SNCA vectors and engineered guide rnas

Abstract

Disclosed herein are plasmids encoding engineered guide RNAs and compositions comprising the same. Also disclosed herein are AAVs containing engineered guide RNAs. Also disclosed herein are methods of treating diseases or conditions in a subject by administering engineered guide RNAs or pharmaceutical compositions described herein.

Description

SNCA VECTORS AND ENGINEERED GUIDE RNASCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. §119 from Provisional Application Serial No. 63 / 663,807 filed on June 25, 2024, Provisional Application Serial No. 63 / 664,063 filed on June 25, 2024, Provisional Application Serial No. 63 / 701,714 filed on October 1, 2024, Provisional Application Serial No. 63 / 728,358 filed on December 5, 2024, Provisional Application Serial No. 63 / 753,285 filed on February 3, 2025, and Provisional Application Serial No. 63 / 800,341 filed on May 5, 2025, the disclosures of which are incorporated herein by reference.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ST .26 xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on June 24, 2025, is named 199235-775601 _SL.xml and is 233,935 bytes in size.BACKGROUND

[0003] Compositions that mediate RNA editing can be viable therapies for genetic diseases. However, efficacious compositions that can maximize on-target RNA editing while minimizing off-target RNA editing are needed. Moreover, vectors encoding guide RNAs that are capable of facilitating RNA editing are also needed.SUMMARY

[0004] Disclosed herein are recombinant AAVs encapsidating a vector. In some embodiments, the vector can comprise a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 128, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 78, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 127, SEQ ID NO: 129 - SEQ ID NO: 132, SEQ ID NO: 163 - SEQ ID NO: 165, or SEQ ID NO: 167 - SEQ ID NO: 172 and an AAV inverted terminal repeat. In some embodiments, the vector can comprise a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 120, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 119,SEQ ID NO: 121 - SEQ ID NO: 124, SEQ ID NO: 152 - SEQ ID NO: 154, or SEQ ID NO: 156 - SEQ ID NO: 161. In some embodiments, the vector can comprise a sequence of SEQ ID NO: 120. In some embodiments, the vector can comprise a sequence of SEQ ID NO: 151. In some embodiments, the vector can comprise a sequence of SEQ ID NO: 155. In some embodiments, the vector can comprise a sequence of SEQ ID NO: 38. In some embodiments, the vector can comprise a sequence of SEQ ID NO: 125. In some embodiments, the vector can comprise a sequence of SEQ ID NO: 126. In some embodiments, the vector can encode an engineered guide RNA. In some embodiments, the vector can comprise the engineered guide RNA, upon hybridization to a region of a target SNCA RNA, can form a guide-target RNA scaffold that comprises one or more structural features. In some embodiments, the engineered guide RNA when hybridized to the region of the target SNCA RNA can facilitate a knockdown of alpha-synuclein protein encoded by the target SNCA RNA. In some embodiments, the target SNCA RNA can comprise a SNCA Codon 1 translation initiation site (TIS) of Exon 2. In some embodiments, the SNCA Codon 1 translation initiation site of Exon 2 can correspond to position 226 of an SNCA transcript variant 1 of accession number NM_000345.4. In some embodiments, the target SNCA RNA can comprise a SNCA pre- mRNA translation initiation site (TIS). In some embodiments, the one or more structural features can comprise a bulge, an internal loop, a wobble base pair, a hairpin, or any combination thereof. In some embodiments, the engineered guide RNA can comprise at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, SEQ ID NO: 112- SEQ ID NO: 117, or SEQ ID NO: 147 - SEQ ID NO: 148. In some embodiments, the engineered guide RNA when hybridized to the region of the target SNCA RNA can facilitate RNA editing by an RNA editing entity of one or more adenosines in the SNCA Codon 1 translation initiation site of Exon 2. In some embodiments, the RNA editing entity can comprise a human ADAR1, or a human ADAR2.

[0005] Also disclosed herein are recombinant AAVs encapsidating a vector that comprises a sequence encoding an engineered guide RNA sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46- SEQ ID NO: 49, SEQ ID NO: 54 - SEQ ID NO: 65, SEQ ID NO: 106 - SEQ ID NO: 111, or SEQ ID NO: 145 - SEQ ID NO: 146. In some embodiments, upon hybridization of theengineered guide RNA to the target SNCA RNA, the engineered guide RNA facilitates RNA editing of an adenosine in the target SNCA RNA by an RNA editing entity. In some embodiments, the engineered guide RNA can facilitate at least about: 30%, 40%, 50%, 60% or 70% RNA editing of a target adenosine in the target SNCA RNA by an RNA editing entity, as measured by an in vitro assay as compared to an otherwise identical control that lacks the engineered guide RNA. In some embodiments, the engineered guide RNA can facilitate at least about: 30%, 40%, 50%, 60% or 70% protein knockdown of a SNCA protein encoded by the target SNCA RNA, as measured by an in vitro assay as compared to an otherwise identical control that lacks the engineered guide RNA. In some embodiments, the engineered guide RNA when hybridized to the region of the target SNCA RNA can facilitate (i) RNA editing of a SNCA TIS in the target SNCA RNA, (ii) skipping of Exon 2 in the target SNCA RNA, (iii) reducing a level of SNCA mRNA expression, or (iv) any combination of (i), (ii), and (iii), thereby resulting in a reduction of alpha-synuclein protein encoded by the target SNCA RNA. In some embodiments, the target SNCA RNA can comprise a SNCA Codon 1 translation initiation site of Exon 2 and optionally wherein the SNCA Codon 1 translation initiation site of Exon 2 corresponds to position 226 of an SNCA transcript variant 1 of accession number NM_000345.4. In some embodiments, the target SNCA RNA can comprise a SNCA pre-mRNA translation initiation site. In some embodiments, the recombinant AAV can comprise an AAV1 virion, AAV2 virion, AAV3 virion, AAV4 virion, AAV5 virion, AAV6 virion, AAV7 virion, AAV8 virion, AAV9 virion, AAV10 virion, AAV11 virion, or a derivative, a chimera, or a variant thereof.

[0006] Also disclosed herein are plasmids encoding an engineered guide RNA. In some embodiments, the plasmid can comprise a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 128, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 78, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 127, SEQ ID NO: 129 - SEQ ID NO: 132, SEQ ID NO: 163 - SEQ ID NO: 165, or SEQ ID NO: 167 - SEQ ID NO: 172 and an AAV inverted terminal repeat.

[0007] Also disclosed herein are engineered guide RNAs or a polynucleotides encoding the engineered guide RNAs. In some embodiments, the engineered guide RNA can comprise a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 40- SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, SEQ ID NO: 112 - SEQ ID NO: 117, or SEQ ID NO: 147 - SEQ ID NO: 148.

[0008] Also disclosed herein are engineered guide RNAs or a polynucleotides encoding the engineered guide RNAs. In some embodiments, the engineered guide RNA can comprise a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 147 or SEQ ID NO: 148. In some embodiments, the engineered guide RNA is capable of hybridizing to a target SNCA RNA with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 150. In some embodiments, the target SNCA RNA can comprise a SNCA TIS pre-mRNA.

[0009] Also disclosed herein are engineered RNAs. In some embodiments, the engineered RNAs can comprise (a) an engineered guide RNA can comprise a targeting sequence that can bind to a target SNCA RNA, and a first Near Sm-Site Structure (NSS) sequence that can be positioned 5’ of the targeting sequence or 3’ of the targeting sequence; and (b) an Sm-binding sequence that can be positioned 3’ of the engineered guide RNA. In some embodiments, the first NSS sequence can be positioned 5’ of the targeting sequence and can be reverse complementary to a 3’ end of the targeting sequence. In some embodiments, the first NSS sequence can be positioned 3’ of the targeting sequence and can be reverse complementary to a 5’ end of the targeting sequence. In some embodiments, the engineered guide RNA can further comprise a second NSS sequence. In some embodiments, the first NSS sequence can be reverse complementary to the second NSS sequence, or one of the first NSS sequence or the second NSS sequence can be positioned 5’ of the targeting sequence and the other of the first NSS sequence or the second NSS sequence can be positioned 3’ of the targeting sequence. In some embodiments, the second NSS sequence can be at least about 5 to about 20 nucleotides in length. In some embodiments, the first NSS sequence can be at least about 5 to about 20 nucleotides in length. In some embodiments, hybridization of the first NSS sequence to the second NSS sequence, a 5’ end of the targeting sequence, or a 3’ end of the targeting sequence prevents hybridization of the Sm-binding sequence to the targeting sequence. In some embodiments, the first NSS sequence can form not less than 5 and not more than 15 base pair interactions with the second NSS sequence, a 5’ end of the targeting sequence, or a 3’ end of the targeting sequence. In some embodiments, the first or the second NSS sequence can be positioned 5’ of the Sm-binding sequence.

[0010] Also disclosed herein are pharmaceutical compositions comprising: the recombinant AAV encapsidating the vector described previously, the plasmid encoding the engineered guide RNA described previously, the engineered guide RNA described previously, or the engineered guide RNA described previously, and a pharmaceutically acceptable: excipient, carrier, or diluent. In some embodiments, the pharmaceutical composition can be in unit dose form.

[0011] Also described herein are methods of administering to a subject an effective amount of the recombinant AAV encapsidating the vector described previously, the plasmid encoding the engineered guide RNA described previously, the engineered guide RNA described previously, the engineered guide RNA described previously, or the pharmaceutical composition described previously. In some embodiments, the subject can be a mouse, a nonhuman primate, or a human. In some embodiments, the pharmaceutical composition can be in unit dose form.

[0012] Also described herein are methods of treating an alpha-synucleinopathy in a subject comprising administering to a subject an effective amount of the recombinant AAV encapsidating the vector described previously, the plasmid encoding the engineered guide RNA described previously, the engineered guide RNA described previously, the engineered guide RNA described previously, or the pharmaceutical composition, where the administering treats the alpha-synucleinopathy in the subject. In some embodiments, the alpha-synucleinopathy can be a Parkinson’s disease, a dementia with Lewy bodies, or a multiple system atrophy. In some embodiments, the subject can be a mouse, a non-human primate, or a human. In some embodiments, the pharmaceutical composition can be in unit dose form.

[0013] Also described herein are methods of editing an SNCA RNA transcript in a subject comprising administering to a subject an effective amount of the recombinant AAV encapsidating the vector described previously, the plasmid encoding the engineered guide RNA described previously, the engineered guide RNA described previously, the engineered guide RNA described previously, or the pharmaceutical composition, where after the administering the SNCA RNA transcript is edited in the subject. In some embodiments, the subject can be a mouse, a non-human primate, or a human. In some embodiments, the pharmaceutical composition can be in unit dose form. In some embodiments, the editing of the SNCA transcript can comprise editing of a SNCA Codon 1 translation initiation site of Exon 2. In some embodiments, the editing of SNCA Codon 1 translation initiation site ofExon 2 transcript can comprise editing of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the total SNCA transcripts in a brain or a region of a brain of the subject. In some embodiments, the editing of the SNCA transcript can comprise editing of a SNCA pre- mRNA translation initiation site. In some embodiments, the editing of the SNCA pre-mRNA translation initiation site can comprise editing of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the total SNCA transcripts in a brain or a region of a brain of the subject.INCORPORATION BY REFERENCE

[0014] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Novel features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which exemplary principles of the present disclosure are utilized, and the accompanying drawings of which:

[0016] FIG. 1 shows a legend of various exemplary structural features present in guide-target RNA scaffolds formed upon hybridization of a latent guide RNA of the present disclosure to a target RNA. Example structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (24 nucleotides on the target RNA side base paired to 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Figure discloses SEQ ID NOS 174-175, respectively, in order of appearance.

[0017] FIG. 2A - FIG. 2B shows guide RNA abundance of different AAV cassettes. FIG. 2A shows an exemplary tandem and bidirectional ITR-to-ITR AAV construct with cassette 1 and cassette 2. FIG. 2B shows the Cassette 2 / Cassette 1 gRNA abundance for SNCA and additional targets in various cell types.

[0018] FIG. 3A - FIG. 3E shows guide RNA expression, editing, and knockdown results for different SNCA constructs in human neurons. FIG. 3A shows alternative cassette 1 and cassette 2 construct layouts with substitutions of different promoters, terminators, and / or hairpins or swapping of the cassettes. FIG. 3B shows the relative Cassette 2 / Cassette 1 gRNA abundance in human neurons for the different SNCA construct layouts shown in FIG. 3A. Each construct contained a SNCA 3’ UTR-targeting gRNA in one cassette and a SNCA TIS-targeting gRNA in the other cassette. FIG. 3C shows the total guide RNA amounts (Cassette 2 and Cassette 1) in human neurons for the different SNCA construct layouts tested in FIG. 3B (left) and total guide amounts for constructs with a SNCA TIS-targeting gRNA in both cassettes in either an original layout (“Original”) or construct layout 2 (SEQ ID NO: 38, “Construct 2”). FIG. 3D shows percent editing of SNCA in human iPSC-derived neurons with constructs with a SNCA TIS-targeting gRNA in both cassettes in either an original layout (“Original”), construct layout 2 (SEQ ID NO: 38, “Construct 2”), or construct layout 3 (“Construct 3”). Editing was compared to a non-targeting gRNA control. FIG. 3E shows reduction of total alpha synuclein protein (aSYN) in human iPSC-derived neurons with constructs with a SNCA TIS-targeting gRNA in both cassettes in either an original layout (“Original”), construct layout 2 (SEQ ID NO: 38, “Construct 2”), or construct layout 3 (“Construct 3”). Total protein with each construct was compared to an infection duration- matched non-targeting gRNA control to determine % reduction of total protein (denoted with arrows).

[0019] FIG. 4A - FIG. 4G shows the results of targeting SNCA from in vivo mouse experiments. FIG. 4A shows the amount of human SNCA (hSNCA) present after treatment with different AAV payloads. The Y-axis shows the amount of hSNCA per total protein and the X-axis shows the treatment group. FIG. 4B shows the amount of guide RNA expression (normalized to UlsnRNA) in the brainstem, cerebellum, midbrain, striatum, cortex and hippocampus for the ITR-to-ITR SEQ ID NO: 80 and ITR-to-ITR SEQ ID NO: 38 SNCA targeting constructs. FIG. 4C shows the percent editing of the SNCA target RNA at thetarget translation initiation site (TIS) site with the different treatment groups (PBS Control, Scramble Control, Non-target control, ITR-to-ITR SEQ ID NO: 80, and ITR-to-ITR SEQ ID NO: 38) in the striatum, the midbrain, the cortex, the hippocampus, the brainstem, and the cerebellum. FIG. 4D shows the percent editing at the -4 off-target adenosine located in the Kozak sequence upstream of the TIS of the SNCA target RNA with the different treatment groups (PBS Control, Scramble Control, Non-target control, ITR-to-ITR SEQ ID NO: 80, and ITR-to-ITR SEQ ID NO: 38) in the striatum, the midbrain, the cortex, the hippocampus, the brainstem, and the cerebellum. FIG. 4E shows the percent skipped of the SNCA TIS containing exon of the target novel splice variant (NSV) RNA with the different treatment groups (PBS Control, Scramble Control, Non-target control, ITR-to-ITR SEQ ID NO: 80, and ITR-to-ITR SEQ ID NO: 38) in the striatum, the midbrain, the cortex, and the hippocampus. FIG. 4F shows images of agarose gel electrophoresis of Exon 2 skipping of the SNCA target RNA with the different treatment groups (Scramble Control, Non-target control, ITR-to-ITR SEQ ID NO: 80, and ITR-to-ITR SEQ ID NO: 38) in the midbrain. FIG. 4G shows the total SNCA transcript copies / mGAPDH with the different treatment groups (PBS Control, Scramble Control, Non-target control, ITR-to-ITR SEQ ID NO: 80, and ITR- to-ITR SEQ ID NO: 38) in the striatum, the midbrain, and the cortex.

