Biomarker for diagnosing lung adenocarcinoma and use thereof

Abstract

The present disclosure relates to a composition for diagnosing lung adenocarcinoma and a use thereof and, more specifically, to a composition for diagnosing lung adenocarcinoma, comprising an agent capable of measuring the expression level of SYNCRIP protein or a gene coding therefor, whereby lung adenocarcinoma can be efficiently diagnosed.

Description

Biomarkers for lung cancer diagnosis and their applications

[0001] The present invention relates to a composition for diagnosing lung cancer and its use.

[0002]

[0003] Cancer is a disease for which early diagnosis is crucial, and its prevalence has recently been increasing. According to data from the Central Cancer Registry published in 2024, lung cancer will account for 11.5% of all cancer incidence in Korea in 2022, ranking third. Furthermore, as of 2023, it will also be recorded as the cancer with the highest mortality rate. As such, lung cancer is one of the cancers with the highest prevalence and mortality rates, and lung cancer treatments and biomarkers are among the fields with the highest market growth.

[0004] Non-small cell lung cancer (NSCLC) accounts for 80% of lung cancers, with adenocarcinoma (LUAD) accounting for the largest proportion. The five-year survival rate for lung adenocarcinoma is only about 17%, and the recurrence rate after surgery is high. Therefore, there is a critical need to develop novel biomarkers to enhance early detection, improve prognostic accuracy, guide treatment decisions, and monitor treatment response.

[0005] Currently, genes such as EGFR, BRAF, MET, ALK, and KRAS are being used to develop targeted therapies and genetic biomarkers for lung cancer. However, only about half of all lung cancer patients have abnormalities in these genes, making it difficult for the remaining lung cancer patients to receive treatment using the latest targeted therapies and genetic biomarkers.

[0006] Normal and cancer cells exhibit differences in protein translation and expression. In particular, cancer cells exhibit significantly increased expression of genes that promote cell proliferation and suppress apoptosis. Among these genes, Aurora kinase genes promote cell division and include three types: Aurora kinase A (AURKA), AURKB, and AURKC. AURKC primarily contributes to germ cell formation, while AURKA and AURKB have been found to be elevated in various cancer types. Unlike AURKA, which is essential for normal development, AURKB's function is potentially compensated by AURKC, making targeting AURKB inhibition a promising approach for cancer treatment. Overexpression of AURKB is frequently observed in lung cancer patients, and it is known as a key gene in lung adenocarcinoma.

[0007] AZD1152 (barasertib), which exhibits 1,000-fold higher selectivity for AURKB than AURKA, showed promising clinical efficacy, but its development was halted due to toxicity and difficulties in clinical application. Currently, nanoparticle-encapsulated AURKB inhibitors are being developed. For clinical application of AURKB inhibitors, biomarkers predicting the efficacy of AURKB inhibition are needed, enabling optimal treatment for patients expected to respond. Furthermore, the development of relevant biomarkers is essential for early diagnosis and prognosis prediction of lung adenocarcinoma.

[0008]

[0009] The present invention aims to provide a novel biomarker for diagnosing lung cancer, predicting prognosis, or predicting treatment response to anticancer drugs.

[0010] The purpose of the present invention is to provide a pharmaceutical composition for treating lung cancer.

[0011]

[0012] 1. A composition for diagnosing lung cancer, comprising a preparation capable of measuring the expression level of a SYNCRIP protein or a gene encoding the same.

[0013] 2. In the above 1, a composition for diagnosing lung cancer, wherein the agent capable of measuring the expression level of the SYNCRIP protein is a monoclonal antibody, polyclonal antibody, chimeric antibody, ligand, PNA, aptamer or nanoparticle that specifically binds to the SYNCRIP protein.

[0014] 3. A composition for diagnosing lung cancer, wherein the agent capable of measuring the expression level of a gene encoding a SYNCRIP protein in the above 1 is a primer pair, probe or antisense nucleotide that specifically binds to the gene.

[0015] 4. A kit for diagnosing lung cancer, comprising the composition described in any one of 1 to 3 above.

[0016] 5. A method for providing information for diagnosing lung cancer, comprising a step of measuring the expression level of a SYNCRIP protein or a gene encoding the same in a biological sample obtained from an individual.

[0017] 6. A method for providing information for diagnosing lung adenocarcinoma, further comprising a step of diagnosing lung adenocarcinoma when the expression level of the SYNCRIP protein or the gene encoding it is higher than that of the control group in the above 5.

[0018] 7. A pharmaceutical composition for treating lung cancer comprising a SYNCRIP inhibitor.

[0019] 8. A pharmaceutical composition for treating lung cancer, wherein in the above 7, the SYNCRIP inhibitor is an antibody or an antigen-binding fragment thereof that specifically binds to the SYNCRIP protein.

[0020] 9. A pharmaceutical composition for treating lung cancer, wherein in the above 7, the SYNCRIP inhibitor is an antisense nucleotide, siRNA, shRNA, ribozyme, or CRISPR / Cas9 that complementarily binds to a gene encoding the SYNCRIP protein or a part thereof.

[0021] 10. A pharmaceutical composition for treating lung cancer, wherein the SYNCRIP inhibitor in the above 7 is a CRISPR / Cas9 complex comprising an oligonucleotide pair consisting of the sequences of SEQ ID NOs: 1 and 2 or an oligonucleotide pair consisting of the sequences of SEQ ID NOs: 3 and 4.

