TGFB-targeting RNA interference method, nucleic acid and application thereof

Abstract

The present invention provides a nucleic acid molecule used for regulating the level or amount of TGFB mRNA. Specifically, the present invention provides the delivery of a primary microRNA to form a precursor after in vivo processing, and a microRNA used for the in vivo inhibition of the expression of TGFB mRNA. The present invention also provides a delivery system for the nucleic acid molecule, comprising a vector, an exosome and a cell, and a pharmaceutical composition containing same. The present invention also provides an application of the nucleic acid molecule and the delivery system in cancer treatment and drug preparation.

Description

RNA interference methods, nucleic acids targeting TGFB and uses thereof

[0001] This application claims priority to the Chinese patent application with the application number 202410872809.7, the title of which is "RNA interference methods, nucleic acids targeting TGFB and uses thereof", filed on June 28, 2024, the whole content of which is incorporated herein by reference. TECHNICAL FIELD

[0002] The present application relates to the field of molecular biology and medicine. In particular, the present application relates to systems for delivering precursor miRNAs and their use in the treatment of diseases. BACKGROUND

[0003] Transforming growth factor-beta (TGF-beta / TGFB) is a multifunctional cytokine belonging to the transforming growth factor superfamily. TGFB was discovered to regulate cell proliferation, apoptosis, differentiation and migration, and to be involved in various cellular and biological functions such as embryonic patterning, stem cell maintenance, immune regulation, bone formation and tissue repair.

[0004] TGFB proteins comprise a family of conserved dimeric proteins with a molecular weight of about 25 kDa. TGFB signaling is involved in a large number of disorders and diseases, including cancer, cardiovascular, bone, CNS, PNS, inflammatory and neurodegenerative disorders. The role of TGFB in tumors is complex, with both inhibitory and promoting effects. In early stages of tumor development, TGFB can inhibit cell proliferation, initiate differentiation and induce apoptosis; in the middle and later stages of tumor development progression, TGFB can promote tumor metastasis and invasion through various mechanisms; in the late stage, TGFB can promote immune escape of tumor cells. In epithelial cells, TGFB inhibits cell proliferation. The transformation of normal epithelial cells to cancer cells is accompanied by a down-regulation of the growth-inhibitory response to TGFB, thus allowing the cells to escape the autocrine tumor suppressor activity of TGFB signaling. Increased production of TGFB by cancer cells contributes to the invasive and metastatic behavior of cancer cells. TGFB can induce epithelial-to-mesenchymal transition (EMT), which makes cells aggressive and migratory. In addition, increased TGFB production also has an impact on stromal and immune cells, thus providing a favorable microenvironment for cancer development. TGFB proteins can generally signal through TBR-I / II receptor kinases and their Smad substrates, but can also signal independently of Smad.

[0005] Various delivery systems have been employed in the art to safely and accurately deliver artificial miRNAs or siRNAs in the form of pri-miRNA or pre-miRNA to target tissues. However, there remains a need in the art for improved, more efficient, and less off-targeted ways and methods of delivering artificial miRNAs and their use in medicaments for treating cancer. SUMMARY

[0006] The present invention provides nucleic acid molecules and methods for modulating (increasing or decreasing) the level or amount of mRNA of transforming growth factor-beta (TGF-β / TGFB). In particular, the present invention provides nucleic acid molecules for delivering primary microRNA (pri-miRNA or pri-miR) to form, upon in vivo processing, precursor- and microRNA (miRNA or miR).

[0007] Transforming growth factor-beta (TGF-β / TGFB, TGFB1) is a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind to various TGF-beta receptors, causing recruitment and activation of SMAD family transcription factors, thereby modulating expression of genes. The encoded pre-protein is processed proteolytically to generate latency-associated peptide (LAP) and mature peptide and exists in a latent form consisting of a homodimer of mature peptide, a homodimer of LAP, and latent TGF-beta binding protein or an active form of mature peptide consisting of a homodimer only. Mature peptide can also form heterodimers with its TGFB family members. This encoded protein can regulate the proliferation, differentiation, and growth of cells and can modulate the expression and activation of other growth factors, including interferon-gamma and tumor necrosis factor-alpha. The Gene ID for the human TGFB gene is 7040.