[0020] FIG. 5 provides a bar graph quantifying on-target editing of an SNCA target RNA in HEK293 cells upon treatment with plasmids encoding an engineered guide RNA with Near Sm-site Structure (NSS) opening strategies 1 to 9 (SEQ ID NO: 99 - SEQ ID NO: 102, SEQ ID NO: 66, SEQ ID NO: 103, SEQ ID NO: 67, SEQ ID NO: 104, or, SEQ ID NO: 105, respectively), a previous NSS opening strategy (SEQ ID NO: 98, “Previous Strategy”), or no NSS modification (SEQ ID NO: 50, “canonical”) in two biological replicates. An RNA with a mutated Sm-binding sequence (“Sm-Mutant”), an RNA encoding GFP, and no transfection (“NT”) were used as negative controls.

[0021] FIG. 6 provides a bar graph quantifying on-target editing of an SNCA target RNA in HEK293 cells upon treatment with plasmids encoding engineered guide RNAs with Near Sm-site Structure (NSS) opening strategies 5 and 7 (SEQ ID NO: 66 and SEQ ID NO: 67, respectively) or with no NSS modification (SEQ ID NO: 50, “canonical”). Cells were transfected with either 300 ng (left) or 100 ng (right) of plasmid encoding the engineered guide RNA (gRNA). Editing efficiency was compared to an RNA with a sequence of 10 nucleotides complementary to the target appended to the 3’ end of the guide RNA (“110 nt.guide”). An RNA with a mutated Sm-binding sequence (“Sm Mutant-l-2-3-5C”) was used as a negative control.

[0022] FIG. 7 provides a bar graph illustrating the SNCA RNA editing efficiency achieved by six different guide RNAs (gRNAs) with no NSS modification (“canonical”) or that have been modified using Near Sm-site Structure (NSS) opening strategy 5 or 7.

[0023] FIG. 8 provides fluorescence images of transfected HEK293T following staining for coilin and DAPI as well as gRNA detection with FISH. Cells were transfected with plasmids encoding a canonical guide RNA (SEQ ID NO: 50, “Canonical”) with a functional Sm- binding sequence (top), a guide RNA with NSS-opening strategy 7 (SEQ ID NO: 67, “NSS7 gRNA”) with a functional Sm-binding sequence (middle), or a guide RNA with a mutated Sm-binding sequence (“Sm Mutant”, bottom). Images show localization of coilin (left), guide RNA (gRNA, middle), or coilin, guide RNA (gRNA), and DAPI staining of cell nuclei (right).

[0024] FIG. 9 provides fluorescence images and corresponding fluorescence intensities of transfected HEK293T following gRNA FISH and immunostaining for coilin. Cells were transfected with plasmids encoding a canonical guide RNA (SEQ ID NO: 50, “Canonical guide RNA”)) with a functional Sm-binding sequence (top), a guide RNA with NSS-opening strategy 7 (SEQ ID NO: 67, NSS7 guide RNA”) with a functional Sm-binding sequence (middle), or a guide RNA with a mutated Sm-binding sequence (“Sm Mutant”, bottom). Images on the left show localization of coilin and guide RNA. Plots on the right show fluorescence intensity of coilin and guide RNA across a line drawn across the images on the left through Cajal bodies.

[0025] FIG. 10A - FIG. 10F shows the results of targeting SNCA from in vivo Human Induced Pluripotent Stem Cells (hiPSC)-derived neurons. FIG. 10A shows the amount of human alpha-synuclein (aSYN) per total protein present after treatment with different constructs (No treatment, Control, ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) at varying doses (high, medium (med), and low). The Y-axis shows the amount of human aSYN protein / total protein, and the X-axis shows the treatment group. FIG. 10B shows the percent editing at SNCA translation initiation site (TIS) target adenosine with the different treatment groups (No treatment, Control, ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) at varying doses (high, medium (med), and low). The Y-axis shows the percent (%) editing at target adenosine, and the X-axis shows the treatment group. FIG. 10C shows the percent off-target editing for target SNCA as measured by Sanger sequencing. The Y-axisshows the percent editing, and the X-axis shows the position on the target RNA relative to a target adenosine, where position 0 corresponds to the target adenosine. FIG. 10D shows a bar graph quantifying the local splice variant distribution after treatment with different constructs (No treatment, Control, ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) at varying doses (high, medium (med), and low). The Y-axis shows percent of transcripts, and the X-axis shows the treatment group. FIG. 10E shows the dose-dependent gRNA expression in hiPSC-derived neurons after treatment (No treatment, ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) at varying doses (high, medium (med), and low). The Y-axis shows gRNA expression normalized to UlsnRNA, and the X-axis shows the treatment group. FIG. 10F shows the percent editing at SNCA TIS as a function of normalized number of gRNAs. The Y-axis shows the percent (%) editing at SNCA (ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) TIS, and the X-axis shows the number of gRNA copies normalized to U 1 snRNA.

[0026] FIG. 11A - FIG. 11C shows the results of targeting SNCA in mouse primary neurons. FIG. 11A shows the amount of human alpha-synuclein (aSYN) present after treatment with different treatment groups (No Treatment, Control, ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) at varying doses (high and low). The Y-axis shows the amount of human aSYN and the X-axis shows the treatment group. FIG. 11B shows the percent editing at SNCA translation initiation site (TIS) target adenosine with the different treatment groups (Control, ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) at varying doses (high and low). The Y-axis shows the percent (%) editing at target adenosine, and the X-axis shows the treatment group. FIG. 11C shows the dose-dependent splicing observed with the different constructs (No treatment, Control, ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) at varying doses (high and low). The Y-axis shows percent Exon la (ddPCR) and the X-axis shows the treatment group.

[0027] FIG. 12A - FIG. 12C shows the results of deep RNA sequencing to profile global editing / splicing specificity and differential gene expression. FIG. 12A shows the amount of gRNA present in glutamatergic neurons after treatment with different constructs (Untreated, Control, ITR-to-ITR SEQ ID NO: 38, and ITR-to-ITR SEQ ID NO: 39) at different doses of virus (le4 viral genomes (vg) / cell, 5e4 vg / cell, le5 vg / cell) encapsidating the ITR-to-ITR payload. The Y-axis shows the gRNA expression normalized to UlsnRNA, and the X-axis shows the treatment group. FIG. 12B shows the percent SNCA editing in glutamatergic neurons after treatment with different constructs (Untreated, Control, ITR-to-ITR SEQ IDNO: 38, and ITR-to-ITR SEQ ID NO: 39) at different doses of virus (le4 vg / cell, 5e4 vg / cell, le5 vg / cell) encapsidating the ITR-to-ITR payload. The Y-axis shows the percent SNCA editing, and the X-axis shows the treatment group. FIG. 12C shows the local editing profiles for SEQ ID NO: 38 and SEQ ID NO: 39. The Y-axis shows the percent A -> I editing, and the X-axis shows the position on the target RNA relative to a target adenosine at position 0.

[0028] FIG. 13A - FIG. 13C shows the percent editing of SNCA gRNA with different vector designs in hiPSC-derived neurons. FIG. 13A shows the percent editing of gRNA (SEQ ID NO: 31) in different vector designs. The Y-axis shows the percent editing and the X-axis shows the vector design. FIG. 13B shows the percent editing of gRNA (SEQ ID NO: 32) in different vector designs. The Y-axis shows the percent editing and the X-axis shows the vector design. FIG. 13C shows the percent editing of gRNA (SEQ ID NO: 48) in different vector designs. The Y-axis shows the percent editing and the X-axis shows the vector design.

[0029] FIG. 14A-14H show dose-dependent on-target editing, exon skipping and protein knock-down at different doses of high dose (5e4 vg / cell), mid dose (5e3 vg / cell), or low dose (5e2 vg / cell) of virus encapsidating the various constructs. FIG. 14A shows percent cell viability when treated with high, mid and low dose of virus encapsidating different constructs. The Y-axis shows the percent cell viability, and the X-axis shows the dose and treatment group. FIG. 14B shows dose-dependent percent SNCA TIS editing when treated with high, mid and low dose of virus encapsidating different constructs. The Y-axis shows the percent SNCA TIS editing, and the X-axis shows the dose and treatment group. FIG. 14C shows SNCA splice variants when treated with high, mid and low dose of virus encapsidating different constructs. The increasing triangles indicates dose increase. FIG. 14D shows dosedependent percent SNCA exon skipping when treated with high, mid and low dose of virus encapsidating different constructs. The Y-axis shows the percent SNCA exon skipping, and the X-axis shows the dose and treatment group. FIG. 14E shows dose-dependent guide RNA abundance after treatment with high, mid and low dose of virus encapsidating different constructs. The Y-axis shows the gRNA abundance, and the X-axis shows the dose and treatment group. FIG. 14F shows exon-skipping relative to guide RNA abundance. The Y- axis shows exon skipping and the X-axis shows gRNA abundance. FIG. 14G shows aSyn protein knock-down after treatment with high, mid and low dose of virus encapsidating different constructs. The Y-axis shows the fold change of aSyn protein, and the X-axis shows the dose and treatment group. FIG. 14H shows aSyn protein knockdown (“Fold Change aSynProtein”) relative to SNCA TIS editing percentage (“% On-Target Editing”). The Y-axis shows the fold change of aSyn protein, and the X-axis shows the percent of on-target SNCA TIS editing.

[0030] FIG. 15 shows alpha-synuclein knockdown in the central nervous system of a human transgenic mouse model after treatment with different constructs (Control, ITR-to-ITR construct having SEQ ID NO: 38 (“gRNAl”), and ITR-to-ITR construct having SEQ ID NO: 81 (“gRNA2”)). The Y-axis shows target protein fold change relative to control, and the X- axis shows treatment group, with the first three bars representing protein expression in the cortex, and the next three bars representing protein expression in the striatum.

[0031] FIG. 16A shows dose-dependent guide RNA abundance after treatment with low and high dose of virus encapsidating different constructs in iPSC-derived glutamatergic neurons. The Y-axis shows the gRNA abundance, and the X-axis shows the dose. FIG. 16B shows dose-dependent A->I editing of SNCA RNA constructs when treated with low and high dose of virus encapsidating different constructs in iPSC-derived glutamatergic neurons. The Y- axis shows the percent A->I editing, and the X-axis shows the dose. FIG. 16C shows dosedependent percent SNCA exon skipping when treated with low and high dose of virus encapsidating different constructs in iPSC-derived glutamatergic neurons. The Y-axis shows the percent SNCA exon skipping, and the X-axis shows the dose.

[0032] FIG. 17A depicts global differential gene expression upon administration of virus encapsidating different constructs using DEseq2, with genes filtered for a fold change >2 and p < 0.05. The different constructs comprising engineered guide RNAs were compared to the NTGC-01 dosed control, and differentially expressed genes linked to the negative controls (NE-01 and NTGC-01) were excluded from analysis. FIG. 17B depicts global splicing events upon administration of virus encapsidating different constructs using rMATS, with a false discovery rate (FDR) < 0.05 and a read depth > 100. The different constructs comprising engineered guide RNAs were quantified versus the NTGC-01 dosed control, and splicing events linked to the negative controls (NE-01 and NTGC-01) were excluded from analysis.

[0033] FIG. 18A-18C depicts dose-dependent alpha synuclein protein knockdown, SNCA TIS editing, and SNCA TIS exon skipping using constructs disclosed herein in mouse hSNCA neurons. FIG. 18A shows the total alpha synuclein protein levels as measured by ELISA after treatment with low dose (5E2 vg / cell) or high dose (5e4 vg / cell) of virus encapsidating different constructs (SEQ ID NO: 38, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 125, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 126). Y-axis showsrelative aSyn protein expression, and X-axis shows treatment group and dose. FIG. 18B shows the percent on-target editing of SNCA TIS as measured by Sanger sequencing after treatment with low dose or high dose of virus encapsidating different constructs. Y-axis shows % on-target editing expression, and X-axis shows treatment group and dose. FIG. 18C shows the percent exon skipping of the SNCA TIS exon after treatment with low dose or high dose of virus encapsidating different constructs. Y-axis shows % exon skipping, and X-axis shows treatment group and dose.

[0034] FIG. 19A-19G shows dose-dependent on-target editing, exon skipping and protein knock-down in cynomolgus neural progenitor cells (NPC)-derived neurons. FIG. 19A depicts gRNA abundance at different doses of high dose (le5 vg / cell), medium (mid) dose (le4 vg / cell), or low dose (le3 vg / cell) of virus encapsidating the various constructs (SEQ ID NO: 38 or SEQ ID NO: 39). Y-axis shows gRNA Abundance (gRNA / Ul snRNA), and X-axis shows treatment group. FIG. 19B depicts percent on-target editing at different doses of high dose, mid dose, or low dose of virus encapsidating the various constructs (SEQ ID NO: 38 or SEQ ID NO: 39), as compared to a non-targeting gRNA control (NTGC-01). Y-axis shows Percent A-> I editing, and X-axis shows dose and treatment group. FIG. 19C depicts percent SNCA exon Skipping at different doses of high dose, mid dose, or low dose of virus encapsidating the various constructs (SEQ ID NO: 38 or SEQ ID NO: 39), as compared to NTGC-01. Y-axis shows Percent SNCA exon skipping, and X-axis shows dose and treatment group. FIG. 19D depicts percent on-target editing of virus encapsidating the various constructs (SEQ ID NO: 38 or SEQ ID NO: 39) in cyno NPC-derived neurons as compared to human neurons. Y-axis shows Percent on-target editing, and X-axis shows gRNA abundance (gRNA / ul snRNA). FIG. 19E depicts relative aSYN protein of virus encapsidating the various constructs (SEQ ID NO: 38 or SEQ ID NO: 39) in NPC neurons as compared to human neurons. Y-axis shows Percent on-target editing, and X-axis shows gRNA abundance (gRNA / ul snRNA). FIG. 19F depicts a stacked bar graph showing the impact on splicing in cyno NPC-derived neurons after treatment with medium dose (le4 vg / cell) and high dose (le5 vg / cell) of virus encapsidating the various constructs (SEQ ID NO: 38 or SEQ ID NO: 39) in cyno NPC-derived neurons as compared to human neurons. Y-axis shows number of high impact events, and X-axis shows dose and treatment group. FIG. 19G depicts a stacked bar graph showing the impact on gene expression in cyno NPC-derived neurons after treatment with medium dose (le4 vg / cell) and high dose (le5 vg / cell) of virus encapsidating the various constructs (SEQ ID NO: 38 or SEQ ID NO: 39) in cyno NPC-derived neurons ascompared to human neurons. Y-axis shows number of high impact events, and X-axis shows dose and treatment group.