[0022]

[0023] The present invention utilizes SYNCRIP as a novel lung adenocarcinoma marker, enabling the early diagnosis of lung adenocarcinoma, predicting its prognosis, and treating lung adenocarcinoma by suppressing its expression. Furthermore, SYNCRIP can be used as a biomarker to predict treatment response to drugs such as anticancer agents.

[0024]

[0025] Figure 1a is a fluorescence microscopic image showing the expression levels of AURKB and SYNCRIP proteins in lung cancer patient tissues, as a result of immunofluorescence staining with AURKB and SYNCRIP antibodies. Immunofluorescence staining was performed on squamous cell carcinoma (SCC) and adenocarcinoma (LUAD) patient tissues, respectively.

[0026] Figure 1b is a graph showing the expression level of each protein measured from fluorescence intensity by immunofluorescence staining with AURKB and SYNCRIP antibodies in lung cancer patient tissue.

[0027] Figure 1c is a graph showing the expression levels of each protein measured from fluorescence intensity by immunofluorescence staining with AURKB and SYNCRIP antibodies in lung cancer patient tissue. Grades 1 to 3 indicate the stages.

[0028] Figure 2a is a Kaplan-Meier survival plot confirming the overall survival rate of SCC (209025) patients according to the level of SYNCRIP expression.

[0029] Figure 2b is a Kaplan-Meier survival plot that confirms the overall survival rate of LUAD (236146) patients according to the level of SYNCRIP expression.

[0030] Figure 2c is a Kaplan-Meier survival plot confirming the relapse-free survival of LUAD (236146) patients according to the level of SYNCRIP expression.

[0031] Figure 3a shows the results of measuring the expression level of AURKB protein in NIH3T3 fibroblasts and LLC (lewis lung carcinoma) cell lines in which SYNCRIP was knocked out. LC-SYNCRIP is a SYNCRIP knocked-out plasmid introduced into the cell line, indicating the experimental group, and LC-GFP is a control group in which SYNCRIP was not knocked out.

[0032] Figure 3b shows the results of measuring the amount of AURKB mRNA in NIH3T3 fibroblasts and LLC (lewis lung carcinoma) cell lines in which SYNCRIP was knocked out. LC-SYNCRIP is a SYNCRIP knocked-out plasmid introduced into the cell lines, indicating the experimental group, and LC-GFP is a control group in which SYNCRIP was not knocked out.

[0033] Figure 4a is a schematic diagram showing the position where the AURKB 5′UTR sequence is inserted on the plasmid in a dual luciferase reporter assay experiment to confirm the AURKB protein expression regulation mechanism of SYNCRIP.

[0034] Figure 4b shows the results of a dual luciferase reporter assay to confirm the mechanism of SYNCRIP's regulation of AURKB protein expression. The results confirming that FLUC expression was high when a plasmid with an AURKB 5'UTR sequence inserted into an LLC cell line was transfected (left) and the results confirming the binding between AURKB 5'UTR and SYNCRIP protein using biotinylated-AURKB 5'UTR and streptavidin beads (right).

[0035] Figure 4c shows the results of a dual luciferase reporter assay to confirm the mechanism of SYNCRIP's regulation of AURKB protein expression, and confirms that the protein translation promotion phenomenon by the AURKB 5′UTR sequence is reduced in NIH3T3 cells and LLC cells in which SYNCRIP is knocked out, respectively. Mock is a control group without the AURKB 5′UTR sequence inserted, LC-SYNCRIP is an experimental group in which SYNCRIP is knocked out, and LC-GFP is a control group in which SYNCRIP is not knocked out.

[0036] Figure 5a shows the results of an in vitro clonogenic assay performed on NIH3T3 cells and LLC cells in which the SYNCRIP gene was knocked out, confirming that cell proliferation was inhibited. LC-SYNCRIP is a plasmid with SYNCRIP knocked out and serves as the experimental group, while LC-GFP is a plasmid with no SYNCRIP knocked out and serves as the control group.

[0037] Figure 5b shows the results of an in vitro MTT assay performed on NIH3T3 cells and LLC cells in which the SYNCRIP gene was knocked out, confirming that cell proliferation was inhibited. LC-SYNCRIP is a plasmid with SYNCRIP knocked out and serves as the experimental group, while LC-GFP is a plasmid with no SYNCRIP knocked out and serves as the control group.

[0038] Figure 5c shows the results of an in vivo experiment in which NIH3T3 cells and LLC cells in which the SYNCRIP gene was knocked out were injected subcutaneously into mice with SYNCRIP knockout LLC cells and a control group to determine changes in tumor volume. LC-SYNCRIP is a plasmid with SYNCRIP knockout and serves as the experimental group, while LC-GFP is a plasmid with no SYNCRIP knockout and serves as the control group.

[0039] Figure 6a is a photograph showing the results of verifying the function of the SYNCRIP gene in an organoid system. The SYNCRIP gene was knocked out by transfecting gRNA and Cas9 into lung adenocarcinoma organoids, and the degree of organoid growth was observed 7 days and 21 days later.

[0040] Figure 6b shows the results of verifying the function of the SYNCRIP gene in the organoid system. The SYNCRIP gene was knocked out by transfecting gRNA and Cas9 into lung adenocarcinoma organoids, and the organoid diameter was measured 21 days later using Image J.

[0041] Figure 7a shows the results of an in vitro MTT assay performed on LLC cell lines (#2 and #15) in which the AURKB 5′UTR sequence was deleted using Crispr / Cas9.

[0042] Figure 7b shows the results of an in vitro experiment in which LLC cell lines (#2 and #15) were created in which the AURKB 5′UTR sequence was deleted using Crispr / Cas9, and cell proliferation was confirmed to be inhibited through a clonogenic assay.

