the SORT lipid. In some embodiments, the reference lipid comprises 13,16,20-tris(2- hydroxydodecyl)-13,16,20,23-tetraazapentatricontane-11,25-diol (“LF92”), a phospholipid, cholesterol, and a PEG-lipid.

[0158] In some embodiments of the method, the SORT lipid achieves therapeutic effect in about 1.1-fold to about 20-fold cells compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves therapeutic effect in about 1.1-fold to about 10-fold cells compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves therapeutic effect in about 1.1-fold to about 5-fold cells compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves therapeutic effectin about 10-fold to about 20-fold cells compared to that achieved with a reference lipid composition. In some embodiments of the method, the SORT lipid achieves therapeutic effect in at least about 1.1 -fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold cells compared to that achieved with a reference lipid composition.

[0159] In some embodiments of the method, the SORT lipid achieves therapeutic effect in about 1.1 -fold to about 20-fold cells compared to that achieved with a reference lipid composition, wherein the cells are selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof. In some embodiments of the method, the SORT lipid achieves therapeutic effect in about 1.1 -fold to about 10-fold cells compared to that achieved with a reference lipid composition, wherein the cells are selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof. In some embodiments of the method, the SORT lipid achieves therapeutic effect in about 5- fold to about 10-fold more cells compared to that achieved with a reference lipid composition, wherein the cells are selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof. In some embodiments of the method, the SORT lipid achieves therapeutic effect in about 10-fold to about 20-fold more cells compared to that achieved with a reference lipid composition, wherein the cells are selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof. In some embodiments of the method, the SORT lipid achieves therapeutic effect in at least about 1.1 -fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15- fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19- fold, or at least about 20-fold more cells compared to that achieved with a reference lipid composition, wherein the cells is selected from basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof.C. Additional Lipids in the Lipid Nanoparticles

[0160] In some aspects of the present disclosure, compositions containing one or more lipids are mixed with the cationic ionizable lipids to create a composition. In some embodiments, the polymers are mixed with 1, 2, 3, 4, or 5 different types of lipids. It iscontemplated that the cationic ionizable lipids can be mixed with multiple different lipids of a single type. In some embodiments, the cationic ionizable lipids compositions comprise at least a steroid or a steroid derivative, a PEG lipid, and a phospholipid. Steroids and Steroid Derivatives

[0161] In some aspects of the present disclosure, the cationic ionizable lipids are mixed with one or more steroid or a steroid derivative to create a composition. In some embodiments, the steroid or steroid derivative comprises any steroid or steroid derivative. As used herein, in some embodiments, the term “steroid” is a class of compounds with a four ring 17 carbon cyclic structure which can further comprises one or more substitutions including alkyl groups, alkoxy groups, hydroxy groups, oxo groups, acyl groups, or a double bond between two or more carbon atoms. In one aspect, the ring structure of a steroid comprises three fused cyclohexyl rings and a fused cyclopentyl ring as shown in the formula below:.

[0162] In some embodiments, a steroid derivative comprises the ring structure above with one or more non-alkyl substitutions. In some embodiments, the steroid or steroid derivative is a sterol wherein the formula is further defined as:.

[0163] In some embodiments of the present disclosure, the steroid or steroid derivative is a cholestane or cholestane derivative. In a cholestane, the ring structure is further defined by the formula:

[0164] As described above, a cholestane derivative includes one or more non-alkyl substitution of the above ring system. In some embodiments, the cholestane or cholestane derivative is a cholestene or cholestene derivative or a sterol or a sterol derivative. In other embodiments, the cholestane or cholestane derivative is both a cholestere and a sterol or a derivative thereof.

[0165] In some embodiments, the compositions may further comprise a molar ratio of the steroid to the total lipid composition from about 5 to about 30. In some embodiments, the molar ratio is from about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, to about 60 or any range derivable therein. In some embodiments, the molar ratio is from about 8 to about 16. In some embodiments, the molar ratio is from about 10 to about 14. Polymer conjugated lipid

[0166] In some aspects of the present disclosure, the polymers are mixed with one or more polymer conjugated lipid such as PEGylated lipids (or PEG lipid) to create a dendrimer composition. In some embodiments, the present disclosure comprises using any lipid to which a PEG group has been attached. In some embodiments, the PEG lipid is a diglyceride which also comprises a PEG chain attached to the glycerol group. In other embodiments, the PEG lipid is a compound which contains one or more C6-C24 long chain alkyl or alkenyl group or a C6-C24 fatty acid group attached to a linker group with a PEG chain. Some non- limiting examples of a PEG lipid includes a PEG modified phosphatidylethanolamine and phosphatidic acid, a PEG ceramide conjugated, PEG modified dialkylamines and PEG modified 1,2-diacyloxypropan-3-amines, PEG modified diacylglycerols and dialkylglycerols. In some embodiments, PEG modified diastearoylphosphatidylethanolamine or PEG modified dimyristoyl-sn-glycerol. In some embodiments, the PEG modification is measured by the molecular weight of PEG component of the lipid. In some embodiments, the PEG modification has a molecular weight from about 100 to about 15,000. In some embodiments, the molecular weight is from about 200 to about 500, from about 400 to about 5,000, from about 500 to about 3,000, or from about 1,200 to about 3,000. The molecular weight of the PEG modification is from about 100, 200, 400, 500, 600, 800, 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, 2,750, 3,000, 3,500, 4,000, 4,500, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 12,500, to about 15,000. Some non-limiting examples of lipids that may be used in the present invention are taught by U.S. Patent 5,820,873, WO 2010 / 141069, or U.S. Patent 8,450,298, which is incorporated herein by reference.

[0167] In another aspect, the PEG lipid has the formula:wherein: R12and R13are each independently alkyl(C≤24), alkenyl(C≤24), or a substituted version of either of these groups; Reis hydrogen, alkyl(C≤8), or substituted alkyl(C≤8); and x is 1-250. In some embodiments, Reis alkyl(C≤8)such as methyl. R12and R13are each independently alkyl(C≤4-20). In some embodiments, x is 5-250. In one embodiment, x is 5-125 or x is 100- 250. In some embodiments, the PEG lipid is 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol.

[0168] In another aspect, the PEG lipid has the formula:wherein: n1is an integer between 1 and 100 and n2and n3are each independently selected from an integer between 1 and 29. In some embodiments, n1is 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100, or any range derivable therein. In some embodiments, n1is from about 30 to about 50. In some embodiments, n2is from 5 to 23. In some embodiments, n2is 11 to about 17. In some embodiments, n3is from 5 to 23. In some embodiments, n3is 11 to about 17.

[0169] In some embodiments, the compositions may further comprise a molar ratio of the PEG lipid to the ionizable total lipid composition from about 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 10, 12, to about 12.5 or any range derivable therein. In some embodiments, the molar ratio is from about 1 to about 10. In some embodiments, the molar ratio is from about 0.5 to about 8. In some embodiments, the molar ratio is from about 2 to about 6. Phospholipid

[0170] In some aspects of the present disclosure, the polymers are mixed with one or more phospholipids to create a composition. In some embodiments, any lipid which also comprises a phosphate group. In some embodiments, the phospholipid is a structure which contains one or two long chain C6-C24 alkyl or alkenyl groups, a glycerol or a sphingosine,one or two phosphate groups, and, optionally, a small organic molecule. In some embodiments, the small organic molecule is an amino acid, a sugar, or an amino substituted alkoxy group, such as choline or ethanolamine. In some embodiments, the phospholipid is a phosphatidylcholine. In some embodiments, the phospholipid is distearoylphosphatidylcholine or dioleoylphosphatidylethanolamine.

[0171] In some embodiments, the compositions may further comprise a molar ratio of the phospholipid to the total lipid composition from about 5 to about 50. In some embodiments, the molar ratio is from about 5, 10, 15, 20, 25, 30, 35, 40, 45, to about 50 or any range derivable therein. In some embodiments, the molar ratio is from about 8 to about 16. In some embodiments, the molar ratio is from about 10 to about 14. D. Nucleic Acids and Nucleic Acid Based Therapeutic Agents Nucleic acids

[0172] In some aspects of the present disclosure, the compositions comprise one or more nucleic acids. In some embodiments, the composition comprises one or more nucleic acids present in a weight ratio to the ionizable lipid from about 5:1 to about 1:100. In some embodiments, the weight ratio of nucleic acid to dendrimer is from about 5:1, 2.5:1, 1:1, 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:60, 1:70, 1:80, 1:90, or 1:100, or any range derivable therein. In addition, it should be clear that the present disclosure is not limited to the specific nucleic acids disclosed herein. The present invention is not limited in scope to any particular source, sequence, or type of nucleic acid, however, as one of ordinary skill in the art could readily identify related homologs in various other sources of the nucleic acid including nucleic acids from non-human species (e.g., mouse, rat, rabbit, dog, monkey, gibbon, chimp, ape, baboon, cow, pig, horse, sheep, cat and other species). It is contemplated that the nucleic acid used in the present disclosure can comprises a sequence based upon a naturally occurring sequence. Allowing for the degeneracy of the genetic code, sequences that have at least about 50%, usually at least about 60%, more usually about 70%, most usually about 80%, preferably at least about 90% and most preferably about 95% of nucleotides that are identical to the nucleotide sequence of the naturally occurring sequence can encode the same protein as the naturally occurring sequence. In another embodiment, the nucleic acid is a complementary sequence to a naturally occurring sequence, or complementary to at least 80%, 90%, 98%, 98% and 99%. Longer polynucleotides encoding 250, 500, 1000, 1212, 1500, 2000, 2500, 3000 or longer are contemplated herein.

[0173] The nucleic acid used herein may be derived from genomic DNA, i.e., cloned directly from the genome of a particular organism. In preferred embodiments, however, the nucleic acid would comprise complementary DNA (cDNA). Also contemplated is a cDNA plus a natural intron or an intron derived from another gene; such engineered molecules are sometime referred to as “mini-genes.” At a minimum, these and other nucleic acids of the present invention may be used as molecular weight standards in, for example, gel electrophoresis.

[0174] The term “cDNA” is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy.

[0175] Targeting double-stranded (ds) DNA with polynucleotides leads to triple-helix formation; targeting RNA will lead to double-helix formation. Antisense polynucleotides, when introduced into a target cell, specifically bind to their target polynucleotide and interfere with transcription, RNA processing, transport, translation and / or stability. Antisense RNA constructs, or DNA encoding such antisense RNA's, may be employed to target a gene editing event within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject.

[0176] As stated above, “complementary” or “antisense” means polynucleotide sequences that are substantially complementary over their entire length and have very few base mismatches. For example, sequences of fifteen bases in length may be termed complementary when they have complementary nucleotides at thirteen or fourteen positions. Naturally, sequences which are completely complementary will be sequences which are entirely complementary throughout their entire length and have no base mismatches. Other sequences with lower degrees of homology also are contemplated. For example, an antisense construct which has limited regions of high homology, but also contains a non-homologous region (e.g., ribozyme; see below) could be designed. These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions.

[0177] In some embodiments, the polynucleotide comprising a sequence encoding for a polynucleotide-guided nuclease such as an mRNA comprises from about 250 to about 15,000 nucleotides, from about 500 to about 5,000 nucleotides, from about 800 to about2,500 nucleotides, or from about 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, to about 15,000 nucleotides, or any range derivable therein. In some embodiments, the guide polynucleotide, particularly a polynucleotide which has been configured to complex with at least a portion of a target gene or transcript or a polynucleotide with a sequence that encodes for such a guide polynucleotide such as a sgRNA comprises from about 25 to about 500 nucleotides, from about 50 to about 300 nucleotides, from about 80 to about 200 nucleotides or from about 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, to about 500 nucleotides, or any range derivable therein. In some embodiments, the donor polynucleotide, particularly a polynucleotide configured to repair a modified target gene or transcript such as a DNA comprises from about 25 to about 2,500 nucleotides, from about 25 to about 500 nucleotides, from about 50 to about 300 nucleotides, from about 80 to about 200 nucleotides or from about 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, to about 500 nucleotides, or any range derivable therein.

[0178] In some embodiments, the composition comprises a weight ratio of the polynucleotide comprising a sequence encoding for a polynucleotide-guided nuclease such as an mRNA to the guide polynucleotide, particularly a polynucleotide which has been configured to complex with at least a portion of a target gene or transcript or a polynucleotide with a sequence that encodes for such a guide polynucleotide such as a sgRNA from about 10:1 to about 1:5, from about 5:1 to about 1:3, from about 3:1 to about 1:2, or from about 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, to about 1:5, or any range derivable therein. In some embodiments, the composition comprises a weight ratio of the polynucleotide comprising a sequence encoding for a polynucleotide-guided nuclease such as an mRNA to the donor polynucleotide, particularly a polynucleotide configured to repair a modified target gene or transcript such as a DNA from about 2:1 to about 1:20, from about 1:1 to about 1:10, from about 1:2 to about 1:8, or from about 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, to about 1:20, or any range derivable therein. In some embodiments, the composition comprises a weight ratio of the guide polynucleotide, particularly a polynucleotide which has been configured to complex with at least a portion of a target gene or transcript or a polynucleotide with a sequence that encodes for such a guide polynucleotide such as a sgRNA to the donor polynucleotide, particularly a polynucleotide configured to repair a modified target gene or transcript such as a DNA from about 4:1 to about 1:10, from about 2:1 to about 1:8, from about 1:1 to about1:4, or from about 4:1, 3:1, 2:1, 2:3, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, to about 1:10, or any range derivable therein.

[0179] In some embodiments, the composition comprises a molar ratio of lipid components to nucleic acid components of from about 1,000:1 to about 5,000:1, from about 2,000:1 to about 4,000:1, or from about 1,000:1, 1,500:1, 2,000:1, 2,500:1, 3,000:1, 3,500:1, 4,000:1, 4,500:1, to about 1,500:1, or any range derivable therein. In some embodiments, the composition comprises an N:P ratio of from about 1:1 to about 20:1, from about 2:1 to about 10:1, from about 4:1 to about 8:1, or from about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, to about 20:1, or any range derivable therein. Modified Nucleobases

[0180] In some embodiments, the nucleic acids of the present disclosure comprise one or more modified nucleosides comprising a modified sugar moiety. Such compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to an oligonucleotide comprising only nucleosides comprising naturally occurring sugar moieties. In some embodiments, modified sugar moieties are substituted sugar moieties. In some embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.

[0181] In some embodiments, modified sugar moieties are substituted sugar moieties comprising one or more non-bridging sugar substituent, including but not limited to substituents at the 2' and / or 5' positions. Examples of sugar substituents suitable for the 2'- position, include, but are not limited to: 2'-F, 2'-OCH3(“OMe” or “O-methyl”), and 2'- O(CH2)2OCH3(“MOE”). In certain embodiments, sugar substituents at the 2' position is selected from allyl, amino, azido, thio, O-allyl, O--C1-C10alkyl, O--C1-C10substituted alkyl; OCF3, O(CH2)2SCH3, O(CH2)2--O--N(Rm)(Rn), and O--CH2--C(=O)--N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10alkyl. Examples of sugar substituents at the 5'-position, include, but are not limited to: 5'-methyl (R or S); 5'- vinyl, and 5'-methoxy. In some embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, T-F-5'-methyl sugar moieties (see, e.g., PCT International Application WO 2008 / 101157, for additional 5',2'-bis substituted sugar moieties and nucleosides).

[0182] Nucleosides comprising 2'-substituted sugar moieties are referred to as 2'- substituted nucleosides. In some embodiments, a 2'-substituted nucleoside comprises a 2'- substituent group selected from halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O, S, or N(Rm)-alkyl; O, S, or N(Rm)-alkenyl; O, S or N(Rm)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2--O--N(Rm)(Rn) or O--CH2-- C(=O)--N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group or substituted or unsubstituted C1-C10alkyl. These 2'-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.

[0183] In some embodiments, a 2'-substituted nucleoside comprises a 2'-substituent group selected from F, NH2, N3, OCF3, O--CH3, O(CH2)3NH2, CH2—CH=CH2, O--CH2— CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O--(CH2)2--O--N(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (O--CH2--C(=O)--N(Rm)(Rn) where each Rmand Rnis, independently, H, an amino protecting group or substituted or unsubstituted C1-C10alkyl.

[0184] In some embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, OCF3, O--CH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2--O--N(CH3)2, --O(CH2)2O(CH2)2N(CH3)2, and O--CH2--C(=O)-- N(H)CH3.

[0185] In some embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, O--CH3, and OCH2CH2OCH3.

[0186] Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In some such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' sugar substituents, include, but are not limited to: --[C(Ra)(Rb)]n--, - -[C(Ra)(Rb)]n--O--, --C(RaRb)--N(R)--O-- or, --C(RaRb)--O--N(R)--; 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)--O-2' (LNA); 4'-(CH2)--S-2'; 4'-(CH2)2--O-2' (ENA); 4'-CH(CH3)--O-2' (cEt) and 4'- CH(CH2OCH3)--O-2', and analogs thereof (see, e.g., U.S. Patent 7,399,845); 4'- C(CH3)(CH3)--O-2' and analogs thereof, (see, e.g., WO 2009 / 006478); 4'-CH2--N(OCH3)-2' and analogs thereof (see, e.g., WO2008 / 150729); 4'-CH2--O--N(CH3)-2' (see, e.g., US2004 / 0171570, published Sep. 2, 2004); 4'-CH2--O--N(R)-2', and 4'-CH2--N(R)--O-2'-, wherein each R is, independently, H, a protecting group, or C1-C12alkyl; 4'-CH2--N(R)--O-2', wherein R is H, C1-C12alkyl, or a protecting group (see, U.S. Patent. 7,427,672); 4'-CH2--C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'- CH2--C(=CH2)-2' and analogs thereof (see, PCT International Application WO 2008 / 154401).

[0187] In some embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups independently selected from --[C(Ra)(Rb)]n--, --C(Ra)=C(Rb)--, --C(Ra)=N--, --C(=NRa)--, --C(=O)--, --C(=S)--, --O--, --Si(Ra)2--, --S(=O)x--, and --N(Ra)--; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Raand Rbis, independently, H, a protecting group, hydroxyl, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7alicyclic radical, substituted C5-C7alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)--H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1and J2is, independently, H, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, acyl (C(=O)--H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12aminoalkyl, substituted C1-C12aminoalkyl, or a protecting group.

[0188] Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) α-L- Methyleneoxy (4'-CH2--O-2') BNA, (B) β-D-Methyleneoxy (4'-CH2--O-2') BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4'-(CH2)2--O-2') BNA, (D) Aminooxy (4'-CH2--O--N(R)-2') BNA, (E) Oxyamino (4'-CH2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy) (4'-CH(CH3)--O-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH2--S-2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH2--CH(CH3)-2') BNA, (J) propylene carbocyclic (4'-(CH2)3-2') BNA, and (K) Methoxy(ethyleneoxy) (4'-CH(CH2OMe)-O-2') BNA (also referred to as constrained MOE or cMOE).

[0189] Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr.Opinion Invens. Drugs, 2001, 2, 5561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patents 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004 / 106356, WO 1994 / 14226, WO 2005 / 021570, and WO 2007 / 134181; U.S. Patent Publication Nos. US 2004 / 0171570, US 2007 / 0287831, and US 2008 / 0039618; U.S. Serial Nos. 12 / 129,154, 60 / 989,574, 61 / 026,995, 61 / 026,998, 61 / 056,564, 61 / 086,231, 61 / 097,787, and 61 / 099,844; and PCT International Applications Nos. PCT / US2008 / 064591, PCT / US2008 / 066154, and PCT / US2008 / 068922.

[0190] In some embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4'-CH2--O-2') bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0191] In some embodiments, substituted sugar moieties comprise one or more non- bridging sugar substituent and one or more bridging sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars; PCT International Application WO 2007 / 134181, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).

[0192] In some embodiments, modified sugar moieties are sugar surrogates. In some such embodiments, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom. In some such embodiments, such modified sugar moiety also comprises bridging and / or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'-position (see, e.g., published U.S. Patent Application US 2005 / 0130923) and / or the 5' position. By way of additional example, carbocyclic bicyclic nucleosides having a 4'-2' bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).

[0193] In some embodiments, sugar surrogates comprise rings having other than 5- atoms. For example, in some embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. & Med. Chem. (2002) 10:841-854), and fluoro HNA (F-HNA).