[0008] In this document, protein symbols are not in italics and are all uppercase; gene symbols are in italics. For example, TGFB is a protein, the gene encoding this protein is written as Tgfb. Sometimes in this document protein symbols are not in italics either. For example, sometimes in this document “Tgfb” means the TGFB protein. Sometimes in this document gene symbols are not in italics either. For example, sometimes in this document “TGFB” or “TGFB gene” means the gene Tgfb that encodes the TGFB protein.

[0009] In particular, the present invention provides an isolated nucleic acid comprising a nucleic acid sequence encoding an RNA that inhibits expression of a TGFB gene, the nucleic acid sequence comprising a miRNA sequence that inhibits the TGFB gene.

[0010] In one aspect, the present application provides nucleic acids for delivering primary microRNA or precursor microRNA in vivo, which are processed in cells to produce highly specific artificial microRNA or siRNA that reduces TGFB expression.

[0011] The term "microRNA (or miRNA or miR)" herein refers to a non-coding RNA of 19-25 nucleotides in length that binds to the 3' UTR of a nucleic acid molecule and down-regulates gene expression (by reducing nucleic acid molecule stability or by inhibiting translation). The regulatory polynucleotide of the present application can comprise one or more microRNA sequences, microRNA seeds or artificial microRNAs, e.g., sequences that function as microRNAs.

[0012] The term "pre-miRNA" herein refers to a precursor microRNA. A pre-miRNA is about 70 bases long and is generated in the nucleus after cleavage of a pri-miRNA with Drosha. The pre-miRNA is exported to the cytoplasm by the exportin 5, where they are processed by the nuclease Dicer to form mature miRNAs.

[0013] The term "siRNA" herein refers to small interfering RNA, which is also sometimes referred to as short interfering RNA or silencing RNA, is a class of double-stranded RNA, usually 17-24 base pairs in length. It interferes with the expression of specific genes by degrading mRNAs that have a nucleotide sequence complementary to the antisense strand (also known as the guide strand) of the siRNA, thereby preventing translation.

[0014] The polynucleotide of the present application can efficiently deliver an exogenous nucleotide sequence to an exosome, specifically inhibit a target gene in a target cell after the exosome reaches the target cell, and can maximize the avoidance of side effects caused by off-target.

[0015] In one aspect of the present application, an isolated nucleic acid comprising a nucleic acid sequence encoding a pri-miRNA that inhibits the expression of a TGFB gene is provided. The pri-miRNA comprises a miRNA sequence that inhibits the TGFB gene, and one or more of a flanking structural sequence, a stem loop structure, and a complement sequence of the RNA sequence. In one embodiment of the present application, the nucleic acid sequence of the pri-miRNA in the nucleic acid comprises, in order from 5' to 3', a 5' flanking structural sequence, a miRNA sequence that inhibits the expression of the gene, a stem loop sequence, a complement sequence, and a 3' flanking structural sequence.

[0016] As used herein, "isolated" means that the substance is separated from its original environment. For example, nucleic acids and polypeptides in their natural state within a living organism are not isolated, but the same nucleic acids or polypeptides are isolated when separated from other substances with which they are naturally present.

[0017] In one embodiment of the present application, the nucleic acid comprises multiple copies of the nucleic acid sequence of the pri-miRNA. In one embodiment of the present application, the multiple copies are 2-10 copies, preferably 2-5 copies, more preferably 2-3 copies. For example, it comprises 2, 3 or 4 copies.

[0018] In one embodiment of the present application, the aforementioned nucleic acid has a spacer sequence between the sequences of the pri-miRNA encoding the multiple copies of the suppressor gene expression. In another embodiment of the present application, the spacer sequence has 6-50 nucleotides, preferably 10-30 nucleotides.