[0043] Figures 7c and 7d show the results of an in vivo experiment in mice in which LLC cell lines (#2 and #15) were created in which the AURKB 5′UTR sequence was deleted using Crispr / Cas9, and tumor size was confirmed to be reduced.

[0044]

[0045] The present invention provides a composition for diagnosing lung cancer.

[0046] The present invention provides a composition for diagnosing lung adenocarcinoma, which can more efficiently diagnose lung adenocarcinoma by including a preparation capable of measuring the expression level of a SYNCRIP protein or a gene encoding the same.

[0047] Synaptotagmin-binding cytoplasmic RNA-interacting protein (SYNCRIP) is a subfamily of heterogeneous ribonucleoprotein particles (hnRNPs), also known as hnRNP Q. hnRNPs are RNA-binding proteins involved in alternative splicing, RNA processing, polyadenylation, and mRNA metabolism and transport. Among these, SYNCRIP is an evolutionarily well-conserved protein involved in multiple cellular pathways, has been associated with neurological and muscular developmental disorders, and plays a crucial role in RNA metabolism.

[0048] "Adenocarcinoma (LUAD)" is a type of non-small cell lung cancer that accounts for 80% of lung cancers, and is the most common type of non-small cell lung cancer.

[0049] “Diagnosis” may include determining a subject’s susceptibility to a particular disease or condition, determining whether a subject currently has a particular disease or condition, or determining a prognosis for a subject with a particular disease or condition.

[0050] In the present invention, the agent capable of measuring the expression level of the SYNCRIP protein may be, for example, a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a ligand, a peptide nucleic acid (PNA), an aptamer, or a nanoparticle that specifically binds to the SYNCRIP protein.

[0051] In one embodiment of the present invention, the protein expression level of SYNCRIP was measured using an antibody that specifically binds to the SYNCRIP protein (Monoclonal Anti-hnRNP-Q antibody produced in mouse; Cat. no. R5653, Sigma Aldrich).

[0052] In one embodiment of the present invention, the protein expression level of SYNCRIP was measured by immunofluorescence staining or Western blot using an antibody (R5653 from Sigma Aldrich) that specifically binds to the SYNCRIP protein.

[0053] In the present invention, a preparation capable of measuring the expression level of a gene encoding a SYNCRIP protein may be, for example, a primer pair, a probe, or an antisense nucleotide that specifically binds to the gene.

[0054] The method for measuring the expression level of the gene encoding the SYNCRIP protein is also not particularly limited, and the expression level of the gene encoding the SYNCRIP protein can be measured using methods such as reverse transcription polymerase reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blot, RNA sequencing, or microarray.

[0055] Primers can initiate DNA synthesis in the presence of reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR conditions and the lengths of the sense and antisense primers can be modified based on those known in the art.

[0056] A probe is a nucleic acid fragment, such as RNA or DNA, ranging from a few bases to several hundred bases in length that can specifically bind to mRNA. It is labeled to enable detection of the presence of a specific mRNA. Probes can be produced in the form of oligonucleotide probes, single-stranded DNA probes, double-stranded DNA probes, RNA probes, etc. Selection of an appropriate probe and hybridization conditions can be modified based on those known in the art.

[0057] The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These nucleic acid sequences can also be modified using various methods known in the art. Examples include methylation, capping, substitution with one or more homologs of a natural nucleotide, and modifications between nucleotides.

[0058] The present invention provides a lung cancer diagnostic kit comprising the lung cancer diagnostic composition of the present invention.

[0059] "Lung cancer diagnostic kit" refers to a kit containing a lung cancer diagnostic composition, and may include not only the lung cancer diagnostic composition but also one or more types of compositions, solutions, or devices suitable for expression level analysis. For example, the kit may include, but is not limited to, a substrate, a suitable buffer solution, a secondary antibody labeled with a detection label, and a chromogenic substrate for immunological detection of antibodies.

[0060] The lung cancer diagnostic kit of the present invention may further include components, tools, reagents, etc. commonly used in the field so as to be suitable for use as a lung cancer diagnostic kit.

[0061] The lung adenocarcinoma diagnostic kit of the present invention may be a kit containing essential elements necessary for performing RT-PCR. In addition to each primer pair specific for the mRNA of a marker gene, the RT-PCR kit may also include a test tube or other appropriate container, a reaction buffer, deoxyribonucleotides (dNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNase and RNase inhibitors, DEPC water, sterile water, and the like. Furthermore, the kit may include a primer pair specific for a gene used as a quantitative control.

[0062] The lung adenocarcinoma diagnostic kit of the present invention may include a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, and a chromogenic substrate for immunological detection of a nucleotide sequence of a gene encoding a SYNCRIP protein, a sequence complementary to the nucleotide sequence, a fragment of the nucleotide, or a substance that specifically binds to a protein encoded by the nucleotide sequence.

[0063] The lung adenocarcinoma diagnostic kit of the present invention may be a lung adenocarcinoma diagnostic microarray capable of measuring the expression level of a gene encoding a SYNCRIP protein.

[0064] The lung adenocarcinoma diagnostic kit of the present invention may include an antibody that specifically binds to a marker component, a secondary antibody conjugate to which a label that develops color by reaction with a substrate is conjugated, a chromogenic substrate solution that reacts with the label to develop color, a washing solution, an enzyme reaction stop solution, etc., and may be manufactured with a plurality of separate packagings or compartments containing the reagent components used, but may not be limited thereto.