[0194] In some embodiments, the modified THP nucleosides of Formula VII are provided wherein q1, q2, q3, q4, q5, q6and q7are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6and q7is other than H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6and q7is methyl. In some embodiments, THP nucleosides of Formula VII are provided wherein one of R1and R2is F. In certain embodiments, R1is fluoro and R2is H, R1is methoxy and R2is H, and R1is methoxyethoxy and R2is H.

[0195] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841- 854).

[0196] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO 2008 / 101157 for other disclosed 5',2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see U.S. Patent Publication US 2005 / 0130923) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007 / 134181 wherein a 4'-CH2--O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., 2007).

[0197] In some embodiments, the present invention provides oligonucleotides comprising modified nucleosides. Those modified nucleotides may include modified sugars, modified nucleobases, and / or modified linkages. The specific modifications are selected such that the resulting oligonucleotides possess desirable characteristics. In some embodiments, oligonucleotides comprise one or more RNA-like nucleosides. In some embodiments, oligonucleotides comprise one or more DNA-like nucleotides.

[0198] In some embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modified nucleobases.

[0199] In some embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein.5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine andguanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5- propynyl CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7- deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4- b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-13][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H- pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3- d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Patent 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al., 1991; and those disclosed by Sanghvi, Y. S., 1993.

[0200] Representative United States Patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. Patents 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and 6,005,096, each of which is herein incorporated by reference in its entirety.

[0201] In some embodiments, the present invention provides oligonucleotides comprising linked nucleosides. In such embodiments, nucleosides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (P=O), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P=S). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (--CH2--N(CH3)--O--CH2--), thiodiester (--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane (--O--Si(H)2--O--); and N,N'-dimethylhydrazine (--CH2--N(CH3)--N(CH3)--). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In some embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0202] The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), α or β such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.

[0203] Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2--N(CH3)--O-5'), amide-3 (3'-CH2--C(=O)--N(H)-5'), amide-4 (3'-CH2--N(H)--C(=O)-5'), formacetal (3'-O--CH2--O-5'), and thioformacetal (3'-S-- CH2--O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts.

[0204] Additional modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. For example, one additional modification of the ligand conjugated oligonucleotides of the present invention involves chemically linking to the oligonucleotide one or more additional non-ligand moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., 1989), cholic acid (Manoharan et al., 1994), a thioether, e.g., hexyl-5-tritylthiol (Manoharan et al., 1992; Manoharan et al., 1993), a thiocholesterol (Oberhauser et al., 1992), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., 1991; Kabanov et al., 1990; Svinarchuk et al., 1993), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., 1995; Shea et al., 1990), a polyamine or a polyethylene glycol chain (Manoharan et al., 1995), or adamantane acetic acid (Manoharan et al., 1995), a palmityl moiety (Mishra et al., 1995), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., 1996).

[0205] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Patents 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference. E. Nucleic Acid Editing Systems

[0206] Disclosed herein includes a composition comprising a nucleic acid composition assembled with (e.g., encapsulated within) a lipid nanoparticle, wherein the nucleic acid editing system comprises: (i) a guide nucleic acid comprising a targeting sequence that is complementary with a target sequence, for example of a (e.g., endogenous) (e.g., mutant) cystic fibrosis transmembrane conductance regulator (CFTR) gene or transcript; (ii) a (e.g., heterologous) polypeptide (such as one described herein) comprising a (e.g., heterologous) actuator moiety (such as endonuclease) or a (e.g., heterologous) polynucleotide (such as one described herein) encoding the polypeptide, which actuator moiety is configured to (1) form a complex with the guide nucleic acid and (2) cleave the (e.g., endogenous) (e.g., mutant) CFTR gene or transcript in a cell in a cleavage event; and (iii) a donor template nucleic acid configured to alter the (e.g., endogenous) (e.g., mutant) CFTR gene or transcript, subsequent to the cleavage event, to provide a functional CFTR gene, transcript or protein in the cell. The composition may be for enhancing an expression or activity of cystic fibrosis transmembrane conductance regulator (CFTR) protein in a cell that exhibits a (e.g., endogenous) mutant CFTR gene or transcript.

[0207] In some embodiments, the guide nucleic acid comprises a nucleotide sequence selected from those set forth in Table 1 of the Examples (or disclosed elsewhere herein) and complementary sequences thereof. The targeting sequence of the guide nucleic acid maycomprise a nucleotide sequence selected from those set forth in Table 1 of the Examples (or disclosed elsewhere herein) and complementary sequences thereof. The target sequence may be within a region of the CFTR gene or transcript. For example, the target sequence may be specific to a region with a mutation of CFTR relative to a corresponding wild-type counterpart. The target sequence may be within a region coding for an ATP binding domain, an intrically disordered domain, a transmembrane domain, transporter domain, a PDZ domain, or other region, domain, or motif of the CFTR protein, gene or transcript. Exon 10 is the location of the F508del mutation in human CFTR. Exon 12 is the location of the G542X mutation in mouse CFTR gene. The (e.g., heterologous) actuator moiety (such as endonuclease) may be configured to cleave a (e.g., endogenous) CFTR gene or transcript at a cleavage site flanking a mutation of CFTR. F. Methods for Enhancing CFTR Expression or Activity

[0208] Disclosed herein includes a method for enhancing an expression or activity of cystic fibrosis transmembrane conductance regulator (CFTR) protein in cell(s). The method may comprise: (a) contacting the cell with a nucleic acid editing system assembled with lipid composition(s), which nucleic acid editing system comprises (i) a guide nucleic acid, (ii) a heterologous polypeptide comprising an endonuclease or a heterologous polynucleotide encoding the heterologous polypeptide, and (iii) a donor template nucleic acid, to yield a complex of the heterologous endonuclease with the guide nucleic acid in the cell; (b) cleaving a CFTR gene or transcript in the cell with the complex at a cleavage site to yield a cleaved CFTR gene or transcript; and (c) using the donor template nucleic acid to repair the cleaved CFTR gene or transcript to yield a repaired CFTR gene or transcript encoding a functional CFTR protein in the cell, thereby enhancing the expression or activity of CFTR protein in the cell. The CFTR gene or transcript cleaved in (b) or a cleavage event may be an endogenous CFTR gene or transcript. The CFTR gene or transcript cleaved in (b) or a cleavage event may be a mutant CFTR gene or transcript. The CFTR gene or transcript cleaved in (b) or a cleavage event may be an endogenous mutant CFTR gene or transcript. The repaired CFTR gene or transcript may be generated via homology directed repair (HDR) pathway or event(s). The functional CFTR protein encoded by the repaired CFTR gene or transcript may be a wild-type CFTR protein. The nucleic acid editing system may be one described herein, for example, in the “NUCLEIC ACID EDITING SYSTEMS” section. The method may comprise using said donor template nucleic acid to repair said cleaved CFTR gene or transcript via a homology directed repair (HDR) pathway or event(s).

[0209] In some embodiments of the method for enhancing the expression or activity of CFTR protein, the lipid composition comprises: an ionizable cationic lipid; and a selective organ targeting (SORT) lipid separate from the ionizable cationic lipid. The lipid composition may further comprise a phospholipid separate from the SORT lipid. The lipid composition may be one described herein, for example, in the “LIPID COMPOSITIONS” section.

[0210] In some embodiments of the method for enhancing the expression or activity of CFTR protein, the contacting or (a) is ex vivo. In some embodiments, the contacting or (a) is in vitro. In some embodiments, the contacting or (a) is in vivo. In some embodiments, the contacting or (a) is repeated. In some embodiments, the cell is a cell described herein, for example, in the “CELLS” section. In some embodiments, the cell is a lung cell, e.g., a lung basal cell. In some embodiments, the lung basal cell exhibits or is determined to exhibit p63. In some embodiments, the cell is an airway epithelial cell, e.g., a bronchial epithelial cell. In some embodiments, the cell is undifferentiated. In some embodiments, the cell is differentiated. In some embodiments, the contacting or comprises contacting a plurality of cells (e.g., lung cells, such as lung basal cells) that comprise the cell (e.g., lung cell, such as lung basal cell). The repairing may yield a functional (e.g., wild-type) CFTR gene, transcript or protein, e.g., in at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, or 70% of the plurality of cells.

[0211] In some embodiments of the method for enhancing the expression or activity of CFTR protein, a cleavage event or (b) comprises cleaving a (e.g., endogenous) (e.g., mutant) CFTR gene or transcript that comprises a mutation relative to a corresponding wild type counterpart. The mutation may be a loss-of-function mutation, such as a nonsense or frameshift mutation. The mutation may be present in an exon selected from exons 9-27 (e.g., exon 10, exon 12) of CFTR. The mutation may be F508del or G542X. The mutation may be F508del. The mutation may be G542X. The (e.g., loss-of-function) mutation may be associated with cystic fibrosis, hereditary emphysema, or chronic obstructive pulmonary disease (COPD). The method may alter a mutant CFTR gene or transcript in cell(s) to a functional CFTR gene or transcript, for example, by inserting one or more nucleotides at or near the cleavage site.

[0212] In some embodiments of the method for enhancing the expression or activity of CFTR protein, a repair event or (c) is characterized by an off-target insertion or / and deletion (indel) rate, for example, of no more than about 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, or 40%. The off-target indel rate may be associated with or characteristic of non-homologous end-joining (NHEJ) pathway or event(s) in the repair eventor (c). The off-target indel rate may comprise a ratio of (1) a sum of test cells detected to have an incorrectly altered CFTR gene or transcript relative to (2) a sum of total test cells. The incorrectly altered CFTR gene or transcript may encode a non-functional CFTR protein. The incorrectly altered CFTR gene or transcript may comprise an insertion or / and deletion (indel) relative to an endogenous (e.g., mutant) CFTR gene or transcript in cell(s) at or near a cleavage site of the nucleic acid editing system. In some embodiments, a repair event or (c) is characterized by an on-target repair rate, for example, of at least about 5%, 6%, 7%, 8%, 9%, 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%. The on-target repair rate may be associated with or characteristic of homology directed repair (HDR) pathway or event(s) in the repair event or (c). The on-target repair rate may comprise a ratio of (1) a sum of test cells detected to have the (e.g., correctly) repaired CFTR gene or transcript relative to (2) a sum of total test cells. The (e.g., correctly) repaired CFTR gene or transcript may encode a functional (e.g., wild-type) CFTR protein. Accurate specificity to a target sequence as well as the prevention or reduction of the number of off-target insertion and / or deletions may be performed by designing oligo using in silio prediction algorithms, or other design methods of oligos, such to analyze potential targets and off-targets in a given sequence.

[0213] In some embodiments of the method for enhancing the expression or activity of CFTR protein, the method increases an amount of a functional CFTR gene, transcript or protein in the cell (e.g., by at least about 1.1 -fold) relative to a corresponding control. In some embodiments, the method yields a therapeutically effective amount of a functional of CFTR gene, transcript or protein in the cell. In some embodiments, the method yields at least about 10%, 15%, 20%, 25%, or 30%, by mole or by weight, among all detected or detectable CFTR gene, transcript or protein. The functional CFTR gene, transcript or protein may be a wildtype CFTR gene, transcript or protein. The corresponding control may be a corresponding cell absent the contacting or (a). The corresponding control may be a corresponding cell absent the contacting or (a).

[0214] In some embodiments of the method for enhancing the expression or activity of CFTR protein, the method enhances (e.g., chloride) ion transport in cell(s) (e.g., by at least about 1.1 -fold) relative to a corresponding control. The method may reduce defective export from or import to cell(s) of chloride, such as chloride anion or in the form of a chloride salt or other chloride-containing compound. The method may enhance or stimulate ion (e.g., chloride) transport in cell(s). The enhanced or stimulated ion (e.g., chloride) transport may result in secretion or absorption of (e.g., chloride) ions. The corresponding control may be a corresponding cell absent the contacting. Enhanced (e.g., chloride) ion transport may bedetermined by evaluating CFTR-mediated currents across cell(s) by employing standard Ussing chamber (see Ussing and Zehrahn, Acta. Physiol. Scand. 23:110-127, 1951) or nasal potential difference measurements (see Knowles et al., Hum. Gene Therapy 6:445-455, 1995). The enhanced chloride transport may be determined by the Ieq (equivalen current) assay using the TECC-24 system as described in Vu et al., J. Med. Chem.2017, 60, 458−473, which is hereby incorporated by reference in its entirety.

[0215] The enhanced (e.g., chloride) ion transport may be determined by CFTR- dependent whole-cell current measurement(s), as described in International Patent Application No. PCT / US2017 / 032967, published as WO2017201091, which is hereby incorporated by reference in its entirety.

[0216] In some embodiments, the method further comprises deriving (e.g., by cell culturing) a cell composition (e.g., a lung cell composition) from the cell. G. Methods for Lung Cell Editing

[0217] Disclosed herein includes a method for genetic correction of cystic fibrosis transmembrane conductance regulator (CFTR) in a lung (e.g., basal) cell, comprising: contacting the lung (e.g., basal) cell with a composition that comprises a nucleic acid editing system assembled with a lipid composition, thereby delivering the nucleic acid editing system to the lung (e.g., basal) cell. Further details on nucleic acid editing systems are provided in a preceding section.

[0218] Disclosed herein includes a method for genetic correction of cystic fibrosis transmembrane conductance regulator (CFTR) in a cell composition, comprising: contacting the cell composition comprising a plurality of lung (e.g., basal) cells with a composition that comprises a nucleic acid editing system assembled with a lipid composition, thereby delivering the nucleic acid editing system, e.g., to at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, or 70% of the plurality of lung (e.g., basal) cells.

[0219] Disclosed herein includes a method for genetic correction of cystic fibrosis transmembrane conductance regulator (CFTR) in a cell composition, comprising: contacting the cell composition with a composition that comprises a nucleic acid editing system assembled with a lipid composition, which cell composition comprise a lung (e.g., basal) cell and a lung non-basal cell, thereby delivering the nucleic acid editing system to the lung (e.g., basal) cell in a greater amount than that delivered to the lung non-basal cell. The non-basal cell may be an ionocyte (e.g., exhibiting or determined to exhibit to FOXI1), a ciliated cell,an endothelial cell, epithelial cells, immune cells, alveolar type 1 cells, alveolar type 2 cells, a secretory cell (such as goblet cell and club cell), or a combination thereof.

[0220] In some embodiments of any one of the methods for genetic correction of CFTR of this section, the lung (e.g., basal) cell or the plurality of lung (e.g., basal) cells is / are determined to exhibit a mutation in CFTR gene. In some embodiments of any one of the methods for genetic correction of CFTR of this section, the lung (e.g., basal) cell or the plurality of lung (e.g., basal) cells exhibit(s) a mutation in CFTR gene.

[0221] In some embodiments of any one of the methods for genetic correction of CFTR of this section, the lung (e.g., basal) cell or the plurality of lung (e.g., basal) cells is / are from a subject. The subject may be determined to exhibit a mutation in CFTR gene. The subject may exhibit a mutation in CFTR gene.

[0222] In some embodiments of any one of the methods for genetic correction of CFTR of this section, the contacting is ex vivo. In some embodiments of any one of the methods for genetic correction of CFTR of this section, the contacting is in vitro. In some embodiments of any one of the methods for genetic correction of CFTR of this section, the contacting is in vivo.

[0223] In some embodiments of the method, a cell or plurality of cells is isolated from the subject. The compositions as described elsewhere here may be contacted with the cell outside of the subject. Upon administration of the composition or therapeutic, the cell may be re-injected or otherwise re-introduced into the subject. In some embodiments of the method, the cell is a cell line. In some embodiments of the method, the cell is a lung cell. In some embodiments, the lung cell is a lung airway cell. Examples of lung airway cells that can be targeted by the delivery of the present application includes but is not limited to basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof.

[0224] In some of the embodiments of the present disclosure, the gene editing (e.g., genetic correction of CFTR) is long-lasting. More particularly, the editing of the genome results in an edited genome that is present after 10 days, after 15 days, after 20 days, after 25 days, after 30 days, after 35 days, after 40 days, after 45 days, after 50 days, after 55 days, after 60 days, after 65 days, after 70 days, after 75 days, after 80 days, after 85 days, after 90 days, after 100 days, or after 120 days. In some embodiments, the editing of the genome results in an edited genome that is present after 1 month, after 2 months, after 3 months, after 4 months, after 5 months, after 6 months, after 7 months, after 8 months, after 9 months, or after 12 months, or any range derivable therein. In some embodiments, the editing of the genome results in an edited genome that is present after 1 year, after 2 years, after 3 years,after 4 years, after 5 years, after 6 years, after 7 years, after 8 years, after 9 years, or after 10 years. In some embodiments, the editing of the genome results in an edited genome that is present after more than 1 year.

[0225] In some embodiments, the presently disclosed compositions and methods provide for the gene editing (e.g., genetic correction of CFTR) of a certain portion of cells that are contacted by the composition. In some embodiments, the editing of the genome results in an edited genome that is present in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more than 95% of the cells (e.g. lung cells or lung cell compositions), or any range derivable therein. In some embodiments, the editing of the genome results in an edited genome that is present in about 10% to about 90%, of the cells (e.g. lung cells or lung cell compositions). In some embodiments, the editing of the genome results in an edited genome that is present in about 20% to about 80%, of the cells (e.g. lung cells or lung cell compositions). In some embodiments, the editing of the genome results in an edited genome that is present in about 40% to about 60%, of the cells (e.g. lung cells or lung cell compositions). In some embodiments, the editing of the genome results in an edited genome that is present in about 20% of the cells or about 40% of the cells (e.g. lung cells or lung cell compositions). In some embodiments, the editing of the genome results in an edited genome that is present in about 60% of the cells (e.g. lung cells or lung cell compositions). In some embodiments, the editing of the genome results in an edited genome that is present in about 80% of the cells (e.g. lung cells or lung cell compositions).

[0226] In some embodiments, the editing of the genome results in an increase in function of one or more gene products (e.g. CFTR gene, transcript or protein). In some embodiments, the editing of the genome results in an increase in function of one or more gene products of about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or any range derivable therein. In some embodiments, the editing of the genome results in an increase in function of one or more gene products of at least (about) 10%, at least (about) 20%, at least (about) 30%, at least (about) 40%, at least (about) 50%, at least (about) 60%, at least (about) 70%, at least (about) 80%, at least (about) 90%, or any range derivable therein. In some embodiments, the editing of the genome results in an increase in function of one or more gene products of at least 20%. In some embodiments, the editing of the genome results in an increase in function of one or moregene products of at least 40%. In some embodiments, the editing of the genome results in an increase in function of one or more gene products of at least 80%.H. Methods of Treatment

[0227] Disclosed herein includes methods for treating a subject having or suspected of having a disease or disorder, such as a genetic disease or disorder or a disease or disorder associated with a mutation to one or more genes, the method comprising administering to the subject a composition comprising one or more of each of the following nucleic acids: a polynucleotide comprising a sequence encoding for a polynucleotide-guided nuclease such as an mRNA; a guide polynucleotide, particularly a polynucleotide which has been configured to complex with at least a portion of a target gene or transcript or a polynucleotide with a sequence that encodes for such a guide polynucleotide such as a sgRNA; and the donor polynucleotide, particularly a polynucleotide configured to repair a modified target gene or transcript such as a DNA; and a lipid nanoparticle comprising at least one ionizable lipid; wherein the each of the nucleic acids are encapsulated within the lipid nanoparticle. The subject may be a mammal. The subject may be a non-human species (e.g., mouse, rat, rabbit, dog, monkey, gibbon, chimp, ape, baboon, cow, pig, horse, sheep, cat and other species). The subject may be a human. The subject may be determined to exhibit a mutation in a gene. In some embodiments, the administering comprises systemic (e.g., intravenous) administration. In some embodiments, the subject is selected from the group consisting of mouse, rat, monkey, and human. In some embodiments, the subject is a human.I. Methods of Modifying the Genome of a Cell

[0228] Some aspects of the disclosure are directed to methods of modifying the genome of a cell in vitro or in vivo in a subject, comprising contacting the cell with a nucleic acid sequence encoding a sequence-targeting nuclease, a guide RNA (e.g., a single guide RNA), and a donor template, wherein the modification comprises the insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template (e.g., via homologous recombination with the donor sequence). Homologous recombination (HR) mediated repair (also termed homology-directed repair (HDR)) uses homologous donor DNA as a template to repair a double stranded DNA break. If the sequence of the donor DNA differs from the genomic sequence, this process leads to the introduction of sequence changes into the genome.

