High-throughput method for mitochondria DNA isolation from plant seeds

The method of selectively binding nuclear DNA to a solid phase using Cerium oxide nanopowder addresses the inefficiencies of existing mitochondrial DNA isolation techniques, enabling high-throughput and contamination-free extraction for downstream applications.

WO2025264737A1PCT designated stage Publication Date: 2025-12-26SYNGENTA CROP PROTECITON AG +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/034068
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-20
Filing Date
2025-06-18
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Existing methods for isolating mitochondrial DNA from plant seeds are time-consuming, expensive, and prone to nuclear DNA contamination, limiting their applicability in high-throughput applications.

Method used

A method involving the selective binding of nuclear DNA to a solid phase, such as Cerium oxide nanopowder, allowing for the separation of mitochondrial DNA in a high-throughput manner by using an alkaline adsorption buffer to leave mitochondrial DNA in solution.

Benefits of technology

Enables efficient and high-throughput extraction of mitochondrial DNA from plant seeds, virtually free of nuclear DNA contamination, suitable for downstream analyses like real-time PCR and genotyping.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025034068_26122025_PF_FP_ABST
    Figure US2025034068_26122025_PF_FP_ABST
Patent Text Reader

Abstract

The invention relates to methods of extracting mitochondrial DNA from whole seeds virtually free of nuclear DNA in a high-throughput environment. Methods also relate to the use of a solid phase nuclear DNA binder to selectively remove nuclear DNA from a sample solution comprising dry seed powder resuspended in an alkaline adsorption buffer and extracting mitochondrial DNA from a supernatant of the sample solution treated with the solid phase nuclear DNA binder. The solid phase nuclear DNA binder comprises Cerium oxide powder or Iron Oxide powder in particular embodiments.
Need to check novelty before this filing date? Find Prior Art

Description

Docket No. PAT-109841-WO-SEC-1 HIGH-THROUGHPUT METHOD FOR MITOCHONDRIA DNA ISOLATION FROM PLANT SEEDS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to, and the benefit of, U.S. Provisional Patent Application No.63661920, titled Method for mitochondrial DNA extraction, filed on June 20, 2024, the contents of which are incorporated by reference herein in their entirety. FIELD OF THE INVENTION

[0002] The presently disclosed subject matter relates to methods of isolating mitochondrial DNA from whole seeds (e.g., crop plant seeds) virtually free of any contaminating levels of nuclear DNA. The isolated mitochondrial DNA can be subjected to downstream analyses, including real-time PCR, quantitative PCR, SNP discovery and detection, and genotyping. BACKGROUND

[0003] Heterosis (also known as hybrid vigor) in plants is a primary goal of modern plant breeding. Breeders cross a variety of individual plants in the hope of obtaining progeny hybrid plants which display improved characteristics compared to either parent, i.e., heterosis. These heterosis characteristics may include increased yield, increased reproductive ability, increase in size, earlier flowering and maturity, greater resistance to disease and pests, faster growth rate, and others. However, plants are capable of self-fertilization, which leads to progeny inbred plants. This phenomenon reduces the total number of progeny hybrid plants which can be successfully screened for heterosis.

[0004] In order to reduce the frequency of self-fertilization (and increase the number of cross- fertilization events), breeders create physical barriers to self-fertilization. For example, a breeder may plant the parent plants in different plots and hand-carry the pollen from one plant to another. Additionally, the male reproductive organs may be physically removed or chemically rendered inert so as to prevent self-fertilization events. Another alternative is to use a cytoplasmic male sterile (“CMS”) system. See, for example, U.S. Patent No.3,842,538 (issued Oct.22, 1974).

[0005] Briefly, using a CMS breeding system prevents self-fertilization events from occurring as frequently. A CMS breeding system requires three lines: a mother line, a father line, and aDocket No. PAT-109841-WO-SEC-1 maintainer line. The mother line is cytoplasmically male sterile, conferred by mutations in the mitochondria of the line. In a typical CMS-enabled breeding program, the mother line requires generational maintenance by crossing with a maintainer line, which is not cytoplasmically male sterile but is homozygous recessive for restorer genes. This cross creates next-generation plants comprising the mother line’s mitochondria, conferring cytoplasmic male sterility. When the breeder is ready to create a hybrid line, a father line is crossed with the mother line. The father line is at least heterozygous dominant for restorer genes. Because the mother line cannot be self- fertilized, F1 seeds produced must be by a cross with the father line. And because the father line possesses restorer genes, the F1 progeny is both male and female fertile.

[0006] There are many reasons beyond CMS breeding systems analyzing the mitochondrial DNA in the absence of genomic DNA, including mitochondrial genome sequencing. In some plant species, particularly wheat, understanding mitochondrial differences at the genetic level is very difficult—or impossible—to determine without first isolating the mitochondria. This is because during the course of evolution mitochondria and host genomes have shared their genetic codes through recombination events and gene transfer. Therefore, to analyze mitochondria requires performing sophisticated tissue separation, mitochondria isolation, and only then performing genetic analysis.

[0007] Methods of mitochondrial DNA (mtDNA) extraction known in the art include, at a minimum, isolating the embryo from a seed because the remainder of the seed (e.g., the endosperm, pericarp or seed coat, or other seed portions) would interfere with mtDNA isolation. Additionally, known methods in the art teach isolating mitochondria organelles using several time-consuming centrifugation steps, including ultracentrifugation steps. See, e.g., Zaheer Ahmed and Yong-Bi Fu, An improved method with a wider applicability to isolate plant mitochondria for mtDNA extraction, PLANT METHODS (2015) 11:56. One issue with such prior art methods is that the requirements prevent the methods from being performed in a high- throughput manner.

[0008] Another method, described by Yu et. al. in US Pat Pub. No.2020 / 0236885 A1, extracts mtDNA from dry seeds relying primarily on low-speed centrifugation. However, methods that do not use ultracentrifugation can result in mitochondrial DNA contamination with nuclear DNA. While DNAase treatment can be used to remove the contamination, it may be difficult to balance the conflicting requirements of needing to keep the DNase active for long enough to remove theDocket No. PAT-109841-WO-SEC-1 contaminating nuclear DNA and inactivating the DNAse quickly enough to avoid digestion of the mtDNA. Still other approaches rely on alcohol precipitation of DNA and extraction with magnetic beads. However, magnetic beads-based approaches for mtDNA isolation can be time- consuming and expensive.