[0019] Specifically, in one aspect of the present application, the pri-miRNA has the following structure of Formula I:

[0020] wherein, "|" represents base pairing, (A1A2...A a-1 A a ) is the first RNA sequence; (B b B b-1 ...B2B1) is the second RNA sequence, (A1A2...A a-1 A a ) and (B b B b-1 ...B2B1) are fully complementary or substantially fully complementary, wherein a and b are each independently an integer of about 15-29, preferably an integer of about 18-22;

[0021] [M1M2...M m-1 M m ] is the 5' end flanking sequence; [N n N n-1 ...N2N1] is the 3' end flanking sequence, wherein m and n are each independently an integer of about 25-50, preferably m < n;

[0022] is a spacer sequence for forming a stem loop structure, referred to as a C stem loop,

[0023] wherein c is an integer of about 10-30, preferably an integer of about 16-20.

[0024] The pri-miRNA provided by this invention, after biological processing (in vivo, in tissues, or in cells, etc.) (hereinafter referred to as "processing"), produces pre-miRNA or miRNA, ultimately generating an RNA sequence targeting the target mRNA. In this invention, the 5' flanking structural sequence (such as [M1M2…M...M...) in Formula I... m-1 M m ]) and the first RNA sequence (such as A1A2…A in Formula I) a-1 A a The structure composed of 3' flanking structures (such as [N in Formula I]) is also called the 5' arm, and the first RNA sequence in it is called the 5' arm RNA sequence or 5' arm miRNA. Correspondingly, the structure is composed of 3' flanking sequences (such as [N in Formula I]). n N n-1 …N2N1]) and the second RNA sequence (as shown in Formula I, B) b B b-1 The structure consisting of …B2B1) is also called the 3' arm, and the second RNA sequence therein is called the 3' arm RNA sequence or 3' arm miRNA. The pre-miRNA provided by this invention contains an RNA sequence that targets the target mRNA, which can be located or situated on the 5' arm or 3' arm of the stem-loop structure of the regulatory polynucleotide, i.e., the first miRNA sequence or the second miRNA sequence. The pre-miRNA provided by this invention can generate one or two single-stranded mature miRNAs. Based on the processing from the 5' and 3' arms of the precursor, the single-stranded mature miRNA corresponding to the first miRNA sequence (A1A2…Aa-1Aa) can be called miRNA-5p, and the mature miRNA corresponding to the second miRNA sequence (BbBb-1…B2B1) can be called miRNA-3p.

[0025] miRNAs can be substantially complementary to at least a portion of the sequence of the mRNA encoding a gene. "Substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming secondary structures. Typically, two "substantially complementary" nucleotide sequences have at least 70% complementary nucleotides; preferably, at least 80%; more preferably, at least 90%; and even more preferably, at least 95%; such as 98%, 99%, or 100%. Functionally, miRNAs interfere with the post-transcriptional degradation of mRNA expressing a specific gene with a complementary nucleotide sequence, thereby preventing translation.

[0026] In one aspect of the present application, the miRNA has a length of 15-29 nucleotides (nt), preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. A large number of experiments have shown that when the length of the RNA sequence is less than 18 nt, especially less than 15 nt, the RNA sequence is mostly ineffective and does not play a role, and when the length of the RNA sequence is greater than 22 nt, especially greater than 25 nt, not only the cost of the line is greatly increased, but also the effect is not superior to that of the RNA sequence with a length of 18-22 nt, and the economic benefit is poor. Therefore, when the length of the miRNA sequence is 15-25 nt, especially 18-22 nt, the effect is the best.

[0027] In one aspect of the present application, the pri-miRNA provided by the present application is biologically processed to obtain substantially only the miRNA with the sequence of the first miRNA sequence, and another RNA sequence does not form or almost does not form the miRNA. In one embodiment of the present application, the pri-miRNA provided by the present application is processed in vivo to obtain the miRNA with the sequence of the first miRNA sequence which has activity, i.e., the 5' arm miRNA has activity, and almost no miRNA with the sequence of the second miRNA sequence, i.e., the 3' arm miRNA does not have activity or almost does not have activity.