[0065] As a specific example, the kit may be a kit characterized by including essential elements necessary for performing ELISA to implement various ELISA methods such as ELISA kits and sandwich ELISA. Such ELISA kits include antibodies specific for the proteins. The antibodies have high specificity and affinity for the SYNCRIP protein and little cross-reactivity to other proteins, and may be monoclonal antibodies, polyclonal antibodies, or recombinant antibodies. In addition, the ELISA kit may include antibodies specific for a control protein. In addition, the ELISA kit may include, but is not limited to, reagents capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes and their substrates, or other substances capable of binding to antibodies.

[0066] In addition, the kit of the present invention may be a kit for implementing Western blot, immunoprecipitation analysis, complement fixation analysis, flow cytometry, or protein chip, and may further include additional components suitable for each analysis method.

[0067] The present invention provides a method for providing information for diagnosing lung cancer, comprising a step of measuring the expression level of a SYNCRIP protein or a gene encoding the same in a biological sample obtained from an individual.

[0068] An "individual" is an animal that can develop lung cancer, or an animal for which information for diagnosing lung cancer is desired, and may be a vertebrate animal, preferably a mammal. For example, the individual may be a human, monkey, pig, cow, horse, dog, sheep, cat, rat, etc.

[0069] "Biological sample obtained from an individual" means a sample isolated from an individual requiring diagnosis of lung adenocarcinoma, such as whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, blood (including plasma and serum), sputum, tears, mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, pelvic fluids, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate. aspirate), bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cells, cell extracts, or cerebrospinal fluid.

[0070] In one embodiment, the biological sample may be, but is not limited to, tissue isolated from a lung cancer patient.

[0071] The present invention provides a method for providing information for diagnosing lung adenocarcinoma, which further includes a step of diagnosing lung adenocarcinoma when the expression level of the SYNCRIP protein or the gene encoding it is higher than that of a control group.

[0072] A "control" may be, for example, a normal person, an individual without symptoms suggestive of lung adenocarcinoma or who has not been diagnosed with lung adenocarcinoma, or a patient with a type of lung cancer other than lung adenocarcinoma, or a sample obtained from such a patient.

[0073] The present invention provides a method for diagnosing lung cancer, comprising the step of measuring the expression level of a SYNCRIP protein or a gene encoding the same in a biological sample obtained from an individual.

[0074] The diagnostic method of the present invention may further include a step of diagnosing lung cancer when the expression level of the SYNCRIP protein or the gene encoding it is higher than that of the control group.

[0075] The present invention provides a use of a preparation capable of measuring the expression level of a SYNCRIP protein or a gene encoding the same for diagnosing lung cancer.

[0076] The present invention provides a composition for predicting the therapeutic response of lung cancer to an anticancer agent, comprising a preparation capable of measuring the expression level of a SYNCRIP protein or a gene encoding the same.

[0077] "Prediction of treatment responsiveness" means predicting whether a patient with lung cancer will respond favorably or unfavorably to anticancer drugs, predicting the risk of resistance to anticancer drugs, and predicting the patient's prognosis after anticancer treatment, such as recurrence, metastasis, or survival.

[0078] The composition for predicting therapeutic response of the present invention can provide information for selecting the most appropriate anticancer treatment regimen for patients with lung adenocarcinoma. More specifically, the composition for predicting therapeutic response of the present invention can provide information for facilitating the selection of anticancer agents and enhancing therapeutic response by predicting whether the patient will respond favorably or unfavorably to the anticancer agent.

[0079] The present invention provides a method for providing information for predicting treatment response to an anticancer agent in lung cancer, comprising a step of measuring the expression level of a SYNCRIP protein or a gene encoding the same in a biological sample obtained from an individual.

[0080] The information providing method for predicting treatment responsiveness of the present invention includes a step of predicting that the lower the expression level of the SYNCRIP protein or the gene encoding it, the higher the treatment responsiveness of lung adenocarcinoma to an anticancer agent.

[0081] In the method for providing information for predicting treatment responsiveness of the present invention, if treatment responsiveness is predicted to be low, the anticancer agent for lung adenocarcinoma can be changed. Furthermore, after changing the anticancer agent for lung adenocarcinoma, the step of measuring the expression level of the SYNCRIP protein or the gene encoding it in a biological sample obtained from the subject can be performed again.

[0082] The present invention provides a use of a formulation capable of measuring the expression level of a SYNCRIP protein or a gene encoding the same for predicting the therapeutic response of lung cancer to an anticancer agent.

[0083] The present invention provides a use of a formulation capable of measuring the expression level of a SYNCRIP protein or a gene encoding the same for predicting the prognosis of lung cancer.

[0084] The terms lung cancer, SYNCRIP, preparations capable of measuring the expression level of the SYNCRIP protein or the gene encoding it, subjects, biological samples obtained from subjects, and controls are described as above unless contradictory.

[0085] The present invention provides a pharmaceutical composition for treating lung cancer comprising a SYNCRIP inhibitor.

[0086] A SYNCRIP inhibitor is a substance that reduces the expression or activity of a SYNCRIP protein or reduces the expression of a gene encoding a SYNCRIP protein.

[0087] The content of the SYNCRIP inhibitor in the pharmaceutical composition of the present invention can be appropriately adjusted depending on the form and purpose of use, patient condition, type and severity of symptoms, etc.

[0088] In the pharmaceutical composition of the present invention, the SYNCRIP inhibitor may be an antibody or an antigen-binding fragment thereof that specifically binds to the SYNCRIP protein.