[0009] Still other methods for separating mitochondrial DNA from nuclear DNA involve the use of density gradient centrifugation, for example, cesium chloride density gradient centrifugation. Therein, total DNA is loaded onto a cesium chloride density gradient and centrifuged for 10 hours at 450,000 x g to separate the DNA by size. The result of this ultracentrifugation is two distinct bands of DNA: a higher nuclear DNA band and a lower mitochondrial DNA band. In some protocols, ethidium bromide may be added to enhance the density differential, permitting better visualization of the DNA. Mitochondrial DNA is then collected by inserting a needle into the tube at the appropriate location and removing the band enriched in mitochondrial DNA. While this is an effective method for isolating mtDNA, the method requires a long ultracentrifugation step, as well as patience and dexterity to collect the DNA. In addition, it may be desirable to limit exposure to cesium chloride and ethidium bromide. Finally, the force generated during the ultracentrifugation step and the use of hypodermic needles to extract DNA from the ultracentrifuge tube may result in DNA shearing. Another method for isolating mtDNA involves enzymatically enriching mtDNA from extracted total DNA using kits based on multiple displacement amplification (MDA) technology. However, this process is time-consuming and expensive. SUMMARY

[0010] The present invention significantly improves the art by providing a method for isolating mitochondrial DNA from seeds (for example, dry seeds) by selectively binding nuclear DNA from a seed powder sample to a solid phase, thereby leaving mitochondrial DNA in solution, for easier extraction and purification. By identifying conditions where nuclear DNA binds to the solid phase and mitochondrial DNA is not adsorbed by the solid phase, improved separation of nuclear DNA from mitochondrial DNA is achieved. The invention also enables high-throughput extraction of plant mitochondria and mitochondrial DNA. In embodiments, the method disclosed herein is used to enable the selective binding of nuclear DNA to a solid phase, allowing forDocket No. PAT-109841-WO-SEC-1 separation of nuclear DNA from mitochondrial DNA in plant seeds, such as the seeds of crop plants or cereal plants (e.g., wheat, barley, etc.). BRIEF DESCRIPTION OF THE DRAWINGS

[0011] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate various example embodiments and together with this description, serve to explain the principles of the disclosed embodiments.

[0012] Figure 1 is an amplification plot generated from an RT-PCR reaction using DNA extracted from hybrid wheat seeds. The plot compares nuclear DNA presence to mitochondria DNA (mtDNA) presence. The plot shows the presence of wheat mtDNA in the sample of DNA extracted from the seeds.

[0013] Figure 2 is an amplification plot using DNA extracted from wheat flour that has been treated with Cerium oxide nanopowder, and wherein the DNA was cleaned and concentrated with isopropanol, in accordance with an embodiment of a method for mtDNA isolation as disclosed herein. The plot compares nuclear DNA presence to mitochondria DNA (mtDNA) presence.

[0014] Figure 3 is an amplification plot using DNA extracted from wheat flour that has been treated with Cerium oxide nanopowder, without the use of an additional DNA cleaning step, in accordance with an embodiment of a method for mtDNA isolation as disclosed herein. The plot compares nuclear DNA presence to mitochondria DNA (mtDNA) presence.

[0015] Figure 4 is an amplification plot showing the effect of concentration and composition of buffering salts in an adsorption buffer used for mtDNA extraction on mtDNA yield.

[0016] Figure 5 is an amplification plot showing the effect of pH of an adsorption buffer used for mtDNA extraction on mt DNA yield.

[0017] Figure 6 is an amplification plot showing the effect of pretreatment of Cerium oxide powder in solutions with different pH on mt DNA yield.

[0018] Figure 7 is an amplification plot comparing the efficacy of using Cerium oxide powder as a solid phase in the mtDNA extraction protocol with that of using Iron oxide powder.

[0019] Figure 8 is an amplification plot showing the results of mtDNA extraction using chitosan as a solid phase.Docket No. PAT-109841-WO-SEC-1

[0020] Figure 9 is an amplification plot showing the results of mtDNA extraction using silica as a solid phase. DEFINITIONS

[0021] This invention is not limited to the particular methodology, protocols, cell lines, plant species or genera, constructs, and reagents described herein. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which will be limited only by the appended claims. It must be noted that as used herein and in the appended claims, the singular forms “a,” “and,” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to “a plant” is a reference to one or more plants and includes equivalents thereof known to those skilled in the art, and so forth. As used herein, the word “or” means any one member of a particular list and also includes any combination of members of that list (i.e., includes also “and”).

[0022] The term “about” is used herein to mean approximately, roughly, around, or in the region of. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 20 percent, preferably 10 percent up or down (higher or lower). With regard to a temperature, the term “about” means ± 1 °C, preferably ± 0.5°C. Where the term “about” is used in the context of this invention (e.g., in combinations with temperature or molecular weight values) the exact value (i.e., without “about”) is preferred.

[0023] As used herein, the term “amplified” means the construction of multiple copies of a nucleic acid molecule or multiple copies complementary to the nucleic acid molecule using at least one of the nucleic acid molecules as a template. Amplification systems include the polymerase chain reaction (PCR) system, ligase chain reaction (LCR) system, nucleic acid sequence-based amplification (NASBA, Cangene, Mississauga, Ontario), Q-Beta Replicase systems, transcription-based amplification system (TAS), and strand displacement amplification (SDA). See, e.g., Diagnostic Molecular Microbiology: Principles and Applications, PERSING et al., Ed., American Society for Microbiology, Washington, D.C. (1993). The product of amplification is termed an “amplicon.”Docket No. PAT-109841-WO-SEC-1

[0024] The term “genotype” refers to the genetic constitution of a cell or organism. An individual's “genotype for a set of genetic markers” includes the specific alleles, for one or more genetic marker loci, present in the individual. As is known in the art, a genotype can relate to a single locus or to multiple loci, whether the loci are related or unrelated and / or are linked or unlinked. In some embodiments, an individual’s genotype relates to one or more genes that are related in that the one or more of the genes are involved in the expression of a phenotype of interest (e.g., a quantitative trait as defined herein). Thus, in some embodiments a genotype comprises a sum of one or more alleles present within an individual at one or more genetic loci of a quantitative trait.

[0025] The phrase “nucleic acid” or “polynucleotide” refers to any physical string of monomer units that can be corresponded to a string of nucleotides, including a polymer of nucleotides (e.g., a typical DNA polymer or polydeoxyribonucleotide or RNA polymer or polyribonucleotide), modified oligonucleotides (e.g., oligonucleotides comprising bases that are not typical to biological RNA or DNA, such as 2'-O-methylated oligonucleotides), and the like. In some embodiments, a nucleic acid or polynucleotide can be single-stranded, double-stranded, multi-stranded, or combinations thereof. Unless otherwise indicated, a particular nucleic acid or polynucleotide of the present invention optionally comprises or encodes complementary polynucleotides, in addition to any polynucleotide explicitly indicated.

[0026] “PCR (polymerase chain reaction)” is understood within the scope of the invention to refer to a method of producing relatively large amounts of specific regions of DNA, thereby making possible various analyses that are based on those regions.

[0027] The term “probe” refers to a single-stranded oligonucleotide that will form a hydrogen- bonded duplex with a substantially complementary oligonucleotide in a target nucleic acid analyte or its cDNA derivative.