[0028] In one aspect of the present application, the amount of the miRNA which is almost not formed by the biologically processing of the pri-miRNA provided by the present application is less than 40%, preferably less than 10%, more preferably less than 5%, for example, less than or equal to 2%, of the total miRNA obtained after the processing of the pri-miRNA.

[0029] In one aspect of the present application, the target knockdown (KD) of the target mRNA of the miRNA sequence of the gene by the pri-miRNA of the nucleic acid provided by the present application is at least higher than about 30%, about 40%, 50%, 90%, 95%, or up to 99% after in vivo processing.

[0030] In one aspect of the present application, the target knockdown of the protein of the expression of the gene by the miRNA sequence of the gene by the pri-miRNA of the nucleic acid provided by the present application is at least higher than about 40%, 50%, 90%, 95%, or up to 99% after in vivo processing.

[0031] In one aspect of the present application, the target knockdown achieved by the miRNA which is almost not formed by the biologically processing of the pri-miRNA provided by the present application is lower than about 40%, 10%, 5%, or close to 0.

[0032] In one aspect of the present application, the pri-miRNA provided by the present application, after biological processing, essentially only produces miRNA that does not produce off-target effects.

[0033] In one embodiment of the present application, the miRNA sequence that inhibits the expression of the TGFB gene has the following nucleotide sequence:

[0034] TATGCTGTGTGTACTCTGCTT (SEQ ID NO: 9);

[0035] TCCACTTTTAACTTGAGCCTC (SEQ ID NO: 11);

[0036] TCGATAGTCTTGCAGGTGGAT (SEQ ID NO: 13);

[0037] ACTTGCAGTGTGTTATCCCTG (SEQ ID NO: 15);

[0038] TATCCCACGGAAATAACCTAG (SEQ ID NO: 17);

[0039] ATGCTGGTTGTACAGGGCCAG (SEQ ID NO: 19);

[0040] AGTCAATGTACAGCTGCCGCA (SEQ ID NO: 21); or

[0041] TTAAATACAGCCCCCATGGGC (SEQ ID NO: 23).

[0042] In one embodiment of the present application, the combination of the RNA sequence that inhibits the expression of the TGFB gene and its complementary sequence has the following sequence group with the following nucleotide sequence:

[0043] In one embodiment of the present application, the RNA that inhibits the expression of the TGFB gene is a pri-miRNA, which has a stem-loop structure. In one embodiment of the present application, the sequence of the stem-loop structure has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO: 27).

[0044] In one embodiment of the present application, the RNA that inhibits the expression of the TGFB gene is a pri-miRNA, which has a 5' end flanking sequence (such as [M1M2…M m-1 M m ]) and a 3' end flanking sequence (such as [Nn N n-1 In one embodiment of the present application, the 5' flanking sequence and the 3' flanking sequence of the pri-miRNA each independently or simultaneously has more than 80% identity, preferably more than 90% identity, preferably more than 95% identity, and preferably 100% identity to the pri-miR sequence of a mammal, particularly human. In one embodiment of the present application, the pri-miR is pri-miR155.

[0045] In one embodiment of the present application, the 5' flanking sequence of the pri-miRNA has the following nucleotide sequence: TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 25).

[0046] In one embodiment of the present application, the 3' flanking sequence of the pri-miRNA has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO: 26).

[0047] In one aspect of the present application, the present application also provides a pre-miRNA processed from the pri-miRNA of the present application as described above.

[0048] The present application also provides a combination of isolated nucleic acids encoding RNAs that inhibit the expression of one or more target genes. The nucleic acids include (1) a nucleic acid sequence encoding an RNA that inhibits the expression of a TGFB gene, and (2) a nucleic acid sequence encoding an RNA that inhibits the expression of a second gene.