[0229] The term “modification of the genome” as used herein encompasses the addition of a regulatory sequence or a nucleotide sequence encoding a gene product viahomologous recombination (i.e., insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template). In some embodiments, the modification comprises replacement of a genomic region associated with a disease or condition (e.g., a genetic mutation) with a non-pathological genomic region via homologous recombination. For example, in some embodiments the modification comprises replacement of a genomic region comprising a mutation with a wild-type or non-mutated genomic region. In some embodiments, the mutation comprises a substitution or deletion mutation. In some embodiments, the modification comprises insertion of a nucleotide sequence in the genome corresponding to a deleted portion of a deletion mutation via homologous recombination. In some embodiments, the modification of the genome comprises insertion and / or replacement of a genomic sequence via homologous recombination that modulates the expression, activity or stability of a gene product. In some embodiments, the modification of the genome comprises modification of both alleles of the cell. In some embodiments, the modification of the genome comprises modification of one allele of the cell.

[0230] In some embodiments, the composition results in a homology directed repair rate of at least 1%, at least 5%, at least 15%, at least 25%, at least 50%, or at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or at least 50%. In some embodiments, the composition has an indel rate of less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1%. J. Cells Basal cells

[0231] Basal cells are derived from undifferentiated columnar epithelium in the developing airway. They are characterized by basal position in the columnar epithelium, the presence of hemidesmosomes (characterized by alpha 6 beta 4 integrins), cytokeratins 5 and 14, NGFR, and the nuclear protein p63. The distribution of basal cells varies by airway level and animal species. Airways that are larger in diameter have more basal cells than airways with smaller diameters. As the airway decreases in diameter, the number of basal cells also decreases, and none are present in the terminal bronchioles.

[0232] Basal cells are considered the tissue-specific stem cells in both mouse and human airway epithelium, given their capacity to self-renew and differentiation into various mature cell lineages including ciliated, secretory, goblet, and ionocytes (Montoro et al., 2018; Rock et al., 2009; Rock et al., 2010; Zhou et al., 2022). Basal cells in the mouse and humanairway epithelium can be identified by the expression of nerve growth factor receptor (NGFR) (Rock et al., 2009) or cytoskeletal protein keratin 5 (KRT5) (Zuo et al., 2015). Lineage tracing and clonal growth studies have supported their roles in differentiation and regeneration (Rock et al., 2009; Rock et al., 2010; Zuo et al., 2015; Pooja et al., 2011). When isolated, these cells (NGFR+, KRT5+) can grow in Matrigel, forming clonal structures with markers for ciliated and Clara cells (Rock et al., 2009). This growth is supported by a medium with EGF, FGF, and bovine pituitary extract. Lineage tracing studies in mice using a CK5–CreER model show KRT5-positive basal cells developing into ciliated cells in the proximal airways under normal and post-sulfur dioxide injury conditions (Rock et al., 2009; Rock et al., 2010). More recently, KRT5-positive stem cells from bronchiolar regions have been observed to repair alveolar lung tissue post H1N1 infection, forming organized, spherical "pods" and expressing alveolar-specific proteins (Zuo et al., 2015; Pooja et al., 2011).

[0233] In another aspect, provided herein is a method for (e.g., lung) basal cell delivery of a nucleic acid editing system, comprising: contacting said (e.g., lung) basal cell with a composition comprising said nucleic acid editing system assembled with a lipid composition, thereby delivering said nucleic acid editing system to said (e.g., lung) basal cell. In some embodiments, the contacting is ex vivo. For example, cells may be isolated from a patient and contacted with the composition. The cells may then be reintroduced to the subject. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is in vivo. The cells may be derived from the subject. The cells may be in the subject. The subject may be a subject as described elsewhere herein. For example, the subject may be determined to exhibit a mutation in the CFTR gene.

[0234] In another aspect, provided herein is a method for (e.g., lung) basal cell delivery of a nucleic acid editing system, comprising: contacting a (e.g., lung) cell composition comprising a plurality of (e.g., lung) basal cells with a composition that comprises said nucleic acid editing system assembled with a lipid composition, thereby delivering said nucleic acid editing system to at least 15% of said plurality of (e.g., lung) basal cells. The lung cell composition may also comprise other lung cells, as described elsewhere herein, for example, an endothelial cell, a secretory cell, an epithelial cell, an immune cell, an alveolar type 1 cell, an alveolar type 2 cell, a goblet cell, a ciliated cell, club cell, an ionocyte, or a combination thereof. The (e.g. lung) cell composition may comprise a first cell of a first CFTR genotype and a second cell of a second CFTR genotype. The (e.g. lung) cells may comprises a variety of genotypes or a variety of CFTR alleles.

[0235] In another aspect, provided herein is a method for (e.g., lung) basal cell- targeted delivery of a nucleic acid editing system, comprising: contacting a plurality of (e.g., lung) cells of a plurality of cell types with a composition that comprises said nucleic acid editing system assembled with a lipid composition, which plurality of cells comprise a (e.g., lung) basal cell and a (e.g., lung) non-basal cell, thereby delivering said nucleic acid editing system to said basal cell in a greater amount than that delivered to said non-basal cell an endothelial cell, a secretory cell, an epithelial cell, an immune cell, an alveolar type 1 cell, an alveolar type 2 cell, a goblet cell, a ciliated cell, club cell, an ionocyte, or a combination thereof. The (e.g. lung) cell composition may comprise a first cell of a first CFTR genotype and a second cell of a second CFTR genotype. The (e.g. lung) cells may comprise a variety of genotypes or a variety of CFTR alleles.

[0236] In another aspect, provided herein is a method for delivery to basal cells of a subject, comprising administrating to the subject the pharmaceutical composition as described in the present application. In some embodiments of the method, the pharmaceutical composition comprises a nucleic acid editing system assembled with a lipid composition as described in the present application, wherein the lipid composition comprises (i) an ionizable cationic lipid; and (ii) a selective organ targeting (SORT) lipid separate from the ionizable cationic lipid. The lipid composition may further comprise a phospholipid. In some embodiments, the basal cell is a lung basal cell.

[0237] In some embodiments of the method, the pharmaceutical composition is administrated to the subject through any suitable delivery. In some embodiment, the pharmaceutical composition is administrated to the subject through inhalation. In some embodiments, the pharmaceutical composition is administrated to the subject through systemic administration such as intravenous administration. Ciliated cells

[0238] Ciliated cells are those cells with cilia structures on the cell surface. Examples of ciliated cells include but are not limited to respiratory tract ciliated cells, oviduct ciliated cell, uterine endometrial ciliated cells, rete testis ciliated cells, ductulus efferens ciliated cells, and / or ciliated ependymal cells. Human respiratory tract ciliated cells bear 200 to 300 cilia on their surface. Cilia are elongated motile cylindrical projections from the apical cell membrane, about 0.25 mm in diameter, that contain microtubules and cytoplasm in continuity with that of the cell. Human tracheal cilia are 5 to 8 mm long, becoming shorter in more distal airways.

[0239] The structure of a cilium is complex and consists of an axoneme, anchored by a basal body and a rootlet to the cell, and it possesses some smaller claw-like formations on its tip. The direction in which the basal body points defines the orientation of the cilium and the direction of the effective beat. The axoneme contains nine pairs of microtubules which surround a central pair of microtubules, as well as radial spokes and peripheral nexin links, which to a great extent maintain the wheel-like arrangement of the cilium. Inner and outer arms attach to the microtubules. The main structural protein of the doublets is tubulin. The arms (inner and outer) contain dynein, which is a protein classified as an ATPase. Dynein generates the force that results in a sliding movement of the microtubules, responsible for ciliary movement. It is generally accepted that the outer dynein arms are mostly responsible for beating frequency whereas the inner dynein arms together with the radial spokes and nexin links have a role in the waveform of the beating. Changes in the structural integrity of the axoneme can result in abnormal movement that ranges from stillness to aberrant patterns of hyperactivity.Secretory cell

[0240] “Secretory cell” refers to cells specialized for secretion. These cells are usually epithelial in origin and have characteristic, well developed rough endoplasmic reticulum or, in the case of cells secreting lipids or lipid-derived products have well developed smooth endoplasmic reticulum. Examples of secretory cells include: salivary gland cells, mammary gland cells, lacrimal gland cells, creuminous gland cells, eccrine sweat gland cells, apocrine sweat gland cells, sebaceous gland cells, Bowman's gland cells, Brunner's gland cells, seminal vesicle cells, prostate gland cells, bulbourethral gland cells, Bartholin's gland cells, gland of Littre cells, endometrial cells, goblet cells of the respiratory and digestive tracts, mucous cells of the stomach, zymogenic cells of gastric glands, oxyntic cells of gastric glands, acinar cells of the pancreas, paneth cells of the small intestine, type II pneumocytes of the lung, club cells of the lung, anterior pituitary cells, cells of the intermediate pituitary, cells of the posterior pituitary, cells of the gut and respiratory tract, cells of the thyroid gland, cells of the parathyroid gland, cells of the adrenal gland, cells of the testes, cells of the ovaries, cells of the juxtaglomerular apparatus of the kidney, cells secreting extracellular matrix (e.g., epithelial cells, nonepithelial cells (such as fibroblasts, chondrocytes, osteoblasts / osteocytes, osteoprogenitor cells), and secretory cells of the immune system (e.g., Ig producing B cells, cytokine producing T cells, etc.).

[0241] The following are examples of compositions and evaluations of compositions of the disclosure. It is understood that various other embodiments may be practiced, given the general description provided above. K. Kits

[0242] The present disclosure also provides kits. Any of the components disclosed herein may be combined in the form of a kit. In some embodiments, the kits comprise a composition as described above or in the claims.

[0243] The kits will generally include at least one vial, test tube, flask, bottle, syringe or other container, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional containers into which the additional components may be separately placed. However, various combinations of components may be comprised in a container. In some embodiments, all of the lipid nanoparticle components are combined in a single container. In other embodiments, some or all of the lipid nanoparticle components are provided in separate containers.

[0244] The kits of the present invention also will typically include packaging for containing the various containers in close confinement for commercial sale. Such packaging may include cardboard or injection or blow molded plastic packaging into which the desired containers are retained. A kit may also include instructions for employing the kit components. Instructions may include variations that can be implemented. L. Chemical Definitions

[0245] When used in the context of a chemical group: “hydrogen” means −H; “hydroxy” means −OH; “oxo” means =O; “carbonyl” means −C(=O)−; “carboxy” means −C(=O)OH (also written as −COOH or −CO2H); “halo” means independently −F, −Cl, −Br or −I; “amino” means −NH2; “hydroxyamino” means −NHOH; “nitro” means −NO2; imino means =NH; “cyano” means −CN; “isocyanate” means −N=C=O; “azido” means −N3; in a monovalent context “phosphate” means −OP(O)(OH)2or a deprotonated form thereof; in a divalent context “phosphate” means −OP(O)(OH)O− or a deprotonated form thereof; “mercapto” means −SH; and “thio” means =S; “sulfonyl” means −S(O)2−; “hydroxysulfonyl” means −S(O)2OH; “sulfonamide” means −S(O)2NH2; and “sulfinyl” means −S(O)−.

[0246] In the context of chemical formulas, the symbol “−” means a single bond, “=“means a double bond, and “≡” means triple bond. The symbol “ “ represents an optionalbond, which if present is either single or double. The symbol “ “ represents a single bondor a double bond. Thus, for example, the formulaincludesAnd it is understood that no one such ring atom forms part of more than one double bond. Furthermore, it is noted that the covalent bond symbol “−”, when connecting one or two stereogenic atoms, does not indicate any preferred stereochemistry. Instead, it covers all stereoisomers as well as mixtures thereof. The symbol ““ when drawn perpendicularly across a bond (e.g., for methyl) indicates a point of attachmentof the group. It is noted that the point of attachment is typically only identified in this manner for larger groups in order to assist the reader in unambiguously identifying a point of attachment. The symbol “means a single bond where the group attached to the thick end of the wedge is “out of the page.” The symbol “means a single bond where the group attached to the thick end of the wedge is “into the page”. The symbol “means a single bond where the geometry around a double bond (e.g., either E or Z) is undefined. Both options, as well as combinations thereof are therefore intended. Any undefined valency on an atom of a structure shown in this application implicitly represents a hydrogen atom bonded to that atom. A bold dot on a carbon atom indicates that the hydrogen attached to that carbon is oriented out of the plane of the paper.

[0247] When a group “R” is depicted as a “floating group” on a ring system, for example, in the formula:then R may replace any hydrogen atom attached to any of the ring atoms, including a depicted, implied, or expressly defined hydrogen, so long as a stable structure is formed. When a group “R” is depicted as a “floating group” on a fused ring system, as for example in the formula: (, then R may replace any hydrogen attached to any of the ring atoms of either of the fused rings unless specified otherwise. Replaceable hydrogens include depicted hydrogens (e.g., the hydrogen attached to the nitrogen in the formula above), implied hydrogens (e.g., ahydrogen of the formula above that is not shown but understood to be present), expressly defined hydrogens, and optional hydrogens whose presence depends on the identity of a ring atom (e.g., a hydrogen attached to group X, when X equals −CH−), so long as a stable structure is formed. In the example depicted, R may reside on either the 5-membered or the 6- membered ring of the fused ring system. In the formula above, the subscript letter “y” immediately following the group “R” enclosed in parentheses, represents a numeric variable. Unless specified otherwise, this variable can be 0, 1, 2, or any integer greater than 2, only limited by the maximum number of replaceable hydrogen atoms of the ring or ring system.

[0248] For the chemical groups and compound classes, the number of carbon atoms in the group or class is as indicated as follows: “Cn” defines the exact number (n) of carbon atoms in the group / class. “C≤n” defines the maximum number (n) of carbon atoms that can be in the group / class, with the minimum number as small as possible for the group / class in question, e.g., it is understood that the minimum number of carbon atoms in the group “alkenyl(C≤8)” or the class “alkene(C≤8)” is two. Compare with “alkoxy(C≤10)”, which designates alkoxy groups having from 1 to 10 carbon atoms. “Cn-n′” defines both the minimum (n) and maximum number (n′) of carbon atoms in the group. Thus, “alkyl(C2-10)” designates those alkyl groups having from 2 to 10 carbon atoms. These carbon number indicators may precede or follow the chemical groups or class it modifies and it may or may not be enclosed in parenthesis, without signifying any change in meaning. Thus, the terms “C5 olefin”, “C5-olefin”, “olefin(C5)”, and “olefinC5” are all synonymous.

[0249] The term “saturated” when used to modify a compound or chemical group means the compound or chemical group has no carbon-carbon double and no carbon-carbon triple bonds, except as noted below. When the term is used to modify an atom, it means that the atom is not part of any double or triple bond. In the case of substituted versions of saturated groups, one or more carbon oxygen double bond or a carbon nitrogen double bond may be present. And when such a bond is present, then carbon-carbon double bonds that may occur as part of keto-enol tautomerism or imine / enamine tautomerism are not precluded. When the term “saturated” is used to modify a solution of a substance, it means that no more of that substance can dissolve in that solution.

[0250] The term “aliphatic” when used without the “substituted” modifier signifies that the compound or chemical group so modified is an acyclic or cyclic, but non-aromatic hydrocarbon compound or group. In aliphatic compounds / groups, the carbon atoms can be joined together in straight chains, branched chains, or non-aromatic rings (alicyclic).Aliphatic compounds / groups can be saturated, that is joined by single carbon-carbon bonds (alkanes / alkyl), or unsaturated, with one or more carbon-carbon double bonds (alkenes / alkenyl) or with one or more carbon-carbon triple bonds (alkynes / alkynyl).

[0251] The term “aromatic” when used to modify a compound or a chemical group atom means the compound or chemical group contains a planar unsaturated ring of atoms that is stabilized by an interaction of the bonds forming the ring.

[0252] The term “alkyl” when used without the “substituted” modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, and no atoms other than carbon and hydrogen. The groups −CH3(Me), −CH2CH3(Et), −CH2CH2CH3(n-Pr or propyl), −CH(CH3)2(i-Pr,iPr or isopropyl), −CH2CH2CH2CH3(n-Bu), −CH(CH3)CH2CH3(sec-butyl), −CH2CH(CH3)2(isobutyl), −C(CH3)3(tert-butyl, t-butyl, t-Bu ortBu), and −CH2C(CH3)3(neo-pentyl) are non-limiting examples of alkyl groups. The term “alkanediyl” when used without the “substituted” modifier refers to a divalent saturated aliphatic group, with one or two saturated carbon atom(s) as the point(s) of attachment, a linear or branched acyclic structure, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. The groups −CH2− (methylene), −CH2CH2−, −CH2C(CH3)2CH2−, and −CH2CH2CH2− are non- limiting examples of alkanediyl groups. An “alkane” refers to the class of compounds having the formula H−R, wherein R is alkyl as this term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH,or −S(O)2NH2. The following groups are non-limiting examples of substituted alkyl groups: −CH2OH, −CH2Cl, −CF3, −CH2CN, −CH2C(O)OH, −CH2C(O)OCH3, −CH2C(O)NH2, −CH2C(O)CH3, −CH2OCH3, −CH2OC(O)CH3,−CH2NH2,−CH2N(CH3)2, and−CH2CH2Cl. The term “haloalkyl” is a subset of substituted alkyl, in which the hydrogen atom replacement is limited to halo (i.e. −F, −Cl, −Br, or −I) such that no other atoms aside from carbon, hydrogen and halogen are present. The group, −CH2Cl is a non-limiting example of a haloalkyl. The term “fluoroalkyl” is a subset of substituted alkyl, in which the hydrogen atom replacement is limited to fluoro such that no other atoms aside from carbon, hydrogen and fluorine are present. The groups −CH2F, −CF3, and −CH2CF3are non-limiting examples of fluoroalkyl groups.

[0253] The term “cycloalkyl” when used without the “substituted” modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, said carbon atom forming part of one or more non-aromatic ring structures, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. Non-limiting examples include: −CH(CH2)2(cyclopropyl), cyclobutyl, cyclopentyl, or cyclohexyl (Cy). The term “cycloalkanediyl” when used without the “substituted” modifier refers to a divalent saturated aliphatic group with two carbon atoms as points of attachment, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. The groupis a non-limiting example of cycloalkanediyl group. A “cycloalkane” refers to the class of compounds having the formula H−R, wherein R is cycloalkyl as this term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH, or −S(O)2NH2.

[0254] The term “alkenyl” when used without the “substituted” modifier refers to an monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched, acyclic structure, at least one nonaromatic carbon-carbon double bond, no carbon-carbon triple bonds, and no atoms other than carbon and hydrogen. Non-limiting examples include: −CH=CH2(vinyl), −CH=CHCH3, −CH=CHCH2CH3, −CH2CH=CH2(allyl), −CH2CH=CHCH3, and −CH=CHCH=CH2. The term “alkenediyl” when used without the “substituted” modifier refers to a divalent unsaturated aliphatic group, with two carbon atoms as points of attachment, a linear or branched, a linear or branched acyclic structure, at least one nonaromatic carbon-carbon double bond, no carbon-carbon triple bonds, and no atoms other than carbon and hydrogen. The groups −CH=CH−, −CH=C(CH3)CH2−, −CH=CHCH2−, and −CH2CH=CHCH2− are non-limiting examples of alkenediyl groups. It is noted that while the alkenediyl group is aliphatic, once connected at both ends, this group is not precluded from forming part of an aromatic structure. The terms “alkene” and “olefin” are synonymous and refer to the class of compounds having the formula H−R, wherein R is alkenyl as this term is defined above. Similarly the terms “terminal alkene” and “α-olefin” are synonymous and refer to an alkene having just one carbon-carbon double bond, wherein that bond is part of a vinyl group at an end of the molecule. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independentlyreplaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH, or −S(O)2NH2. The groups −CH=CHF, −CH=CHCl and −CH=CHBr are non-limiting examples of substituted alkenyl groups.

[0255] The term “alkynyl” when used without the “substituted” modifier refers to a monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, at least one carbon-carbon triple bond, and no atoms other than carbon and hydrogen. As used herein, the term alkynyl does not preclude the presence of one or more non-aromatic carbon-carbon double bonds. The groups −C≡CH, −C≡CCH3, and −CH2C≡CCH3are non-limiting examples of alkynyl groups. An “alkyne” refers to the class of compounds having the formula H−R, wherein R is alkynyl. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3,−OCH2CH3,−C(O)CH3,−NHCH3,−NHCH2CH3,−N(CH3)2,−C(O)NH2,−C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH, or −S(O)2NH2.