[0028] The term “primer”, as used herein, refers to an oligonucleotide which is capable of annealing to the amplification target allowing a DNA polymerase to attach, thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product is induced, e.g., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH. The (amplification) primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxyribonucleotide. The primer is generally sufficiently long to prime the synthesis ofDocket No. PAT-109841-WO-SEC-1 extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and composition (A / T and G / C content) of primer. A pair of bi-directional primers consists of one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification. It will be understood that “primer,” as used herein, may refer to more than one primer, particularly in the case where there is some ambiguity in the information regarding the terminal sequence(s) of the target region to be amplified. Hence, a “primer” includes a collection of primer oligonucleotides containing sequences representing the possible variations in the sequence or includes nucleotides which allow a typical base pairing. The oligonucleotide primers may be prepared by any suitable method. Methods for preparing oligonucleotides of specific sequence are known in the art, and include, for example, cloning and restriction of appropriate sequences, and direct chemical synthesis. Chemical synthesis methods may include, for example, the phospho di- or tri-ester method, the diethylphosphoramidate method and the solid support method disclosed in, for example, US 4,458,066. The primers may be labeled, if desired, by incorporating means detectable by, for instance, spectroscopic, fluorescence, photochemical, biochemical, immunochemical, or chemical means. Template-dependent extension of the oligonucleotide primer(s) is catalyzed by a polymerizing agent in the presence of adequate amounts of the four deoxyribonucleotide triphosphates (dATP, dGTP, dCTP and dTTP, i.e. dNTPs) or analogues, in a reaction medium which is comprised of the appropriate salts, metal cations, and pH buffering system. Suitable polymerizing agents are enzymes known to catalyze primer- and template-dependent DNA synthesis. Known DNA polymerases include, for example, E. coli DNA polymerase I or its Klenow fragment, T4 DNA polymerase, and Taq DNA polymerase. The reaction conditions for catalyzing DNA synthesis with these DNA polymerases are known in the art. The products of the synthesis are duplex molecules consisting of the template strands and the primer extension strands, which include the target sequence. These products, in turn, serve as template for another round of replication. In the second round of replication, the primer extension strand of the first cycle is annealed with its complementary primer; synthesis yields a “short” product which is bound on both the 5'- and the 3'-ends by primer sequences or their complements. Repeated cycles of denaturation, primer annealing, and extension result in the exponential accumulation of the target region defined by the primers. Sufficient cycles are run to achieve the desired amount of polynucleotide containing the targetDocket No. PAT-109841-WO-SEC-1 region of nucleic acid. The desired amount may vary, and is determined by the function which the product polynucleotide is to serve. The PCR method is well described in handbooks and known to the skilled person. After amplification by PCR, the target polynucleotides may be detected by hybridization with a probe polynucleotide which forms a stable hybrid with that of the target sequence under low, moderate, or even highly stringent hybridization and wash conditions. If it is expected that the probes will be essentially completely complementary (i.e., about 99% or greater) to the target sequence, highly stringent conditions may be used. If some mismatching is expected, for example if variant strains are expected with the result that the probe will not be completely complementary, the stringency of hybridization may be lessened. However, conditions are typically chosen which rule out nonspecific / adventitious binding. Conditions, which affect hybridization, and which select against nonspecific binding are known in the art, and are described in, for example, Sambrook and Russell, 2001. Generally, lower salt concentration and higher temperature increase the stringency of hybridization conditions. “PCR primer” is preferably understood within the scope of the present invention to refer to relatively short fragments of single-stranded DNA used in the PCR amplification of specific regions of DNA.

[0029] The terms “protein,” “peptide” and “polypeptide” are used interchangeably herein and refer to a molecule made of multiple amino acids connected to each other via a peptide bond.

[0030] The term “allele(s)” means any of one or more alternative forms of a gene, all of which alleles relate to at least one trait or characteristic. In a diploid cell, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. In some instances (e.g., for QTLs) it is more accurate to refer to “haplotype” (i.e., an allele of a chromosomal segment) instead of “allele”, however, in those instances, the term “allele” should be understood to comprise the term “haplotype”. If two individuals possess the same allele at a particular locus, the alleles are termed “identical by descent” if the alleles were inherited from one common ancestor (i.e., the alleles are copies of the same parental allele). The alternative is that the alleles are “identical by state” (i.e., the alleles appear to be the same but are derived from two different copies of the allele). Identity by descent information is useful for linkage studies; both identity by descent and identity by state information can be used in association studies, although identity by descent information can be particularly useful.Docket No. PAT-109841-WO-SEC-1

[0031] The term “backcrossing” is understood within the scope of the invention to refer to a process in which a hybrid progeny is repeatedly crossed back to one of the parents.

[0032] The term “conditionally male sterile” means a phenotype of male sterility (i.e., an incapability to produce fertile pollen), which can be induced and / or repressed by certain conditions. In consequence, a plant can be “switched” from a male sterile to a male fertile phenotype by applying said certain conditions. Male sterility can be caused by various factors and can be expressed for example as a complete lack of male organs (anthers), degenerated pollen, infertile pollen etc. Based on the intensity of the condition the “switch” from male sterility to male fertility may be complete or incomplete. In an embodiment of the present invention, the term “conditionally male sterile” means a temperature-dependent male sterility and thereby means a nuclear male sterile phenotype, wherein the sterility is temperature dependent and can be reverted to fertility at a temperature of more than 35°C (such as between 35°C and 43°C, or between 37°C and 40°C, or at about 39°C; preferably with an exposure for a preferred heat treatment time and a subsequent growing at ambient temperature).

[0033] The term “germplasm” refers to the totality of the genotypes of a population or another group of individuals (e.g., a species). The term “germplasm” can also refer to plant material; e.g., a group of plants that act as a repository for various alleles. The phrase “adapted germplasm” refers to plant materials of proven genetic superiority; e.g., for a given environment or geo- graphical area, while the phrases “non-adapted germplasm”, “raw germplasm”, and “exotic germplasm” refer to plant materials of unknown or unproven genetic value; e.g., for a given environment or geographical area; as such, the phrase “non-adapted germplasm” refers in some embodiments to plant materials that are not part of an established breeding population and that do not have a known relationship to a member of the established breeding population.

[0034] The term “haplotype” can refer to the set of alleles an individual inherited from one parent. A diploid individual thus has two haplotypes. The term “haplotype” can be used in a more limited sense to refer to physically linked and / or unlinked genetic markers (e.g., sequence polymorphisms) associated with a phenotypic trait. The phrase “haplotype block” (sometimes also referred to in the literature simply as a haplotype) refers to a group of two or more genetic markers that are physically linked on a single chromosome (or a portion thereof). Typically, each block has a few common haplotypes, and a subset of the genetic markers (i.e., a “haplo-type tag”) can be chosen that uniquely identifies each of these haplotypes.Docket No. PAT-109841-WO-SEC-1

[0035] The terms “hybrid”, “hybrid plant”, and “hybrid progeny” in the context of plant breeding refer to a plant that is the offspring of genetically dissimilar parents produced by crossing plants of different lines or breeds or species, including but not limited to the cross between two inbred lines (e.g., a genetically heterozygous or mostly heterozygous individual). The phrase “single cross F1 hybrid” refers to an F1 hybrid produced from a cross between two inbred lines.