[0049] In one aspect of the present application, the second gene includes eIF2A, PERK, HRI, PKR, GCN2, Ago, PACT, hnRNPA1, TDP-43, VCP, SMN, and PRMT1, etc.

[0050] In yet another aspect of the present application, the second gene comprises TAU gene, LRRK2 gene, EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-a gene, integrin-a gene, B7 gene, TGF-β1 gene, HER2 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTPlB gene, PD-1, PD-L1, CTLA4, PTGS2 gene, TTR gene, SNCA gene, FUS gene, FGFR4 gene, FGF19 gene, CTNNB1 gene, KHK gene, mHTT gene and a-synuclein gene, etc.

[0051] In one embodiment of the present application, the isolated nucleic acid encoding a combination of RNAs that suppress the expression of one or more target genes comprises a spacer sequence between the sequence encoding the RNA that suppresses the expression of the TGFB gene and the sequence encoding the RNA that suppresses the expression of the second gene. In another embodiment of the present application, the spacer sequence has 6-50 nucleotides, preferably 10-30 nucleotides.

[0052] In yet another aspect of the present application, a vector comprising the aforementioned isolated nucleic acid of the present application encoding a RNA that suppresses the expression of the TGFB gene is provided. In yet another aspect of the present application, the vector is an expression vector. The nucleic acid of the present application can be located downstream of a promoter of the vector (e.g., but not limited to, CMV, U6, CBA or CBA promoter with SV40 intron).

[0053] In one embodiment of the present application, the vector is a plasmid. In one embodiment of the present application, the plasmid, after being administered to a mammal, can be enriched in a tissue (including: liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, particularly liver), transcribed and / or expressed the RNA fragment of the present application, and the RNA fragment is encapsulated in an exosome in the cells of the tissue.

[0054] In one embodiment of the present application, the vector is a viral vector. For example, it can be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpes virus vector or a lentivirus vector, etc. In one embodiment of the present application, the vector is an adenovirus vector, for example, an adenovirus-associated virus type 5, adenovirus-associated virus type 8 or adenovirus-associated virus type 9.

[0055] In one embodiment of the application, the plasmid or viral vector is enriched and expressed in the liver after administration to a mammal, and the product is substantially encapsulated in exosomes.

[0056] In one aspect of the application, a cell comprising the isolated nucleic acid of the application as previously described is provided. The cell comprising the nucleic acid of the application as previously described of the application can be obtained by transfecting a cell with a plasmid or viral vector. Transfection of a cell with a nucleic acid construct can be performed using a variety of methods. These methods include, but are not limited to, cationic lipid transfection, electroporation, viral transfection, and calcium phosphate transfection.

[0057] In one aspect of the application, an exosome with an RNA that inhibits the expression of a TGFB gene is provided, comprising the pri-miRNA, pre-miRNA or RNA molecule of the application as previously described. In one embodiment of the application, the exosome is a human tissue or cell derived exosome. The tissue includes liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells, or lymphocytes. In one embodiment of the application, the exosome is a liver or liver cell derived exosome.

[0058] The exosomes of the application can be purified using known exosome purification techniques. For example, exosomes can be purified by tangential flow filtration (TFF) or ultracentrifugation, for example 100000 x g for 1-2 hours. Alternative or additional purification methods can be used, such as antibody-based methods, for example immunoprecipitation using specific antibodies, magnetic bead purification, resin-based purification. The exosomes can then be quantified and characterized.

[0059] The RNA provided by the application can be delivered to different tissues to inhibit their specific target genes and treat related diseases.

[0060] In one aspect of the application, a pharmaceutical composition comprising the nucleic acid, vector or cell as previously described is provided. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, vector or cell to a subject.