[0256] The term “aryl” when used without the “substituted” modifier refers to a monovalent unsaturated aromatic group with an aromatic carbon atom as the point of attachment, said carbon atom forming part of a one or more six-membered aromatic ring structure, wherein the ring atoms are all carbon, and wherein the group consists of no atoms other than carbon and hydrogen. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. Non-limiting examples of aryl groups include phenyl (Ph), methylphenyl, (dimethyl)phenyl, −C6H4CH2CH3(ethylphenyl), naphthyl, and a monovalent group derived from biphenyl. The term “arenediyl” when used without the “substituted” modifier refers to a divalent aromatic group with two aromatic carbon atoms as points of attachment, said carbon atoms forming part of one or more six-membered aromatic ring structure(s) wherein the ring atoms are all carbon, and wherein the monovalent group consists of no atoms other than carbon and hydrogen. As used herein, the term does not preclude the presence of one or more alkyl, aryl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via oneor more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). Non-limiting examples of arenediyl groups include:

[0257] An “arene” refers to the class of compounds having the formula H−R, wherein R is aryl as that term is defined above. Benzene and toluene are non-limiting examples of arenes. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH, or −S(O)2NH2.

[0258] The term “aralkyl” when used without the “substituted” modifier refers to the monovalent group −alkanediyl−aryl, in which the terms alkanediyl and aryl are each used in a manner consistent with the definitions provided above. Non-limiting examples are: phenylmethyl (benzyl, Bn) and 2-phenyl-ethyl. When the term aralkyl is used with the “substituted” modifier one or more hydrogen atom from the alkanediyl and / or the aryl group has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2,−NO2,−CO2H,−CO2CH3,−CN, −SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH,or −S(O)2NH2. Non-limiting examples of substituted aralkyls are: (3-chlorophenyl)-methyl, and 2-chloro-2-phenyl-eth-1-yl.

[0259] The term “heteroaryl” when used without the “substituted” modifier refers to a monovalent aromatic group with an aromatic carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heteroaryl group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. Heteroaryl rings may contain 1, 2, 3, or 4 ring atoms selected from are nitrogen, oxygen, and sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to thearomatic ring or aromatic ring system. Non-limiting examples of heteroaryl groups include furanyl, imidazolyl, indolyl, indazolyl (Im), isoxazolyl, methylpyridinyl, oxazolyl, phenylpyridinyl, pyridinyl (pyridyl), pyrrolyl, pyrimidinyl, pyrazinyl, quinolyl, quinazolyl, quinoxalinyl, triazinyl, tetrazolyl, thiazolyl, thienyl, and triazolyl. The term “N-heteroaryl” refers to a heteroaryl group with a nitrogen atom as the point of attachment. The term “heteroarenediyl” when used without the “substituted” modifier refers to an divalent aromatic group, with two aromatic carbon atoms, two aromatic nitrogen atoms, or one aromatic carbon atom and one aromatic nitrogen atom as the two points of attachment, said atoms forming part of one or more aromatic ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Non-limiting examples of heteroarenediyl groups include:

[0260] A “heteroarene” refers to the class of compounds having the formula H−R, wherein R is heteroaryl. Pyridine and quinoline are non-limiting examples of heteroarenes. When these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3,−OCH2CH3,−C(O)CH3,−NHCH3,−NHCH2CH3,−N(CH3)2,−C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH, or −S(O)2NH2.

[0261] The term “heterocycloalkyl” when used without the “substituted” modifier refers to a monovalent non-aromatic group with a carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more non-aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heterocycloalkyl group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. Heterocycloalkyl rings may contain 1, 2, 3, or 4 ring atoms selected from nitrogen, oxygen, or sulfur. If more than one ring is present, the rings may befused or unfused. As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non-limiting examples of heterocycloalkyl groups include aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydrofuranyl, tetrahydrothiofuranyl, tetrahydropyranyl, pyranyl, oxiranyl, and oxetanyl. The term “N-heterocycloalkyl” refers to a heterocycloalkyl group with a nitrogen atom as the point of attachment. N-pyrrolidinyl is an example of such a group. The term “heterocycloalkanediyl” when used without the “substituted” modifier refers to an divalent cyclic group, with two carbon atoms, two nitrogen atoms, or one carbon atom and one nitrogen atom as the two points of attachment, said atoms forming part of one or more ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non-limiting examples of heterocycloalkanediyl groups include:When these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH, or −S(O)2NH2.

[0262] The term “acyl” when used without the “substituted” modifier refers to the group −C(O)R, in which R is a hydrogen, alkyl, cycloalkyl, alkenyl, aryl, aralkyl or heteroaryl, as those terms are defined above. The groups, −CHO, −C(O)CH3(acetyl, Ac), −C(O)CH2CH3, −C(O)CH2CH2CH3, −C(O)CH(CH3)2, −C(O)CH(CH2)2, −C(O)C6H5, −C(O)C6H4CH3, −C(O)CH2C6H5, −C(O)(imidazolyl) are non-limiting examples of acyl groups. A “thioacyl” is defined in an analogous manner, except that the oxygen atom of thegroup −C(O)R has been replaced with a sulfur atom, −C(S)R. The term “aldehyde” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a −CHO group. When any of these terms are used with the “substituted” modifier one or more hydrogen atom (including a hydrogen atom directly attached to the carbon atom of the carbonyl or thiocarbonyl group, if any) has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH,or −S(O)2NH2. The groups, −C(O)CH2CF3, −CO2H (carboxyl), −CO2CH3(methylcarboxyl), −CO2CH2CH3, −C(O)NH2(carbamoyl), and −CON(CH3)2, are non-limiting examples of substituted acyl groups.

[0263] The term “alkoxy” when used without the “substituted” modifier refers to the group −OR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: −OCH3(methoxy), −OCH2CH3(ethoxy), −OCH2CH2CH3, −OCH(CH3)2(isopropoxy), −OC(CH3)3(tert-butoxy), −OCH(CH2)2, −O−cyclopentyl, and −O−cyclohexyl. The terms “cycloalkoxy”, “alkenyloxy”, “alkynyloxy”, “aryloxy”, “aralkoxy”, “heteroaryloxy”, “heterocycloalkoxy”, and “acyloxy”, when used without the “substituted” modifier, refers to groups, defined as −OR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, and acyl, respectively. The term “alkoxydiyl” refers to the divalent group −O−alkanediyl−, −O−alkanediyl−O−, or −alkanediyl−O−alkanediyl−. The term “alkylthio” and “acylthio” when used without the “substituted” modifier refers to the group −SR, in which R is an alkyl and acyl, respectively. The term “alcohol” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a hydroxy group. The term “ether” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with an alkoxy group. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has beenindependently replaced by−OH, −F, −Cl, −Br, −I, −NH2,−NO2,−CO2H,−CO2CH3,−CN,−SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2, −C(O)NHCH3, −C(O)N(CH3)2, −OC(O)CH3, −NHC(O)CH3, −S(O)2OH,or −S(O)2NH2.

[0264] The term “alkylamino” when used without the “substituted” modifier refers to the group −NHR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: −NHCH3and −NHCH2CH3. The term “dialkylamino” when used without the “substituted” modifier refers to the group −NRR′, in which R and R′ can be the same or different alkyl groups, or R and R′ can be taken together to represent an alkanediyl. Non- limiting examples of dialkylamino groups include: −N(CH3)2and −N(CH3)(CH2CH3). Theterms “cycloalkylamino”, “alkenylamino”, “alkynylamino”, “arylamino”, “aralkylamino”, “heteroarylamino”, “heterocycloalkylamino”, “alkoxyamino”, and “alkylsulfonylamino” when used without the “substituted” modifier, refers to groups, defined as −NHR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, alkoxy, and alkylsulfonyl, respectively. A non-limiting example of an arylamino group is −NHC6H5. The term “alkylaminodiyl” refers to the divalent group −NH−alkanediyl−, −NH−alkanediyl−NH−, or −alkanediyl−NH−alkanediyl−. The term “amido” (acylamino), when used without the “substituted” modifier, refers to the group −NHR, in which R is acyl, as that term is defined above. A non-limiting example of an amido group is −NHC(O)CH3. The term “alkylimino” when used without the “substituted” modifier refers to the divalent group =NR, in which R is an alkyl, as that term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom attached to a carbon atom has been independently replaced by −OH, −F, −Cl, −Br, −I, −NH2, −NO2, −CO2H, −CO2CH3, −CN, −SH, −OCH3, −OCH2CH3, −C(O)CH3, −NHCH3, −NHCH2CH3, −N(CH3)2, −C(O)NH2,−C(O)NHCH3,−C(O)N(CH3)2,−OC(O)CH3,−NHC(O)CH3,−S(O)2OH, or −S(O)2NH2. The groups −NHC(O)OCH3and −NHC(O)NHCH3are non-limiting examples of substituted amido groups.

[0265] The use of the word “a” or “an,” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”

[0266] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

[0267] As used in this application, the term “average molecular weight” refers to the relationship between the number of moles of each polymer species and the molar mass of that species. In particular, each polymer molecule may have different levels of polymerization and thus a different molar mass. The average molecular weight can be used to represent the molecular weight of a plurality of polymer molecules. Average molecular weight is typically synonymous with average molar mass. In particular, there are three major types of average molecular weight: number average molar mass, weight (mass) average molar mass, and Z- average molar mass. In the context of this application, unless otherwise specified, the average molecular weight represents either the number average molar mass or weight average molar mass of the formula. In some embodiments, the average molecular weight is thenumber average molar mass. In some embodiments, the average molecular weight may be used to describe a PEG component present in a lipid.

[0268] The terms “comprise,” “have” and “include” are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as “comprises,” “comprising,” “has,” “having,” “includes” and “including,” are also open-ended. For example, any method that “comprises,” “has” or “includes” one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps.

[0269] The term “effective,” as that term is used in the specification and / or claims, means adequate to accomplish a desired, expected, or intended result. “Effective amount,” “Therapeutically effective amount” or “pharmaceutically effective amount” when used in the context of treating a patient or subject with a compound means that amount of the compound which, when administered to a subject or patient for treating a disease, is sufficient to effect such treatment for the disease.

[0270] As used herein, the term “IC50” refers to an inhibitory dose which is 50% of the maximum response obtained. This quantitative measure indicates how much of a particular drug or other substance (inhibitor) is needed to inhibit a given biological, biochemical or chemical process (or component of a process, i.e., an enzyme, cell, cell receptor or microorganism) by half.

[0271] An “isomer” of a first compound is a separate compound in which each molecule contains the same constituent atoms as the first compound, but where the configuration of those atoms in three dimensions differs.

[0272] As used herein, the term “patient” or “subject” refers to a living mammalian organism, such as a human, monkey, cow, sheep, goat, dog, cat, mouse, rat, guinea pig, or transgenic species thereof. In certain embodiments, the patient or subject is a primate. Non- limiting examples of human subjects are adults, juveniles, infants and fetuses.

[0273] As generally used herein “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and / or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0274] “Pharmaceutically acceptable salts” means salts of compounds of the present invention which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid,phosphoric acid, and the like; or with organic acids such as 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, 2-naphthalenesulfonic acid, 3-phenylpropionic acid, 4,4'-methylenebis(3-hydroxy-2-ene-1-carboxylic acid), 4-methylbicyclo[2.2.2]oct-2-ene- 1-carboxylic acid, acetic acid, aliphatic mono- and dicarboxylic acids, aliphatic sulfuric acids, aromatic sulfuric acids, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, carbonic acid, cinnamic acid, citric acid, cyclopentanepropionic acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, heptanoic acid, hexanoic acid, hydroxynaphthoic acid, lactic acid, laurylsulfuric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, muconic acid, o-(4-hydroxybenzoyl)benzoic acid, oxalic acid, p-chlorobenzenesulfonic acid, phenyl-substituted alkanoic acids, propionic acid, p-toluenesulfonic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, tartaric acid, tertiarybutylacetic acid, trimethylacetic acid, and the like. Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine and the like. It should be recognized that the particular anion or cation forming a part of any salt of this invention is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (P. H. Stahl & C. G. Wermuth eds., Verlag Helvetica Chimica Acta, 2002).

[0275] The term “pharmaceutically acceptable carrier,” as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a chemical agent.

[0276] “Prevention” or “preventing” includes: (1) inhibiting the onset of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, and / or (2) slowing the onset of the pathology or symptomatology of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease.

[0277] A “repeat unit” is the simplest structural entity of certain materials, for example, frameworks and / or polymers, whether organic, inorganic or metal-organic. In thecase of a polymer chain, repeat units are linked together successively along the chain, like the beads of a necklace. For example, in polyethylene, -[-CH2CH2-]n-, the repeat unit is −CH2CH2−. The subscript “n” denotes the degree of polymerization, that is, the number of repeat units linked together. When the value for “n” is left undefined or where “n” is absent, it simply designates repetition of the formula within the brackets as well as the polymeric nature of the material. The concept of a repeat unit applies equally to where the connectivity between the repeat units extends three dimensionally, such as in metal organic frameworks, modified polymers, thermosetting polymers, etc. Within the context of the dendrimer, the repeating unit may also be described as the branching unit, interior layers, or generations. Similarly, the terminating group may also be described as the surface group.

[0278] A “stereoisomer” or “optical isomer” is an isomer of a given compound in which the same atoms are bonded to the same other atoms, but where the configuration of those atoms in three dimensions differs. “Enantiomers” are stereoisomers of a given compound that are mirror images of each other, like left and right hands. “Diastereomers” are stereoisomers of a given compound that are not enantiomers. Chiral molecules contain a chiral center, also referred to as a stereocenter or stereogenic center, which is any point, though not necessarily an atom, in a molecule bearing groups such that an interchanging of any two groups leads to a stereoisomer. In organic compounds, the chiral center is typically a carbon, phosphorus or sulfur atom, though it is also possible for other atoms to be stereocenters in organic and inorganic compounds. A molecule can have multiple stereocenters, giving it many stereoisomers. In compounds whose stereoisomerism is due to tetrahedral stereogenic centers (e.g., tetrahedral carbon), the total number of hypothetically possible stereoisomers will not exceed 2n, where n is the number of tetrahedral stereocenters. Molecules with symmetry frequently have fewer than the maximum possible number of stereoisomers. A 50:50 mixture of enantiomers is referred to as a racemic mixture. Alternatively, a mixture of enantiomers can be enantiomerically enriched so that one enantiomer is present in an amount greater than 50%. Typically, enantiomers and / or diastereomers can be resolved or separated using techniques known in the art. It is contemplated that that for any stereocenter or axis of chirality for which stereochemistry has not been defined, that stereocenter or axis of chirality can be present in its R form, S form, or as a mixture of the R and S forms, including racemic and non-racemic mixtures. As used herein, the phrase “substantially free from other stereoisomers” means that the composition contains ≤ 15%, more preferably ≤ 10%, even more preferably ≤ 5%, or most preferably ≤ 1% of another stereoisomer(s).

[0279] “Treatment” or “treating” includes (1) inhibiting a disease in a subject or patient experiencing or displaying the pathology or symptomatology of the disease (e.g., arresting further development of the pathology and / or symptomatology), (2) ameliorating a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease (e.g., reversing the pathology and / or symptomatology), and / or (3) effecting any measurable decrease in a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease.

[0280] The above definitions supersede any conflicting definition in any reference that is incorporated by reference herein. The fact that certain terms are defined, however, should not be considered as indicative that any term that is undefined is indefinite. Rather, all terms used are believed to describe the invention in terms such that one of ordinary skill can appreciate the scope and practice the present invention. M. Examples

[0281] The following examples are included to demonstrate preferred embodiments of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure. Example 1: Lung SORT LNPs mediate stem cell delivery to achieve durable editing for more than 1.5 years

[0282] To investigate the potential of Lung SORT LNPs to deliver mRNA-encoded gene editors to lung stem cells, Ai14 LoxP-stop-LoxP tdTomato (tdTom) reporter mice (Cheng et al., 2020; Madisen et al., 2010; Miller et al., 2017; Wei et al., 2020; Wang et al., 2022) were used, in which removal of the stop cassette orchestrated by Cre recombinase or CRISPR-Cas9 activates tdTom expression, allowing identification of gene-edited cells (FIG. 1A). Mice were administered Cre mRNA Lung SORT LNPs (LNP-Cre) IV (2 mg / kg, 2 doses 48 hours apart) to evaluate the rates and long-term persistence of genetic changes in the lung after Cre editing. Lung tissues were collected at ten intervals after the second injection, from 2 to 660 days (FIG. 1B) for ex-vivo imaging and flow cytometry. tdTom expression was uniformly spread throughout the mouse lung at every time point (FIG. 1C). tdTomquantification by average radiance (FIG.1D) and total flux (FIG.1E) indicated persistence of the tdTom for the entire 660-day experiment.

[0283] Flow cytometry analysis revealed that mice had durable editing in a diverse array of lung cell types encompassing endothelial cells (CD31+), epithelial cells (EpCAM+), immune cells (CD45+), and stem cells (NGFR+ and KRT5+) (FIG. 2, FIG.3). Over 32% of all lung cells manifested tdTom-positive (tdTom+) expression 48 hours after the second LNP dose (baseline mark), which subsequently escalated to 51% on day 7 and was sustained throughout the 660-day experiment (FIG. 1F). The editing level was consistently high at the 660-day end point (>93% in endothelial, >23% in immune, >48% in epithelial) (FIGs. 1G- 1I). Among EpCAM+NGFR+ stem cells, 28% showed tdTom expression on day 2, climbing to 75% on day 180, and remaining 49-70% for 660 days (FIG. 1J). Within EpCAM+KRT5+ stem cells, 27% displayed tdTom expression at 48 hours, peaking at 97% on day 120 and then remaining between 45-80% for up to 660 days (FIG. 1K). This dynamic tdTom expression within stem cells may be indicative of mouse stem cell turnover rate over different time intervals (Rock et al., 2009; Rock et al., 2010; Zuo et al., 2015; Pooja et al., 2011; Vaughan et al., 2015).

[0284] The general applicability of Lung SORT LNPs was further examined with CRISPR-Cas9 as a second editing approach. Lung SORT LNPs encapsulating Cas9 mRNA and sgTOM1 (Staahl et al., 2017) (2:1, wt:wt) (Table 1). LNP-Cas9 were administered IV to Ai14 reporter mice (2 mg / kg per dose, 3 doses 7 days apart). Following IV administration of Lung SORT LNPs encapsulating Cas9 mRNA and sgTOM1 (Staahl et al., 2017) (2:1, wt:wt) (Table 1) (LNP-Cas9) to Ai14 reporter mice (2 mg / kg per dose, 3 doses 7 days apart), mice were analyzed. LNP-Cas9 mediated in vivo editing yielded persistent tdTom expression across the lungs through the eight-month end point including >16% in whole lung cells, >40% in endothelial cells, >7% in immune cells, >25% in epithelial cells, >10% in stem cells (FIG. 4). Confirming editing of >10% at these levels in stem cells was encouraging since the reporter is expected to underestimate CRISPR-Cas9 induced events: there are 3 sgTOM1 target sites in the stop and only a deletion between the outermost leads to tdTom expression. In addition, analysis of lung immune cell types demonstrated that 22.6% of neutrophils, 41.7% of macrophages, 32.4 dendritic cells, 14.9% B cells, 14.9 CD4+ T cells and 13.5% CD8+ T cells were successfully edited (FIG. 8). As CF is associated with neutrophil abnormality (Yonker et al., 2021) and macrophage dysfunction (Gillan et al., 2023), causing chronic airway inflammation and a progressive decline in lung function, successful lung neutrophil and macrophage correction as shown by the present disclosure may represent auseful approach to anti-inflammatory treatment strategies and therefore be useful in treating chronic disease.