[0036] The phrase “inbred line” refers to a genetically homozygous or nearly homozygous population. An inbred line, for example, can be derived through several cycles of brother / sister breedings or of selfing. In some embodiments, inbred lines breed true for one or more phenotypic traits of interest. An “inbred”, “inbred individual,” or “inbred progeny” is an individual sampled from an inbred line. The term “inbred” means a substantially homozygous individual or line.

[0037] The terms “introgression,” “introgressed,” and “introgressing” refer to both a natural and artificial process whereby genomic regions of one species, variety, or cultivar are moved into the genome of another species, variety, or cultivar, by crossing those species. The process may optionally be completed by backcrossing to the recurrent parent.

[0038] The term “marker-based selection” is understood within the scope of the invention to refer to the use of genetic markers to detect one or more nucleic acids from the plant, where the nucleic acid is associated with a desired trait to identify plants that carry genes for desirable (or undesirable) traits, so that those plants can be used (or avoided) in a selective breeding program.

[0039] The phrase “phenotypic trait” refers to the appearance or other detectable characteristic of an individual, resulting from the interaction of its genome with the environment.

[0040] The term “plurality” refers to more than one entity. Thus, a “plurality of individuals” refers to at least two individuals. In some embodiments, the term plurality refers to more than half of the whole. For example, in some embodiments a “plurality of a population” refers to more than half the members of that population.

[0041] The term “progeny” refers to the descendant(s) of a particular cross. Typically, progeny result from breeding of two individuals, although some species (particularly some plants and hermaphroditic animals) can be selfed (i.e., the same plant acts as the donor of both male and female gametes). The descendant(s) can be, for example, of the F1, the F2, or any subsequent generation.Docket No. PAT-109841-WO-SEC-1

[0042] The phrase “qualitative trait” refers to a phenotypic trait that is controlled by one or a few genes that exhibit major phenotypic effects. Because of this, qualitative traits are typically simply inherited. Examples in plants include, but are not limited to, flower color, cob color, and disease resistance such as for example Northern corn leaf blight resistance.

[0043] “Phenotype” is understood within the scope of the invention to refer to a distinguishable characteristic(s) of a genetically controlled trait.

[0044] A “plant” is any plant at any stage of development.

[0045] A “plant cell” is a structural and physiological unit of a plant, comprising a protoplast and a cell wall. The plant cell may be in form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, plant tissue, a plant organ, or a whole plant.

[0046] “Plant cell culture” means cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development.

[0047] “Plant material” refers to leaves, stems, roots, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant.

[0048] A “plant organ” is a distinct and visibly structured and differentiated part of a plant such as a root, stem, leaf, flower bud, or embryo.

[0049] “Plant tissue” as used herein means a group of plant cells organized into a structural and functional unit. Any tissue of a plant in planta or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant parts, plant seeds, tissue culture and any group of plant cells organized into structural and / or functional units. The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as listed above or otherwise embraced by this definition is not intended to be exclusive of any other type of plant tissue.

[0050] The term “plant part” indicates a part of a plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.

[0051] The term “population” means a genetically heterogeneous collection of plants sharing a common genetic derivation.Docket No. PAT-109841-WO-SEC-1

[0052] The term “predominately male sterile” means that in a population of at least 100 plants not more than 10 %, preferably not more than 5 %, more preferably not more than 1 % of the flowers on all of those plants have functional male organs producing fertile pollen. It has to be understood that an individual plant can have both fertile and sterile flowers. In preferred embodiments not more than 10 %, preferably not more than 5 %, more preferably not more than 1 % of the flowers on an individual plant have functional male organs producing fertile pollen.

[0053] The term “offspring” plant refers to any plant resulting as progeny from a vegetative or sexual reproduction from one or more parent plants or descendants thereof. For instance, an offspring plant may be obtained by cloning or selfing of a parent plant or by crossing two parent plants and includes selfings as well as the F1 or F2 or still further generations. An F1 is a first- generation offspring produced from parents at least one of which is used for the first time as donor of a trait, while offsprings of second generation (F2) or subsequent generations (F3, F4, etc.) are specimens produced from selfings of F1's, F2's etc. An F1 may thus be a hybrid resulting from a cross between two true breeding parents (true-breeding is homo-zygous for a trait), while an F2 may be an offspring resulting from self-pollination of said F1 hybrids.

[0054] “Recombination” is the exchange of information between two homologous chromosomes during meiosis. The frequency of double recombination is the product of the frequencies of the single recombinants. For instance, a recombinant in a 10 cM area can be found with a frequency of 10%, and double recombinants are found with a frequency of 10% x 10% = 1 % (1 centimorgan is defined as 1% recombinant progeny in a testcross).

[0055] The term “RHS” or “restored hybrid system” means a nuclear male sterility-based hybrid system.

[0056] The phrases “sexually crossed” and “sexual reproduction” in the context of the present invention refer to the fusion of gametes to produce progeny (e.g., by fertilization, such as to produce seed by pollination in plants). In some embodiments, a “sexual cross” or “cross- fertilization” is fertilization of one individual by another (e.g., cross-pollination in plants). In some embodiments the term “selfing” refers to the production of seed by self-fertilization or self- pollination; i.e., pollen and ovule are from the same plant.

[0057] “Selective breeding” is understood within the scope of the present invention to refer to a program of breeding that uses plants that possess or display desirable traits as parents.Docket No. PAT-109841-WO-SEC-1

[0058] “Tester plant” is understood within the scope of the present invention to refer to a plant used to characterize genetically a trait in a plant to be tested. Typically, the plant to be tested is crossed with a “tester” plant and the segregation ratio of the trait in the progeny of the cross is scored.

[0059] The term “tester” refers to a line or individual with a standard genotype, known characteristics, and established performance. A “tester parent” is an individual from a tester line that is used as a parent in a sexual cross. Typically, the tester parent is unrelated to and genetically different from the individual to which it is crossed. A tester is typically used to generate F1 progeny when crossed to individuals or inbred lines for phenotypic evaluation.

[0060] The phrase “topcross combination” refers to the process of crossing a single tester line to multiple lines. The purpose of producing such crosses is to determine phenotypic performance of hybrid progeny; that is, to evaluate the ability of each of the multiple lines to produce desirable phenotypes in hybrid progeny derived from the line by the tester cross.

[0061] The terms “variety” or “cultivar” mean a group of similar plants that by structural or genetic features and / or performance can be distinguished from other varieties within the same species.

[0062] Crop means wheat, maize (corn), rice, sunflower, soybean, tomato, or any plant or plants grown for their food (whether for animal feed or human consumption) or fiber.