[0061] The drug can be administered orally, inhaled, subcutaneously injected, intramuscularly injected, or intravenously injected. The drug can be in the form of a tablet, a capsule, a powder, a granule, a pill, a suppository, an ointment, a solution, a suspension, a lotion, a gel, a paste, etc. The plasmid or viral vector in the drug is enriched in a tissue (including: liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organ, blood cell or lymphocyte, especially liver) of a mammal after administration, and the product expressed by the plasmid or viral vector is massively encapsulated in an exosome in the cells of the tissue and delivered to a target tissue to exert a therapeutic effect.

[0062] The pharmaceutical composition can be used to treat cancer, acute or chronic infectious disease, or other acute or chronic disease. The cancer can be any cancer, including leukemia, lymphoma, multiple myeloma, or solid tumor, such as leukemia, which is acute lymphoblastic leukemia, acute myelogenous leukemia, acute promyelocytic leukemia, acute lymphoblastic leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, monocytic leukemia, and hairy cell leukemia; lymphoma, which is Hodgkin's lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, and small lymphocytic lymphoma; and solid tumor, which is urothelial carcinoma of the bladder, urethra, ureter, and renal pelvis, multiple myeloma, kidney cancer, breast cancer, colon cancer, head and neck cancer, lung cancer, prostate cancer, glioblastoma, osteosarcoma, liposarcoma, soft tissue sarcoma, ovarian cancer, melanoma, liver cancer, esophageal cancer, pancreatic cancer, and gastric cancer, etc.

[0063] The acute or chronic infectious disease includes viral diseases such as influenza, viral hepatitis, AIDS, and SARS, bacterial diseases such as tuberculosis and bacterial pneumonia, and other acute or chronic infectious diseases caused by various pathogenic microorganisms. The other acute or chronic diseases include respiratory diseases, immune system diseases, blood and hematopoietic system diseases, circulatory system diseases such as cardiovascular diseases, endocrine system metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases, and motor system diseases. For example, the disease is cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.

[0064] In one aspect of the present application, a method for treating a disease is provided, which comprises administering the nucleic acid, vector, or exosome as described above to a subject. The disease includes a tumor, acute or chronic infectious disease, or other acute or chronic disease.

[0065] It will be appreciated by persons skilled in the art that the actual dose administered will vary depending on a variety of factors such as the carrier, the target cell or tissue, the general condition of the subject to be treated, the degree of transformation / modification sought, the route of administration, the mode of administration, the type of transformation / modification sought, etc. DETAILED DESCRIPTION

[0066] The essence of the present application and the beneficial effects will be further illustrated below in conjunction with the examples, which are only used to illustrate the present application and not to limit the present application.

[0067] Materials and methods of Example 1

[0068] Table 1 Cells, materials and kits:

[0069] Example 2 Nucleic acid synthesis and plasmid preparation

[0070] 1. Commission Suzhou Jinyuizhi Biotechnology Co., Ltd. to synthesize or prepare the nucleic acid fragments in the following Table 2.

[0071] Among them, the sequence of the pri-miRNA is as follows in the table

[0072] Table 2 Single copy pri-miRNA sequence and structure

[0073] Among them, miTGFB#1 to miTGFB#8 are nucleic acid fragments of pri-miRNA encoding proteins that inhibit the expression of single pri-miRNA of TGFB gene, which contain RNA sequences targeting the mRNA of TGFB.

[0074] The structure of the single pri-miRNA sequence from 5' to 3' includes: 5' flanking sequence TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 25); miRNA sequence; stem-loop structure sequence GTTTTGGCCTCTGACTGAC (SEQ ID NO: 27); compensation sequence; 3' flanking sequence CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO: 26).

[0075] Among them, miTGFB#1 to miTGFB#8 have the following combinations of miRNA sequences and compensation sequences, respectively:

[0076] Table 3 miRNA sequence of pri-miRNA

[0077] 2. Constructing a plasmid containing the above-mentioned pri-miRNA nucleic acid fragment inhibiting TGFB and expressing the contained miRNA

[0078] The above-mentioned pri-miRNA-encoding nucleic acid fragments were inserted into pcDNA6.2-EmGFP-mir9 vectors, respectively, to prepare plasmids carrying the sequences of the pri-miRNA targeting TGFB, and the obtained plasmids were named miTGFB#1 to miTGFB#10, respectively.