[0285] As mentioned above, LNP-Cas9 editing yielded persistent tdTom expression across the lungs through the eight-month end point including in stem cells (FIG. 4). Regarding tolerability, LNP-Cas9 did not alter kidney and liver function up to 240 days at the tested dose and did not cause tissue damage based on H&E staining of mouse hearts and spleens (2 mg / kg total RNA three times) (FIG. 5). Lung SORT LNPs facilitated delivery to the trachea which is involved in the pathophysiology of lung diseases, albeit at a lower overall rate (12.3%) compared to the bronchus (46.9%) (FIG. 6). Editing was also observed in CF-affected organs including liver, pancreas, kidney, and gastrointestinal tract (FIG. 7). A more in-depth characterization revealed 13.5-41.7% editing in various lung immune cell types (FIG. 8). Moreover, delivery efficacy was unchanged in a bacterial infection model with inflamed lungs (FIG. 9), suggesting that infections common in people with CF may not reduce gene editing. Table 1: Non-limiting Example Sequences of sgRNA used in the present disclosure.Example 2: Long-term Editing of Diverse Cell Types in the Lungs

[0286] The lifespans of both lung endothelial cells and lung-resident immune cells range from a few days to several weeks (Bowden, 1983; Adamson, 1985). The present disclosure provides methods of efficiently editing cell types with high turnover rate for extended periods of time, for example 1.5 years. Without being bound by theory, Lung SORT LNPs of the present disclosure may edit lung-resident endothelial and immune progenitor cells, ultimately leading to a pool of edited mature cells. Leveraging the endothelial progenitor marker CD157 (BST1) (Wakabayashi et al., 2018), tdTom expression was tracked in lung progenitor cells. Over 87% of CD31+CD157+cells expressed tdTom at 48 hours, which rose to 95% by day 7, and was sustained for 660 days (FIG. 10). Studies also indicate existence of a pool of lung-resident hematopoietic stem / progenitor cells marked by Lin- Sca1+c-kit+(LSK) for hematopoietic stem cells (HSCs) and Lin-Sca1-c-kit+for multipotentprogenitors (MPs) (Lefrançais et al., 2017). Following IV administration of LNP-Cre, 74% of lung-resident HSCs and 42% of lung-resident MPs expressed tdTom at 48 hours that persisted over 660 days (FIG.11).

[0287] The lung's epithelial lining is made up of assorted cell types performing distinct roles in preserving lung functionality and homeostasis (Kotton & Morrisey, 2014; Brigid et al., 2014). Key epithelial cell types include alveolar type 1 (AT1) for gas-exchange, type 2 (AT2) for maintaining alveolar homeostasis, goblet cells for mucus production, ciliated cells for mucus removal, club cells for bronchiolar epithelium protection, and rare ionocytes that highly express CFTR (Plasschaert et al., 2018). To delve deeper, lung tissues were harvested at various time points for tissue section imaging (Table 2). Nearly all cell types displayed co-localization of tdTom and their respective cell marker, indicating widespread editing (FIG. 12A). Approximately 18% AT1 cells, 20% AT2 cells, 10% goblet cells, 6% ciliated cells, and 2% club cells showed evidence of editing, which persisted for up to 360 days (FIG. 12B). 21.4% of ionocytes were edited by day 2, increasing to 58% at the 660-day mark (FIG. 13), which is important since ionocytes control airway surface liquid absorption (Yuan et al., 2023; Lei et al., 2023). Whole section images (FIGS.12C-12E), and 3D rendering of the entire lung after LNP-Cre treatment revealed a uniform distribution of tdTom expression throughout the lung lobe. A second reporter mouse, double-fluorescent mTmG (Muzumdar et al., 2007), was used to further visualize and quantify edited cells (~8% by tissue volume) two days after a single LNP-Cre administration that mediated excision to turn on eGFP expression replacing pre-existing tdTom fluorescent proteins (FIG.14), further supporting Lung SORT LNP enabled genome editing. Table 2. Primary antibody staining conditions used for immunofluorescence.Example 3: Delivery is Enhanced in Vitronectin Receptor-expressing Cells

[0288] It is known in the art that SORT LNPs avidly bind distinct plasma proteins after IV administration, thereby facilitating endogenous targeting of organs and cell types (Dilliard et al., 2021). The protein corona of Lung SORT LNPs is most highly enriched in vitronectin (FIG. 15), which aids uptake in vitronectin receptor (VtnR)-expressing cells (Dilliard et al., 2021). Corroborating with that study, pre-incubating Lung SORT LNPs with vitronectin improved transfection of VtnR+human bronchial epithelial (16HBE14o-) cells, but not VtnR- cells (FIG.16). To further study this possible mechanism, VtnR expression was analyzed in vivo. Most lung cell types exhibit high levels of VtnR (25.5% of endothelial, 23.5% of epithelial, 29.5% of EpCAM+NGFR+, and 33.6% of EpCAM+KRT5+cells) (FIG. 12F, FIG.17). However, in the case of CD45+cells, a small proportion (5.0%) express VtnR. To evaluate the correlation between VtnR expression with Lung SORT LNP mediated editing, tdTom activation in VtnR-positive (VtnR+, CD51+CD61+) lung cells was compared to their VtnR-negative (VtnR-, CD51-CD61-) counterparts 24 hours after a single LNP-Cre treatment. Lung SORT LNP delivery to VtnR+epithelial, immune, EpCAM+NGFR+stem, and EpCAM+KRT5+stem cells was greater than to VtnR- fractions (FIGS. 12H-12K) indicative of preferential uptake. However, VtnR+or VtnR- lung endothelial cells were equally transfected by Lung SORT LNPs at the tested dose (FIG. 12G, FIG. 18). Comparing to other organs with <4% VtnR positivity, lung is the most VtnR enriched organ (24.4%), suggesting a role for tissue specificity, especially in non-endothelial cell populations (FIG. 19).

[0289] While VtnR expression may explain enriched uptake of Lung SORT LNPs in lung cells, it might not fully explain lung targeting. Without being bound by theory, giventhat the LNPs will access deeper tissue structures through the vasculature, reduced expression of VtnR in non-lung organs could be one factor that contributes to the lung targeting of Lung SORT LNPs. Work known in the art has demonstrated preferential vascular expression of the vitronectin receptor (VtnR) in the lungs compared to the beds of other organs like the liver and the kidneys (Singh et al., 2000). Comparing to other organs with <4% VtnR positivity, Lung is the most VtnR enriched organ (24.4%) among all tested organs (FIG. 19A). Endothelial cells of various organs displayed no preference for tdTom in VtnR+or VtnR- fraction (FIG. 19B). However, in non-endothelial cell population, tdTom expression was enriched within the VtnR+fraction in heart (24.8% vs 2.9%), lung (23.3% vs 2.9%), liver (88.3% vs 52.4%), spleen (10.4% vs 4.6%), and kidney (24.6% vs 2.7%) (FIG. 19C). These results emphasize the essential role of VtnR-mediated uptake of serum vitronectin-bound lung SORT LNPs in vivo. Example 4: Efficient Editing of Primary Human CF Patient-derived Basal Cells

[0290] Unlike non-CF derived HBE cultures, fully differentiated CF HBE cultures display similar function characteristics associated with CF airway phenotype in vivo, including accumulation of thick sticky mucus and abnormal ion and fluid transport (Neuberger et al., 2011). By measuring CFTR-dependent current changes, the area under the curve (AUC) between forskolin and ivacaftor (VX-770) stimulation, one can quantify the functional restoration of CFTR. In this study, primary HBE culture carrying compound heterozygous mutations, one allele with R553X mutation and the other one with F508del mutation, was used. Therefore, the baseline editing level of C% on the target position in untreated control is 50% (from the F508del allele). As noted below, CFTR modulator Trikafta (elexacaftor / tezacaftor / ivacaftor, standard-of-care for CF persons with at least one F508del allele, or any of the other approved mutations (Middleton et al., 2019)) was used to compare the therapeutic efficacy of LNP-ABE. Further details are provided below.

[0291] To assess the therapeutic potential of Lung SORT LNP for genetic lung diseases, cystic fibrosis (CF), which is caused by mutations in CFTR, was utilized as a representative model. Among editing strategies, base editing does not rely on double-stranded break repair, resulting in minimal undesired editing events, even in non-dividing cells (Gaudelli et al., 2017; Newby & Liu, 2021; Yeh et al., 2018). A base editing strategy (NG- ABE8e), A•T to G•C conversion of the currently untreatable CF nonsense mutation CFTRR553Xto wild-type CFTR, has been reported in cells (Geurts et al., 2020; Krishnamurthy et al., 2021). This therapeutic strategy was applied by co-encapsulating ABE mRNA andsgR553X (Table 1) to correct R553X mutation in primary and immortalized human bronchial epithelial (HBE) cells. In engineered 16HBEge CFTR-R553X cells (51), LNP-ABE (ABE mRNA:sgRNA=2:1, wt / wt) treatment led to 95.0% correction by DNA sequencing at 1.5 μg / well dose (FIG.20).

[0292] Next, the R553X mutation was corrected in primary CF patient-derived human bronchial epithelial (HBE) cells (Gruenert et al., 1995) carrying R553X / F508del compound heterozygous mutations. The difficult-to-treat HBE model differentiates into a pseudostratified epithelium at air-liquid interface (ALI) that mimics characteristics of in vivo airway biology, allowing strong prediction of therapeutic efficacy in humans (Clancy et al., 2019; Van Goor et al., 2009; Van Goor et al., 2011) (FIG. 21A). Following LNP-ABE (1.4 μg total RNA, ABE mRNA:sgRNA=2:1, wt / wt) treatment, approximately 60% allelic correction was achieved in both undifferentiated P2 culture composed mainly of basal cells and fully differentiated P3 culture analyzed by EditR (Kluesner et al., 2018) (FIG. 21B). Using next generation sequencing (NGS) and CRISPResso2 (Clement et al., 2019) analysis, a mean 83.7% frequency of the desired product (C nucleotide at T7) was confirmed, with moderate bystander editing (14.5%) at T11 and no editing at T17 (FIG. 21C). Bystander editing at T11position should be neutral in effect since both GGT and GGC encode glycine (Krishnamurthy et al., 2021).

[0293] To evaluate the CFTR protein expression restoration after LNP-ABE treatment, we performed capillary western blotting (FIG. 21D, FIG. 22). LNP-ABE alone doubled the expression of core glycosylated CFTR (Band B, FIG. 21D-21E) and increased the expression of fully glycosylated, mature CFTR by 5.5-fold (Band C, FIG. 21D and FIG. 21F). Combined treatment with LNP-ABE and the CFTR modulator Trikafta (elexacaftor / tezacaftor / ivacaftor, standard-of-care for CF people with F508del mutations (Middleton et al., 2019)), further increased the expression of fully glycosylated CFTR by 7.8- fold (Band C, FIG.21D and FIG.21F).

[0294] The ability of LNP-ABE to restore HBE function was tested by measuring CFTR-dependent Cl- channel activity 4 weeks after the LNP-ABE treatment using transepithelial current clamp (TECC) assay. LNP-ABE alone effectively restored 53.4% of the CFTR function (AUC 11.6  µA / cm2*min) (FIG. 21G) compared to the activity of wild- type CFTR measured from HBE culture derived from an individual without CF presumed to have 100% CFTR activity (AUC 21.7 µA / cm2*min) (FIG. 21H), which greatly exceeds the widely accepted therapeutic threshold for CFTR activity restoration of > 10% to prevent CF disease symptoms (Rowe et al., 2007; Amaral, 2005; Dreano et al., 2023). CFTR functionwas further boosted to 85% restoration in combination of LNP-ABE and Trikafta (AUC 18.5 µA / cm2*min) (FIG. 21G). Considering the nature of heterozygous CF HBE model, higher efficacy of restoration of CFTR function might be achieved in homozygous model by treating with LNP-ABE alone. Lung SORT LNP delivery was also compared in differentiated HBEs from the apical and basolateral sides using tdTomato mRNA, which confirmed high (>50%) transfection of basal cells (FIG. 23). Basolateral administration was used to mimic in vivo systemic delivery to the lungs, as LNPs can reach the lung stem cells and mature epithelium through intravenous administration (IV) from blood side. . Flow cytometry analysis showed that over 50% of basal cells, 36.8% of club cells, and 9.5% ciliated cells. were transfected from the basolateral side.

[0295] Together, the present disclosure suggests, without being bound by theory, that efficient correction of undifferentiated lung basal cells can successfully produce corrected mature epithelium and restore CFTR function. Furthermore, delivery of gene editor by the presently disclosed compositions through systemic administration could potentially reach lung basal stem cells more effectively than other local delivery approaches. Example 5: In Vivo Stem Cell Editing in CF mouse lungs

[0296] LNP-ABE-mediated editing was evaluated in genetically engineered CF mice harboring the whole human exon 12 containing R553X replacing the endogenous mouse exon (see Methods section) to study R553X correction in the local human sequence context. Despite having the R553X nonsense mutation, the model does not exhibit pathological features in the lung, consistent with other CF mouse models (McHugh et al., 2018). To address this constraint, intestinal stem cells were isolated from homozygous R553X mice and generated intestinal organoids (forskolin-induced swelling (FIS) assay) (McHugh et al., 2018; Dekkers et al., 2013) to assess restoration of CFTR function (FIG. 21I-21K). Forskolin activates CFTR, stimulates intracellular pathways, and phosphorylates CFTR to open the CFTR channel, permitting ion / water uptake and ultimately organoid swelling. Once the mutated CFTR gene is corrected, organoid swelling should be observed, while untreated organoids will remain at the baseline volume. Over 82% of organoids swelled after LNP- ABE treatment.47.8% of A•T to G•C conversion was confirmed by DNA sequencing. These findings demonstrate the capacity of the present invention to remedy pathological features of CF in cells derived from R553X mice.

[0297] To assess the feasibility of base editing in lung stem cells for potential long- lasting effect, heterozygous R553X mice with one allele carrying the locally humanizedR553X mutation and one normal mouse CFTR allele were used. By using a specifically designed pair of primers, only the human R553X region was amplified by PCR for sequencing analysis (Table 3). LNP-ABE was administered IV at 1.5 mg / kg total RNA (ABE mRNA: sgR553X=2:1, weight ratio) (Table 4). Ten days after a single treatment, mouse lungs were collected. Genomic DNA was extracted from whole lungs, trachea, and lung stem cells isolated from whole lung single cell suspension using magnetic based cell separation (FIG. 21N) for PCR amplification and NGS sequencing. 50.0% correction at the desired T7 position in lung stem cells, 12.2% in whole lung, and 28.7% in trachea was quantified (FIG. 21O). These results suggest that in some embodiments LNP-ABE of the present disclosure can efficiently correct the target pathogenic mutation in mouse lung stem cells. Table 3. Primers used for sequencing analyses.

[0298] Table 4. Characterization of Lung SORT LNPs encapsuling ABE mRNA / sgR553X made by vortex mixing or T-mixing.Example 6: Materials and Methods (i) Lipid nanoparticle formulation

[0299] 5A2-SC8 was synthesized and purified by following published protocols (Zhou et al., 2016; Wang et al., 2022). 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE, Cat# 850725) and 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP, Cat# 890890) were purchased from Avanti Polar Lipids. Cholesterol (Cat# C3045) was purchased from Sigma-30 Aldrich. 1,2-Dimyristoyl-rac-glycero-3-methylpolyoxyethylene (DMG-PEG2000, Cat# GM-020) was purchased from NOF America Corporation. D-Lin-MC3- DMA (Cat# 555308) was purchased from MedKoo Biosciences. LNPs were prepared by following published protocol (Wang et al., 2022). In brief, an aqueous phase with RNA cargos was rapidly mixed with an organic phase containing the lipids at a 3:1 volume ratio. The organic phase was prepared by dissolving 5A2-SC8, DOPE, cholesterol, DMG-PEG and DOTAP in ethanol at given molar ratio (32.4:18:36:3.6:10 for in vitro studies; 21.6:12:24:2.4:40 for in vivo studies). The aqueous phase contains RNA cargos in citrate buffer (pH 4). The total lipid to RNA weight ratio was 20:1. LNPs were formed by either vortex mixing or T-mixing, then dialyzed (Pur-A-Lyzer Midi Dialysis Kits, WMCO 3.5 kDa, Cat# PURX35100) against 1 x phosphate buffered saline (PBS) for 3 hours before usage. The particle size, polydispersity index, and zeta potential of LNPs were measured using dynamic light scattering (DLS) (Zetasizer Nano ZS machine, Malvern, v.7.13) and the RNA encapsulation efficiency were measured using Quant-iT RiboGreen RNA assay (Invitrogen, Cat# R11491) following published protocols (Wang et al., 2022). (ii) In vitro transcribed mRNA and chemically modified sgRNA

[0300] mRNAs encoding Cre recombinase, Cas9, NG-ABE8e were synthesized by in vitro transcription (IVT). NG-ABE8e was a gift from Professor David Liu (Addgene plasmid # 138491 ; http: / / n2t.net / addgene:138491 ; RRID:Addgene_138491) (Richter et al., 2020). The coding fragments of each protein were cloned into a pCS2+MT plasmid backbone featuring a SP6 promoter, customized 5’ and 3’ untranslated regions (UTR) as well as a poly(A) segment through NEBuilder HiFi DNA assembly (NEB, Cat# E2621S). IVT was conducted using the MEGAscript SP6 transcription kit (Invitrogen, Cat# AM1330) with N1- methylpseudouridine-5'-triphosphate replacing the typical uridine triphosphate. Next, a Cap1 cap structure was installed to the 5’ end of the mRNA using the Cap1 Capping System (Hongene, Cat# ON-028 & ON-014). Luciferase mRNA and tdTomato mRNA was provided by ReCode Therapeutics. All mRNAs were purified using LiCl and the integrity of the purified mRNAs was monitored by High Sensitivity RNA ScreenTape System (Agilent, Cat# 5067-5579).

[0301] sgRNAs (sgTOM1 and sgR553X) were purchased from and synthesized by Agilent using solid phase synthesis and phosphoramidite chemistry. All sgRNAs were incorporated with end modification (3 x 2′-O-methyl-3′-phosphorothioate (MS) on 5’ end and 3 x 2′-O-methyl-3′-phosphonoacetat (MP) on 3’ end (Ryan et al., 2022)). Heavily modified sgR553X (HM sgR553X) was utilized for in vivo base editing experiment by following apreviously reported modification pattern (Yin et al., 2017). The sequences of sgRNA used are shown in Table 1. (iii) Animal experiments

[0302] Animal experiments were approved by the Institution Animal Care and Use Committee of The University of Texas Southwestern Medical Center under animal protocols (#2016-101430 and # 2016-101897) or the Institutional Animal Care and Use Committee of Case Western Reserve University under animal protocols (#2014-0064)), and were consistent with local, state, and federal regulations as applicable. Ai14 mice (Strain #:007914, RRID:IMSR_JAX:007914) and mT / mG mice (Strain #:007676, RRID:IMSR_JAX:007676) were purchased from The Jackson Laboratory and bred to maintain the homozygous strains at the UTSW Animal Facility. All animals were maintained on a 12 / 12-h light / dark schedule at a mean temperature of 22 °C. Heterozygous and homozygous R553X CF mice created at Case Western Reserve University were used for in vivo base editing studies at CWRU. All experiments were performed with sample sizes calculated by power analyses. (iv) Cell lines and primary cells

[0303] The immortalized, CFTR wild-type expressing human bronchial epithelial cells, 16HBE14o- (generated by D. Gruenert) was gene edited at the endogenous CFTR locus using CRISPR-Cas9 to create isogenic 16HBEge CFTR R553X and 16HBEge CFTR F508del (M470) cell lines (Valley et al., 2019). The 16HBEge CFTR R553X and 16HBEge CFTR F508del (M470) cells were provided by the Cystic Fibrosis Foundation Therapeutics Lab.

[0304] Primary HBE cells were collected from transplanted lungs from a healthy donor (DD0059J) who has wild-type CFTRwt / wtand an individual with cystic fibrosis (20180717CF) who was heterozygous for CFTRR553X / F508del. Primary HBE cells were provided by the Cystic Fibrosis Foundation Therapeutic Lab. (v) In vivo long-term lung cell editing study

[0305] For gene editing in mice lungs with LNP-Cre, 8-week-old Ai14 mice were randomly allocated to either LNP-Cre-treated group or PBS-treated group. The mice were injected with 200 μL of LNP-Cre formulation at 2 mg / kg (Cre mRNA) twice, 2 days apart. Animals were euthanized at different time points over a total of 660 days (2 days, 7 days, 21 days, 42 days, 60 days, 120 days, 180 days, 270 days,360, and 660 days after the last injection). To study in vivo lung cell editing, lungs were either collected for ex vivo fluorescence imaging (AMI-HTX, Spectral Instruments Imaging) followed by FACS analysis or fixed with 4% PFA for two days followed by 10%-18% sucrose for frozen sectioning with the assistance of the UTSW Histo Pathology Core and immunofluorescence staining withHOPX, MUC5AC, Tubulin, SCGB1A1 and ABCA3 antibodies (Table 2) with assistance provided by the UTSW Tissue Management Core.