[0063] Ground seeds, seed flour, seed powder, and similar terms refer to whole seeds which have been subject to mechanical disruption and / or pulverization, whether at room temperatures or sub-freezing temperatures. Examples include burr or blade grinding, mill grinding, and mortar and pestle grinding, among others.

[0064] High-throughput refers to the processing of multiple samples simultaneously or in rapid succession or both. For example, in embodiments, the instant invention is capable of processing 24 samples simultaneously, which is considered high-throughput. Similarly, processing 48 or 96 samples simultaneously is also considered high-throughput. Additionally, processing one sample individually, or a small number of samples (e.g., eight or less) simultaneously is not considered high-throughput.

[0065] Low-speed centrifugation means centrifugation at speeds less than about 4000 xg. In some embodiments, low speed centrifugation means at 2000 to 4000 xg. The unit “xg” is equivalent to G-forces. In comparison, high speed centrifugation (or ultracentrifugation) meansDocket No. PAT-109841-WO-SEC-1 centrifugation at speeds of 17,000 xg or higher. In particular embodiments, high speed centrifugation may be needed if a DNA extraction protocol involves an alcohol precipitation step to clean or concentrate DNA. In other particular embodiments, high speed centrifugation may be needed to precipitate mitochondria in a sample in order for the mitochondria to be suitable for downstream processes, such as DNA isolation and genotyping.

[0066] Seed, kernel, grain, and similar terms, as used herein, refers to a mature plant ovule capable of being sowed and germinated into a plant. For some species, the seed comprises an embryo and endosperm. It may also comprise a seed coat (i.e., a pericarp). Other seeds, e.g., soybean or sunflower, may not comprise an endosperm. Preferably, the seeds used in the instant invention are substantially free of seed chip sampling, endosperm removal, or any other form of individual sampling or modification. The seeds of the instant invention may be from any seed- propagated plant, including but not limited to crops such as wheat and soybean; as well as cereals such as barley.

[0067] Sample plate, sampling plate, sampling block, microwell, microplate, and the like refer to plates comprising at least four wells arrayed in a grid. In one embodiment, the sample plate comprises sample wells arranged in an A×B format, wherein A and B are perpendicular axes, and the number of wells along the A axis can be greater than, less than, or equal to the number of wells along the B axis. In one embodiment, the number of wells along the A axis or B axis is at least 2. In one embodiment, the number of wells along the A axis or B axis is between 2 and 15. In one aspect, the plate comprises 24, 48, or 96 wells in total. In one embodiment, one of the sample wells is connected to another sample well by a frangible region. In one embodiment, the sample plate comprises a base comprising a docking portion for securing the sample plate to a corresponding docking portion of a plate frame holder. DETAILED DESCRIPTION

[0068] Embodiments of the invention pertain to a method of obtaining plant mitochondria DNA, virtually free of nuclear DNA, from plant seeds, the method comprising: incubating a sample solution comprising pulverized seeds and an adsorption buffer having an alkaline pH with a solid phase nuclear DNA binder to selectively remove nuclear DNA from the sample solution; and extracting mitochondrial DNA from a supernatant comprising plant mitochondria DNA virtuallyDocket No. PAT-109841-WO-SEC-1 free of nuclear DNA for use in a downstream process. In embodiments, the method further comprises low-speed centrifuging the incubated sample solution.

[0069] In particular embodiments, the solid phase nuclear DNA binder is a heavy metal oxide, such as Cerium oxide (CeO) or Iron oxide (Fe2O3). In other particular embodiments, the solid phase nuclear DNA binder is chitosan, silica, or diatomaceous earth. In embodiments where the sample solution is incubated with the silica, the incubation is in the presence of a chaotropic salt, such as Potassium Iodide (KI). In specific embodiments, incubating the sample solution with the solid phase nuclear DNA binder comprises pulverizing the seeds into a powder; resuspending a portion of the powder with the adsorption buffer to create a seed solution; low-speed centrifuging the seed solution at a speed at or below 4000 rpm; incubating the supernatant of step (c) with the heavy metal oxide to selectively bind nuclear DNA; re-centrifuging the supernatant solution of (d) at a speed at or below 4000 rpm to collect the heavy metal oxide powder with the bound nuclear DNA leaving the mitochondrial DNA in the supernatant; and extracting mitochondrial DNA from the supernatant solution of (d). In example embodiments, the seeds are wheat, barley, soy, or other crop or cereal plant seeds. In particular embodiments, the seeds are dry seeds. In example embodiments, the downstream process is genotyping or genetic purity testing.

[0070] Embodiments of the invention also pertain to obtaining plant mitochondria from seeds by suspending a sample of pulverized seeds in an adsorption buffer; low speed centrifuging the suspended sample; incubating the supernatant of (b) with a heavy metal oxide to selectively bind nuclear DNA; and recentrifuging the incubated supernatant of (c) to provide a supernatant solution comprising plant mitochondria including mitochondrial DNA suitable for downstream processes. In further embodiments, mitochondrial DNA (“mtDNA”) is extracted from the supernatant solution comprising plant mitochondria. Any known method to concentrate DNA can be applied to the supernatant to concentrate the mtDNA. In example embodiments, the heavy metal oxide is Cerium Oxide, particularly Cerium Oxide nanopowder. In other example embodiments, the heavy metal oxide is Iron Oxide.

[0071] Embodiments of the invention also pertain to a high-throughput method of obtaining plant mitochondria from a plurality of bulked dry seed lots, comprising (a) obtaining a plurality of dry seed lots; pulverizing the plurality of dry seed lots into separate powders; sampling from each of the separate powders of step (b) and placing each sample into an individual well of a sampling plate; adding alkaline adsorption buffer to the sample in each well of the samplingDocket No. PAT-109841-WO-SEC-1 plate; centrifuging the sampling plate at a low speed to remove cell debris; transferring the supernatants to a new sampling plate; incubating the supernatants of step (f) with a heavy metal oxide to selectively bind nuclear DNA; centrifuging the sampling plate at a low speed to remove cell nuclear DNA; and extracting plant mitochondria, and optionally plant mitochondrial DMA, from the supernatants of step (h). In embodiments, the adsorption buffer comprises Tris and NaOH, particularly 100 mM Tris-HCl and 35mM NaOH. In embodiments, the low-speed centrifuging is between 2000 xg and 4000 xg and the sampling plate is a 24-well plate, or a 48- well plate, or a 96-well plate.

[0072] The invention particularly pertains to a high-throughput method of obtaining plant mitochondria from a plurality of bulked dry seed lots, comprising: (a) obtaining a plurality of dry seed bulks; (b) pulverizing the plurality of dry seed bulks into separate powders; (c) sampling from each of the separate powders of step (b) and placing each sample into an individual well of a sampling plate; (d) adding alkaline adsorption buffer to the sample in each well of the sampling plate; (e) centrifuging the sampling plate at a low speed to remove cell debris; (f) transferring the supernatants to a new sampling plate; (g) incubating the supernatants of step (f) with a heavy metal oxide to selectively bind nuclear DNA; (h) centrifuging the sampling plate at a low speed to remove cell nuclear DNA; and (g) extracting plant mitochondria, and optionally plant mitochondrial DNA, from the supernatants of step (h).