[0089] In the pharmaceutical composition of the present invention, the SYNCRIP inhibitor may be an antisense nucleotide, siRNA, shRNA, ribozyme, or CRISPR / Cas9 that complementarily binds to a gene encoding a SYNCRIP protein or a portion thereof.

[0090] In the present invention, the siRNA may be an siRNA that complementarily binds to a gene encoding a SYNCRIP protein or a portion thereof, for example, sc-72096 or sc-72097 from Santa Cruz Biotechnology.

[0091] In the present invention, the shRNA may be an shRNA that complementarily binds to a gene encoding a SYNCRIP protein or a part thereof, for example, sc-72096-SH, sc-72096-V, sc-72097-SH or sc-72097-V from Santa Cruz Biotechnology.

[0092] In the present invention, the shRNA may be an shRNA that complementarily binds to a gene encoding a SYNCRIP protein or a portion thereof, for example, TG308987 from Origene.

[0093] In the present invention, inhibition of SYNCRIP may be achieved by using genetic scissors.

[0094] "Gene scissors" are tools used to cut the DNA of plant and animal genes. Examples include restriction enzymes, zinc finger nucleases (ZFNs), TALENs, and CRISPR / Cas9. Gene scissors can be used in genome editing technology, which solves problems by removing incorrect parts of genes.

[0095] "CRISPR / Cas9" is a type of third-generation genetic scissors, consisting of a "guide RNA (gRNA)" made of RNA and an enzyme called "Cas9" that cuts DNA. CRISPR is a DNA sequence found in the genome of prokaryotic organisms such as bacteria and archaea, and Cas9 is an enzyme that uses the CRISPR sequence as a guide to recognize and cut DNA complementary to the CRISPR sequence. The guide RNA acts as a guide that directs which part of the DNA to cut. RNA can bind complementarily to DNA sequences. CRISPR utilizes this characteristic of RNA to find and bind to a DNA sequence complementary to the base sequence of its own RNA.

[0096] Guide RNA forms a complex with Cas9, a restriction enzyme that cuts the double helix of DNA. When this enzyme is inserted into the desired site of genetic manipulation, Cas9 finds the target DNA sequence and cuts it. Cells have the ability to repair DNA breaks. Therefore, when the DNA is restored to its original sequence, Crispr / Cas9 activates again to cut it. If this process is repeated repeatedly, "repair errors" occur, resulting in a few bases different from the original sequence. These differences cause Crispr to stop working, and the sequence altered by the repair error no longer functions. This makes it possible to precisely identify and knock out the target gene. Furthermore, this technology can be used not only to cut genes, but also to add genes to desired locations. By inserting a new DNA sequence along with Crispr / Cas9, the cell will absorb the added DNA sequence as it repairs the cut site.

[0097] The present invention can also provide a pharmaceutical composition for treating lung cancer, which further includes an agent capable of removing an AURKB 5' UTR region or an agent capable of inhibiting binding between SYNCRIP and AURKB 5' UTR.

[0098] The present invention provides a pharmaceutical composition for treating lung cancer, wherein the SYNCRIP inhibitor is a CRISPR / Cas9 complex comprising an oligonucleotide pair consisting of the sequences of SEQ ID NOs: 1 and 2 or an oligonucleotide pair consisting of the sequences of SEQ ID NOs: 3 and 4.

[0099] In the present invention, the oligonucleotide pair consisting of the sequences of SEQ ID NOs: 1 and 2 or the oligonucleotide pair consisting of the sequences of SEQ ID NOs: 3 and 4 may serve as a guide RNA (gRNA) that forms a complex with Cas9 and ultimately suppresses SYNCRIP by knocking out the CRISPR / Cas9 complex.

[0100] The pharmaceutical composition of the present invention may further include suitable carriers, excipients, and diluents commonly used in the manufacture of pharmaceutical compositions. The carriers may be used without limitation as long as they are known in the art, such as buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, bases, and lubricants.

[0101] Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

[0102] The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., topical preparations, suppositories, and sterile injection solutions according to conventional methods. Furthermore, it can be used in the form of topical preparations for skin in the form of ointments, lotions, sprays, patches, creams, powders, suspensions, gels, or gels. When formulating, it can be prepared using diluents or excipients such as commonly used fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.

[0103] Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and these solid preparations may be prepared by mixing the extract with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

[0104] Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives. Preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin.

[0105] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. The effective dosage level can be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug, the time of administration, the route and excretion rate, the duration of treatment, concomitant medications, and other factors well known in the medical field. The pharmaceutical composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, or can be administered singly or in multiple doses. It is important to consider all of the above factors and administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be readily determined by those skilled in the art.

[0106] The present invention provides a method for treating lung cancer comprising administering a SYNCRIP inhibitor to a subject in need of treatment.

[0107] The treatment method of the present invention may comprise administering to a subject an effective amount of a SYNCRIP inhibitor.

[0108] The present invention provides the use of a SYNCRIP inhibitor for the treatment of lung cancer.

[0109] The terms lung cancer, SYNCRIP, SYNCRIP inhibitor and entity are explained as above unless contradictory.

[0110]

[0111] Hereinafter, the present invention will be described in detail by way of examples to specifically explain the present invention.

[0112]

[0113] Example

[0114] 1. Materials and Methods

[0115] 1.1. Plasmid constructs

[0116] To construct a plasmid for CRISPR-mediated silencing of SYNCRIP, the lentiCRISPRv2 vector (Addgene, Plasmid #52961) was used as a backbone. For genetic perturbation of SYNCRIP in mouse cells and human organoids, pairs of oligonucleotides specific for mouse cells and human organoids were phosphorylated, annealed at 60°C for 30 s, and ligated to the digested lentiCRISPRv2 plasmid. This plasmid was designated LC-SYNCRIP. The specific sequences of the oligonucleotides used are shown in Table 1.