[0079] Example 3 Cell and Exosome Preparation and Analysis

[0080] The plasmids prepared in Example 2 were transfected into HEK293T cells, and exosomes in the cell culture medium were observed. Nanoparticle tracking analysis (NTA) showed that the number of exosomes secreted by each group was similar, and the size distribution was similar, with a peak at 128-131 nm. Transmission electron microscopy (TEM) confirmed that the purified exosomes exhibited a typical round vesicle morphology and correct size. In addition, enrichment of specific exosomal markers (CD63, TSG101, and CD9) was only detected in purified exosomes, but not in the cell culture medium. Exosomal RNA was extracted for miRNAseq to analyze the miRNA composition and detect the amount and ratio of 5' arm miRNA (i.e., the first miRNA) and 3' arm miRNA (i.e., the second miRNA) in the exosomal RNA.

[0081] The results are shown in Table 4 below.

[0082] Table 4 miRNA composition detection

[0083] Example 4 miRNA Activity

[0084] 1. TGFB mRNA level changes

[0085] 293T cells were plated in 6-well plates at a density of 1.2E6 cells per well overnight, and Lipofectamin 3000 was used to transfect 293T cells at 2.5ug miRNA plasmid per well, and the cells were collected 48 hours after transfection.

[0086] Cellular mRNA was extracted and TGFB mRNA changes were detected using qPCR. Total RNA was extracted using a total RNA extraction kit (UE) according to the instructions, and reverse transcription was performed using a reverse transcription reagent (Takara). qPCR was performed using TGFB / GAPDH / β-actin primers. The primer sequences are as follows:

[0087] The results are shown in Table 5 below.

[0088] Table 5 miRNA activity detection-mRNA target knockdown (KD)

[0089] 2. TGFB protein level changes

[0090] In addition, Western Blotting was used to detect changes in TGFB protein in cells. Part of the cells were lysed using RIPA (Bi Yun Tian), the total protein concentration was measured by BCA method (Adamas life), the BSA standard was diluted, 20 μL of sample or standard was added to each well, 200 μL of reaction reagent was added, and incubated at 37°C for 30 minutes. The OD value was measured by enzyme label instrument (Thermo Fisher) 562m, and the total protein concentration of the sample was calculated according to the standard curve.

[0091] After adding 4X LDS (Thermo Fisher) to the sample, heating at 70°C for 10 min, using SDS-PAGE (Elabscience) to load and transfer the gel, adding TGFB and Vinculin (Abeam) antibody for incubation, and imaging and gray scale analysis of TGFB and Vinculin bands on TANON 5200 multi-imager and software.

[0092] The results are shown in Table 7 below.

[0093] Table 6 miRNA activity detection-protein target knockdown (KD)

[0094] The above is a description of the present application, which cannot be considered as a limitation of the present application. Unless otherwise indicated, the practice of the present application will use conventional techniques of organic chemistry, polymer chemistry, biotechnology, etc. It is obvious that the present application can be implemented in other ways in addition to those specifically described in the above description and examples. Other aspects and improvements within the scope of the present application will be apparent to those skilled in the art. Many changes and modifications are possible according to the teachings of the present application, and therefore are within the scope of the present application.

Claims

1. An isolated nucleic acid comprising a nucleic acid sequence encoding RNA that represses the expression of the TGFB gene, said nucleic acid sequence comprising a miRNA sequence that represses the TGFB gene.

2. The nucleic acid of claim 1, wherein the RNA is a pri-miRNA, which comprises, from 5' to 3', a 5' flanking structure sequence, a miRNA sequence that inhibits TGFB gene expression, a stem-loop sequence, a compensation sequence, and a 3' flanking structure sequence.