[0073] Embodiments of the invention pertain to a method for the removal of nuclear DNA from a sample comprising nuclear DNA and mitochondrial DNA via selective binding of the nuclear DNA to a solid phase, thereby selectively removing the nuclear DNA from the sample. In particular embodiments, the solid phase is a heavy metal oxide such as Cerium Oxide, or Iron Oxide. In particular embodiments, the sample is a seed sample and the solid phase is cerium oxide in nanopowder form.

[0074] In further embodiments, any of the methods disclosed herein further includes an optional DNAse treatment step including adding DNAse to the adsorption buffer while the nuclear DNA is binding to the solid phase, or performing the DNAse treatment after nuclear DNA has been bound to the solid phase. DNase treatment is performed for a duration following which the DNase is deactivated by any known method of DNAse inactivation. EXAMPLESDocket No. PAT-109841-WO-SEC-1

[0075] The following non-limiting examples show one having ordinary skill in the art how to practice the claimed methods. Example 1: Materials

[0076] The following materials are used in the claimed method. 1. Adsorption Buffer: 100 mM Tris-HCl, pH 7.5, 2% PVP (polyvinylpyrrolidone), 35mM NaOH. Stored at 4 °C. 2. Cerium (IV) Oxide nanopowder (CeO) from Sigma-Aldrich, Inc. (Product No: 544841). Nanopowder was used to leverage the higher surface area it provides. 3. (Optional) DNase I (100 mg) from Sigma-Aldrich, Inc. (Product No: 10104159001), stored at 4 °C. 4. Isopropanol. 5. 70% EtOH. 6. 24-well sample plate. 7. 48-well sample plate. 8. 250-µl wide orifice tips.

[0077] Reasonable substitutions can be made to the above list, and the person having ordinary skill in the art will be aware of such reasonable substitutions. Likewise, slight modifications to the above materials, and the person of ordinary skill in the art will be aware of these modifications. Example variations in the Adsorption buffer composition are provided herein at Example 9. Example 2: Extraction Protocol

[0078] Pulverize 13 g of seeds to a fine powder with an appropriate grinder. In one example embodiment, the seeds are ground one or two times with a Retsch dry mill for 2 x 30 seconds at 10 RPM. The seeds may be any seed, but particularly wheat or barley seed. Seeds may be stored at room temperature or at 4^C.

[0079] Obtain a 24-well sample plate. From each sample of seed flour, subsample into a well between 500mg and 1000mg of seed flour, for example, approximately 750mg of flour, using an appropriate sampling tool such as a measuring spoon. Subsamples may be done in singles, duplicates, triplicates, or more. Add 3.0 mL of adsorption buffer to each well and briefly stir toDocket No. PAT-109841-WO-SEC-1 wet the powder. For example, the buffer may be stirred into the seed flour sample using a sterile pipette tip.

[0080] Centrifuge the plate(s) for approximately 27 seconds or until the centrifuge reaches approximately 3500 rpm in an appropriate device, such as the EPPENDORF®5810R Refrigerated Centrifuge. Carefully transfer the supernatant to the well of a 48-well sample plate and repeat the centrifugation step for approximately 27 seconds or until the centrifuge reaches approximately 3500 rpm.

[0081] Add 750µl of the supernatant, to 50 mg Cerium Oxide (CeO) powder in a 2 ml tube which has been pre-wetted and vortexed with 100 µl adsorption buffer. Incubate the Cerium Oxide-supernatant slurry for 15 to 20 minutes at room temperature. During the incubation period, mix the slurry twice either via pipetting up and down with a 1 ml pipette or via vortexing at low speed. This mixing improves the binding of nuclear DNA to the heavy metal oxide powder. Repeated mixing was found to improve the binding of the nuclear DNA to the heavy metal oxide powder. However, care must be taken at this step to avoid excessive vortexing or pipetting as this can damage the mitochondria and cause the mitochondrial DNA to also bind to the heavy metal oxide powder resulting in a lower yield of mitochondrial DNA.

[0082] Centrifuge the 2 ml tube containing the slurry in a bench centrifuge for 1 minute at 4000 RPM to collect the CeO powder at the bottom of the tube. Transfer the supernatant, which contains the mitochondrial DNA, into a new tube. At this point, the practitioner has obtained plant mitochondrial DNA substantially free of genomic plant DNA from the nucleus.

[0083] The Cerium Oxide does not only adsorb nuclear DNA but also contaminants which can inhibit any enzymatic reactions. The mitochondrial DNA is therefore ready for downstream applications. For example, the extracted DNA can be amplified using standard PCR protocols.

[0084] Optionally, the mitochondria DNA can be cleaned and further concentrated via alcohol precipitation, magnetic beads, or any other method. If no alcohol cleaning is performed, the DNA should be briefly heat treated to inactivate any potential native DNAse present in the solution. For example, the solution may be incubated for 20 minutes at 65°C. DNA concentration and cleaning protocols are well-known in the general state of the art. Example DNA cleaning and concentration protocols are provided, for example, at U.S. Pat. Publication No. US2020 / 0236885A1 (e.g., at Examples 3-5), the contents of which are incorporated by reference herein in their entirety.Docket No. PAT-109841-WO-SEC-1

[0085] To detect the presence of wheat mtDNA, real-time PCR (“rtPCR”) reactions were run. rtPCR is well-known in the general state of the art. The primers listed in Table 1 were used to detect wheat mtDNA. The sequence of the amplicon produced is also included. Table 1. Wheat mtDNA primer sequences Fwd. CCACCATTTCTCCTGCTTGAAcon GAGATTCAAGCAGGAGAAATGGTGG

[0086] Results of rtPCR reactions for mitochondrial and genomic DNA. The plots show the presence of wheat mtDNA in Figure 1.

[0087] Figure 2 shows an amplification plot using DNA extracted from wheat flour that has been treated with CeO nano-powder as disclosed in the above protocol. The DNA was cleaned and concentrated with isopropanol. As a result of the treatment, only mtDNA is present in the sample and no nuclear DNA can be detected. In comparison, Figure 3 shows an amplification plot using DNA extracted from wheat flour that has been treated with CeO nano-powder as disclosed in the above protocol. No additional cleaning step via alcohol precipitation was performed. Binding of nuclear DNA to the CeO nano powder may be likely due to hydrophobic interactions between the DNA and the CeO powder (in the presence of the adsorption buffer at a pH of 7.9). As shown in Figure 3, DNA extracted using this approach is clean enough to serve as a template for PCR. The supernatant was also visibly clear after the adsorption process.