[0306] To investigate the potential of Lung SORT LNPs to deliver CRISPR- Cas9 / sgRNA system in Ai14 mice, a previously developed sgRNA (sg298 or sgTOM1, Table 1) was utilized (Staahl et al., 2017). Unlike Cre recombinase, which is highly efficient in LoxP deletion, tdTom activation induced by the CRISPR-Cas9 system necessitates double or triple deletion of the STOP cassettes which underestimates the efficacy of LNP-Cas9- mediated editing. For gene editing in mice lungs with LNP-Cas9, 8-week-old Ai14 mice were randomly allocated to either LNP-Cas9-treated group or PBS-treated group. The mice were injected with 200 μL of LNP-Cre formulation at 2 mg / kg total RNA (Cas9 mRNA:sgTOM1=2:1, wt / wt) three times, one week apart. Animals were euthanized at different time points over a total of 240 days (7 days, 21 days, 60 days, 120 days, 120 days, 240 days after the last injection) (FIG. 4). Lung tissues were collected for FACS analysis to study in vivo lung cell editing, heart and spleen tissues were collected for histopathology evaluation (sections and H&E staining were prepared by UT Southwestern Tissue Management Shared Resource, the slides were scanned using Vectra Polaris from Akoya Biosciences at 20X magnification and digitalized using Phenochart software), and serum separated from whole blood were collected to measure liver function (AST and ALT) and kidney function (BUN and CREA) (analysis performed by the UT Southwestern Metabolic Phenotyping Core) (vi) LNP treatment in mice with acute infection and inflammation in lungs

[0307] The acute infection mouse model was generated by following a published protocol (Abid et al., 2017).8-week-old Ai14 mice were randomly allocated to P. aeruginosa infection group or non-infection group. P. aeruginosa strain PAO1 was obtained from ATCC (Klockgether et al., 2010). Bacteria colonies were streaked onto Trypticase soy agar (TSA) plates from frozen glycerol stocks and incubated overnight at 37°C. Overnight cultures were washed in 150 nM sodium chloride, and the resulting pellets were resuspended in 1 ml of Luria-Bertani (LB) broth. Culture concentrations were determined based on the optical density at 600 nm (OD600) and the previously determined number of CFU for each strain, to give the CFU / OD600. Mice in infection group were inoculated intranasally with 50 ul of P.aeruginosa at 3.5 x 105CFU to generate acute infection model. The previous study found neutrophil number and cytokine expression evaluated 9 h after P. aeruginosa infection in mouse lungs (Abid et al., 2017). To investigate the delivery efficiency of LNP in infected and inflamed lungs, mice were injected with either LNP-Cre formulation at 2 mg / kg (Cre mRNA)or PBS 9 hr post P. aeruginosa infection. Animals were euthanized 24 hr after LNP-Cre treatment, followed by FACS analysis of lung cells to study editing efficiency. (vii) Isolation of single cells from mouse tissues

[0308] Mouse lungs, tracheas and other organs were extracted and immediately placed in ice-cold PBS. These tissues were then cut into small pieces and moved into a 50 mL tube containing 10 mL of 1X lung tissue digestion media [RPMI digestion medium (1:1 vol / vol): RPMI supplemented with 2% wt / vol BSA, 300 U / mL collagenase, and 100 U / mL hyaluronidase]. The 50 mL tube was placed in an incubator set at 37 °C for an hour, with continuous shaking at a speed of 180 rpm. After incubation, the homogenized lung cell solution was agitated using a pipette to disperse any clumps of cells, then it was filtered into a new 50 mL Falcon tube through a 100-micron strainer. The strainer was rinsed using 10 mL of a wash buffer composed of chilled PBS and 2% Fetal Bovine Serum (FBS). Afterwards, the sample was centrifuged at a speed of 1200 rpm for 5 minutes. Following this step, the supernatant was removed, and the remaining cell pellet was reconstituted in 10 mL of the chilled wash buffer. Subsequently, the sample was spun at 1200 rpm for 5 minutes. Next, the cell pellet was treated with 5 mL of 1X RBC lysis buffer (BioLegend, Cat# 420301) at room temperature for 5 minutes to eliminate any red blood cells. After the lysis procedure, 10 mL of wash media was added to the sample, which was subsequently spun at 1200 rpm for another 5 minutes. The final cell pellet, which was now free from red blood cells, was reconstituted in 5 mL of cell staining buffer (BioLegend, Cat# 420201). Finally, the sample was subjected to antibody staining in preparation for flow cytometry.

[0309] To examine whether Lung SORT LNPs facilitate mRNA delivery to the tracheal region of the lung and enable cell editing, LNP-Cre were intravenously administered to Ai14 mice in two successive doses, each being 2 mg / kg 48 hours apart. Tracheas (FIG. 6A) were extracted 48 hours following the final injection, and tdTom expression across various cell types was quantified using flow cytometry. The composition of cells markedly differed between the trachea and bronchus regions of the lung. The trachea harbored more immune cells (~55.8%) and fewer epithelial (~13.7%) and endothelial cells (~8.4%) compared to the bronchus (35.4% immune cells, 28.7% epithelial cells, and 23.5% endothelial cells) (FIG. 6A). Overall, the percentage of total edited cells was lower in the trachea (~12%) compared to the bronchus (~46%) (FIG. 6B). Among the various cell types, barring edited endothelial cells which were 70.7% in the trachea and 88.3% bronchus (high in both trachea and bronchus), the percentage of edited immune cells (5.6% in trachea vs.37.8% in bronchus), epithelial cells (16.4% in trachea vs. 71.7% in bronchus), basal epithelial cells(12.0% in trachea vs. 59.9% in bronchus), and epithelial stem cells (12.2% in trachea vs. 67.9% in bronchus) was lower in the trachea compared to the bronchus region (FIG. 6B-6G). This difference could be attributed to the challenges faced by the lung SORT LNPs in navigating and reaching the tracheal part of the lung. Regardless, Lung SORT LNPs also reach the trachea following IV administration and achieve genome editing. (viii) Antibody staining of single cells from mouse tissues and analysis by flow cytometry

[0310] Single-cell suspensions, derived from the mouse lungs and other organs, were initially blocked with mouse Fc-receptor blocker (Thermo Fisher, Cat# 14-9161-73) for a period of 15 minutes. After that, the cells were marked with a variety of antibodies, namely Alexa Fluor 488-conjugated anti-mouse CD31 (BioLegend, Cat# 102414), Pacific Blue- conjugated anti-mouse CD45 (BioLegend, Cat# 103126), Alexa Fluor 647-conjugated anti- mouse EpCAM (BioLegend, Cat# 118212), APC-conjugated anti-mouse CD157 (BioLegend, Cat# 140207), PerCP Cy5-5-conjugated anti-mouse Sca1 (Invitrogen, Cat# 45-5981-80), Alexa Fluor 700-conjugated anti-mouse CD117 (Thermo Fisher, Cat# 56-1172-80), FITC- conjugated anti-mouse lineage cocktail antibodies (BioLegend, Cat# 133302), unconjugated anti-mouse NGFR (LS Bio, Cat# LS-C179536), PE / Cyanine7-conjugated anti-mouse / rat CD61 (BioLegend, Cat# 104317),Brilliant Violet 711-conjugated anti-mouse CD51 (Fisher Scientific, Cat# BDB740755), FITC-conjugated anti-mouse CD3 (BioLegend, Cat# 100203), FITC-conjugated anti-mouse Ly-6G (BioLegend, Cat# 108405), FITC-conjugated anti-mouse CD11b (BioLegend, Cat# 101205), FITC-conjugated anti-mouse TER-119 (BioLegend, Cat# 116205), APC-conjugated anti-mouse B220 (BioLegend, Cat# 103211), Alexa Fluor 700- conjugated anti-mouse CD8 (Thermo Fisher, Cat# 56-0081-80), PerCP-conjugated anti- mouse CD4 (BioLegend, Cat# 100431), APC-conjugated anti-mouse Ly-6G (BioLegend, Cat# 127613), Alexa Fluor 594-conjugated anti-mouse F4 / 80 (BioLegend, Cat# 123140), PerCP / Cy5.5-conjugated anti-mouse CD11c (BioLegend, Cat# 117327). This labeling process involved incubating a 100 µL portion of the cell suspension with 1 µL these antibodies for 15 minutes, while keeping on ice. Dead cells within the suspension were identified using Ghost Dye Red (Tonbo Bioscience, Cat# 13-0865-T100). Following this, the cell pellet was washed thrice with cell staining buffer to eliminate excess antibodies. The NGFR-stained cells were further stained with a rat secondary Alexa Fluor 488-conjugated antibody (Thermo Fisher, Cat# A48262) for 15 minutes on ice. Finally, the cell pellet was resuspended in 500 µL of cold cell staining buffer and kept on ice until it was ready for analysis through a flow cytometer. The cells were subsequently analyzed using a BectonDickenson (BD) LSR Fortessa flow cytometer. Finally, the data collected from the flow cytometer were processed and analyzed using Flowjo software (BD).

[0311] For intracellular flow cytometry, the EpCAM-stained cell pellet was resuspended in 500 µL of fix / perm solution, part of the BD Fix / Perm kit (BD Bioscience, Cat# 554714) and left on ice for 20 minutes. Following this, the cells were centrifuged at 1200 rpm for 5 minutes to obtain cell pellet. The pellet was then washed three times with 1X fix / perm wash buffer (the kit supplied a 10X concentration, which was diluted to 1X with MilliQ water), before being prepared for antibody staining. Subsequently, 100 µL of the fixed and permeabilized EpCAM-stained cells were incubated with 1 µL of an unconjugated anti- mouse KRT5 antibody (Abcam, Cat# ab52635) for a duration of 30 minutes. After this incubation period, the cells were washed three times with 1X fix / perm wash buffer to remove any surplus antibody, and then resuspended in 100 µL of 1X fix / perm buffer. In the subsequent step, 100 µL of the KRT5-labelled cells were incubated with 1 µL of an Alexa Fluor 488-conjugated anti-rabbit secondary antibody on ice for an additional 30 minutes. Finally, after another three washes with 1X fix / perm wash buffer, the cell pellet was resuspended in 500 µL of cold 1X fix / perm wash buffer and kept on ice until it was ready for analysis through a flow cytometer.

[0312] For intracellular FOXI1 staining, the cell pellet was resuspended in 500 µL of fix / perm solution, part of the BD Fix / Perm kit (BD Bioscience, Cat# 554714) and left on ice for 20 minutes. Following this, the cells were centrifuged at 1200 rpm for 5 minutes to obtain cell pellet. The pellet was then washed three times with 1X fix / perm wash buffer (the kit supplied a 10X concentration, which was diluted to 1X with MilliQ water), before being prepared for antibody staining. Subsequently, 100 µL of the fixed and permeabilized cells were incubated with 1 µL of an Alexa Fluor 647 conjugated anti-mouse FOXI1 antibody (Novus Biologicals, Cat# NBP2-70747AF647) for a duration of 30 minutes. After this incubation period, the cells were washed three times with 1X fix / perm wash buffer to remove any surplus antibody. Finally, the cell pellet was resuspended in 500 µL of cold 1X fix / perm wash buffer and kept on ice until it was ready for analysis by a flow cytometer. (ix) Magnetic cell separation of cells isolated from mouse lungs

[0313] To isolate NGFR positive cells from the snap freezed lungs, the mouse biotin positive selection kit (Stem Cell Technologies, Cat# 17665) was employed according to manufacturer's instructions. In brief, 5 x106RBC-depleted cells were incubated in 100 µL of cell staining buffer (BioLegend, Cat# 420201) with 1 µL of FcR blocker (Thermo Fisher, Cat# 14-9161-73) and 1 µL of biotin-conjugated anti-mouse NGFR antibody (Thermo Fisher,Cat# P75NTR-BIOTIN) at room temperature for 15 minutes. Next, 10 µL of biotin selection cocktail was added to the cell suspension, which was then incubated for another 15 minutes at room temperature. Finally, 5 µL of streptavidin-bound magnetic nanoparticles was added to the cell suspension and incubated for 10 minutes at room temperature. The cell suspension was then adjusted to a total volume of 2.5 mL by adding 2.4 mL of cell staining buffer in a 5 mL falcon tube and was subjected to a magnet for 5 minutes. The magnet was then placed at a 45-degree angle, enabling the supernatant to be decanted off. The NGFR positive cell fraction, which had adhered to the tube, was dislodged from the magnet by washing the tubes with 500 µL of fresh cell staining buffer. Lastly, the magnetic nanoparticles bound cells were centrifuged at 1200 rpm for 5 minutes to obtain the final cell pellet. (x) Immunofluorescence

[0314] For immunofluorescence studies, mouse lung samples were fixed with 4% paraformaldehyde for two days at 4 °C then equilibrated in 10% sucrose for 12 hr followed by 18% sucrose for another 12 hr before proceeding with cryosectioning with assistance from the UTSW Histo Pathology Core. Slides were then stained with HOPX, MUC5AC, Tubulin, SCGB1A1, and ABCA3 antibodies (Table 2) of lung cells and later imaged with assistance from the UTSW Tissue Management Core. The frozen tissues mounted on charged glass slides were dried for 30 minutes at 37 °C on a slide warmer (Slide Moat from Boekel Scientific, model 240000) followed by 15 minutes at room temperature. The slides were rehydrated in a wash buffer (Leica, Cat# AR9590) for 10 minutes and then loaded into the Leica Bond RX. The slides were incubated with unconjugated primary antibody for 20 minutes followed by goat anti-mouse secondary antibody with Alexa Fluor 647 (Biolegend, Cat# 405322, 1:200) or donkey anti-rabbit secondary antibody with Alexa Fluor 647 (Biolegend, Cat# 406414, 1:200) for 30 minutes. All slides were mounted with ProLong Gold Antifade Mountant with DNA Stain DAPI (Invitrogen, Cat# P36931). The slides were scanned using Vectra Polaris from Akoya Biosciences at 20X magnification and digitalized using Phenochart software. Five to six random segments from each whole slide immunofluorescence images for each mouse lung were used to generate quantification analysis. Editing efficiency was calculated as tdTomato+Alexa Fluor 647+cells / Fluor 647+cells and expressed as a percentage. (xi) TissueCyte 3D imaging and analysis

[0315] Inflated lung tissues were prepared by following a published protocol (Klouda et al., 2020) and used for vibratome sectioning and tissuecyte 3D imaging. In brief, mouse trachea was cannulated with 22 g blunt-ended needle and inflated with 2.5–4 mL 2% agarosesolution. The dissected lungs were incubated in 4% paraformaldehyde solution overnight at 4 °C. The next day, the left lobe of the lungs was washed with 1 X PBS at 4 °C and stored for future use.

[0316] A modified agarose embedding method was employed for the lungs used in this study, which incorporated infiltration of the inflated lung with acrylamide prior to agarose embedding. The lungs were soaked overnight at 4 °C in a solution of Surecast (ThermoFisher, Cat# HC2040), with a total concentration of 4% Surecast and 0.5% VA-044 activator, in excess volume (5 mL per lung lobe), diluted in phosphate buffer (PB; 0.42 g / L monobasic sodium phosphate, 0.92 g / L dibasic sodium phosphate). The lungs were then allowed to equilibrate to room temperature for 1 hour while gently shaking. Each lung was transferred to a cryomold (VWR, Cat# 15160-215), which was filled with the prepared acrylamide solution. The mold was covered securely with foil and incubated in an oven at 40 °C for two hours. After polymerization was complete, the excess acrylamide was carefully removed from around the lung. The acrylamide-infused tissue was then embedded in oxidized agarose for vibratome sectioning and TissueCyte imaging as previously described (Ramirez et al., 2019).

[0317] Images of serial tissue sections were collected throughout the volume of the lung using the Tissuecyte 1000 Two-Photon Tomography system with integrated vibratome. Samples were imaged using a two photon laser with 920 nm excitation wavelength and 3- channel PMT detectors (Red >560 nm, Green 500-560 nm, Blue <500 nm) as contiguous overlapping tiles on each serial section. Serial blockface sections were cut with the integrated vibratome (60 hz) spaced 75 μm apart and each serial section was imaged at three Z-focal plane levels spaced 25 μm apart. Contiguous overlapping image tiles for each section and focal plane were stitched using the UT Autostitch software (Tissuevision). Overlapping tile regions were aligned based on xy coordinates and specified overlap parameter (95%) and alpha blended to form the whole section image. Average tile intensity values from the first 60 slices were used to perform brightness adjustment on all tiles prior to stitching to improve section uniformity. Stitched whole section images from the three focal planes collected for each section were downsampled to 1.5 microns per pixel, merged as a maximum intensity projection (MIP), and color adjusted for visual contrast fidelity by eye using a Matlab script. For the Ai14 mouse lung rendering, whole lung volumes of the red channel of the contrast adjusted MIP tissue images were resampled to 800 z slices using bilinear interpolation to improve rendering smoothness, and visualized in Fiji’s 3D viewer. For the mTmG mouse lung rendering, once the merging and color adjustment were complete, a subsample of MIPcolor adjusted section images from the whole lung volume were selected for the training portion of the machine learning based signal segmentation pipeline. Machine learning training for GFP signal segmentation was done in the Ilastik software, using the default parallel random forest implementation. Selected features used as discriminators in the model were Gaussian Smoothing (sigma = 0.3-5.0), Laplacian of Gaussian (sigma = 0.3-5.0), Gaussian Gradient Magnitude (sigma = 0.3-5.0), Difference of Gaussians (sigma = 0.3-5.0), Structure Tensor Eigenvalues (sigma = 0.3-5.0), Hessian of Gaussian Eigenvalues (sigma = 0.3-5.0). In Ilastik, an annotator labeled pixels from selected section images as either GFP signal or background classes (background, tissue autofluorescence, and bubbles). These annotations were used to train the classifier. Once the annotator labeled enough pixels to be satisfied with the classification accuracy, predictions for GFP signal on all of the lung volume sections were exported as 8 bit probability maps: per pixel intensity mappings separated by class, in which higher intensity values represent a higher classifier certainty that the classification of that pixel is correct.

[0318] The exported probability maps were used to perform quantification on the classified GFP signal. Using a thresholded version of the MIP images, a selection mask of the tissue area in the images was created. This mask was applied to the GFP probability map to select predicted GFP signal that was within the tissue boundaries. Then the summed intensity values and summed intensity values per unit volume (mm3) were calculated using a Matlab script. The percent area calculation was done by determining a threshold level (threshold = 101) for the probability map by eye to determine the classifier certainty level where visible GFP signal looked correctly segmented, and then applying the same determined threshold to both samples. Then the total volume of positive thresholded GFP signal within the tissue area was quantified and divided by the total tissue volume using an ImageJ script to obtain the final percent area measurement.

[0319] Whole lung volumes were resampled to 800 – z slices using bilinear interpolation to improve rendering smoothness, and visualized in Fiji’s 3D viewer. (xii) Mass spectrometry proteomics analysis of plasma proteins absorbed on Lung SORT LNPs

[0320] The previously described approach was used to isolate plasma proteins that interact with the Lung SORTLNPs used in this study (Dilliard et al., 2021). In brief, C57BL6 / J mouse plasma (Fisher Scientific, Cat# NC0961764) was added to LNP-Cre solution (1 g / L, total lipid content), at a 1:1 volume ratio and incubated for 15 min at 37 °C. The LNP / plasma mixture was loaded onto a 0.7 M sucrose in MilliQ water cushion of equalvolume to the mixture and centrifuged for 1 hour at 15,300 g and 4 °C. The supernatant was removed, and the pellet was washed with 1× PBS. The pellet was centrifuged at 15,300 g and 4 °C for another 5 min to remove washing buffer. Washing was repeated twice more for a total of three washes. After the final wash, the pellet was resuspended in 2 wt. % SDS. Excess lipids were removed using ReadyPrep 2-D Cleanup (Bio-Rad, Cat# 1632130) following the manufacturer recommended protocol. The resulting pellet was resuspended in 2× Laemmli buffer.