[0035] FIG. 20A-200 shows a time course experiments in human neurons transduced with the constructs disclosed herein. FIG. 20A shows the a-synuclein protein levels as measured by ELISA over time (day 1 (DI), day 3 (D3), day 6 (D6), day 9 (D9), day (D12)) in cells transduced with a non-expressing gRNA control (NE), and a non-targeting gRNA control (NTGC-01), as compared to no treatment (No tdxn). Y-axis shows a-synuclein (pg) / total protein (pg), and X-axis shows treatment group, and transduction day. FIG. 20B shows the a- synuclein protein levels as measured by ELISA over the time course in human neurons transduced with ITR-to-ITR constructs (SEQ ID NO: 38, SEQ ID NO: 120, SEQ ID NO: 125, or SEQ ID NO: 126), as compared to NTGC-01. Y-axis shows fold change (FC) a- synuclein protein as compared to NTGC-01, and X-axis shows transduction duration (days). FIG. 20C shows the percent editing at SNCA TIS as measured by sanger sequencing over the time course in human neurons transduced with the ITR-to-ITR constructs, as compared to NE, NTGC-01 and No Tdxn. Y-axis shows % editing at SNCA TIS, and X-axis shows transduction duration (days). FIG. 20D shows the percent exon 2 skipping over the time course in human neurons transduced with the ITR-to-ITR constructs, as compared to NE, NTGC-01 and No Tdxn. Y-axis shows % exon 2 spliced, and X-axis shows transduction duration (days). FIGs. 20E-20I depict representative electrophoresis gels visualizing Exon 2 skipping at different time points in human neurons transduced with the ITR-to-ITR constructs disclosed herein, as compared to NTGC-01 : DI (FIG. 20E), D3 (FIG. 20F), D6 (FIG. 20G), D9 (FIG. 20H), and D12 (FIG. 201). FIG. 20J is a bar graph showing SNCA / HPRT1 copies over the time course in human neurons transduced with NE, and NTGC-01, as compared to No tdxn. Y-axis shows SNCA / HPRT1 copies, and X-axis shows treatment group, and transduction day. FIG. 20K shows the SNCA / HPRT1 copies over the time course in human neurons transduced with ITR-to-ITR constructs, as compared to NTGC-01. Y-axis shows FC SNCA / HPRT1 as compared to NTGC-01, and X-axis shows transduction duration (days). FIG. 20L shows the gRNA expression over the time course in human neurons transduced with ITR-to-ITR constructs, as compared to No tdxn, NE, NTGC-01. Y-axis shows gRNA / ulsnRNA, and X-axis shows treatment group. FIG. 20M shows gRNA abundance vs FC a-syn protein to NTGC-01 in human neurons transduced with ITR-to-ITR constructs. Y- axis shows FC a-syn protein as compared to NTGC-01, and X-axis shows gRNA abundance (gRNA / Ul). FIG. 20N shows gRNA abundance vs percent exon 2 skipping in humanneurons transduced with ITR-to-ITR constructs. Y-axis shows % exon 2 skipping, and X-axis shows gRNA abundance (gRNA / Ul). FIG. 200 shows gRNA abundance vs percent on- target editing at SNCA TIS in human neurons transduced with ITR-to-ITR constructs. Y-axis shows % on-target editing at SNCA TIS, and X-axis shows gRNA abundance (gRNA / Ul).

[0036] FIG. 21 shows guide RNA abundance measured in the cortex and striatum tissue from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (low dose) or lel2 vg / mouse (high dose).

[0037] FIG. 22 shows SNCA TIS editing measured in Cortex (CTX), Striatum (STR), Hippocampus (HPC), Brain Stem - Hindbrain (BS), Cerebellum (Cb) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (low dose).

[0038] FIG. 23A shows SNCA TIS editing measured in Cortex (CTX), Striatum (STR), Hippocampus (HPC), Brain Stem - Hindbrain (BS), Cerebellum (Cb) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lel2 vg / mouse (high dose). FIG. 23B shows a heatmap of editing events at target adenosines that span the SNCA TIS editing in CTX from the mice treated with the ITR-to- ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (low dose) or lel2 vg / mouse (high dose).

[0039] FIG. 24 shows SNCA TIS editing as a function of gRNA abundance in Cortex (CTX), Striatum (STR), Hippocampus (HPC), and Brain Stem - Hindbrain (BS) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC- 01”).

[0040] FIG. 25 shows exon skipping evaluation in Cortex (CTX) samples from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (“low dose”) or lel2 vg / mouse (“high dose”).

[0041] FIG. 26 shows exon skipping evaluation in Striatum (STR) samples from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lel2 vg / mouse (“high dose”).

[0042] FIG. 27 shows exon skipping evaluation in Hippocampus (HPC) samples from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC- 01”) at a dose of lel2 vg / mouse (“high dose”).

[0043] FIG. 28A shows alpha-synuclein (aSyn) protein knockdown measured in the cortex and striatum tissue from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (low dose) or lel2 vg / mouse (high dose). Data reported is Fold Change relative to dose-matched NTGC-01 control. FIG. 28B shows alpha-synuclein (aSyn) protein knockdown measured in the Cortex (CTX), Striatum (STR), Hippocampus (HPC), and Brain Stem tissue from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (low dose) or lel2 vg / mouse (high dose). FIG. 28C shows alpha-synuclein (aSyn) protein knockdown measured in the Cortex (CTX), Striatum (STR), Hippocampus (HPC), and Brain Stem tissue from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lel2 vg / mouse (high dose). FIG. 28D shows alpha-synuclein (aSyn) protein knockdown measured in Cerebrospinal Fluid(CSF) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (low dose) or lel2 vg / mouse (high dose).

[0044] FIG. 29 shows alpha-synuclein protein knockdown correlation to gRNA abundance measured in Cortex (CTX), and Striatum (STR) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”).

[0045] FIG. 30 shows alpha-synuclein protein knockdown correlation to SNCA TIS editing measured in Cortex (CTX), and Striatum (STR) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”).

[0046] FIG. 31A shows alpha-synuclein protein knockdown correlation to skipping of Exon 2 measured in Cortex (CTX) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”). FIG. 31B shows alpha-synuclein protein knockdown correlation to skipping of Exon 2 measured in Cortex (CTX) and Striatum (STR) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”). FIG. 31C shows gRNA abundance correlation to skipping of Exon 2 measured in Cortex (CTX) and Striatum (STR) from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”).

[0047] FIG 32A shows exon skipping evaluation in Cortex (CTX), Striatum (STR), Hippocampus (HPC), and Brain Stem from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (“lowdose”) or lel2 vg / mouse (“high dose”). FIG 32B shows exon skipping evaluation in Cortex (CTX), Cortex (CTX), Striatum (STR), Hippocampus (HPC), and Brain Stem from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lel2 vg / mouse (“high dose”).

[0048] FIG 33A shows SNCA transcript levels in Cortex (CTX), Striatum (STR), Hippocampus (HPC), and Brain Stem from the mice treated with a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (“low dose”) or lel2 vg / mouse (“high dose”). FIG 33B shows the SNCA transcript levels in Cortex (CTX), Striatum (STR), Hippocampus (HPC), and Brain Stem from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lel2 vg / mouse (“high dose”). FIG 33C shows SNCA transcript levels in Cortex (CTX), Striatum (STR), Hippocampus (HPC), and Brain Stem from the mice treated with the ITR-to-ITR constructs of SEQ ID NO: 38 (Construct 1 from Table 11), SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), and SEQ ID NO: 126 (Construct 11 from Table 10), or a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (“low dose”) or lel2 vg / mouse (“high dose”).

[0049] FIG. 34A shows alpha-synuclein protein knockdown in Cortex (CTX), and Striatum (STR) from mice treated with the ITR-to-ITR constructs of SEQ ID NO: 120 (Construct 5 from Table 10), SEQ ID NO: 125 (Construct 10 from Table 10), a non-targeting guide (“NTGC-01”) at a dose of lei 1 vg / mouse (“low dose”) or lel2 vg / mouse (“high dose”). FIG. 34B shows alpha-synuclein protein knockdown in Cerebrospinal fluid (CSF) from mice treated with the ITR-to-ITR construct of SEQ ID NO: 120 (Construct 5 from Table 10), a non-targeting guide (“NTGC-01”).

[0050] FIG. 35A - FIG. 35D shows quantification of on-target editing, exon skipping, and gRNA abundance of engineered guide RNAs encoded by SEQ ID NO: 110, SEQ ID NO: 145, and SEQ ID NO: 46 in HEK293 cells. FIG. 35A shows a schematic of the human SNCA gene. FIG. 35B provides a bar graph quantifying exon skipping of an SNCA target RNA in HEK293 cells upon treatment with plasmids encoding engineered guide RNAs at either a concentration of 50 ng, 100 ng, 150 ng, 200 ng, or 300 ng. Y-axis shows skippedproduct: canonical product, and X-axis shows concentration. FIG. 35C provides a bar graph quantifying percent on-target editing of an SNCA target RNA in HEK293 cells upon treatment with plasmids encoding engineered guide RNAs encoded by SEQ ID NO: 110, SEQ ID NO: 145, and SEQ ID NO: 46 at either a concentration of 50 ng, 100 ng, 150 ng, 200 ng, or 300 ng. Y-axis shows percent on-target editing, and X-axis shows concentration. FIG. 35D shows a bar graph summarizing the percent of on-target editing transcripts, canonical splice product transcripts, and exon skipped product transcripts after treatment with engineered guide RNAs encoded by SEQ ID NO: 110, SEQ ID NO: 145, and SEQ ID NO: 46 at varying doses (50 ng, 100 ng, 150 ng, 200 ng, or 300 ng). The Y-axis shows percent of transcripts, and the X-axis shows the treatment group.DETAILED DESCRIPTIONRNA Editing

[0051] RNA editing refers to a process by which RNA is enzymatically modified post synthesis at specific nucleosides. RNA editing can comprise any one of an insertion, deletion, or substitution of a nucleotide(s). Examples of RNA editing include chemical modifications, such as pseudouridylation (the isomerization of uridine residues) and deamination (removal of an amine group from: cytidine to give rise to uridine, or C-to-U editing; or from adenosine to inosine, or A-to-I editing). RNA editing can be used to correct mutations (e.g., correction of a missense mutation) in order to restore protein expression and to introduce mutations or edit coding regions of RNA to effect protein knockdown.

[0052] Described herein are engineered guide RNAs that facilitate RNA editing by an RNA editing entity (e.g., an adenosine Deaminase Acting on RNA (ADAR)) or biologically active fragments thereof. For example, engineered guide RNAs of the present disclosure can facilitate editing of a translation initiation site (e.g. the Codon 1 translation initiation site) of a target SNCA mRNA (for example, an engineered guide RNA of any one SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 55 - SEQ ID NO: 65, or SEQ ID NO: 112 - SEQ ID NO: 117). In some instances, ADARs can be enzymes that catalyze the chemical conversion of adenosines to inosines in RNA. Because the properties of inosine mimic those of guanosine (inosine will form two hydrogen bonds with cytosine, for example), inosine can be recognized as guanosine by the translational cellular machinery. “Adenosine-to-inosine (A-to-I) RNA editing”, therefore, effectively changes the primarysequence of RNA targets. In general, ADAR enzymes share a common domain architecture comprising a variable number of amino-terminal dsRNA binding domains (dsRBDs) and a single carboxy -terminal catalytic deaminase domain. Human ADARs possess two or three dsRBDs. Evidence suggests that ADARs can form homodimer as well as heterodimer with other ADARs when bound to double-stranded RNA, however it can be currently inconclusive if dimerization is needed for editing to occur. The engineered guide RNAs disclosed herein can facilitate RNA editing by any of or any combination of the three human ADAR genes that have been identified (ADARs 1-3). ADARs have a typical modular domain organization that includes at least two copies of a dsRNA binding domain (dsRBD; ADARlwith three dsRBDs; ADAR2 and ADAR3 each with two dsRBDs) in their N-terminal region followed by a C-terminal deaminase domain.

[0053] The engineered guide RNAs (e.g. SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, or SEQ ID NO: 112 - SEQ ID NO: 117) of the present disclosure facilitate RNA editing (for example, of an SNCA Exon 2 Codon 1 translation initiation site) by endogenous ADAR enzymes. In some embodiments, the engineered guide RNA of the present disclosure can be encoded by a polynucleotide comprising a polynucleotide sequence of any one of SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 66 - SEQ ID NO: 77, or SEQ ID NO: 106 - SEQ ID NO: 111. The engineered guides herein are encoded in ITR-to-ITR regions such as any one of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 80, or SEQ ID NO: 119 - SEQ ID NO: 126. The engineered guides herein are encoded in DNA regions such as any one of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 81, or SEQ ID NO: 127 - SEQ ID NO: 134. The ITR-to-ITR sequences can be packaged in a viral vector such as an AAV. In some cases, the ITR-to-ITR region can be packaged in a recombinant AAV. In some embodiments, exogenous ADAR can be delivered alongside the engineered guide RNAs disclosed herein to facilitate RNA editing. In some embodiments, the ADAR is human AD ARI . In some embodiments, the ADAR is human ADAR2. In some embodiments, the ADAR is human ADAR3. In some embodiments, the ADAR is human AD ARI, human ADAR2, human ADAR2, or any combination thereof.

[0054] TIS. In some embodiments, the engineered guide RNAs of the present disclosure target a target sequence of a target SNCA RNA that comprises a translation initiation site (TIS), wherein the adenosine of the TIS is edited. In some embodiments, an engineered guide RNA of the present disclosure (e.g. an engineered guide RNA that comprises apolynucleotide sequence of any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, or SEQ ID NO: 112 - SEQ ID NO: 117) can target the Codon 1 TIS of Exon 2 corresponding to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4). In some embodiments, an engineered guide RNA that targets the SNCA Codon 1 TIS of Exon 2 comprises a polynucleotide sequence of any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, or SEQ ID NO: 112 - SEQ ID NO: 117.

[0055] In some embodiments, an engineered guide disclosed herein is at least partially complementary to a target SNCA RNA. In some cases, the target SNCA RNA comprises the sequence of: GCCAUUCGACGACAGUGUGGUGUAAAGGAAUUCAUUAGCCAUGGAUGUAUU CAUGAAAGGACUUUCAAAGGCCAAGGAGGGAGUUGUGGCUGCUGCUGAG (SEQ ID NO: 43). In some cases, the target SNCA RNA can comprise a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 43. In some cases, the target DNA sequence encoding the target RNA sequence comprises the sequence of GCCATTCGACGACAGTGTGGTGTAAAGGAATTCATTAGCCATGGATGTATTCAT GAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAG (SEQ ID NO: 144) An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA (e.g., SNCA). In some embodiments, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 43. In some embodiments, an engineered guide RNA hybridizes to at least 60, 70, or 80 bases of a target RNA sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 43 and facilitates a protein knockdown. In some embodiments, the engineered guide RNAs facilitate ADAR-mediated RNA editing of the TIS (AUG) to IUG, read as GUG. In some instances, this results in protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. In some instances, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 43, resulting in exon skipping. In some cases, the exon skipping that occursthrough editing of the SNCA Codon 1 TIS produces SNCA mRNA alternate splice variants. In some embodiments, the engineered guide RNA when hybridized to the region of the target RNA sequence of SEQ ID NO: 43 facilitates (i) RNA editing of a SNCA TIS in the target SNCA RNA, (ii) skipping of Exon 2 in the target SNCA RNA, (iii) reducing a level of SNCA mRNA expression, or (iv) any combination of (i), (ii), and (iii), thereby resulting in a reduction of alpha-synuclein protein encoded by the target SNCA RNA.