[0088] To detect the presence of any contaminant wheat genomic DNA, further rtPCR reactions were run. The primers listed in Table 2 were used to detect contaminant wheat gDNA. The sequence of the amplicon produced is also included. Table 2. Wheat nuclear gDNA primer sequences Fwd. CAAGGACGCCGAATTCAAGA Rev. CGAAGAAGGTGCCCTTGAGA Probe TET-CCACCCGATGAACTTCCTGAACGAGA-BHQ1 Ampli CAAGGACGCCGAATTCAAGACCCACCCGATGAACTTCCTGAACGAGAGG con ACTCTCAAGGGCACCTTCTTCGDocket No. PAT-109841-WO-SEC-1Example 3: Effect of Buffer concentration on mtDNA yield

[0089] The composition of the adsorption buffer was modified to study the effect of various Tris HCL concentrations on mitochondrial DNA yield. The rest of the protocol was followed as described in Example 2. No extra cleaning steps via isopropanol precipitation step were done. Selective binding of nuclear DNA to Cerium oxide depends on the adsorption buffer. Tris HCl concentration is one factor. Results are shown in Figure 4. Other buffers and buffer concentrations to be assessed in the future include: - Tris HCl concentration 50mM to 1M, or 50mM to 500mM and 500mM to 1M; - HEPES buffer at a concentration of 50mM to 1M, or 50mM to 500mM and 500mM to 1M; - Other buffers such as Phosphate buffer and MOPS buffer. - Buffers will be tested in the range of 50mM to 1M concentrations.Example 4: Effect of Buffer pH on mtDNA yield

[0090] The pH of the adsorption buffer was modified to study the effect of various pHs on mitochondrial DNA yield. The rest of the protocol was followed as described in Example 2. No extra cleaning steps via isopropanol precipitation step were done. As shown in Figure 5, lowering the pH resulted in no nuclear DNA being extracted from the sample and a drop in the mitochondrial DNA yield. This effect from the lowering of the pH suggests an electrostatic interaction between Cerium Oxide and mitochondrial DNA. Based on this, the suggested pH range of the adsorption buffer is about pH 7 to about pH 10. At higher pHs, there is a potential for the mitochondrial membrane to get disrupted. Example 5: Effect of pre-soaking CeO powder in solutions with different pH on mtDNAyield

[0091] The protocol of Example 2 was modified to study the effect of pre-soaking CeO powder in solutions with different pH on mitochondrial DNA yield. The CeO powder was pre-soaked in either a basic solution or an acidic solution prior to performing adsorption experiments. The rest of the protocol was followed as described in Example 2. No extra cleaning steps via isopropanol precipitation step were done. As shown in Figure 6, no DNA (nuclear DNA or mtDNA) was obtained after pre-treating Cerium Oxide in acidic solution. This effect suggests an electrostaticDocket No. PAT-109841-WO-SEC-1 interaction between Cerium Oxide and both the nuclear and mitochondrial DNA. As in Example 4, Example 5 shows that the selective binding of nuclear DNA is not based on electrostatic interaction.Example 6: Effect of using other metal oxides on adsorption of DNA

[0092] Cerium Oxide nano powder was replaced with 130 mg Iron oxide (Fe2O3) nano powder. The rest of the protocol was followed as described in Example 2 with no extra cleaning steps via isopropanol precipitation step. As shown in Figure 7, the effect of Fe2O3 was similar to that of CeO. In other words, the Fe2O3 was able to selectively bind the nuclear DNA and leave the mtDNA free in the supernatant. Under the same conditions, a higher yield was achieved with Cerium oxide relative to iron oxide. Adsorption conditions for iron oxide will be further optimized in the future.

[0093] Other metal oxides that could provide similar results include metal oxides of the Lanthanide group of the periodic table. Such metal oxides are expected to have similar characteristics, at least in terms of DNA adsorption, as Cerium oxide and Iron oxide. The identified metal oxides will be tested in nano powder form. Example 7: Effect of using chitosan for adsorption of DNA

[0094] Cerium Oxide nano powder was replaced with 50 mg of Chitosan powder. Chitosan is a linear polysaccharide composed of randomly distributed β-(1→4)-linked D- glucosamine (deacetylated unit) and N-acetyl-D-glucosamine (acetylated unit). Chitosan has a number of commercial and possible biomedical uses. It can be used in agriculture as a seed treatment and a biopesticide against fungal pathogens.

[0095] Chitosan does not dissolve in a liquid at a pH higher than 6.8 and can therefore be used as a solid phase. The rest of the protocol was followed as described in Example 2 with no extra cleaning steps via isopropanol precipitation step. As shown in Figure 8, the initial results indicate the selective adsorption of nuclear DNA by chitosan, leaving mtDNA in the supernatant. As with Cerium Oxide the selective binding is not due to electrostatic interaction as the experiment was performed at a pH above the isoelectric point. The DNA binding (at low pH) and DNA releasing (at high pH) abilities of chitosan potentially exploit the different charges of the amino groups of chitosan in solutions with different pH and the negative charge of DNA.Docket No. PAT-109841-WO-SEC-1 Example 8: Effect of using silica for adsorption of DNA

[0096] The protocol of Example 2 was modified to show that nuclear DNA can be selectively bound to silica (diatomaceous earth) in the presence of a chaotropic salt. The modified protocol included the following steps: 1. Transfer 50mg diatomaceous earth powder to a tube, add 800µl of 8M KI, and briefly vortex. 2. Pulverize 13 g wheat seeds to a fine powder. 3. Transfer 1 g into wells of a 24 wells plate. 4. Add 3 ml of H2O, stir with a pipette tip to wet powder. 5. Centrifuge for 27 seconds (or until centrifuge reaches 3500 RPM). 6. Transfer supernatant into 24 well plate. 7. Centrifuge for 27 seconds (or until centrifuge reaches 3500 RPM). 8. Add 100 µl of supernatant to diatomaceous earth / KI mix. 9. Incubate 15-20 minutes, mix several times. 10. Centrifuge for 1 minute. 11. Transfer 500µl supernatant to a new tube. 12. Add 350µl isopropanol. 13. Centrifuge for 20 minutes. 14. Discard and perform 70 % ethanol wash. 15. Dry pellet and dissolve in 100µl H2O.

[0097] As shown in Figure 9, selective removal of nuclear DNA via silica (diatomaceous earth) occurred in the presence of chaotrophic salt (KI). Protocol conditions can be further optimized for higher mitochondrial DNA yield.

[0098] These results show that high quality mitochondrial DNA, that is virtually free from nuclear DNA contamination, was isolated from whole seeds in a high-throughput manner using a heavy metal oxide powder acting as a selective solid phase binder of nuclear DNA.Docket No. PAT-109841-WO-SEC-1 Example 9: Alternative buffer compositions

[0099] Variations in Adsorption buffer composition include buffers with a lower PVP content and a higher Polyethylene Glycol (PEG) content. One example adsorption buffer comprises 1.6% PVP, 90mM Tris-HCl pH 7.5, 100 mM Tris-HCl, pH 7.5, 35mM NaOH, and 2% PEG. DNAse is prepared at a stock concentration of 100mg DNAse I in 20ml of water with aliquots stored at -20°C.