[0321] To prepare the sample for mass spectrometry proteomics, 10 μL of the plasma protein mixture isolated from the LNPs was loaded on to a 4-20% TGX gel. The sample was run at 90 V for 10 min, to enable stacking. To fix and visualize the proteins, the gel was stained with Bio-Safe Coomassie. After 1 hour of destaining, the protein band was cut out using a razor blade and diced into a small cube with a volume of nearly 1 mm3. The cubes were then placed in a 1.5 mL Eppendorf tube and kept at 4 °C until they were analyzed by mass spectrometry at the UTSW Proteomics Core. The protein contents were identified and quantified using a Thermo QExactive HF mass spectrometer. The identified proteins were sorted according to their abundance / MW. A custom Python Script was created to rank the most abundant proteins and plot them as a heat map and classify the physiological classes of the identified proteins. (xiii) LNPs treatment in 16HBE14o- with R553X mutations

[0322] 16HBE14o- human bronchial epithelial cells with R553X mutation were maintained in complete growth media composed of Minimum Essential Medium (Gibco, Cat#11095-072) with 10% Fetal Bovine Serum (Gibco, Cat#26140-079) and 1% Penicillin / Streptomycin (Gibco, Cat#15140-122). Plates and flasks were coated with LHC basal medium (Gibco, Cat#12677-027) with 1.34 μL / mL Bovine serum albumin 7.5% (Gibco, Cat#15260-037), 10 μL / mL Bovine collagen solution, Type 1 (Advanced BioMatrix, Cat#5005-100mL), 10 μL / mL Fibronectin from human plasma (1mg / mL) (Thermofisher, Cat#33016-015) by 2h incubation at 37 °C followed by thorough removal of coating solution and storage at 4 °C up to three months. Cells were thawed into a T75 flask at a seeding density of 1 x 106 per flask in complete growth media and incubated at 37 °C for 3 days until confluency. Medium was changed three times a week. For the LNP-ABEs treatment, cells were seeded onto a 6-well plate with a seeding density of 3 x 105cells / well in 2 mL of complete growth media. Cells were incubated overnight to reach 80% confluency and the media was replaced with fresh complete growth media before LNP-ABEs treatment. For the treatment, 100 µL of LNP-ABE were added to each well at 80% cell confluency stage and 48h post-treatment, 1 mL of complete growth media was added to each well. 72 h post- treatment, cells were collected using TrypLE Express (Gibco, Cat# 12604-021). (xiv) LNP-ABE treatment in undifferentiated HBE cells with CF R553X / F508del mutation

[0323] Cystic fibrosis patient derived HBE cells with compound heterozygous mutation of R553X / F508del (passage 2, P2) were thawed and seeded at 1.3 x 105cells / well on 6-well plates precoated with 3T3 conditioned media (Cell culture core, Rosalind Franklin University of Medicine and Science), with daily maintenance in BEGM Bronchial Epithelial Cell Growth Medium (Lonza, Cat# CC3170). At day 4, undifferentiated cells were treated with 100 µL of 1.4 µg / well of LNP-ABEs, with media change 48 h post-treatment. An untreated group was used as the negative control. Once confluent at day 6, cells were established on transwell inserts for cell differentiation (passage 3, P3) with seeding at 1.5 x 105cells / insert (Corning, #3378; HTS Transwell®-24-well permeable support with 0.4 µm pore polyester membrane and 6.5 mm inserts) with complete growth medium on both apical and basal sides. After 24 hrs, the inserts were changed to a 2% UG Differentiating medium (Cell Culture Core, Rosalind Franklin University of Medicine and Science). After 96 h, cultures were brought to the Air-liquid interface (ALI). Cultures were maintained for 4 weeks with media change every other day. The fully differentiated HBEs were finally detached from the inserts by adding ice-cold Accumax (Cat# 00-4666-56, Thermofisher) and incubating at 37 °C for 30 min for further analyses. (xv) CFTR quantification using JessTM capillary western blot

[0324] P3 R553X / F508del HBE cells were lysed immediately following TECC-24 functional analysis. After removing the media from the basolateral side, cells were washed with 100 µL of 1X DPBS at room temperature. 35 µL of RIPA buffer (Rockland Immunochemical, Cat# MB-077-0050) with 1% HALT (Thermofisher, Cat# 78442), 1% 0.5M EDTA (15575-038), 0.5% Universal Nuclease (Thermofisher, Cat# 88702) was then added directly to the apical side of the insert. After 30 min at 4 °C on a plate shaker, cell lysates were collected, and insoluble fractions were separated by centrifugation at 15,000 rpm for 5 minutes at 4 °C. Supernatant were transferred to new tubes and amount of protein in the cell lysates was measured using a bicinchoninic acid (BCA) assay (Thermofisher, Cat# 23227). The lysates were then diluted to a final concentration of 1.5 µg / µL in a 5x fluorescent master mix (ProteinSimple, EZ standard pack 1), and 3 µL was added per well to the JESS microplate. Polyclonal rabbit IgG anti-human CFTR antibody (Atlas, Cat# HPA021939) was used at 3 µg / mL and the monoclonal mouse IgG2A anti-Vinculin antibody(R&D systems, Cat# MAB6896) was used at 20 µg / mL concentration. For secondary antibodies (ProteinSimple, Anti-Rabbit detection module, Cat# DM-001, and Anti-Mouse detection module, Cat# DM-002), and chemiluminescence were used as per kit instructions. Additional reagents including Ab-diluent, washing buffer, and capillary cartridges were used from the 66-440 kDa Separation Module (SM-W004-1, ProteinSimple, Bio-Techne). The manufacturer’s protocol was followed to perform the JESSTMcapillary western blot instrument (ProteinSimple, Bio-Techne, Minneapolis, MN, USA). The results were analyzed using Compass for Simple Western software. (xvi) Measurement of CFTR function in fully differentiated HBE cells

[0325] Post-treatment, undifferentiated HBE R553X / F508del cells at P3 were subjected to differentiation for 4 weeks. Once differentiated, CFTR function in the HBE cells was measured as transepithelial chloride secretion using a Transepithelial Current Clamp (TECC) and a 24-well electrode manifold (EP Devices). 4 days prior to the small molecule treatment, selected wells were washed with 3 mM DTT (Roche Diagnostics, Cat# 10197777001) for 30 mins at 37 °C. 24 h before the small molecule treatment, cells were washed with 1X DPBS (Gibco, Cat# 14190-144,) for 30 mins at 37 °C then incubated for 24 hours with either Trikafta or control vehicle 0.2% DMSO (Fisher Scientific, Cat# BP231100). To prepare the plate for functional assay, differentiation media was replaced with HEPES buffered F-12 assay medium (pH 7.4) on both apical and basolateral sides. After an incubation of 45 minutes at 37 °C without CO2, the plate was mounted onto a 37 °C heated platform, and transepithelial resistance (Rt) and voltage (Vt) were continuously measured using the TECC device. Baseline values were first measured for 30 minutes, then Rt and Vt were measured (1) for 15 minutes after apical addition of benzamil (Sigma, Cat# 2417) (6 µM final concentration); (2) for 30 minutes after simultaneous apical / basolateral addition of forskolin (Sigma, Cat# F6886) (10 μM final concentration) / VX-770 (Selleckchem chemicals, Cat# S1144) (1 µM final concentration); (3) and for 15 minutes after basolateral addition of bumetanide (Sigma, Cat# B3023) (20 µM final concentration). CFTR functional results are presented as equivalent chloride current (Ieq) which was calculated using Ohm’s law, Ieq = Vt / Rt. (xvii) LNP-tdTom treatment in fully differentiated HBE cells with CF R553X / F508del mutation

[0326] Cystic fibrosis patient derived HBE cells with compound heterozygous mutation of R553X / F508del (passage 2, P2) were thawed and seeded in BEGM growth medium on flasks precoated with 3T3 conditioned media. Once confluent at day 5,undifferentiated cells were established on Falcon inserts with complete growth medium on both apical and basal sides. After reaching full confluency on inserts, cultures were then brought to the Air-liquid interface (ALI) in 2% UG Differentiating medium (Cell Culture Core, Rosalind Franklin University of Medicine and Science). Cultures were maintained for 23 days with media change every other day. Cells were then treated with 50 µL of LNP- tdTom (12 ug tdTom mRNA per well, 30:1 total lipid to mRNA weight ratio) either to the apical side in liquid bolus for 8 h or to the basolateral side containing 650 µL of differential media for 24h. An untreated group was used as the negative control. Cells were finally collected using Accumax (Sigma, #SCR006). (xviii) Antibody staining and analysis by flow cytometry of the treated differentiated HBE cells

[0327] Collected cells were resuspended using the LIVE / DEAD™ Fixable Scarlet (723) Viability Kit (Thermofisher, #L34987) and fixed using 4% PFA for 10 min at RT. Cells were then permeabilized by adding eBioscience™ Permeabilization Buffer (Life Technologies, #00-8333-56) for 10 min at RT. Fc Receptor blocker (Biolegend, Human TrueStain FcX, #422302) was then used to block the cells in staining buffer (permeabilization buffer + 0.5% BSA) for 30 minutes at RT. Cells were first incubated uteroglobin / SCGB1A1 Antibody (Novus Biologicals LLC #MAB4218) for 50 min at RT and goat anti-rat IgG with Alexa Fluor 405 (ABCAM #ab175671) on ice for 30 min . After washing, the cells were marked with a variety of primary antibodies, namely Alexa Fluor 647-conjugated Anti- Cytokeratin 5 antibody (Abcam #ab193895), Alexa Fluor 750-conjugated Acetyl--Tubulin (Lys40) (D20G3) XP Rabbit mAb (Cell Signaling Technology #87488S), Alex Fluor 488 conjugated Mucin 5AC [45M1] mouse mAb (Abcam # ab309610-100UL) for 50 min at RT. After PBS wash and resuspension in PBS 0.5% BSA, samples were subsequently analyzed using a Thermofisher Attune Cytpix flow cytometer. Finally, the data collected from the flow cytometer were processed and analyzed using Flowjo software (BD). (xix) LNPs treatment in A-498, Huh-7 and 16HBE14o- cells

[0328] A-498 cells were obtained from ATCC. Huh-7 cells were a kind gift from Dr. Hao Zhu’s lab. A-498, Huh-7, or 16HBE14o- with F508del mutation were cultured in white- bottom 96-well plates at a density of 1×104cells per well the day before transfection. The white-bottom 96-well plates for 16HBE14o- were pre-coated by coating solution as previously described and all cells were cultured in the medium as recommended by the suppliers. SORT LNPs (5A2-SC8 / DOPE / cholesterol / DMG-PEG / DOTAP=21.6:12:24:2.4:40 molar ratio, total lipids / mRNA = 20 / 1, wt / wt) and non-SORT LNPs(MC3 / DSPC / cholesterol / DMG-PEG=50 / 10 / 38.5 / 1.5 molar ratio, total lipids / mRNA = 20 / 1, wt / wt) containing luciferase (Luc) mRNA were prepared by vertex mixing using published protocol (Wang et al., 2022).

[0329] For vitronectin pre-coating assay, SORT and non-SORT LNPs containing Luc mRNA were incubated with or without 0.25 g vitronectin / g total lipid of human vitronectin (Thermo Fisher, Cat# A14700) for 15 minutes at 37°C. Then the culture was treated with either native LNPs or vitronectin-coated LNPs (25 ng of Luc mRNA per well, n=4). After 24 h, Luc mRNA expression was quantified by ONE-Glo + Tox kits (Promega, Cat# E7120) 24 h after the treatment by following Promega’s standard protocol.

[0330] For vitronectin competitive assay, cells were incubated with human vitronectin by replacing culture media with the vitronectin-contained medium at 0.2 μg vitronectin / mL concentration prior LNP treatment. After 10-min incubation, vitronectin-coated LNPs (0.25 g vitronectin / g total lipid) were added into each well with 25 ng Luc mRNA (n=4). Following 4 h co-incubation, each well was washed with PBS one time and replaced with the fresh medium without vitronectin. After 24 h, Luc mRNA expression was quantified by ONE-Glo + Tox kits (Promega, Cat# E7120) 24 h after the treatment by following Promega’s standard protocol. (xx) Generation of the partially humanized exon replacement R553X mice

[0331] To produce the partially humanized R553X mouse Cftr allele (CftrR553X) we replaced mouse exon 12 and flanking intronic sequences (130 bp upstream; 89 bp downstream) with the corresponding human sequence exon 12 containing the R553X mutation.

[0332] Candidate guide RNAs (gRNA) in the introns surrounding exon 12 of mouse Cftr were tested in vitro using Guide-It gRNA in vitro transcription and screening kit (Takara) and two active guides were chosen (5’-GGCACTTGAGTTTATATGAT-3’ (SEQ ID NO: 7) for intron 11 and 5’-ATCAATTCCAGAGACAGAAC-3’(SEQ ID NO: 8) for intron 12). A targeting vector plasmid was constructed containing the human sequences and 1 kb arms homologous to the mouse genome. The gRNAs (5 ng / μL each; Synthego), targeting vector plasmid (1ng / μL; VectorBuilder) and Cas9 protein (10 ng / μL; PNABio) were injected in the pronucleus of C57BL / 6J zygotes. Embryos were transferred to pseudo-pregnant females. Founders were identified by genotyping and sequencing for correct integration of human exon 12 sequence.

[0333] Mice homozygous for the R553X mutation were created by breeding heterozygous males and females. Genotyping was completed by PCR analysis using DNAextracts from ear biopsies. Genotyping was completed to distinguish between alleles of mouse exon 12 and human exon 12 (R553X). To detect the human exon 12 containing R553X allele (205 bp) primers P1 (5’- AGAAGGAAGATGTGCCTTTCA -3’) (SEQ ID NO: 9) and P2 (5’- CAAATGCTTGCTAGACCAATAATTAGT -3’) (SEQ ID NO: 10) were used. To detect the mouse exon 12 (WT) allele (312 bp) primers P3 (5’- TGGGCTTATGGGTAGTCTTTGA-3’) (SEQ ID NO: 11) and P4 (5’- CAGGAAGCAGAAGAGAAATGTGT -3’) (SEQ ID NO: 12) were used in a single reaction. Primers were selected to surrounding introns since human and mouse exon 12 are highly homologous. PCR reactions were completed for 40 cycles of 95 °C for 30 seconds, 55 °C for 30 seconds and 72 °C for 30 seconds and products were run out on 2% agarose gels. All mice were allowed unrestricted access to water and solid chow (Envigo, Teklad S-2335 breeder diet, Cat# 7904). All animals were maintained on a 12-h light, 12-h dark schedule at a mean ambient temperature of 22 °C and were housed in standard polysulfone microisolator cages in ventilated units with corncob bedding. (xxi) Crypt harvest and intestinal organoid culture

[0334] Intestinal organoids were cultured similar to previously described methods (McHugh et al., 2018). Mice were euthanized by CO2asphyxiation, and 20 cm of intestine measured from the stomach were removed. Fecal matter was flushed from the intestine with Ca2+- and Mg2+-free PBS, and the intestine was flayed using dissecting scissors. The villi were scraped from the small intestine using a microscope slide, and the intestine was cut into ~1 cm segments, which were suspended in 2 mM EDTA in Ca2+- and Mg2+-free PBS. The intestinal segments were incubated on a shaker for 30 minutes at room temperature. The segments were then vortexed at for 10 seconds, allowed to settle, and then the supernatant was removed and stored in a 10 cm dish. This process was repeated until four supernatant fractions were produced. The fractions were inspected under a microscope, and the fraction which was most enriched for crypts was passed through a 70 µm cell strainer. The crypts were pelleted at 1,000xG for 10 minutes, then resuspended in 1:1 mixture of Intesticult Organoid Growth Media (STEMCELL Technologies, Cat# # 06005) and MatriGel (Corning) at a concentration of 10 crypts / µL. The organoids were seeded to 12-well plates, with 70 µL Matrigel:OGM added to each well in 4-5 droplets. The plate was placed in a 37 °C / 5% CO2incubator for 15 minutes to allow the MatriGel to harden. The MatriGel domes were then immersed in 1 mL OGM and returned to the 37 °C / 5% CO2incubator. OGM was changed every 3-4 days, and the organoids were passaged once every 5-7 days.(xxii) R553X correction in intestinal organoids using LNP-ABE

[0335] Organoids were grown in Matrigel droplets in a 12 well plate to approximately 75% confluency with Mouse Intesticult OGM containing 10 μM Y-27632 (STEMCELL Technologies) and 5 μM CHIR 99021 (Sigma-Aldrich). Organoids were released from Matrigel using PBS and centrifugation. Pelleted organoids are resuspended in 1 mL of Acutase (Life Technologies) and incubated at 37 °C for 5 minutes to digest organoids into single cells. Digestion was halted by quenching the Acutase with 2 mL of DMEM media containing 10% FBS. Single stem cells were then placed in an eppedorf tube with 200 µL of OGM containing 0.8 μg of total RNA (ABE mRNA:sgR553X=1:1, wt / wt) and incubated at 37 °C / 5% CO2for 4 hours. Cells and media were then placed in one well of a Matrigel coated 96-well plate. Cells were grown at 37 °C / 5% CO2for approximately 4-5 days until full organoids develop from the surviving single stem cells. Forskolin-induced swelling of the resulting intestinal organoids were carried out as previously described (McHugh et al., 2018; Dekkers et al., 2013), with small modifications. 200 µL OGM containing 20 µM forskolin was added to each well, creating a 10 µM final concentration. Kinetic brightfield images of FIS were acquired under live cell conditions with a Lionheart FX Automated Microscope (Biotek Instruments, Winooski, Vermont). After one hour of FIS, each organoid was scored as either corrected for CFTR activity, if the organoid swelled, or not corrected for CFTR activity, if the organoid did not swell. Eight 96 wells per treatment group were used for each experiment. DNA was isolated from each well for sequencing of the R553X locus. (xxiii) Sanger sequencing analysis

[0336] Passive Cell lysis Buffer (Promega, Cat# E1941) with proteinase K (Thermal Fisher, Cat# EO0492) was used according to the manufacturer’s recommendations to isolate genomic DNA of 16HBEge cells, CFTRR553X / F508delHBE cells through a PCR program (65 °C for 15 min, 95 °C for 10 min). R553X target sequence was amplified using KAPA polymerase (Roche, Cat# 50-196-5243) with the primers listed in Table 3 following a PCR program (95 °C for 5 min; (95 °C for 30 s; 63 °C for 30 s; 72 °C for 30 s) for 35 cycles; 72 °C for 7 min and then keep at 4 °C). 40 ng of gDNA from intestinal organoids derived from R553X homozygous mice was used for the PCR reaction using a Phusion U Green Multiple PCR Master Mix (Thermo Fisher, Cat# F564S) with an amplification program (98 °C for 3 min; (98°C for 10 s; 58°C for 30 s; 72°C for 30 s) for 30 cycles; 72°C for 2 min). The PCR products were purified using Qiagen PCR purification kit (Qiagen, Cat# 28106), then sequenced by the McDermott Center Sequencing core facility at UTSW. The editingefficiency was determined by analyzing the Sanger sequencing results with EditR (http: / / baseeditr.com / ) (Kluesner et al., 2018). (xxiv) Targeted amplicon deep sequencing analysis

[0337] Deep amplicon sequencing was used to measure the on-target base editing efficiency in P3 CFTRR553X / F508delHBE culture and lungs from compound heterozygous R553X mice carrying human exon 12 containing the R553X mutation treated with LNP- ABE. Lung single cells were isolated from the snap frozen R553X mice, then NGFR+cells from bulk lung single cells were isolated from using magnetic cell separation as previously described. Genomic DNA was isolated from lung single cells and NGFR+cell from the bulk lung using NucleoSpin Tissue XS kits (MACHEREY-NAGEL, Cat# 740901.50). The on- target site for human R553X sequence was PCR amplified with primers listed in the supplementary Table 3 with the addition of 8 bp barcodes on both ends.40 ng of gDNA was used for the PCR reaction using a Phusion U Green Multiple PCR Master Mix (Thermo Fisher, Cat# F564S) with an amplification program (98 °C for 3 min; (98 °C for 10 s; 58 °C [R553X mouse] / 63 °C [R553X HBE] for 30 s; 72 °C for 30 s) for 30 cycles; 72 °C for 2 min). PCR products were purified with Qiagen PCR purification kit (Qiagen, Cat# 28106) with 25 μL of DNase free water and quantified by Qubit dsDNA high-sensitivity assay (Invitrogen, Cat# Q33231). Targeted amplicon deep-sequencing library was then prepared and later sequenced by Novogene using Illumina NovaSeq 6000. After demultiplexing, amplicon sequencing data were analyzed with CRISPResso2 (https: / / crispresso.pinellolab.partners.org / ) to determine the editing efficiency (Clement et al., 2019). (xxv) Display items

[0338] The images of lipid nanoparticles, human, mice, lungs, syringes, cells, proteins, plates, and pipettes (FIG.1A, FIG.1B, FIG.4A, FIG.6A, FIG.8A, FIG.14A, FIG. 16A, FIG.16D, FIG.21A, FIG.21I, FIG.21N) were created with BioRender.com. (xxvi) Statistical analyses

[0339] Statistical analyses were performed using Prism 9 (GraphPad Software, version 9.5.1). Data are presented as individual data points or mean + / - standard error of the mean (SEM). Statistical tests were performed in GraphPad Prism 9. A two-tailed unpaired t- test was used for comparison between the respective two groups, one-way ANOVA was used for comparison between three or more groups with one variable. P values less than 0.05 were considered statistically significant. * * * * * * * * * * * * * * * * * * * * *

[0340] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of certain embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.