[0117] Sequence for mouse cells 5'-CACCGGTTCAATGAAGACGGCGCAT-3' (SEQ ID NO: 1) 5'-AAACATGCGCCGTCTTCATTGAACC-3' (SEQ ID NO: 2) for human organoid 5'-CACCGCCTGAATAAACGGAATCTGG-3' (SEQ ID NO: 3) 5'-AAACCCAGATTCCGTTTATTCAGGC-3' (SEQ ID NO: 4)

[0118]

[0119] To construct the pRF plasmid, the mouse AURKB 5'UTR (NM_011496.1) was amplified with pfu polymerase (SolGent). The PCR product was digested at the SalI / SmaI sites and inserted into the intragenic region of the pRF bicistronic vector. The PCR product was also digested with EcoRI / XbaI and inserted into the pSK vector for in vitro binding assays.

[0120]

[0121] 1.2. Creation of stable cells

[0122] To generate control or SYNCRIP-deficient cells, LC-GFP or LC-SYNCRIP plasmids were transfected into cells using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. After 2 days, selection with 2 μg / ml puromycin was initiated. Puromycin-resistant NIH3T3 and LLC cells were maintained in DMEM (HyClone) supplemented with 10% fetal bovine serum (FBS) (Gibco), 1% penicillin-streptomycin, and 2 μg / ml puromycin.

[0123]

[0124] 1.3. Preparation and Culturing of Patient-Derived Lung Cancer Organoids

[0125] Small sections of lung cancer tissue samples and cryobiopsies were finely ground and suspended in DMEM / F12 medium containing 1% penicillin-streptomycin, and then passed through a 70 μm strainer. The filtered cells were centrifuged at 300 × g for 5 min at 4 °C, and the cell pellet was treated with red blood cell lysis buffer (BioLegend) for 5 min at room temperature. Cold Dulbecco's phosphate-buffered saline (DPBS) containing 10% fetal bovine serum was added, and the mixture was centrifuged again at 300 × g for 5 min at 4 °C. The cell pellet was then resuspended in cold-reduced growth factor basement membrane extract type 2 (BME, R&D Systems).

[0126] Cells were seeded at a density of approximately 50,000 single cells per 50 μL drop of BME solution in each well of a 24-well tissue culture plate (SPL Life Sciences). After solidification, 1 mL of LCO culture medium (1% penicillin-streptomycin, 1 mM HEPES [Gibco], 1% GlutaMAX [Gibco], 1.25 mM N-acetylcysteine ​​[Sigma], 5 mM nicotinamide [Sigma], 50 μg / mL primocin [InvivoGen], 500 ng / mL human R-Spondin 1 [PeproTech], 100 ng / mL human noggin [PeproTech], 50 μg / mL human FGF7 [PeproTech], 100 ng / mL human FGF10 [PeproTech], 1% B27 supplement [Gibco], 500 nM SB 202190 [Tocris], 500 nM A 83-01 [Tocris], Serum-free Advanced DMEM / F12 [Gibco] supplemented with 5 μM Y-27632 [Stemcell Technologies] was added, and the medium was replaced every 4 days.

[0127] For organoid transfection, each lung adenocarcinoma organoid was seeded at a density of 10,000 single cells per well of a 48-well plate in a 10 μl BME dome. Then, 250 μl of airway organoid medium was added and transfected with the LC-SYNCRIP plasmid using Lipofectamine 3000. The shape and size of the organoids were observed using an EVOS M5000 microscope, and the diameter of the organoids was measured using Image J.

[0128]

[0129] 1.4. In vitro RNA synthesis and in vitro binding assay

[0130] For in vitro binding assays, biotin-UTP-labeled RNA was transcribed from XbaI-linearized pSK-AURKB 5′UTR plasmid using T7 RNA polymerase (Promega). Cell extracts prepared from NIH3T3 cells were incubated with biotinylated-AURKB 5′UTR RNA and subjected to streptavidin resin adsorption. Resin-bound proteins were analyzed using SDS-PAGE.

[0131]

[0132] 1.5. Xenograft animal model

[0133] Total 1 x 10 6 LLC cells were mixed with Matrigel (Corning) at a 1:1 ratio and injected subcutaneously into the flank of each mouse. The mice were monitored for tumor appearance, and the mice were sacrificed at the indicated times.

[0134]

[0135] 1.6. Dual luciferase reporter assay

[0136] For reporter assays, cells were transfected with pRF plasmids and lysed in reporter lysis buffer (Promega). Renilla and firefly luciferase activities were measured using the Dual Luciferase® Reporter Assay System (Promega) according to the manufacturer's instructions.

[0137]

[0138] 1.7. Proliferation assay

[0139] For the MTT assay, control and SYNCRIP-deficient cells were seeded at 5,000 cells / well in 96-well plates. MTT solution (5 mg / ml; Sigma) was added to the cells every 24 h to a final concentration of 0.5 mg / ml and incubated at 37°C for 2 h. 100 μl of DMSO was added to each well, and the absorbance at 570 nm was measured using a microplate reader.

[0140] For the colony formation assay, cells were seeded in 6-well plates at 2,000 cells / well. NIH3T3 cells were stained with crystal violet 6 days after seeding, and LLC cells were stained with crystal violet 14 days after seeding. Photographs were taken using a digital camera, and quantitative changes in colony formation were determined by measuring the absorbance at 595 nm.