[0056] In some embodiments, an engineered guide disclosed herein is at least partially complementary to a target SNCA RNA. In some cases, the target SNCA RNA comprises the sequence of: GCCAUUCGACGACAGUGUGGUGUAAAGGAAUUCAUUAGCCAUGGAUGUAUU CAUGAAAGGACUUUCAAAGGCCAAGGAGGGAGUUGUGGCUGCUG (SEQ ID NO: 136). In some cases, the target DNA sequence encoding the target RNA sequence comprises the sequence of GCCATTCGACGACAGTGTGGTGTAAAGGAATTCATTAGCCATGGATGTATTCAT GAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTG (SEQ ID NO: 137). In some cases, the target SNCA RNA can comprise a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 136. An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA (e.g., SNCA). In some embodiments, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 136. In some embodiments, an engineered guide RNA hybridizes to at least 60, 70, or 80 bases of a target RNA sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 136 and facilitates a protein knockdown. In some embodiments, the engineered guide RNAs facilitate ADAR-mediated RNA editing of the TIS (AUG) to IUG, read as GUG. In some instances, this results in protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. In some instances, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 136, resulting in exon skipping. In some embodiments, the engineered guide RNA when hybridized to the region of the target RNA sequence of SEQID NO: 136 facilitates (i) RNA editing of a SNCA TIS in the target SNCA RNA, (ii) skipping of Exon 2 in the target SNCA RNA, (iii) reducing a level of SNCA mRNA expression, or (iv) any combination of (i), (ii), and (iii), thereby resulting in a reduction of alpha-synuclein protein encoded by the target SNCA RNA.

[0057] In some embodiments, an engineered guide disclosed herein is at least partially complementary to a target SNCA RNA. In some cases, the target SNCA RNA comprises the sequence of: GACAGUGUGGUGUAAAGGAAUUCAUUAGCCAUGGAUGUAUUCAUGAAAGGA CUUUCAAAGGCCAAGGAGGGAGUUGUGGCUGCU (SEQ ID NO: 138). In some cases, the target DNA sequence encoding the target RNA sequence comprises the sequence ofGACAGTGTGGTGTAAAGGAATTCATTAGCCATGGATGTATTCATGAAAGGACTT TCAAAGGCCAAGGAGGGAGTTGTGGCTGCT (SEQ ID NO: 139). In some cases, the target SNCA RNA can comprise a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 138. An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA (e.g., SNCA). In some embodiments, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 138. In some embodiments, an engineered guide RNA hybridizes to at least 60, 70, or 80 bases of a target RNA sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 138 and facilitates a protein knockdown. In some embodiments, the engineered guide RNAs facilitate ADAR-mediated RNA editing of the TIS (AUG) to IUG, read as GUG. In some instances, this results in protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. In some instances, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 138, resulting in exon skipping. In some embodiments, the engineered guide RNA when hybridized to the region of the target RNA sequence of SEQ ID NO: 138 facilitates (i) RNA editing of a SNCA TIS in the target SNCA RNA, (ii) skipping of Exon 2 in the target SNCA RNA, (iii) reducing a level of SNCA mRNA expression, or (iv) anycombination of (i), (ii), and (iii), thereby resulting in a reduction of alpha-synuclein protein encoded by the target SNCA RNA.

[0058] In some embodiments, an engineered guide disclosed herein is at least partially complementary to a target SNCA RNA. In some cases, the target SNCA RNA comprises the sequence of: UCGACGACAGUGUGGUGUAAAGGAAUUCAUUAGCCAUGGAUGUAUUCAUGA AAGGACUUUCAAAGGCCAAGGAGGGAGUUGUGGC (SEQ ID NO: 140). In some cases, the target DNA sequence encoding the target RNA sequence comprises the sequence of TCGACGACAGTGTGGTGTAAAGGAATTCATTAGCCATGGATGTATTCATGAAAG GACTTTCAAAGGCCAAGGAGGGAGTTGTGGC (SEQ ID NO: 141). In some cases, the target SNCA RNA can comprise a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 140. An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA (e.g., SNCA). In some embodiments, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 140. In some embodiments, an engineered guide RNA hybridizes to at least 60, 70, or 80 bases of a target RNA sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 140 and facilitates a protein knockdown. In some embodiments, the engineered guide RNAs facilitate ADAR-mediated RNA editing of the TIS (AUG) to IUG, read as GUG. In some instances, this results in protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. In some instances, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 140, resulting in exon skipping. In some embodiments, the engineered guide RNA when hybridized to the region of the target RNA sequence of SEQ ID NO: 140 facilitates (i) RNA editing of a SNCA TIS in the target SNCA RNA, (ii) skipping of Exon 2 in the target SNCA RNA, (iii) reducing a level of SNCA mRNA expression, or (iv) any combination of (i), (ii), and (iii), thereby resulting in a reduction of alpha-synuclein protein encoded by the target SNCA RNA.

[0059] In some embodiments, an engineered guide disclosed herein is at least partially complementary to a target SNCA RNA. In some cases, the target SNCA RNA comprises the sequence of: UCGACGACAGUGUGGUGUAAAGGAAUUCAUUAGCCAUGGAUGUAUUCAUGA AAGGACUUUCAAAGGCCAAGGAGGGAGUUGUGGCUGCUG (SEQ ID NO: 142). In some cases, the target DNA sequence encoding the target RNA sequence comprises the sequence of TCGACGACAGTGTGGTGTAAAGGAATTCATTAGCCATGGATGTATTCATGAAAG GACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTG (SEQ ID NO: 143). In some cases, the target SNCA RNA can comprise a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 142. An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA (e.g., SNCA). In some embodiments, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 142. In some embodiments, an engineered guide RNA hybridizes to at least 60, 70, or 80 bases of a target RNA sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 142 and facilitates a protein knockdown. In some embodiments, the engineered guide RNAs facilitate ADAR-mediated RNA editing of the TIS (AUG) to IUG, read as GUG. In some instances, this results in protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. In some instances, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 142, resulting in exon skipping. In some embodiments, the engineered guide RNA when hybridized to the region of the target RNA sequence of SEQ ID NO: 142 facilitates (i) RNA editing of a SNCA TIS in the target SNCA RNA, (ii) skipping of Exon 2 in the target SNCA RNA, (iii) reducing a level of SNCA mRNA expression, or (iv) any combination of (i), (ii), and (iii), thereby resulting in a reduction of alpha-synuclein protein encoded by the target SNCA RNA.

[0060] In some embodiments, an engineered guide disclosed herein is at least partially complementary to a target SNCA RNA. In some cases, the target SNCA RNA is a SNCATIS pre-mRNA. In some embodiments, the TIS pre-mRNA comprises the sequence of: UUUUAUGUUUUCCAGUGUGGUGUAAAGGAAUUCAUUAGCCAUGGAUGUAUU CAUGAAAGGACUUUCAAAGGCCAAGGAGGGAGUUGUGGCUGCUG (SEQ ID NO: 150). In some cases, the target DNA sequence encoding the target TIS pre-mRNA sequence comprises the sequence of TTTTATGTTTTCCAGTGTGGTGTAAAGGAATTCATTAGCCATGGATGTATTCATG AAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTG (SEQ ID NO: 149). In some cases, the target SNCA RNA can comprise a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 150. An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA (e.g., SNCA TIS pre-mRNA). In some embodiments, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 150. In some embodiments, an engineered guide RNA hybridizes to at least 60, 70, or 80 bases of a target RNA sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 150 and facilitates a protein knockdown. In some embodiments, the engineered guide RNAs facilitate ADAR-mediated RNA editing of the TIS (AUG) to IUG, read as GUG. In some instances, this results in protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. In some instances, an engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 150. In some embodiments, the engineered guide RNA when hybridized to the region of the target RNA sequence of SEQ ID NO: 150 facilitates (i) RNA editing of a SNCA TIS in the target SNCA RNA, (ii) skipping of Exon 2 in the target SNCA RNA, (iii) reducing a level of SNCA mRNA expression, or (iv) any combination of (i), (ii), and (iii), thereby resulting in a reduction of alpha-synuclein protein encoded by the target SNCA RNA.

[0061] In some cases, the exon skipping that occurs through editing of the SNCA Codon 1 TIS produces SNCA mRNA alternate splice variants. Without wishing to be bound by theory, alternative splicing can result in production of SNCA mRNA alternate splice variants that lack Exon 2, which contains the Codon 1 TIS. The production of thesealternative splice variants that lack Exon 2 (and thus the Exon 2 Codon 1 TIS) results in knockdown of wildtype alpha-synuclein protein. Thus, protein knockdown can be accomplished either by directly editing the TIS itself (thereby reducing SNCA mRNA transcription), or by indirectly removing the Exon 2 TIS through exon skipping, or a combination of both directly editing the TIS and indirectly removing the Exon 2 TIS through exon skipping.

[0062] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0063] Throughout this application, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0064] As used herein, the term “about” a number can refer to that number plus or minus 10% of that number.

[0065] As disclosed herein, a base paired (bp) region refers to a region of the guide-target RNA scaffold in which bases in the guide RNA (e.g., the bases in the targeting sequence of the guide RNA) are paired with opposing bases in the target polynucleotide. Base paired regions can extend from one end or proximal to one end of the guide-target RNA scaffold to or proximal to the other end of the guide-target RNA scaffold. Base paired regions can extend between two structural features. Base paired regions can extend from one end or proximal to one end of the guide-target RNA scaffold to or proximal to a structural feature. Base paired regions can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, a base paired region has from 1 to 50, 1 to 75, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1 to 200, 1 to 225, 1 to 250, 1 to 275, 1 to 300, 50 to 75, 50 to 100, 50to 125, 50 to 150, 50 to 175, 50 to 200, 50 to 225, 50 to 250, 50 to 275, 50 to 300, 60 to 75, 60 to 100, 60 to 125, 60 to 150, 60 to 175, 60 to 200, 60 to 225, 60 to 250, 60 to 275, 60 to 300, 70 to 100, 70 to 125, 70 to 150, 70 to 175, 70 to 200, 70 to 225, 70 to 250, 70 to 275, 70 to 300, 80 to 100, 80 to 125, 80 to 150, 80 to 175, 80 to 200, 80 to 225, 80 to 250, 80 to 275, 80 to 300, 90 to 125, 90 to 150, 90 to 175, 90 to 200, 90 to 225, 90 to 250, 90 to 275, 90 to 300, 100 to 125, 100 to 150, 100 to 175, 100 to 200, 100 to 225, 100 to 250, 100 to 275, 100 to 300, 150 to 200, 150 to 225, 150 to 250, 150 to 275, or 150 to 300 base pairs. In some embodiments, a base paired region has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69,70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132,133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150,151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 191, 192, 193, 194, 195,196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213,214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231,232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 250, 251, 252,253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270,271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288,289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, or 300 base pairs.

[0066] As disclosed herein, a “bulge” refers to the structure substantially formed only upon formation of the guide-target RNA scaffold, where contiguous nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand. A bulge can independently have from 0 to 4 contiguous nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the target RNA side of the guide-target RNA scaffold or a bulge can independently have from 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the guide RNA side of the guide-target RNA scaffold. However, a bulge, as used herein, does not refer to a structure where a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA do not base pair - a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA that do not base pair is referredto herein as a “mismatch.” Further, where the number of participating nucleotides on either the guide RNA side or the target RNA side exceeds 4, the resulting structure is no longer considered a bulge, but rather, is considered an “internal loop.” A “symmetrical bulge” refers to a bulge where the same number of nucleotides is present on each side of the bulge. An “asymmetrical bulge” refers to a bulge where a different number of nucleotides are present on each side of the bulge.

[0067] The term “complementary” or “complementarity” refers to the ability of a nucleic acid to form one or more bonds with a corresponding nucleic acid sequence by, for example, hydrogen bonding (e.g., traditional Watson-Crick), covalent bonding, or other similar methods. In Watson-Crick base pairing, a double hydrogen bond forms between nucleobases T and A, whereas a triple hydrogen bond forms between nucleobases C and G. For example, the sequence A-G-T can be complementary to the sequence T-C-A. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). “Perfectly complementary” can mean that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein can refer to a degree of complementarity that can be at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, or more nucleotides, or can refer to two nucleic acids that hybridize under stringent conditions (i.e., stringent hybridization conditions). Nucleic acids can include nonspecific sequences. As used herein, the term “nonspecific sequence” or “not specific” can refer to a nucleic acid sequence that contains a series of residues that may not be designed to be complementary to or can be only partially complementary to any other nucleic acid sequence.

[0068] The terms “determining,” “measuring,” “evaluating,” “assessing,” “assaying,” and “analyzing” can be used interchangeably herein to refer to forms of measurement. The terms include determining if an element is present or not (for example, detection). These terms can include quantitative, qualitative or quantitative and qualitative determinations. Assessing can be relative or absolute. “Detecting the presence of’ can include determining the amount of something present in addition to determining whether it is present or absent depending on the context.

[0069] The term “encode,” as used herein, refers to an ability of a polynucleotide to provide information or instructions sequence sufficient to produce a corresponding gene expression product. In a non-limiting example, mRNA can encode a polypeptide during translation, whereas DNA can encode an mRNA molecule during transcription.

[0070] As used herein, the term “engineered guide RNA” can be used interchangeably with “guide RNA” and refers to a designed polynucleotide that is at least partially complementary to a target RNA. An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA. Modification of the target RNA includes alteration of RNA splicing, reduction or enhancement of protein translation, target RNA knockdown, target RNA degradation, and / or ADAR mediated RNA editing of the target RNA. In some cases, guide RNAs facilitate ADAR mediated RNA editing for the purpose of target mRNA knockdown, downstream protein translation reduction or inhibition, downstream protein translation enhancement, correction of mutations (including correction of any G to A mutation, such as missense or nonsense mutations), introduction of mutations (e.g., introduction of an A to I (read as a G by cellular machinery) substitution), or alter the function of any adenosine containing a regulatory motif (e.g., polyadenylation signal, miRNA binding site, etc.). In some cases, a guide RNA can affect a functional outcome (e.g., target RNA modulation, downstream protein translation) via a combination of mechanisms, for example, ADAR-mediated RNA editing and binding and / or degrading target RNA. In some cases, a guide RNA can facilitate introduction of mutations at sites targeted by enzymes in order to modify the affinity of such enzymes for targeting and cleaving such sites. The guide RNAs of this disclosure can contain one or more structural features. A structural feature can be formed from latent structure in latent (unbound) guide RNA upon hybridization of the engineered latent guide RNA to a target RNA. Latent structure refers to a structural feature that forms or substantially forms only upon hybridization of a guide RNA to a target RNA. For example, upon hybridization of the guide RNA to the target RNA, the latent structural feature is formed in the resulting double stranded RNA (also referred herein as guide-target RNA scaffold). In such cases, a structural feature can include, but is not limited to, a mismatch, a wobble base pair, a symmetric internal loop, an asymmetric internal loop, a symmetric bulge, or an asymmetric bulge. In other instances, a structural feature can be a preformed structure (e.g., a GluR2 recruitment hairpin, or a hairpin from U7 snRNA).