3. The nucleic acid of claim 2, comprising multiple copies of the nucleic acid sequence of the pri-miRNA, preferably, the multiple copies being 2-10 copies, for example, 2, 3 or 4 copies.

4. The nucleic acid according to claim 1, wherein the miRNA sequence for inhibiting TGFB gene expression has the following nucleotide sequence: TATGCTGTGTGTACTCTGCTT(SEQ ID NO:9); TCCACTTTTAACTTGAGCCTC(SEQ ID NO:11); TCGATAGTCTTGCAGGTGGAT(SEQ ID NO:13); ACTTGCAGTGTGTTATCCCTG (SEQ ID NO: 15); TATCCCACGGAAATAACCTAG(SEQ ID NO:17); ATGCTGGTTGTACAGGGCCAG (SEQ ID NO: 19); AGTCAATGTACAGCTGCCGCA(SEQ ID NO:21); or TTAAATACAGCCCCCATGGGC (SEQ ID NO:23).

5. The nucleic acid according to claim 1, wherein the combination of the miRNA sequence that inhibits TGFB gene expression and its compensating sequence constitutes a sequence group having the following nucleotide sequences:

6. The nucleic acid according to claim 1, wherein the RNA that inhibits TGFB gene expression has a stem-loop structure, for example, having the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO:27).

7. The nucleic acid according to claim 1, wherein the RNA that inhibits TGFB gene expression has a 5' flanking structure sequence and a 3' flanking structure sequence, each of which independently or simultaneously shares greater than 80% identity with the pri-miR sequence of mammals or humans, preferably greater than 95%, more preferably 100%.

8. The nucleic acid according to claim 7, wherein the 5' flanking structure sequence has the following nucleotide sequence: TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO:25), And / or, wherein the 3' flanking structure sequence has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO:26).

9. A vector comprising encoding the isolated nucleic acid of any one of claims 1-8.

10. A cell comprising the nucleic acid of any one of claims 1-8 or the vector of claim 9. Optionally, the exosomes in the cells contain RNA obtained by in vivo processing of the pri-miRNA.

11. An exosome comprising the RNA according to claim 10.

12. A method for regulating gene activity in target cells, comprising administering a nucleic acid according to any one of claims 1-8 or a vector according to claim 9, a cell according to claim 10 or an exosome secreted by said cell, or an exosome according to claim 11.

13. A pharmaceutical composition comprising the nucleic acid of any one of claims 1-8 or the carrier of claim 9, the cell of claim 10 or the exosome secreted by said cell, or the exosome of claim 11.

14. A method of treating a disease, comprising administering a nucleic acid according to any one of claims 1-8 or a vector according to claim 9, a cell according to claim 10 or an exosome secreted by said cell, or an exosome according to claim 11.

15. Use of the nucleic acid of any one of claims 1-8, or the vector of claim 9, the cell of claim 10, or the exosomes secreted by the cell, or the exosomes of claim 11, in the preparation of a medicament for treating a disease.

16. The use as claimed in claim 15, wherein the disease is cancer, acute or chronic infectious disease or other acute or chronic disease.

17. The use as claimed in claim 16, wherein the cancer is leukemia, lymphoma, multiple myeloma, or a solid tumor, such as leukemia being acute lymphoblastic leukemia, acute myeloid leukemia, acute promyelocytic leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, monocytic leukemia, and hairy cell leukemia; lymphoma being: Hodgkin lymphoma; non-Hodgkin lymphoma; Burkitt lymphoma; and small lymphocytic lymphoma; solid tumor being bladder cancer, urethral, ​​ureteral, and renal pelvis urothelial carcinoma, multiple myeloma, kidney cancer, breast cancer, colon cancer, head and neck cancer, lung cancer, prostate cancer, glioblastoma, osteosarcoma, liposarcoma, soft tissue sarcoma, ovarian cancer, melanoma, liver cancer, esophageal cancer, pancreatic cancer, and gastric cancer.

Images