[0341] While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the disclosure be limited by the specific examples provided within the specification. While the disclosure has been described with reference to the aforementioned specification, the descriptions and illustrations of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. Furthermore, it shall be understood that all aspects of the disclosure are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is therefore contemplated that the disclosure shall also cover any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.REFERENCES Abid et al., Infect. Immun.85, (2017). Adamson, in Toxicology of Inhaled Materials: General Principles of Inhalation Toxicology, H. Witschi, J. D. Brain, Eds. (Springer Berlin Heidelberg, Berlin, Heidelberg, 1985), chap.11, pp.289-317. Amaral, Pediatr. Pulmonol.39, 479-491 (2005). Baden et al., New. Engl. J. Med.384, 403-416 (2020). Bowden, Am. Rev. Respir. Dis.128, S46-S48 (1983). Brigid et al., Cell Stem Cell 15, 123-138 (2014). Cheng et al., Nat. Nanotechnol.15, 313-320 (2020). Clancy et al., J. Cyst. Fibros.18, 22-34 (2019). Clement et al., Nat. Biotechnol.37, 224-226 (2019). Dekkers et al., Nat. Med.19, 939-945 (2013). Dilliard & Siegwart, Nat. Rev. Mater.8, 282-300 (2023). Dilliard et al., Proc. Natl. Acad. Sci. USA 118, e2109256118 (2021). Dreano et al., Eur. Respir. J.62, 2300110 (2023). Gaudelli et al., Nature 551, 464-471 (2017). Geurts et al., Cell Stem Cell 26, 503-510.e507 (2020). Gillan et al., Sci. Adv.9, (2023). Gillmore et al., New. Engl. J. Med.385, 493-502 (2021). Gruenert et al., Am. J. Physiol.268, L347-360 (1995). Hajj & Whitehead, Nat. Rev. Mater.2, 17056 (2017). Hodges & Conlon, Genes Dis 6, 97-108 (2019). Klockgether et al., Journal of Bacteriology 192, 1113-1121 (2010). Klouda et al., Front. Med.7, 343 (2020). Kluesner et al., CRISPR J.1, 239-250 (2018). King et al., Hum. Gene Ther.31, 956-972 (2020). Kotton & Morrisey, Nat. Med.20, 822-832 (2014). Krishnamurthy et al., Nucleic Acids Res 49, 10558-10572 (2021). Lefrançais et al., Nature 544, 105-109 (2017). Lei et al., J. Clin. Invest.133, e171268 (2023). Li et al., Nat. Biotechnol.41, 1410-1415 (2023).Madisen et al., Nat. Neurosci.13, 133-140 (2010). McCarron et al., Gene Ther.30, 469-477 (2023). McHugh et al., Plos One 13, e0199573 (2018). Middleton et al., New. Engl. J. Med.381, 1809-1819 (2019). Mitchell et al., Nat. Rev. Drug Discov.20, 101-124 (2021). Miller et al., Angew. Chem. Int. Ed.56, 1059-1063 (2017). Montoro et al., Nature 560, 319-324 (2018). Muzumdar et al., Genesis 45, 593-605 (2007). Neuberger et al., Methods Mol. Biol.741, 39-54 (2011). Newby & Liu, Mol. Ther.29, 3107-3124 (2021). Patel et al., Adv. Mater.31, 1805116 (2019). Plasschaert et al., Nature 560, 377-381 (2018). Polack et al., New. Engl. J. Med.383, 2603-2615 (2020). Pooja et al., Cell 147, 525-538 (2011). Raguram et al., Cell 185, 2806-2827 (2022). Ramirez et al., Am. J. Physiol. Lung Cell Mol. Physiol.278, L217-L226 (2000). Ran et al., Nat. Protoc.8, 2281-2308 (2013). Ratjen et al., Nat. Rev. Dis. Primers 1, 15010 (2015). Richter et al., Nat. Biotechnol.38, 883-891 (2020). Rock et al., Proc. Natl. Acad. Sci. USA 106, 12771-12775 (2009). Rock et al., Dis. Models Mech.3, 545-556 (2010). Rowe et al., Proc. Am. Thorac. Soc.4, 387-398 (2007). Rurik et al., Science 375, 91-96 (2022). Ryan et al., Biochemistry, (2022). Staahl et al., Nat. Biotechnol.35, 431-434 (2017). Suzuki et al., Mol. Ther.28, 1684-1695 (2020). Valley et al., J. Cyst. Fibros.18, 476-483 (2019). Van Goor et al., Proc. Natl. Acad. Sci. USA 106, 18825-18830 (2009). Van Goor et al., Proc. Natl. Acad. Sci. USA 108, 18843-18848 (2011). Vaughan et al., Nature 517, 621-625 (2015). Wakabayashi et al., Cell Stem Cell 22, 384-397.e386 (2018). Wang & Doudna, Science 379, eadd8643 (2023). Wang et al., Nat. Protoc.18, 265-291 (2022). Wei et al., Nat. Commun.11, 3232 (2020).Wei et al., ACS Nano 14, 9243-9262 (2020). Xu et al., Mol. Ther.25, 1782-1789 (2017). Yeh et al., Nat. Commun.9, (2018). Yin et al., Nat. Biotechnol.35, 1179-1187 (2017). Yonker et al., J. Cyst. Fibros.20, 1062-1071 (2021). Yuan et al., Nature 621, 857-867 (2023). Zhou et al., Proc. Natl. Acad. Sci. USA 113, 520-525 (2016). Zhou et al., eLife 11, e80083 (2022). Zuo et al., Nature 517, 616-620 (2015).

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A composition comprising:(A) a lipid nanoparticle comprising:(1) an ionizable cationic lipid;(2) a sterol;(3) a phospholipid;(4) a polymer conjugated lipid; and(5) a permanently cationic lipid; wherein the lipid nanoparticle comprises a molar ratio of the permanently cationic lipid from about 32 to about 42.5 relative to the entire lipid nanoparticle; and(B) a nucleic acid composition comprising:(1) a mRNA; and(2) a single guide RNA encoding for a gene expressed in lung cells; wherein the nucleic acid composition is encapsulated in the lipid nanoparticle.

2. The composition of claim 1, wherein the composition comprises a molar ratio of the ionizable cationic lipid from about 18 to about 26.

3. The composition of claim 2, wherein the molar ratio of the ionizable cationic lipid is from about 20 to about 24.

4. The composition according to any one of claims 1-3, wherein the composition comprises a molar ratio of the sterol from about 8 to about 16.

5. The composition of claim 4, wherein the molar ratio of the sterol is from about 10 to about 14.

6. The composition according to any one of claims 1-5, wherein the composition comprises a molar ratio of the phospholipid from about 8 to about 16.

7. The composition of claim 6, wherein the molar ratio of the phospholipid is from about 10 to about 14.

8. The composition according to any one of claims 1-7, wherein the composition comprises a molar ratio of the polymer conjugated lipid from about 0.5 to about 8.

9. The composition of claim 8, wherein the molar ratio of the polymer conjugated lipid is from about 2 to about 6.

10. The composition according to any one of claims 1-9, wherein the molar ratio of the permanently cationic lipid is from about 38 to about 42.

11. The composition according to any one of claims 1-10, wherein the ionizable cationic lipid is a dendron.

12. The composition according to any one of claims 1-11, wherein the ionizable cationic lipid is a compound of the formula:or a pharmaceutically acceptable salt thereof, wherein: (a) the core comprises a structural formula (XCore):, wherein: Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or - CR3aR3b-; R2is independently at each occurrence R1gor -L2-NR1eR1f; R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted alkyl; R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted alkyl; L0, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene]-[heterocycloalkyl]-[alkylene], [alkylene]-(arylene)-[alkylene] (e.g., [alkylene]-phenylene-[alkylene]), heterocycloalkyl, and arylene; or, alternatively, part of L1form a heterocycloalkyl with one of R1cand R1d; and x1is 0, 1, 2, 3, 4, 5, or 6; and (b) each branch of the plurality (N) of branches independently comprises a structural formula (XBranch):wherein: * indicates a point of attachment of the branch to the core;g is 1, 2, 3, or 4; Z = 2(g-1); G=0, when g=1; or G when g≠1;(c) each diacyl group independently comprises a structural formula, wherein: * indicates a point of attachment of the diacyl group at the proximal end thereof; ** indicates a point of attachment of the diacyl group at the distal end thereof; Y3is independently at each occurrence an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene; A1and A2are each independently at each occurrence -O-, -S-, or -NR4- , wherein: R4is hydrogen or optionally substituted alkyl; m1and m2are each independently at each occurrence 1, 2, or 3; and R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted alkyl; and (d) each linker group independently comprises a structural formula, wherein: ** indicates a point of attachment of the linker to a proximal diacyl group; *** indicates a point of attachment of the linker to a distal diacyl group; and Y1is independently at each occurrence an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene; and (e) each terminating group is independently selected from optionally substituted alkylthiol, and optionally substituted alkenylthiol.

13. The composition according to any one of claims 1-12, wherein the ionizable cationic lipid is a compound selected from:or pharmaceutically acceptable salts thereof.

14. The composition according to any one of claims 1-13, wherein the phospholipid comprises one or two long chain alkyl or alkenyl groups, a glycerol or a sphingosine, one or two phosphate groups, and a small organic molecule, wherein the small organic molecule is an amino acid, a sugar, or an amino substituted alkoxy group.

15. The composition according to any one of claims 1-14, wherein the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) or 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE).

16. The composition according to any one of claims 1-15, wherein the sterol is cholesterol.

17. The composition according to any one of claims 1-16, wherein the polymer conjugated lipid is a PEG conjugated lipid.

18. The composition of claim 17, wherein the polymer conjugated lipid comprises a polyethylene glycol (PEG) component from about 1000 to about 10,000 daltons.

19. The composition according to any one of claims 1-18, wherein the polymer conjugated lipid is a PEGylated diacylglycerol.

20. The composition according any one of claims 1-19, wherein the polymer conjugated lipid is further defined by the formula:wherein: R12and R13are each independently alkyl(C≤24), alkenyl(C≤24), or a substituted version of either of these groups; Reis hydrogen, alkyl(C≤8), or substituted alkyl(C≤8); and x is 1-250.

21. The composition according to any one of claims 1-20, wherein the permanently cationic lipid is further defined as:wherein: R1and R2are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; R3, R3′, and R3′′ are each independently alkyl(C≤6)or substituted alkyl(C≤6); X−is a monovalent anion.

22. The composition according to any one of claims 1-20, wherein the permanently cationic lipid is further defined as:wherein: R4and R4′ are each independently alkyl(C6-C24), alkenyl(C6-C24), or a substituted version of either group; R4′′ is alkyl(C≤24), alkenyl(C≤24), or a substituted version of either group; R4′′′ is alkyl(C1-C8), alkenyl(C2-C8), or a substituted version of either group; and X2is a monovalent anion.

23. The composition according to any one of claims 1-22, wherein the mRNA encodes for a Cre recombinase.

24. The composition according to any one of claims 1-22, wherein the mRNA encodes for Cas9.

25. The composition according to any one of claims 1-22, wherein the mRNA encodes for an adenine base editor.

26. The composition according to any one of claims 1-25, wherein the sgRNA encodes for a gene that is defective in a disease state.

27. The composition of claim 26, wherein the disease state is a lung disease.

28. The composition according to any one of claims 1-27, wherein the sgRNA encodes for a gene associated with a genetic lung disease.

29. The composition according to any one of claims 1-28, wherein the sgRNA encodes for a wild type version of the gene that is defective in the disease state.

30. The composition according to any one of claims 1-28, wherein the composition is further defined as a composition comprising: (1) an ionizable cationic lipid; wherein the ionizable cationic lipid is a dendron having a core comprising the following structure:and a terminal group comprising an alkyl chain of 8 carbon atoms; and is present in a molar ratio from about 21 to about 22; (2) a sterol; wherein the sterol is cholesterol and is present in a molar ratio from about 23 to about 25; (3) a phospholipid; wherein the phospholipid is 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE) and is present in a molar ratio from about 11 to about 13; (4) a polymer conjugated lipid; wherein the polymer conjugated lipid is DMG-PEG and is present in a molar ratio from about 3 to about 5; and (5) a permanently cationic lipid; wherein the permanently cationic lipid is DOTAP and is present in the molar ratio from about 38 to about 42; and (B) a nucleic acid composition comprising:(1) a mRNA; wherein the mRNA encodes for an adenine base editor; and(2) a single guide RNA encoding for a wild type gene expressed in lung cells; wherein the nucleic acid composition is encapsulated in the lipid nanoparticle.

31. A method of editing the genome of a lung stem cell comprising contacting the lung stem cell with a composition according to any one of claims 1-30 in a therapeutically effective amount.

32. The method of claim 31 , wherein the genome of the lung stem cell contains a gene with a mutation that causes a disease state.

33. The method of either claim 31 or claim 32, wherein the method results in the editing of the genome to the wild type gene.

34. The method according to any one of claims 31-33, wherein the method results in the editing of the genome to result in a gene product that contains at least 25% of the activity of the wild type gene product.

35. The method of claim 34, wherein the gene product contains at least 50% of the activity of the wild type gene product.

36. The method of either claim 34 or claim 35, wherein the gene product has the same activity as the wild type gene product.

37. The method according to any one of claims 31-36, wherein the method results in the editing of at least 20% of the lung stem cells after 120 days.

38. The method of claim 37, wherein at least 50% of the lung stem cells were edited.

39. The method according to any one of claims 31-38, wherein the method results in the editing of one or more other lung cells.

40. The method of claim 39, wherein the one or more other lung cells are endothelial cells, epithelial cells, immune cells, alveolar type 1 cells, alveolar type 2 cells, goblet cells, ciliated cells, club cells, and ionocytes.

41. The method of either claim 39 or claim 40, wherein at least 20% of the one or more lung cells are edited.

42. The method according to any one of claims 39-41, wherein at least 50% of the one or more lung cells are edited.

43. The method according to any one of claims 31-40, wherein the lung stem cells are editing in vivo.

44. The method according to any one of claims 31-43, wherein the editing of the genome results in an edited genome that is present after 30 days.

45. The method of claim 44, wherein the edited genome is present after 90 days.

46. The method of either claim 44 or claim 45, wherein the edited genome is present after 1 year.

47. The method according to any one of claims 31-46, wherein the lung stem cell is a lung basal cell.

48. The method according to any one of claims 31-47, wherein the method may be used to treat a disease or disorder in vivo.

49. The method of claim 49, wherein the disease or disorder is a genetic disease or disorder.

50. The method of either claim 48 or claim 49, wherein the disease or disorder is a genetic lung disease or disorder.

51. The method according to any one of claims 31-50, wherein the method edits the genome of a lung stem cell in a patient.

52. The method of claim 51, wherein the patient is a mammal.

53. The method of claim 52, wherein the mammal is a human.

54. A method of inducing a permanent change in the genome of a lung cell comprising contacting the lung cell with a composition according to any one of claims 1-30 in a therapeutically effective amount.

55. The method of claim 54, wherein the lung cell is a lung stem cell.

56. The method of either claim 54 or claim 55, wherein the method induces a permanent change in the genome of one or more other lung cells.

57. The method of claim 56, wherein the one or more other lung cells are endothelial cells, epithelial cells, immune cells, alveolar type 1 cells, alveolar type 2 cells, goblet cells, ciliated cells, club cells, and ionocytes.

58. The method according to any one of claims 54-57, wherein the permanent change in the genome of the lung cell is retained for at least 30 days.

59. The method of claim 58, wherein the permanent change is retained for at least 60 days.

60. The method of either claim 58 or claim 59, wherein the permanent change is retained for at least 90 days.

61. The method according to any one of claims 58-60, wherein the permanent change is retained for at least one year.

62. The method according to any one of claims 54-61, wherein at least 20% of the lung cells have been edited.

63. The method of claim 62, wherein at least 40% of the lung cells have been edited.

64. The method of either claim 62 or claim 63, wherein at least 60% of the lung cells have been edited.

65. The method according to any one of claims 62-64, wherein at least 80% of the lung cells have been edited.

66. The method according to any one of claims 54-66, wherein the change in the genome of the lung cell results in the increase of function of one or more gene products relative to the wild type gene product.

67. The method of claim 66, wherein the change in the genome of the lung cell results in an increase in function of one or more gene products of at least 20%.

68. The method of either claim 66 or claim 67, wherein the change in the genome of the lung cell results in an increase in function of one or more gene products of at least 40%.

69. The method according to any one of claims 66-68, wherein the change in the genome of the lung cell results in an increase in function of one or more gene products of at least 80%.

70. The method according to any one of claims 54-69, wherein the method results in no measurable change in the function of one or more other tissue types.

71. The method of claim 70, wherein the one or more other tissue types is liver, heart, spleen, or kidney.

72. A method of treating a lung disease or disorder in a patient in need thereof comprising contacting the patient with a therapeutically effective amount of a composition according to any one of claims 1-30.

73. The method of claim 72, wherein the lung disease or disorder is a genetic lung disease or disorder.

74. The method of claim 73, wherein the genetic lung disease or disorder is associated with gene that results in a non-functional gene product.

75. The method according to any one of claims 72-74, wherein the lung disease or disorder is cystic fibrosis.

76. The method of either claim 74 or claim 75, wherein the gene product is cystic fibrosis transmembrane conductance regulator.

77. The method of claim 76, wherein the lung disease or disorder is a cancer of the lungs, bronchi, pharynx, trachea, sinus, larynx, bronchiole, or nose.

78. The method according to any one of claims 72-74, wherein the lung disease or disorder is hereditary emphysema or chronic obstructive pulmonary disease (COPD).

79. The method according to any one of claims 72-74, wherein the lung disease or disorder is pulmonary fibrosis, alpha-1 antitrypsin deficiency, sarcoidosis, pulmonary arterial hypertension, lymphangioleiomyomatosis, familial interstitial pneumonia, pleiotropic clinical presentation, including Hermansky-Pudlak syndrome, neurofibromatosis, tuberous sclerosis, Niemann-Pick disease, Gaucher disease, familial hypocalciuric hypercalcemia, familial SP-C mutation, or dyskeratosis congenita.

80. The method according to any one of claims 72-79, wherein the patient is a mammal.

81. The method of claim 80, wherein the patient is a human.

82. A method of treating a genetic lung disease or disorder in a patient in need thereof comprising contacting the patient with a therapeutically effective amount of a composition according to any one of claims 1-30.

83. The method of claim 82, wherein the genetic lung disease or disorder is cystic fibrosis, hereditary emphysema, or chronic obstructive pulmonary disease (COPD).

84. The method of either claim 82 or claim 83, wherein the genetic lung disease or disorder is cystic fibrosis.

85. The method of claim 84, wherein the patient in need thereof has a CFTR mutation selected from the group consisting of ΔF508, G542X, N1303K, W1282X, E56K, G178R, S549R, K1060T, G1244E, P67L, E193K, G551D, A1067T, S1251N, R74W, L206W, G551S, G1069R, S1255P, D110E, R347H, D579G, R1070Q, D1270N, D110H, R352Q, S945L, R1070W, G1349D, R117C, A455E, S977F, F1074L, R117H, S549N, F1052V, and D1152H.

86. The method of claim 85, wherein the mutation is ΔF508, G542X, G551D, N1303K, or W1282X.

87. A method of treating cystic fibrosis in a patient in need thereof comprising contacting the patient with a therapeutically effective amount of a composition according to any one of claims 1-30.

88. The method according to any one of claims 72-87, wherein the method comprises further administering one or more additional therapeutic agents.

89. The method according to any one of claims 72-88, wherein the composition has been administered once.

90. The method according to any one of claims 72-88, wherein the composition has been administered two or more times.

91. A method of increasing the function of a cystic fibrosis transmembrane conductance regulator (CFTR) in a patient comprising administering to the patient a therapeutically effective amount of a composition according to any one of claims 1-30.

92. A method of editing the genome of a lung cell to correct a mutation in the gene that encodes for the cystic fibrosis transmembrane conductance regulator (CFTR) protein in a patient comprising administering to the patient a therapeutically effective amount of a composition according to any one of claims 1-30.

93. A method of editing a genome of a cell with one or two copies of a gene that encodes for a defective cystic fibrosis transmembrane conductance regulator (CFTR) protein in a patient comprising administering to the patient a therapeutically effective amount of a composition according to any one of claims 1-30, wherein the therapeutic effective amount results in the change in the genome of the cell to a functional cystic fibrosis transmembrane conductance regulator (CFTR) protein.