[0071] An “engineered latent guide RNA” refers to an engineered guide RNA that comprises a portion of sequence that, upon hybridization or only upon hybridization to a target RNA,substantially forms at least a portion of a structural feature, other than a single A / C mismatch feature at the target adenosine to be edited.

[0072] As disclosed herein, a structured motif comprises two or more structural features in a guide-target RNA scaffold.

[0073] As used herein, the term “facilitates RNA editing” by an engineered guide RNA refers to the ability of the engineered guide RNA when associated with an RNA editing entity and a target RNA to provide a targeted edit of the target RNA by the RNA edited entity. In some instances, the engineered guide RNA can directly recruit or position / orient the RNA editing entity to the proper location for editing of the target RNA. In other instances, the engineered guide RNA when hybridized to the target RNA forms a guide-target RNA scaffold with one or more structural features as described herein, where the guide-target RNA scaffold with structural features recruits or positions / orients the RNA editing entity to the proper location for editing of the target RNA.

[0074] A “guide-target RNA scaffold,” as disclosed herein, is the resulting double stranded RNA formed upon hybridization of a guide RNA, with latent structure, to a target RNA. A guide-target RNA scaffold has one or more structural features formed within the double stranded RNA duplex upon hybridization. For example, the guide-target RNA scaffold can have one or more structural features selected from a bulge, mismatch, internal loop, hairpin, or wobble base pair.

[0075] The term percent “identity,” in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent “identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.

[0076] For sequence comparison, typically one sequence acts as a reference sequence (also called the subject sequence) to which test sequences (also called query sequences) are compared. The percent sequence identity is defined as a test sequence’s percent identity to a reference sequence. For example, when stated “Sequence A having a sequence identity of 50% to Sequence B,” Sequence A is the test sequence and Sequence B is the referencesequence. When using a sequence comparison algorithm, test and reference sequences are input into a computer program, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences to achieve the maximum alignment, based on the designated program parameters, introducing gaps in the alignment if necessary. The percent sequence identity for the test sequence(s) relative to the reference sequence can then be determined from the alignment of the test sequence to the reference sequence. The equation for percent sequence identity from the aligned sequence is as follows:[(Number of Identical Positions) / (Total Number of Positions in the Test Sequence)] x 100%.

[0077] For purposes herein, percent identity and sequence similarity calculations are performed using the BLAST algorithm for sequence alignment, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ). The BLAST algorithm uses a test sequence (also called a query sequence) and a reference sequence (also called a subject sequence) to search against, or in some cases, a database of multiple reference sequences to search against. The BLAST algorithm performs sequence alignment by finding high-scoring alignment regions between the test and the reference sequences by scoring alignment of short regions of the test sequence (termed “words”) to the reference sequence. The scoring of each alignment is determined by the BLAST algorithm and takes factors into account, such as the number of aligned positions, as well as whether introduction of gaps between the test and the reference sequences would improve the alignment. The alignment scores for nucleic acids can be scored by set match / mismatch scores. For protein sequences, the alignment scores can be scored using a substitution matrix to evaluate the significance of the sequence alignment, for example, the similarity between aligned amino acids based on their evolutionary probability of substitution. For purposes herein, the substitution matrix used is the BLOSUM62 matrix. For purposes herein, the public default values of April 6, 2023 are used when using the BLASTN and BLASTP algorithms. The BLASTN and BLASTP algorithms then output a “Percent Identity” output value and a “Query Coverage” output value. The overall percent sequence identity as used herein can then be calculated from the BLASTN or BLASTP output values as follows:Percent Sequence Identity = (“Percent Identity” output value) x (“Query Coverage” output value).

[0078] The following non-limiting examples illustrate the calculation of percent identity between two nucleic acids sequences. The percent identity is calculated as follows: [(number of identical nucleotide positions) / (total number of nucleotides in the test sequence)] x 100%. Percent identity is calculated to compare test sequence 1 : AAAAAGGGGG (SEQ ID NO: 1) (length = 10 nucleotides) to reference sequence 2: AAAAAAAAAA (SEQ ID NO: 2) (length = 10 nucleotides). The percent identity between test sequence 1 and reference sequence 2 would be [(5) / (10)] x ioo% = 50%. Test sequence 1 has 50% sequence identity to reference sequence 2. In another example, percent identity is calculated to compare test sequence 3: CCCCCGGGGGGGGGGCCCCC (SEQ ID NO: 3) (length = 20 nucleotides) to reference sequence 4: GGGGGGGGGG (SEQ ID NO: 4) (length = 10 nucleotides). The percent identity between test sequence 3 and reference sequence 4 would be [(10) / (20)] x ioo% = 50%. Test sequence 3 has 50% sequence identity to reference sequence 4. In another example, percent identity is calculated to compare test sequence 5: GGGGGGGGGG (SEQ ID NO: 4) (length = 10 nucleotides) to reference sequence 6: CCCCCGGGGGGGGGGCCCCC (SEQ ID NO: 3) (length = 20 nucleotides). The percent identity between test sequence 5 and reference sequence 6 would be [( 10) / (l 0)] x !00% = 100%. Test sequence 5 has 100% sequence identity to reference sequence 6.

[0079] The following non-limiting examples illustrate the calculation of percent identity between two protein sequences. The percent identity is calculated as follows: [(number of identical amino acid positions) / (total number of amino acids in the test sequence)] x 100%. Percent identity is calculated to compare test sequence 7: FFFFFYYYYY (SEQ ID NO: 5) (length = 10 amino acids) to reference sequence 8: YYYYYYYYYY (SEQ ID NO: 6) (length = 10 amino acids). The percent identity between test sequence 7 and reference sequence 8 would be [(5) / (10)] x ioo% = 50%. Test sequence 7 has 50% sequence identity to reference sequence 8. In another example, percent identity is calculated to compare test sequence 9: LLLLLFFFFFYYYYYLLLLL (SEQ ID NO: 7) (length = 20 amino acids) to reference sequence 10: FFFFFYYYYY (SEQ ID NO: 5) (length = 10 amino acids). The percent identity between test sequence 9 and reference sequence 10 would be [(10) / (20)] x l00% = 50%. Test sequence 9 has 50% sequence identity to reference sequence 10. In another example, percent identity is calculated to compare test sequence 11 : FFFFFYYYYY (SEQ ID NO: 5) (length = 10 amino acids) to reference sequence 12:LLLLLFFFFFYYYYYLLLLL (SEQ ID NO: 7) (length = 20 amino acids). The percent identity between test sequence 11 and reference sequence 12 would be [(10) / ( 10)] * 100% = 100%. Test sequence 11 has 100% sequence identity to reference sequence 12. As disclosed herein, an “internal loop” refers to the structure substantially formed only upon formation of the guide-target RNA scaffold, where nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand and where one side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, has 5 nucleotides or more. Where the number of participating nucleotides on both the guide RNA side and the target RNA side drops below 5, the resulting structure is no longer considered an internal loop, but rather, is considered a “bulge” or a “mismatch,” depending on the size of the structural feature. A “symmetrical internal loop” is formed when the same number of nucleotides is present on each side of the internal loop. An “asymmetrical internal loop” is formed when a different number of nucleotides is present on each side of the internal loop.

[0080] Latent structure refers to a structural feature that substantially forms only upon hybridization of a guide RNA to a target RNA. For example, the sequence of a guide RNA provides one or more structural features, but these structural features substantially form only upon hybridization to the target RNA, and thus the one or more latent structural features manifest as structural features upon hybridization to the target RNA. Upon hybridization of the guide RNA to the target RNA, the structural feature is formed, and the latent structure provided in the guide RNA is, thus, unmasked. The formation and structure of a latent structural feature upon binding to the target RNA depends on the guide RNA sequence. For example, formation and structure of the latent structural feature may depend on a pattern of complementary and mismatched residues in the guide RNA sequence relative to the target RNA. The guide RNA sequence may be engineered to have a latent structural feature that forms upon binding to the target RNA. “Messenger RNA” or “mRNA” are RNA molecules comprising a sequence that encodes a polypeptide or protein. In general, RNA can be transcribed from DNA. In some cases, precursor mRNA containing non-protein coding regions in the sequence can be transcribed from DNA and then processed to remove all or a portion of the non-coding regions (introns) to produce mature mRNA. As used herein, the term “pre-mRNA” can refer to the RNA molecule transcribed from DNA before undergoing processing to remove the non-protein coding regions.

[0081] As disclosed herein, a “mismatch” refers to a single nucleotide in a guide RNA that is unpaired to an opposing single nucleotide in a target RNA within the guide-target RNA scaffold. A mismatch can comprise any two single nucleotides that do not base pair. Where the number of participating nucleotides on the guide RNA side and the target RNA side exceeds 1, the resulting structure is no longer considered a mismatch, but rather, is considered a “bulge” or an “internal loop,” depending on the size of the structural feature.

[0082] As used herein, the term “polynucleotide” refers to a single or double-stranded polymer of deoxyribonucleotide (DNA) or ribonucleotide (RNA) bases read from the 5’ to the 3’ end. The term “RNA” is inclusive of dsRNA (double stranded RNA), snRNA (small nuclear RNA), IncRNA (long non-coding RNA), mRNA (messenger RNA), miRNA (microRNA) RNAi (inhibitory RNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), tRNA (transfer RNA), rRNA (ribosomal RNA), snoRNA (small nucleolar RNA), and cRNA (complementary RNA). The term DNA is inclusive of cDNA, genomic DNA, and DNA-RNA hybrids. A sequence of a polynucleotide may be provided interchangeably as an RNA sequence (containing U) or a DNA sequence (containing T). A sequence provided as an RNA sequence is intended to also cover the corresponding DNA sequence and the reverse complement RNA sequence or DNA sequence. A sequence provided as a DNA sequence is intended to also cover the corresponding RNA sequence and the reverse complement RNA sequence or DNA sequence.

[0083] The term “protein”, “peptide” and “polypeptide” can be used interchangeably and in their broadest sense can refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits can be linked by peptide bonds. In another embodiment, the subunit can be linked by other bonds, e.g., ester, ether, etc. A protein or peptide can contain at least two amino acids and no limitation can be placed on the maximum number of amino acids which can comprise a protein’s or peptide's sequence. As used herein the term “amino acid” can refer to either natural amino acids, unnatural amino acids, or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics. As used herein, the term “fusion protein” can refer to a protein comprised of domains from more than one naturally occurring or recombinantly produced protein, where generally each domain serves a different function. In this regard, the term “linker” can refer to a protein fragment that can be used to link these domains together - optionally to preserve the conformation of the fused protein domains, prevent unfavorableinteractions between the fused protein domains which can compromise their respective functions, or both.

[0084] The term “structured motif’ refers to a combination of two or more structural features in a guide-target RNA scaffold.

[0085] The terms “subject,” “individual,” or “patient” can be used interchangeably herein. A “subject” refers to a biological entity containing expressed genetic materials. The biological entity can be a plant, animal, or microorganism, including, for example, bacteria, viruses, fungi, and protozoa. The subject can be tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro. The subject can be a mammal. The mammal can be a human. The subject can be diagnosed or suspected of being at high risk for a disease. In some cases, the subject is not necessarily diagnosed or suspected of being at high risk for the disease

[0086] As used herein, the term “targeting sequence” can be used interchangeable with “targeting domain” or “targeting region” and refers to a polynucleotide sequence within an engineered guide RNA sequence that is at least partially complementary to a target polynucleotide. The target polynucleotide e.g., a target RNA or a target DNA) may be a region of a polynucleotide of interest, such as a gene or a messenger RNA. As used herein, a “complementary” sequence refers to a sequence that is a reverse complement relative to a second sequence. A targeting sequence of an engineered guide RNA allows the engineered guide RNA to hybridize to a target polynucleotide (e.g., a target RNA) through base pairing, such as Watson Crick base pairing. A targeting sequence can be located at either the N- terminus or C-terminus of the engineered guide RNA, or both, or the targeting sequence can be within the engineered guide RNA. The targeting sequence can be of any length sufficient to hybridize with the target polynucleotide. In some cases, the targeting sequence is at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100,101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118,119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136,137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154,155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172,173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190,191, 192, 193, 194, 195, 196, 197, 198, 199, or up to about 200 nucleotides in length. In an embodiment, an engineered polynucleotide comprises a targeting sequence that is about 25 to 200, 50 to 150, 75 to 100, 80 to 110, 90 to 120, 95 to 115, 60 to 200, 60 to 180, 60 to 160, 60 to 140, 70 to 200, 70 to 180, 70 to 160, 70 to 140, 80 to 200, 80 to 190, 80 to 170, 80 to 160, 80 to 150, 80 to 140, 80 to 130, 80 to 120, 90 to 200, 90 to 190, 90 to 180, 90 to 170, 90 to 160, 90 to 150, 90 to 140, 90 to 130, 90 to 120, 100 to 200, 100 to 190, 100 to 180, 100 to 170, 100 to 160, 100 to 150, 100 to 140, 100 to 130, 100 to 120, 110 to 200, 110 to 190, 110 to 180, 110 to 170, 110 to 160, 110 to 150, 110 to 140, 110 to 120, 120 to 200, 120 to 190, 120 to 180, 120 to 170, 120 to 160, 120 to 150, 120 to 140, 130 to 200, 130 to 190, 130 to 180, 130 to 170, 130 to 160, 130 to 150, 140 to 200, 140 to 190, 140 to 180, 140 to 170, 140 to 160, 150 to 200, 150 to 190, 150 to 180, 150 to 170, 160 to 200, 160 to 190 or 160 to 180 nucleotides in length.

[0087] A targeting sequence comprises at least partial sequence complementarity to a target polynucleotide. The targeting sequence may have a degree of sequence complementarity to the target polynucleotide sufficient to hybridize with the target polynucleotide. In some cases, the targeting sequence comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to the target polynucleotide. In some cases, the targeting sequence comprises less than 100% complementarity to the target polynucleotide sequence. For example, the targeting sequence may have a single base mismatch relative to the target polynucleotide when bound to the target polynucleotide. In other cases, the targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 20, 30, 40 or up to about 50 base mismatches relative to the target polynucleotide when bound to the target polynucleotide. In some aspects, nucleotide mismatches can be associated with structural features provided herein. In some aspects, a targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or up to about 15 nucleotides that differ in complementarity from a wildtype polynucleotide of a subject target polynucleotide.

[0088] A targeting sequence comprises nucleotide residues having complementarity to a target polynucleotide. The targeting sequence may have a number of residues with complementarity to the target polynucleotide sufficient to hybridize with the target polynucleotide. The complementary residues may be contiguous or non-contiguous. In some cases, the targeting sequence comprises at least 50 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 150 nucleotides having complementarity to the target polynucleotide. In some cases, the targetingsequence comprises from 50 to 200 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 250 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 300 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144,145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162,163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180,190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225,226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243,244, 245, 246, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264,265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282,283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, or 300 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises more than 50 nucleotides total and has at least 50 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 150 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 200 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 250 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 300 nucleotides having complementarity to the target polynucleotide. In some cases, the at least 50 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 150 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 200 nucleotides having complementarityto the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 250 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 300 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. For example, a targeting sequence comprises a total of 54 nucleotides wherein, sequentially, 25 nucleotides are complementarity to the target polynucleotide, 4 nucleotides form a bulge, and 25 nucleotides are complementarity to the target polynucleotide. As another example, a targeting sequence comprises a total of 118 nucleotides wherein, sequentially, 25 nucleotides are complementarity to the target polynucleotide, 4 nucleotides form a bulge, 25 nucleotides are complementarity to the target polynucleotide, 14 nucleotides form a loop, and 50 nucleotides are complementary to the target polynucleotide.