[0141]

[0142] 1.8. Reverse transcription-quantitative PCR (RTqPCR)

[0143] Total RNA was extracted from NIH3T3 and LLC cells using an RNA Purification Kit (Thermo Fisher Scientific). A total of 300 ng of total RNA was reverse transcribed into cDNA using the First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. RT-qPCR was performed on the cDNA samples using Power SYBR Green Master Mix. The primer sequences used for RT-qPCR are shown in Table 2.

[0144] Gene nameSequence (5' to 3')mβ-actinForward primer: TATTGGCAACGAGCGG (SEQ ID NO: 5)Reverse primer: CGGATGTCAACGTCAC (SEQ ID NO: 6)mAURKBForward primer: AGGTCTGCAGGGAGAACTGA (SEQ ID NO: 7)Reverse primer: AGGCACAGAAGAGGGGAACT (SEQ ID NO: 8)

[0145]

[0146] 1.9. Immunoblot analysis

[0147] Cells were directly disrupted in Laemmli buffer [60 mM Tris-HCl (pH 6.8), 2% (w / v) sodium dodecyl sulfate (SDS), 10% (v / v) glycerol, and 0.02% (w / v) bromophenol blue)], followed by sonication and heat denaturation. Samples were separated on a 12% SDS-polyacrylamide gel, and proteins were transferred to a polyvinylidene fluoride membrane. After blocking with 5% skimmed milk for 30 min at room temperature, the membranes were incubated overnight at 4°C with the following primary antibodies: anti-14-3-3ζ (Santa Cruz, Paso Robles, CA, USA), anti-AURKB (Abcam, ab2254), anti-SYNCRIP (Sigma Aldrich, R5653), anti-GAPDH (Santa Cruz biotechnology, sc-47724), and anti-ACTIN (Sigma Aldrich, A5316). The following day, the membranes were incubated with horseradish peroxidase-conjugated secondary anti-rabbit (1:5,000, ab205718, Abcam) and anti-mouse (1:10,000, A90-116P, Bethyl Laboratories, Inc.) antibodies for 1 h at room temperature. Immunoreactive signals were detected using the D-Plus™ ECL Femto system (Donginbiotech Co., Ltd., Korea). Western blot quantification was performed using Image J.

[0148]

[0149] 1.10. Immunofluorescence

[0150] A tissue array (LC722) containing 54 lung cancers and adjacent lung tissues was purchased from US Biomax (Rockville, MD). After deparaffinization and hydration, sections were incubated in pepsin (Abcam, Cambridge, UK, ab801437) for 10 minutes and then incubated in 3% hydrogen peroxide solution for an additional 10 minutes. After blocking, sections were treated with primary antibodies against AURKB (Abcam, ab2254) and SYNCRIP (Sigma Aldrich, R5653) overnight at 4°C. The following day, sections were incubated with Fluor® 488-conjugated mouse secondary antibody or Fluor® 647-conjugated rabbit secondary antibody (Abcam) for 1 hour at room temperature. Fluorescence microscopy images were obtained using an EVOS FL Auto Imaging System (Thermo Fisher Scientific, Inc.).

[0151]

[0152] 2. Results

[0153] 2.1. Analysis of SYNCRIP and AURKB protein expression in cancer patient tissues

[0154] To measure the expression levels of AURKB and SYNCRIP proteins in lung cancer patient tissues, immunofluorescence staining was performed using antibodies against AURKB and SYNCRIP.

[0155] Immunofluorescence staining was performed on tissues from patients with various stages of squamous cell carcinoma (SCC) and adenocarcinoma (LUAD), and the results showed that the expression level of SYNCRIP protein was specifically increased in adenocarcinoma (LUAD) unlike in squamous cell carcinoma (SCC) (Fig. 1a). In addition, it was confirmed that the expression of SYNCRIP protein increased as the stage progressed (Fig. 1c). The expression level of AURKB protein showed a statistically significant correlation with the expression of SYNCRIP protein (Fig. 1b).

[0156]

[0157] 2.2 Kaplan-Meier survival plot of lung cancer patients according to SYNCRIP expression level

[0158] Kaplan-Meier survival plots of SCC (209025) and LUAD (236146) patients according to SYNCRIP expression levels were confirmed. OS refers to overall survival (OS), and RFS refers to relapse-free survival (RFS).

[0159] As a result, it was confirmed that the overall survival of SCC patients was not associated with the expression of SYNCRIP protein, whereas LUAD patients had a worse prognosis in both overall survival and recurrence-free survival when the expression of SYNCRIP protein was high (Figures 2a, 2b, and 2c).

[0160]

[0161] 2.3 Generation and analysis of SYNCRIP knockout cell lines

[0162] To determine the effect of SYNCRIP expression inhibition on the mRNA and protein expression of AURKB protein, SYNCRIP knockout cell lines were created and AURKB mRNA and protein expression was analyzed.

[0163] First, we generated NIH3T3 fibroblast and LLC (Lewis lung carcinoma) cell lines in which SYNCRIP was knocked out using the Crispr / Cas9 tool, and the expression levels of SYNCRIP and AURKB in these cell lines were confirmed by Western blot. AURKB mRNA was measured by RT-qPCR using total mRNA extracted from NIH3T3 and LLC cell lines.

[0164] As a result, in both NIH3T3 and LLC cell lines, it was confirmed that the expression level of AURKB protein was reduced in the experimental group in which SYNCRIP expression was suppressed (LC-SYNCRIP) compared to the control group (LC-GFP) (Fig. 3a). However, in both NIH3T3 and LLC cell lines, it was confirmed that there was no change in AURKB mRNA expression (Fig. 3b), thus confirming that suppression of SYNCRIP protein expression only affects AURKB protein expression without affecting AURKB mRNA expression.