[0100] The extraction procedure starts with the addition of 25mg of Cerium oxide nanopowder into a 2ml tube for each sample. Herein no priming of the Cerium oxide is required. Seeds are crushed as discussed previously for 30 seconds at 10000 rpm.1g of seed flour is mixed with 3ml of adsorption buffer and briefly stirred with a pipette tip. Following at least 3 rounds of centrifugation wherein the supernatant from each round is transferred to a new tube. The supernatant is mixed with Cerium oxide nanopowder and DNase to bind the nuclear DNA to the solid phase. Mitochondrial DNA is harvested from the supernatant by centrifuging the mixture for 1 minute at 4000rpm. DNase is inactivated and the mtDNA is extracted and stored.

[0101] Although the method steps are described herein a specific order, it should be understood that other steps may be performed in between described steps, described steps may be adjusted so that they occur at slightly different times, or the described steps may occur in any order unless otherwise specified.

[0102] Many modifications and other implementations of the disclosure will come to mind to one skilled in the art to which this disclosure pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the disclosure is not to be limited to the specific embodiments disclosed herein and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

Claims

Docket No. PAT-109841-WO-SEC-1 What is claimed is:

1. A method of obtaining plant mitochondrial DNA from seeds, comprising: incubating a sample solution comprising pulverized seeds and an adsorption buffer having an alkaline pH with a solid phase nuclear DNA binder to selectively remove nuclear DNA from the sample solution; and extracting mitochondrial DNA from the supernatant for use in a downstream process.

2. The method of claim 1, further comprising low-speed centrifuging the incubated sample solution.

3. The method of claim 1, wherein the solid phase nuclear DNA binder is a heavy metal oxide.

4. The method of claim 3, wherein the heavy metal oxide is Cerium oxide (CeO).

5. The method of claim 3, wherein the heavy metal oxide is Iron oxide (Fe2O3).

6. The method of claim 1, wherein the solid phase nuclear DNA binder is a chitosan.

7. The method of claim 1, wherein the solid phase nuclear DNA binder is silica or diatomaceous earth.

8. The method of claim 7, wherein the sample solution is incubated with the silica in the presence of a chaotropic salt.

9. The method of claim 8, wherein the chaotropic salt is Potassium Iodide (KI).

10. The method of claim 1, wherein incubating the sample solution with the solid phase nuclear DNA binder comprises: (a) pulverizing the seeds into a powder; (b) resuspending a portion of the powder with the adsorption buffer to create a seed solution; (c) centrifuging the seed solution at a speed at or below 4000 rpm; (d) incubating the supernatant of step (c) with a heavy metal oxide; (e) recentrifuging the supernatant solution of (d) at a speed at or below 4000 rpm; and (f) extracting mitochondrial DNA from the supernatant solution of (e).

11. The method of claim 10, wherein the adsorption buffer comprises Tris-HCl and NaOH in a pH range of about 7.5 – 10.

12. The method of claim 11, wherein the adsorption buffer comprises 100 mM Tris-HCl, and 35mM NaOH.Docket No. PAT-109841-WO-SEC-1 13. The method of claim 1, wherein the dry seeds are wheat, soy, barley, corn, rice, sunflower, or other crop plant seed.

14. The method of claim 1, wherein the downstream process is genotyping or genetic purity testing.

15. The method of claim 1, wherein the plant mitochondrial DNA is wheat mitochondrial DNA.

16. The method of claim 1, wherein the plant mitochondrial DNA is barley mitochondrial DNA.

17. A method of obtaining plant mitochondrial DNA from dry seeds, comprising: (a) suspending a sample of powdered dry seeds in an adsorption buffer; (b) low-speed centrifuging the suspended sample; (c) incubating the supernatant of (b) with a heavy metal oxide to selectively bind nuclear DNA from the suspended sample; (d) recentrifuging the incubated supernatant of (c) to provide a supernatant solution comprising plant mitochondria suitable for downstream processes.

18. The method of claim 17, further comprising extracting mitochondrial DNA (“mtDNA”) from the supernatant solution of (d).

19. The method of claim 17, wherein the heavy metal oxide is Cerium Oxide.

20. The method of claim 19, wherein the heavy metal oxide is Cerium Oxide nanopowder.

21. The method of claim 17, wherein the heavy metal oxide is Iron Oxide.

22. A method of obtaining plant mitochondria from dry seeds, comprising: (a) obtaining a plurality of dry seeds; (b) pulverizing the plurality of dry seeds into a powder; (c) contacting a sample from the powder of step (b) with an adsorption buffer comprising Tris-HCl and NaOH; (d) centrifuging the contacted sample of step (c) at a low speed; (e) incubating the supernatant of step (d) with a heavy metal oxide to selectively bind nuclear DNA; (f) recentrifuging the incubated supernatant of step (e) at the low speed, wherein the supernatant comprises plant mitochondria suitable for downstream processes.Docket No. PAT-109841-WO-SEC-1 23. The method of claim 22, wherein the mitochondria are used for mitochondrial DNA (“mtDNA”) extraction.

24. A high-throughput method of obtaining plant mitochondria from a plurality of bulked dry seeds, comprising: (a) obtaining a plurality of dry seed bulks; (b) pulverizing the plurality of dry seed bulks into separate powders; (c) sampling from each of the separate powders of step (b) and placing each sample into an individual well of a sampling plate; (d) adding alkaline adsorption buffer to the sample in each well of the sampling plate; (e) centrifuging the sampling plate at a low speed to remove cell debris; (f) transferring the supernatants to a new sampling plate; (g) incubating the supernatants of step (f) with a heavy metal oxide to selectively bind nuclear DNA; (h) centrifuging the sampling plate at a low speed to remove cell nuclear DNA; (i) extracting plant mitochondria, and optionally plant mitochondrial DNA, from the supernatants of step (h).

25. The method of claim 24, wherein the adsorption buffer comprises Tris and NaOH.

26. The method of claim 25, wherein the adsorption buffer comprises 100 mM Tris-HCl and 35mM NaOH.

27. The method of claim 24, wherein the centrifuging of step (e) is between 2000 xg and 4000 xg.

28. The method of claim 24, wherein the sampling plate is a 24-well plate, or a 48-well plate, or a 96-well plate.

29. A method of isolating plant nuclear DNA from mitochondrial DNA obtained from seeds, comprising: incubating a sample solution comprising pulverized seeds and an adsorption buffer having an alkaline pH with a solid phase nuclear DNA binder to selectively bind nuclear DNA in the sample solution.

Citation Information

Patent Citations

  • Compositions, methods, and kits for isolating and analyzing nucleic acids using an anion exchange material

    US20110071031A1

  • High-throughput method for mitochondria isolation from plant seeds

    US20200236885A1

  • Methods for improved plant gene-editing

    US20230193303A1