[0089] The term “in vivo” refers to an event that takes place in a subject’s body.

[0090] The term “ex vivo” refers to an event that takes place outside of a subject’s body. An ex vivo assay may not be performed on a subject. Rather, it can be performed upon a sample separate from a subject. An example of an ex vivo assay performed on a sample can be an “in vitro” assay.

[0091] The term “in vitro” refers to an event that takes place within a container for holding laboratory reagent such that it can be separated from the biological source from which the material can be obtained. In vitro assays can encompass cell-based assays in which living or dead cells can be employed. In vitro assays can also encompass a cell-free assay in which no intact cells can be employed.

[0092] The term “wobble base pair” refers to two bases that weakly pair. For example, a wobble base pair can refer to a G paired with a U.

[0093] The term “substantially forms” as described herein, when referring to a particular secondary structure, refers to formation of at least 80% of the structure under physiological conditions (e.g., physiological pH, physiological temperature, physiological salt concentration, etc.).

[0094] As used herein, the terms “treatment” or “treating” can be used in reference to a pharmaceutical or other intervention regimen for obtaining beneficial or desired results in the recipient. Beneficial or desired results include but are not limited to a therapeutic benefitand / or a prophylactic benefit. A therapeutic benefit can refer to eradication or amelioration of one or more symptoms of an underlying disorder being treated. Also, a therapeutic benefit can be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement can be observed in the subject, notwithstanding that the subject can still be afflicted with the underlying disorder. A prophylactic effect includes delaying, preventing, or eliminating the appearance of a disease or condition, delaying or eliminating the onset of one or more symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof. For prophylactic benefit, a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease can undergo treatment, even though a diagnosis of this disease may not have been made.

[0095] As used herein, the terms “vector design” or “construct” can be used in reference to a designed polynucleotide encoding one or more guide RNAs as described herein and comprising one or more regulatory elements.Engineered Guide RNAs

[0096] Disclosed herein are engineered guide RNAs (e.g. SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, or SEQ ID NO: 112 - SEQ ID NO: 117) and engineered polynucleotides encoding the same (e.g. SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 66 - SEQ ID NO: 77, or SEQ ID NO: 106 - SEQ ID NO: 111) for site-specific, selective editing of a target RNA (for example, an SNCA Codon 1 TIS of Exon 2 corresponding to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)) via an RNA editing entity or a biologically active fragment thereof. In some embodiments, the engineered guide RNA of the present disclosure can be encoded by a polynucleotide comprising a polynucleotide sequence of any one of SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 66 - SEQ ID NO: 77, or SEQ ID NO: 106 - SEQ ID NO: 111. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the RNA sequence of SEQ ID NO: 43 or a sequence that is at least 80% identical to SEQ ID NO: 43. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the RNA sequence of SEQ ID NO: 136 or a sequence that is at least 80% identical to SEQ ID NO: 136. In some embodiments,the engineered guide RNAs of the present disclosure target one or more adenosines in the RNA sequence of SEQ ID NO: 138 or a sequence that is at least 80% identical to SEQ ID NO: 138. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the RNA sequence of SEQ ID NO: 140 or a sequence that is at least 80% identical to SEQ ID NO: 140. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the RNA sequence of SEQ ID NO: 142 or a sequence that is at least 80% identical to SEQ ID NO: 142. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the RNA sequence of SEQ ID NO: 150 or a sequence that is at least 80% identical to SEQ ID NO: 150.

[0097] In some embodiments, engineered guide RNAs of the present disclosure that target SNCA comprise a micro-footprint sequence and / or a macro-footprint sequence that each comprise latent structures, such that when the engineered guide RNA is hybridized to the target RNA, the latent structures manifest. A latent structure, when manifested, produces at least one structural feature selected from the group consisting of: a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof. In some embodiments, the engineered guide RNA of the disclosure, upon hybridization of the engineered guide RNA and the sequence of the target RNA form a guide-target RNA scaffold, comprising (i) a region that comprises at least one structural feature; and (ii) a macro-footprint, such as a first internal loop (also referred to as a “left bell” or “LB”) and a second internal loop (also referred to as a “right bell” or “RB”) that flank opposing ends of the region of the guide-target RNA scaffold, where the engineered guide RNA facilitates an increase in the amount of the targeted edit of the adenosine of the target RNA via the adenosine deaminase enzyme RNA editing entity, relative to an otherwise comparable engineered guide RNA lacking the first internal loop and the second internal loop. As described herein, a first internal loop and a second internal loop can be described with respect to their position relative to an A / C mismatch in the target RNA scaffold, where the A in the A / C mismatch is the target adenosine of the SNCA target RNA.

[0098] As described herein, a “micro-footprint” sequence refers to a sequence with latent structures that, when manifested, facilitate editing of the adenosine of a target RNA via an adenosine deaminase enzyme. A macro-footprint can serve to guide an RNA editing entity (e.g., ADAR) and direct its activity towards a micro-footprint. In some embodiments, included within the micro-footprint sequence is a nucleotide that is positioned such that, when the guide RNA is hybridized to the target RNA, the nucleotide opposes the adenosineto be edited by the adenosine deaminase and does not base pair with the adenosine to be edited. This nucleotide is referred to herein as the “mismatched position” or “mismatch” and can be a cytosine. Micro-footprint sequences as described herein have upon hybridization of the engineered guide RNA and target RNA, at least one structural feature selected from the group consisting of: a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof. Engineered guide RNAs with superior micro-footprint sequences can be selected based on their ability to facilitate editing of a specific target RNA (such as SNCA mRNA).

[0099] In some embodiments, guide RNAs of the present disclosure (e.g., SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 66 - SEQ ID NO: 77, or SEQ ID NO: 112 - SEQ ID NO: 117) can further comprise a macro-footprint. In some embodiments, the macro-footprint comprises a barbell macro-footprint. A micro-footprint can serve to guide an RNA editing enzyme and direct its activity towards the target adenosine to be edited. A “barbell” as described herein refers to a pair of internal loop latent structures that manifest upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is positioned towards the 5' end or the 3' end of the guide-target RNA scaffold formed upon hybridization of the guide RNA and the target RNA. In some embodiments, each internal loop flanks opposing sides of the micro-footprint sequence.Insertion of a barbell macro-footprint sequence flanking opposing sides of the micro-footprint sequence, upon hybridization of the guide RNA to the SNCA target RNA, results in formation of barbell internal loops on opposing sides of the micro-footprint, which in turn comprises at least one structural feature that facilitates editing of the SNCA target RNA.

[0100] Provided herein are engineered guide RNAs (such as latent guide RNA that comprise a micro-footprint sequence and / or a macro-footprint sequence) and polynucleotides encoding the same; as well as compositions comprising said engineered guide RNAs or said polynucleotides. As used herein, the term “engineered” in reference to a guide RNA or polynucleotide encoding the same refers to a non-naturally occurring guide RNA or polynucleotide encoding the same. For example, the present disclosure provides for engineered polynucleotides encoding for engineered guide RNAs. In some embodiments, the engineered guide comprises RNA. In some embodiments, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified RNA bases or unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA and RNA bases.

[0101] An engineered guide RNA as described herein comprises a targeting domain with complementarity to a target RNA described herein. As such, a guide RNA can be engineered to site-specifically / selectively target and hybridize to a particular target RNA, thus facilitating editing of specific nucleotide in the target RNA via an RNA editing entity or a biologically active fragment thereof. The targeting domain can include a nucleotide that is positioned such that, when the guide RNA is hybridized to the target RNA, the nucleotide opposes a base to be edited by the RNA editing entity or biologically active fragment thereof and does not base pair, or does not fully base pair, with the base to be edited. This mismatch can help to localize editing of the RNA editing entity to the desired base of the target RNA. However, in some instances there can be some, and in some cases significant, off target editing in addition to the desired edit.

[0102] Hybridization of the target RNA and the targeting domain of the guide RNA produces specific secondary structures in the guide-target RNA scaffold that manifest upon hybridization, which are referred to herein as “latent structures.” Latent structures when manifested become structural features described herein, including mismatches, bulges, internal loops, and hairpins. Without wishing to be bound by theory, the presence of structural features described herein that are produced upon hybridization of the guide RNA with the target RNA configure the guide RNA to facilitate a specific, or selective, targeted edit of the target RNA via the RNA editing entity or biologically active fragment thereof. Further, the structural features in combination with the mismatch described above generally facilitate an increased amount of editing of a target adenosine, fewer off target edits, or both, as compared to a construct comprising the mismatch alone or a construct having perfect complementarity to a target RNA. Accordingly, rational design of latent structures in engineered guide RNAs of the present disclosure to produce specific structural features in a guide-target RNA scaffold can be a powerful tool to promote editing of the target RNA with high specificity, selectivity, and robust activity.

[0103] Provided herein are engineered guides and polynucleotides encoding the same; as well as compositions comprising said engineered guide RNAs or said polynucleotides. As used herein, the term “engineered” in reference to a guide RNA or polynucleotide encoding the same refers to a non-naturally occurring guide RNA or polynucleotide encoding the same. For example, the present disclosure provides for engineered polynucleotides encoding engineered guide RNAs. In some embodiments, the engineered guide comprises RNA. In some embodiments, the engineered guide comprises DNA. In some examples, the engineeredguide comprises modified RNA bases or unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA and RNA bases.

[0104] In some examples, the engineered guides provided herein comprise an engineered guide that can be configured, upon hybridization to a target RNA molecule, to form, at least in part, a guide-target RNA scaffold with at least a portion of the target RNA molecule, wherein the guide-target RNA scaffold comprises at least one structural feature, and wherein the guide-target RNA scaffold recruits an RNA editing entity and facilitates a chemical modification of a base of a nucleotide in the target RNA molecule by the RNA editing entity.

[0105] In some examples, a target RNA of an engineered guide RNA of the present disclosure can be a pre-mRNA or mRNA. In some embodiments, the engineered guide RNA of the present disclosure hybridizes to a sequence of the target RNA. In some embodiments, part of the engineered guide RNA (e.g., a targeting domain) hybridizes to the sequence of the target RNA. The part of the engineered guide RNA that hybridizes to the target RNA is of sufficient complementary to the sequence of the target RNA for hybridization to occur.A. Targeting Domain

[0106] Engineered guide RNAs disclosed herein can be engineered in any way suitable for RNA editing. In some examples, an engineered guide RNA generally comprises at least a targeting sequence that allows it to hybridize to a region of a target RNA molecule (e.g. an SNCA Codon 1 TIS of Exon 2 corresponding to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4). A targeting sequence can also be referred to as a “targeting domain” or a “targeting region”.

[0107] In some cases, a targeting domain of an engineered guide allows the engineered guide to target an RNA sequence through base pairing, such as Watson Crick base pairing. In some examples, the targeting sequence can be located at either the N-terminus or C-terminus of the engineered guide. In some cases, the targeting sequence can be located at both termini. The targeting sequence can be of any length. In some cases, the targeting sequence can be at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135,136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or up to about 200 nucleotides in length. In some cases, the targeting sequence can be no greater than about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides in length. In some examples, an engineered guide comprises a targeting sequence that can be from about 60 to about 500, from about 60 to about 200, from about 75 to about 100, from about 80 to about 200, from about 90 to about 120, or from about 95 to about 115 nucleotides in length. In some examples, an engineered guide RNA comprises a targeting sequence that can be about 100 nucleotides in length.

[0108] In some cases, a targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to a target RNA. In some cases, a targeting sequence comprises less than 100% complementarity to a target RNA sequence. For example, a targeting sequence and a region of a target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0109] The targeting sequence can have sufficient complementarity to a target RNA to allow for hybridization of the targeting sequence to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 50 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 60 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 70 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 80 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 90 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 100 nucleotides or more to the target RNA. In some embodiments, antisense complementarity refers to non-contiguous stretches of sequence. In some embodiments, antisense complementarity refers to contiguous stretches of sequence.

[0110] In some cases, an engineered guide RNA targeting SNCA can comprise multiple targeting sequences. In some instances, one or more target sequence domains in the engineered guide RNA can bind to one or more regions of a target SNCA RNA. For example, a first targeting sequence can be configured to be at least partially complementary to a first region of a target RNA (e.g., an SNCA Codon 1 TIS of Exon 2), while a second targeting sequence can be configured to be at least partially complementary to a second region of a target RNA. In some instances, multiple target sequences can be operatively linked to provide continuous hybridization of multiple regions of a target RNA. In some instances, multiple target sequences can provide non-continuous hybridization of multiple regions of a target RNA. A “non-continuous” overlap or hybridization refers to hybridization of a first region of a target SNCA RNA by a first targeting sequence, along with hybridization of a second region of a target SNCA RNA by a second targeting sequence, where the first region and the second region of the target SNCA RNA are discontinuous (e.g., where there is intervening sequence between the first and the second region of the target RNA). Use of an engineered guide RNA as described herein configured for non-continuous hybridization can provide a number of benefits. For instance, such a guide can potentially target pre-mRNA during transcription (or shortly thereafter), which can then facilitate chemical modification using a deaminase (e.g., ADAR) co-transcriptionally and thus increase the overall efficiency of the chemical modification. Further, the use of oligo tethers to provide non-continuous hybridization while skipping intervening sequence can result in shorter, more specific guide RNA with fewer off-target editing.

[0111] In some instances, an engineered guide RNA configured for non-continuous hybridization to a target SNCA RNA (e.g, an engineered guide RNA comprising a targeting sequence with an oligo tether) can be configured to bind distinct regions or a target SNCA RNA separated by intervening sequence. In some instances, the intervening sequence can be at least: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820,830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, or 10000 nucleotides. In some instances, the targeting sequence and oligo tether can target distinct non-continuous regions of the same intron, exon or noncoding region. In some instances, the targeting sequence and oligo tether can target distinct non-continuous regions of adjacent exons, introns or noncoding regions. In some instances, the targeting sequence and oligo tether can target distinct non-continuous regions of distal exons, introns, or noncoding regions.

[0112] In some embodiments, a polynucleotide encoding a guide RNA disclosed herein can comprise a targeting sequence, such as the sequences described in TABLE 1. TABLE 1 provide different guide RNA sequences (DNA and RNA sequences) and the latent structural features associated with guide RNA sequences. For each sequence, the structural features formed in the double stranded RNA substrate upon hybridization of the guide RNA to the target SNCA RNA, are shown in the last column of TABLE 1. For reference, each structural feature formed within a guide-target RNA scaffold (target RNA sequence hybridized to an engineered guide RNA) is annotated as follows: a) the position of the structural feature with respect to the target A (position 0) of the target RNA sequence, with a negative value indicating upstream (5’) of the target A and a positive value indicating downstream (3’) of the target A; b) the number of bases in the target RNA sequence and the number of bases in the engineered guide RNA that together form the structural feature - for example, 6 / 6 indicates that six contiguous bases from the target RNA sequence and six contiguous bases from the engineered guide RNA form the structural feature; c) the name of the structural feature (e.g., symmetric bulge, symmetric internal loop, asymmetric bulge, asymmetric internal loop, mismatch, or wobble base pair), andd) the sequences of bases on the target RNA side and the engineered guide RNA side that participate in forming the structural feature.