[0165]

[0166] 2.4. Confirmation of the mechanism of AURKB protein expression regulation by SYNCRIP

[0167] Since we confirmed that SYNCRIP expression regulates AURKB protein expression, we confirmed the regulatory mechanism through dual luciferase reporter analysis.

[0168] As a result, a plasmid was constructed with the AURKB 5′UTR sequence inserted between RLUC and FLUC (Fig. 4a) and transfected into LLC cells. It was confirmed that FLUC expression was higher in the plasmid with the AURKB 5′UTR sequence inserted than in the control group (Mock) without the AURKB 5′UTR sequence inserted (Fig. 4b). Therefore, it was confirmed that there is a factor that promotes protein translation in the 5′UTR region of AURKB. In addition, the binding between the AURKB 5′UTR and the SYNCRIP protein was confirmed using biotinylated-AURKB 5′UTR and streptavidin beads (Fig. 4b).

[0169] By confirming that the protein translation promotion phenomenon by the AURKB 5′UTR sequence was reduced in NIH3T3 cells and LLC cells in which SYNCRIP expression was knocked out, we experimentally verified that the SYNCRIP protein binds to the AURKB 5′UTR and promotes AURKB protein expression (Fig. 4c).

[0170]

[0171] 2.5. Confirmation of proliferation inhibition in SYNCRIP knockout cells

[0172] We examined whether cell proliferation was inhibited in NIH3T3 cells and LLC cells in which the SYNCRIP gene was knocked out.

[0173] In vitro experiments, clonogenic assays were performed using crystal violet staining in SYNCRIP knockout NIH3T3 cells and LLC cells after 6 and 14 days, respectively (Fig. 5a), and MTT assays were performed every 24 hours, confirming that cell proliferation was inhibited (Fig. 5b). In addition, in vivo experiments, after subcutaneous injection of SYNCRIP knockout LLC cells into mice, the tumor volume generated in SYNCRIP knockout LLC cells was confirmed to be reduced compared to the control group after 30 days (Fig. 5c).

[0174]

[0175] 2.6. Further validation of SYNCRIP gene function through organoid systems

[0176] The function of the SYNCRIP gene was further validated in a lung adenocarcinoma organoid system.

[0177] The SYNCRIP gene was knocked out by transfecting gRNA and Cas9 into lung adenocarcinoma organoids (SB#371 and SB#369), and the growth rate was observed after 7 and 21 days, and the diameter of the organoids after 21 days was measured using Image J. As a result, it was confirmed that the growth rate of the SYNCRIP knockout lung adenocarcinoma organoids was slower than that of the control group (Figs. 6a and 6b).

[0178]

[0179] 2.7. Confirmation of cell proliferation inhibition effect by deletion of AURKB 5′UTR

[0180] When the AURKB 5′UTR sequence was deleted using Crispr / Cas9, the cell proliferation inhibitory effect was additionally confirmed.

[0181] An LLC cell line in which the AURKB 5′UTR sequence was deleted using Crispr / Cas9 was generated, and cell proliferation was confirmed in vitro using the MTT assay (Fig. 7a) and clonogenic assay (Fig. 7b). Furthermore, tumor appearance in mice was observed, confirming that cell proliferation was suppressed and tumor growth was inhibited in vivo compared to the control group (Figs. 7c and 7d).

Claims

1. A composition for diagnosing lung cancer, comprising a preparation capable of measuring the expression level of a SYNCRIP protein or a gene encoding the same.

2. A composition for diagnosing lung cancer, wherein the agent capable of measuring the expression level of the SYNCRIP protein in claim 1 is a monoclonal antibody, polyclonal antibody, chimeric antibody, ligand, PNA, aptamer or nanoparticle that specifically binds to the SYNCRIP protein.

3. A composition for diagnosing lung cancer, wherein the agent capable of measuring the expression level of the gene encoding the SYNCRIP protein according to claim 1 is a primer pair, probe or antisense nucleotide that specifically binds to the gene.

4. A kit for diagnosing lung cancer, comprising the composition described in any one of claims 1 to 3.

5. A method for providing information for diagnosing lung cancer, comprising a step of measuring the expression level of a SYNCRIP protein or a gene encoding the same in a biological sample obtained from an individual.

6. A method for providing information for diagnosing lung cancer, further comprising a step of diagnosing lung cancer when the expression level of the SYNCRIP protein or the gene encoding it is higher than that of the control group, in claim 5.

7. A pharmaceutical composition for treating lung cancer comprising a SYNCRIP inhibitor.

8. A pharmaceutical composition for treating lung cancer, wherein the SYNCRIP inhibitor according to claim 7 is an antibody or an antigen-binding fragment thereof that specifically binds to the SYNCRIP protein.

9. A pharmaceutical composition for treating lung cancer, wherein the SYNCRIP inhibitor according to claim 7 is an antisense nucleotide, siRNA, shRNA, ribozyme, or CRISPR / Cas9 that complementarily binds to a gene encoding a SYNCRIP protein or a portion thereof.

10. A pharmaceutical composition for treating lung cancer according to claim 7, wherein the SYNCRIP inhibitor is a CRISPR / Cas9 complex comprising an oligonucleotide pair consisting of the sequences of SEQ ID NOs: 1 and 2 or an oligonucleotide pair consisting of the sequences of SEQ ID NOs: 3 and 4.

Images