[0113] For example, with reference to SEQ ID NO: 41, -6_6-6_internal_loop-symmetric_ AUUCAU-UCAUAC, O_l-l_mismatch_A-C, 5_2-2_bulge-symmetric_UG-AC, 26_6- 6_internal_loop-symmetric_ AAAGGC-AUAGGC” is read as a structural feature formed in a guide-target RNA scaffold (target SNCA RNA sequence hybridized to an engineered guide RNA of SEQ ID NO: 41), where a structural feature starts 6 nucleotides upstream (5’) (the -6 position) from the target A (0 position) of the target RNA sequence; six contiguous bases from the target RNA sequence and six contiguous bases from the engineered guide RNA form the structural feature; the structural feature is an internal symmetric loop; and a sequence of AUUC AU from the target RNA side and a sequence of UCAUAC from the engineered guide RNA side participate in forming the internal symmetric loop. A structural feature starts at the target A (0 position) of the target RNA sequence; 1 base from the target RNA and 1 base from the engineered guide RNA form the structural feature; the structural feature is a mismatch; and the sequence of A from the target RNA side and a sequence of C from the engineered guide RNA side participate in forming the mismatch. A structural feature starts 5 nucleotides downstream (3’) (the +5 position) from the target A (0 position) of the target RNA sequence; 2 contiguous bases from the target RNA sequence and 2 contiguous bases from the engineered guide RNA form the structural feature; the structural feature is an symmetric bulge; and a sequence of UG from the target RNA side and a sequence of AC from the engineered guide RNA side participate in forming the symmetric bulge. A structural feature starts 26 nucleotides downstream (3’) (the +26 position) from the target A (0 position) of the target RNA sequence; six contiguous bases from the target RNA sequence and six contiguous bases from the engineered guide RNA form the structural feature; the structural feature is an internal symmetric loop; and a sequence of AAAGGC from the target RNA side and a sequence of AUAGGC from the engineered guide RNA side participate in forming the internal symmetric loop.TABLE 1. SNCA Targeting Sequences

[0114] In some embodiments, a polynucleotide encoding a guide RNA disclosed herein can comprise a targeting sequence, such as any one of SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 66 - SEQ ID NO: 77, SEQ ID NO: 106 - SEQ ID NO: 111, or SEQ ID NO: 145 - SEQ ID NO: 146. In some cases, the targeting sequence targets the SNCA Codon 1 TIS of Exon 2. In some cases, the targeting sequence targets the SNCA pre-mRNA TIS. In some cases, SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 66 - SEQ ID NO: 77, SEQ ID NO: 106 - SEQ ID NO: 111, or SEQ ID NO: 145 - SEQ ID NO: 146 can be positioned in a vector in the forward direction (i.e., 5’ to 3’) or in the reverse direction (i.e., 3’ to 5’).

[0115] In some embodiments, an engineered guide RNA disclosed herein may be modified to target a pre-mRNA of the SNCA TIS mRNA target sequence. For example, SEQ ID NO: 110 targeting the SNCA TIS mRNA sequence may be modified to target the pre-mRNA SNCA TIS sequence to a pre-mRNA targeting guide RNA sequence of SEQ ID NO: 145. In another example, SEQ ID NO: 46 targeting the SNCA TIS mRNA sequence may be modified to target the pre-mRNA SNCA TIS sequence to a pre-mRNA targeting guide RNA sequence of SEQ ID NO: 146.

[0116] In some embodiments, an engineered guide RNA disclosed herein can comprise a targeting sequence, such as any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, SEQ ID NO: 112 - SEQ ID NO: 117, or SEQ ID NO: 147 - SEQ ID NO: 148. In some cases, the targeting sequence targets the SNCA Codon 1 TIS of Exon 2. In some cases, the targeting sequence targets the SNCA pre- mRNA TIS. In some embodiments, a composition can comprise an engineered guide RNA comprising any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, SEQ ID NO: 112 - SEQ ID NO: 117, or SEQ ID NO: 147 - SEQ ID NO: 148. In some embodiments, a composition can comprise an engineered guide RNA with at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, SEQ ID NO: 112 - SEQ ID NO: 117, or SEQ ID NO: 147 - SEQ ID NO: 148. In some embodiments, a composition can comprise a polynucleotide encoding an engineered guide RNA comprising any one of SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 66 - SEQ ID NO: 77, SEQ ID NO: 106 - SEQ ID NO: 111, or SEQ ID NO: 145 - SEQ ID NO: 146. In some embodiments, a composition cancomprise a polynucleotide encoding one or more engineered guide RNAs comprising any one of SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 66 - SEQ ID NO: 77, SEQ ID NO: 106 - SEQ ID NO: 111, or SEQ ID NO: 145 - SEQ ID NO: 146. In some embodiments, a composition can comprise a polynucleotide encoding an engineered guide RNA with at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to any one of SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 66 - SEQ ID NO: 77, SEQ ID NO: 106 - SEQ ID NO: 111, or SEQ ID NO: 145 - SEQ ID NO: 146.

[0117] In some embodiments, hybridization of a targeting domain of an engineered guide RNA to a target SNCA RNA results in protein knockdown. For example, hybridization of a targeting domain of an engineered guide RNA to a sequence of a target SNCA RNA containing the Exon 2 Codon 1 TIS can result in silencing of the Codon 1 TIS. This silencing can occur due to, for example, where the hybridization of the targeting domain to the target SNCA RNA results in ADAR-mediated editing of the adenosine of the Codon 1 TIS, thus effectively converting the AUG start codon to a GUG codon and silencing the Codon 1 TIS. Silencing can also occur due to, for example, where the hybridization of the targeting domain to the target SNCA RNA results in exon skipping of Exon 2, thus silencing the Exon 2 TIS by removing it from the mature SNCA mRNA. In some cases, silencing of the Exon 2 Codon 1 TIS can occur due to both ADAR-mediated editing of the Exon 2 TIS and exon skipping of Exon 2. In some cases, silencing can also occur due to, for example, where the hybridization of the targeting domain to a SNCA pre-mRNA TIS, thereby silencing the pre-mRNA TIS by removing it from the mature SNCA mRNA. In some cases, silencing of the pre-mRNA TIS can occur due to ADAR-mediated editing of the pre-mRNA TIS.

[0118] Data provided herein shows the utility of the “Near Sm site structure” (NSS) in the processing of engineered guide RNAs. Secondary structural predictions show that different guide RNAs, even those containing the same regulatory elements, can exhibit variable NSS conformations. These conformations can be broadly categorized as either “open” or “closed” based on their structural characteristics.

[0119] In guide RNAs with an “open” NSS, stems are formed between the 5' end of the guide RNA and the nucleotides at the 3’ end of the guide RNA, immediately upstream of the Sm-binding sequence. The secondary structure formed by hybridization of the 5’ and 3’ ends of the guide RNA prevent hybridization of the Sm-binding sequence to the guide RNA,exposing the Sm-binding sequence to snRNA processing machinery. This configuration is thought to promote efficient recognition and processing by the cellular machinery involved in snRNA maturation. Conversely, a “closed” NSS arises when the Sm-binding sequence hybridizes to the guide sequence, potentially hindering the accessibility of the Sm-binding sequence and impeding proper guide RNA processing.

[0120] Creating an open NSS structure by promoting intramolecular pairing between the 5’ end of the engineered RNA and the region upstream of the Sm-binding sequence enhances guide RNA performance. This can be achieved through careful design and manipulation of the guide RNA, taking into account the secondary structure of the molecule. By designing sequences favoring formation of an open NSS, the efficiency of guide RNA expression and processing may be enhanced, ultimately improving the effectiveness of guide RNA-mediated RNA editing applications. Such added sequences can also be referred to herein as an NSS strategy.

[0121] In some embodiments, the Near Sm-Site Structure (NSS) sequence may be positioned 5’ of the targeting sequence, between the targeting sequence and the Sm-binding sequence, or both. An NSS sequence may be appended to the targeting sequence to form part of the engineered guide RNA. In some embodiments, a first NSS sequence is reverse complementary to a second NSS sequence, wherein one of the first NSS sequence or the second NSS sequence is positioned 5’ of the targeting sequence and the other of the first NSS sequence or the second NSS sequence is positioned between the targeting sequence and the Sm-binding sequence. In some embodiments an NSS sequence is positioned 5’ of a targeting sequence and is reverse complementary to the 3’ end of the targeting sequence. In some embodiments an NSS sequence is positioned 3’ of a targeting sequence and is reverse complementary to the 5’ end of the targeting sequence. As shown in TABLE 2, NSS sequence or sequences can be positioned at various locations relative to the targeting guide RNA sequences according to the indicated strategies to expose the Sm-binding sequence.TABLE 2 - Strategies to Position Near Sm Site Structure (NSS) Sequences Relative toTargeting Sequence

[0122] In some embodiments, a polynucleotide encoding a guide RNA disclosed herein can comprise a guide RNA sequence comprising a near-Sm site structure (NSS) insertion, such as the sequences described in TABLE 3. TABLE 3 provides different guide RNA sequences with NSS insertions (DNA and RNA sequences) and the latent structural features associated with guide RNA sequences comprising the NSS insertions. The NSS sequences are bolded. For each sequence, the structural features formed in the double stranded RNA substrate upon hybridization of the guide RNA to the target SNCA RNA, are shown in the last column of TABLE 3TABLE 3. SNCA Guide Sequences with near-Sm site structure (NSS) insertions

[0123] In some embodiments, a polynucleotide encoding a guide RNA disclosed herein can comprise a targeting sequence and a near-Sm site structure (NSS) insertion, such as any one of SEQ ID NO: 54 - SEQ ID NO: 65. In some cases, the targeting sequence targets the SNCA Codon 1 TIS of Exon 2. In some cases, any one of SEQ ID NO: 54 - SEQ ID NO: 65 can be positioned in a vector in the forward direction (i.e., 5’ to 3’) or in the reverse direction (i.e., 3’ to 5’). In some embodiments, a composition can comprise an engineered guide RNA with at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to any one of SEQ ID NO: 54 - SEQ ID NO: 65.

[0124] In some embodiments, an engineered guide RNA disclosed herein can comprise a targeting sequence and a near-Sm site structure (NSS) insertion, such as any one of SEQ ID NO: 66 - SEQ ID NO: 77. In some cases, the targeting sequence targets the SNCA Codon 1 TIS of Exon 2. In some embodiments, a composition can comprise an engineered guide RNA comprising a NSS insertion comprising any one of SEQ ID NO: 66 - SEQ ID NO: 77. In some embodiments, a composition can comprise an engineered guide RNA with at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to any one of SEQ ID NO: 66 - SEQ ID NO: 77. In some embodiments, a composition can comprise a polynucleotide encoding an engineered guide RNA comprising any one of SEQ ID NO: 54 - SEQ ID NO: 65. In someembodiments, a composition can comprise a polynucleotide encoding one or more engineered guide RNAs comprising any one of SEQ ID NO: 54 - SEQ ID NO: 65. In some embodiments, a composition can comprise a polynucleotide encoding an engineered guide RNA with at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to any one of SEQ ID NO: 54 - SEQ ID NO: 65.

[0125] In some cases, an engineered RNA as disclosed herein can comprise (a) an engineered guide RNA comprising a targeting sequence that binds to a target SNCA RNA, and a first Near Sm-Site Structure (NSS) sequence that is positioned 5’ of the targeting sequence or 3’ of the targeting sequence; and (b) an Sm-binding sequence that is positioned 3’ of the engineered guide RNA. In some cases, the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides (ASOs)) described here comprise a targeting sequence that can be operably linked to a snRNA processing RNA hairpin sequence. In some embodiments, engineered RNAs described here comprise a targeting sequence that allows the engineered RNA to hybridize to a region of a target RNA or target RNA molecule. In some embodiments, the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) described here comprise a targeting sequence with sufficient complementary to a target RNA for hybridization of the engineered RNA and target RNA. Various embodiments comprise engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) comprising a targeting sequence linked to an SmOPT or SmOPT variant sequence and an snRNA processing hairpin. In some embodiments, engineered RNAs described here comprise a targeting sequence (e.g., having sufficient complementary to a target RNA for hybridization of the engineered RNA and target RNA), an NSS sequence (e.g., having sufficient complementarity to a 5’ end or a 3’ end of the targeting sequence to promote hybridization with the targeting sequence), an SmOPT or SmOPT variant sequence, and an snRNA processing hairpin. In some embodiments, engineered RNAs described here comprise a targeting sequence (e.g., having sufficient complementary to a target RNA for hybridization of the engineered RNA and target RNA), a first NSS sequence, a second NSS sequence (e.g., having sufficient complementarity to the first NSS sequence to promote hybridization with the first NSS sequence), an SmOPT or SmOPT variant sequence, and an snRNA processing hairpin.

[0126] Engineered RNAs disclosed herein can be engineered or designed in any way suitable for RNA editing or altering RNA interactions, processing, or expression. In someexamples, an engineered RNA generally comprises at least a targeting sequence that is capable of hybridizing to or, in some embodiments, a targeting sequence with target complementarity to a region of a target RNA or target RNA molecule, used interchangeably here. A targeting sequence can also be referred to as a “targeting domain” or a “targeting region” and used interchangeably here.

[0127] In some cases, a targeting sequence of an engineered RNA described here allows the engineered RNA to target an RNA sequence through base pairing, such as Watson Crick base pairing. In some examples, the targeting sequence can be located at either the N-terminus or C-terminus of the engineered RNA. In some cases, the targeting sequence can be located at both termini. The targeting sequence can be of any length. In some cases, the targeting sequence can be at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69,70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or up to about 200 nucleotides in length. In some cases, the targeting sequence can be no greater than about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75,76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117,118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135,136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides in length. In some examples, an engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) of the disclosure comprises a targeting sequence that can be from about 60 to about 500, from about 60 to about 200, from about 75 to about 100, from about 80 to about 200, from about 90 to about 120, or from about 95 to about 115 nucleotides in length. In some examples, an engineered RNA described here comprises a targeting sequence that can be about 100 nucleotides in length.

[0128] In some cases, a targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to a target RNA, of sufficient complementarity to a target RNA tohybridize. In some cases, a targeting sequence comprises less than 100% complementarity to a target RNA sequence and can hybridize in part to the target RNA. For example, a targeting sequence and a region of a target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0129] Some embodiments of the disclosure provide an engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) described here comprising a targeting sequence with complementarity or sufficient complementarity to a target RNA thereby providing partial hybridization or complete hybridization of the targeting sequence and the target RNA that form guide-target RNA scaffold. A “guide-target RNA scaffold,” as disclosed herein, is the resulting double stranded RNA formed upon hybridization of a guide RNA, with latent structure, to a target RNA. A guide-target RNA scaffold has one or more structural features formed within the double stranded RNA duplex upon hybridization. For example, the guidetarget RNA scaffold can have one or more features selected from a bulge, mismatch, internal loop, hairpin, or wobble base pair. Various aspects of the disclosure provide targeting sequences having complete complementarity to a target RNA. In some examples, the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) of the disclosure comprise a targeting sequence that is substantially complementary to a target RNA. Useful targeting sequences of the disclosure can have sufficient complementarity to a target RNA.

[0130] “ Sufficient complementarity” as used here, can mean at least 5 nucleotides (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600); or can mean 600 nucleotides or fewer (e.g., 550, 450, 350, 250, 150, 105, 95, 85, 75, 65, 55, 45, 35, 25, 15, 5) of the engineered RNA are complementary to or has base pairing to a target RNA; can mean 5-600 nucleotides (e.g., 10-550, 15-450, 20-350, 25-250, 30-150, 35-105, 40-95, 45-85, 50-75, 55-65) of the engineered RNA that are complementary to or has base pairing to a target RNA; can mean at least 70% (e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) of the engineered RNA nucleotides are complementary to the target RNA; can mean 100% or less (e.g., 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%,81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%); or can mean 70%-100% (e.g., 71%-99%, 72%-98%, 73%-97%, 74%-96%, 75%-95%, 76%-94%, 77%-93%, 78%-92%, 79%-91%, 80%-90%, 81%-89%, 82%-88%, 83%-87%, 84%-86) of the engineered RNA nucleotides are complementary to the target RNA.

[0131] In some embodiments, a double stranded RNA (dsRNA) substrate is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The resulting dsRNA substrate is also referred to herein as a “guide-target RNA scaffold.” Described herein are “structural features” that can be present in a guide-target RNA scaffold of the present disclosure. Examples of structural features include a mismatch, a bulge (symmetrical bulge or asymmetrical bulge), an internal loop (symmetrical internal loop or asymmetrical internal loop), or a hairpin (a recruiting hairpin or a non-recruiting hairpin, such as the snRNA processing hairpin RNA sequences of the present disclosure). Engineered guide RNAs of the present disclosure can have from 1 to 50 features. Engineered guide RNAs of the present disclosure can have from 1 to 5, from 5 to 10, from 10 to 15, from 15 to 20, from 20 to 25, from 25 to 30, from 30 to 35, from 35 to 40, from 40 to 45, from 45 to 50, from 5 to 20, from 1 to 3, from 4 to 5, from 2 to 10, from 20 to 40, from 10 to 40, from 20 to 50, from 30 to 50, from 4 to 7, or from 8 to 10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed from latent structure in an engineered latent guide RNA upon hybridization of the engineered latent guide RNA to a target RNA and, thus, formation of a guide-target RNA scaffold. The term “engineered latent guide RNA” refers to an engineered guide RNA that comprises a portion of sequence that, upon hybridization or only upon hybridization to a target RNA, substantially forms at least a portion of a structural feature, other than a single A / C mismatch feature at the target adenosine to be edited. In some embodiments, structural features are not formed from latent structure and are, instead, pre-formed structures (e.g., a GluR2 recruitment hairpin).

[0132] In some embodiments, upon hybridization of the described engineered RNAs (e.g., engineered guide RNA, antisense oligonucleotide) and the described target RNAs, or at least a portion thereof such as the targeting sequence described here, can have one or more structural features (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25); 50 or fewer structural features (e.g., 49, 48, 47, 46, 45, 40, 35, 30, 25, 20, 15, 10, 5, 1); or from 1-50 structural features (e.g., 2-49; 3-48; 4-47; 5-46; 6-45; 7-44; 8-43; 9-42; 10-41; 11-40; 12-39; 13-38; 14-37; 15-36; 16-35; 17-34; 18-33; 19-32; 20-31; 21-30; 22-29; 23-28; 24-27; 25-26; 1-5; 10-15; 15-20; 20-25; 25-30; 30-35; 35-40; 40-45; 45-50; 5-20; 1-3; 4-5; 2-10; 20-40; 10-40; 20-50; 30-50; 4-7; 8-10), where the one or more structural features is selected from the group consisting of: a bulge, a mismatch, an internal loop, a hairpin, a wobble base pair, and any of combinations thereof.

[0133] In some embodiments, the targeting sequence described here can be formed or configured to have at least one mismatched nucleotide when hybridized to a target RNA. In some examples, a structural feature of the guide-target RNA scaffold formed upon hybridization of the engineered RNA and the target RNA of the disclosure, where the structural feature can comprise a wobble base pair, where the wobble base pair refers to two bases that weakly pair. For example, a wobble base pair of the present disclosure may refer to a G paired with a U.

[0134] Some examples of the disclosure provide the described engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) comprising a targeting sequence that where, upon hybridization of the targeting sequence to the target RNA, at least one mismatch forms, and the at least one mismatch comprises at least one adenosine-guanosine (A-G) mismatch, at least one adenosine-adenosine (A-A) mismatch, or at least one adenosinecytidine (A-C), and where the adenosine (A) in the mismatch can be present in the target RNA. In examples of the disclosure, the engineered RNA described can have at least one mismatch comprising an A-C mismatch, where the adenosine in the mismatch can be present in the target RNA. Some embodiments provide for at least one mismatch that can be located from about 1 base to about 200 bases from either end of the targeting sequence.

[0135] As disclosed herein, engineered RNAs of the present disclosure, that can be operably linked to a snRNA processing RNA hairpin sequence of the present disclosure, can be antisense oligonucleotides (also referred to as ASOs) comprising short, chemically modified or synthesized single-stranded nucleotides. Some examples are directed to an engineered RNA that can be an antisense oligonucleotide substantially complementary to a target RNA. ASOs are chemically modified or synthesized DNA or RNA that can be substantially or fully complementary to a target sequence and designed or configured to inhibit, cover, mask, or block a target sequence. ASOs can be chemically modified to avoid degradation in view of their short length. ASOs can be DNA or RNA, but the DNA does not encode for the RNA. In some embodiments of the disclosure, the antisense oligonucleotides that are delivered can be RNA itself or DNA encoding for the RNA. Described herein are engineered RNA antisense oligonucleotides modified or altered from RNA found in nature that can modulate or alter RNA interactions, processing, expression, or combinations thereof. In some instances, an ASO designed or configured to inhibit, cover, mask, or block a target sequence of a target RNA promotes exon skipping of an exon in the target sequence. Methods have been used to induce exon skipping of a protein coding transcript. In many cases, a number of proteins suchas alpha-synuclein and DMD can be expressed as different splice variants, some of which can be implicated in disease. It is thought that by promoting exon skipping events, exons containing a mutation implicated in a disease can be bypassed, or a codon reading frame can be restored, thereby facilitating the translation of variants that are sufficient to correct a disease or disorder, or alleviate symptoms of a disease or disorder.

[0136] As disclosed herein, an engineered guide RNA of the present disclosure that can be operably linked to a snRNA processing RNA hairpin sequence of the present disclosure can be utilized for editing of a base of a nucleotide of a target RNA. The engineered guide RNAs described comprise a targeting sequence with sufficient complementarity to a target RNA operably linked to an engineered Sm or Sm-like protein binding domain sequence (e.g., an engineered SmOPT sequence) and a snRNA processing hairpin RNA sequence of the present disclosureB. Engineered Guide RNAs Having a Recruiting Domain

[0137] In some examples, a subject engineered guide RNA comprises a recruiting domain that recruits an RNA editing entity (e.g., ADAR), where in some instances, the recruiting domain is formed and present in the absence of binding to the target RNA. A “recruiting domain” can be referred to herein as a “recruiting sequence” or a “recruiting region”. In some examples, a subject engineered guide can facilitate editing of a base of a nucleotide in a target sequence of a target RNA that results in modulating the expression of a polypeptide encoded by the target RNA. Said modulation can be increased expression of the polypeptide or decreased expression of the polypeptide. In some cases, an engineered guide can be configured to facilitate an editing of a base of a nucleotide or polynucleotide of a region of an RNA by an RNA editing entity (e.g., ADAR). In order to facilitate editing, an engineered guide RNA of the disclosure can recruit an RNA editing entity (e.g., ADAR). Various RNA editing entity recruiting domains can be utilized. In some examples, a recruiting domain comprises: Glutamate ionotropic receptor AMPA type subunit 2 (GluR2), an Alu sequence, or, in the case of recruiting APOB EC, an APOB EC recruiting domain.

[0138] In some examples, more than one recruiting domain can be included in an engineered guide of the disclosure. In examples where a recruiting domain can be present, the recruiting domain can be utilized to position the RNA editing entity to effectively react with a subject target RNA after the targeting sequence hybridizes to a target sequence of a target RNA (e.g., SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, or SEQ ID NO: 112 - SEQ ID NO: 117). In some cases, arecruiting domain can allow for transient binding of the RNA editing entity to the engineered guide. In some examples, the recruiting domain allows for permanent binding of the RNA editing entity to the engineered guide. A recruiting domain can be of any length. In some cases, a recruiting domain can be from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,67, 68, 69, 70, 71, 72, 73, 74, 75, up to about 80 nucleotides in length. In some cases, a recruiting domain can be no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,67, 68, 69, 70, 71, 72, 73, 74, 75, or 80 nucleotides in length. In some cases, a recruiting domain can be about 45 nucleotides in length. In some cases, at least a portion of a recruiting domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of a recruiting domain comprises about 45 nucleotides to about 60 nucleotides.

[0139] In some embodiments, a recruiting domain comprises a GluR2 sequence or functional fragment thereof. In some cases, a GluR2 sequence can be recognized by an RNA editing entity, such as an ADAR or biologically active fragment thereof. In some embodiments, a GluR2 sequence can be a non-naturally occurring sequence. In some cases, a GluR2 sequence can be modified, for example for enhanced recruitment. In some embodiments, a GluR2 sequence can comprise a portion of a naturally occurring GluR2 sequence and a synthetic sequence.

[0140] In some examples, a recruiting domain comprises a GluR2 sequence, or a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity and / or length to: GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 8). In some cases, a recruiting domain can comprise at least about 80% sequence identity to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 8. In some examples, a recruiting domain can comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence identity and / or length to SEQ ID NO: 8.

[0141] Additional RNA editing entity recruiting domains are also contemplated. In an embodiment, a recruiting domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) domain. In some cases, an APOBEC domain can comprise a non-naturally occurring sequence or naturally occurring sequence. In some embodiments, an APOBEC-domain-encoding sequence can comprise a modified portion. Insome cases, an APOBEC-domain-encoding sequence can comprise a portion of a naturally occurring APOBEC-domain-encoding-sequence. In another embodiment, a recruiting domain can be from an Alu domain.

[0142] Any number of recruiting domains can be found in an engineered guide of the present disclosure. In some examples, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruiting domains can be included in an engineered guide. Recruiting domains can be located at any position of engineered guide RNAs. In some cases, a recruiting domain can be on an N-terminus, middle, or C-terminus of an engineered guide RNA. A recruiting domain can be upstream or downstream of a targeting sequence. In some cases, a recruiting domain flanks a targeting sequence of a subject guide. A recruiting sequence can comprise all ribonucleotides or deoxyribonucleotides, although a recruiting domain comprising both ribo- and deoxyribonucleotides can in some cases not be excluded.C. Engineered Guide RNAs with Latent Structure

[0143] In some examples, an engineered guide disclosed herein useful for facilitating editing of a target RNA by an RNA editing entity can be an engineered latent guide RNA. An “engineered latent guide RNA” refers to an engineered guide RNA that comprises latent structure. “Latent structure” refers to a structural feature that substantially forms upon hybridization of a guide RNA to a target RNA. For example, the sequence of a guide RNA provides one or more structural features, but these structural features substantially form only upon hybridization to the target RNA, and thus the one or more latent structural features manifest as structural features upon hybridization to the target RNA. Upon hybridization of the guide RNA to the target RNA, the structural feature is formed and the latent structure provided in the guide RNA is, thus, unmasked.

[0144] A double stranded RNA (dsRNA) substrate is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA (for example, SNCA Codon 1 TIS of Exon 2). The resulting dsRNA substrate is also referred to herein as a “guide-target RNA scaffold.”

[0145] FIG. 1 shows a legend of various exemplary structural features present in guidetarget RNA scaffolds formed upon hybridization of a latent guide RNA of the present disclosure to a target RNA. Example structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guideRNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (24 nucleotides on the target RNA side base paired to 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Unless otherwise noted, the number of participating nucleotides in a given structural feature is indicated as the nucleotides on the target RNA side over nucleotides on the guide RNA side. Also shown in this legend is a key to the positional annotation of each figure. For example, the target nucleotide to be edited is designated as the 0 position. Downstream (3’) of the target nucleotide to be edited, each nucleotide is counted in increments of +1. Upstream (5’) of the target nucleotide to be edited, each nucleotide is counted in increments of -1. Thus, the example 2 / 2 symmetric bulge in this legend is at the +12 to +13 position in the guide-target RNA scaffold. Similarly, the 2 / 3 asymmetric bulge in this legend is at the -36 to-37 position in the guide-target RNA scaffold. As used herein, positional annotation is provided with respect to the target nucleotide to be edited and on the target RNA side of the guide-target RNA scaffold. As used herein, if a single position is annotated, the structural feature extends from that position away from position 0 (target nucleotide to be edited). For example, if a latent guide RNA is annotated herein as forming a 2 / 3 asymmetric bulge at position -36, then the 2 / 3 asymmetric bulge forms from -36 position to the -37 position with respect to the target nucleotide to be edited (position 0) on the target RNA side of the guide-target RNA scaffold. As another example, if a latent guide RNA is annotated herein as forming a 2 / 2 symmetric bulge at position +12, then the 2 / 2 symmetric bulge forms from the +12 to the +13 position with respect to the target nucleotide to be edited (position 0) on the target RNA side of the guide-target RNA scaffold.

[0146] In some examples, the engineered guides disclosed herein lack a recruiting region and recruitment of the RNA editing entity can be effectuated by structural features of the guide-target RNA scaffold formed by hybridization of the engineered guide RNA and the target RNA. In some examples, the engineered guide, when present in an aqueous solution and not bound to the target RNA molecule, does not comprise structural features that recruit the RNA editing entity (e.g., ADAR). The engineered guide RNA, upon hybridization to a target RNA, form with the target RNA molecule, one or more structural features that recruits an RNA editing entity (e.g., ADAR).

[0147] In cases where a recruiting sequence can be absent, an engineered guide RNA can be still capable of associating with a subject RNA editing entity (e.g., ADAR) to facilitateediting of a target RNA and / or modulate expression of a polypeptide encoded by a subject target RNA. This can be achieved through structural features formed in the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA and the target RNA. Structural features can comprise any one of a: mismatch, symmetrical bulge, asymmetrical bulge, symmetrical internal loop, asymmetrical internal loop, hairpins, wobble base pairs, or any combination thereof.

[0148] Described herein are structural features which can be present in a guide-target RNA scaffold of the present disclosure. Examples of features include a mismatch, a bulge (symmetrical bulge or asymmetrical bulge), an internal loop (symmetrical internal loop or asymmetrical internal loop), or a hairpin (a recruiting hairpin or a non-recruiting hairpin). Engineered guide RNAs of the present disclosure can have from 1 to 50 features. Engineered guide RNAs of the present disclosure can have from 1 to 5, from 5 to 10, from 10 to 15, from 15 to 20, from 20 to 25, from 25 to 30, from 30 to 35, from 35 to 40, from 40 to 45, from 45 to 50, from 5 to 20, from 1 to 3, from 4 to 5, from 2 to 10, from 20 to 40, from 10 to 40, from 20 to 50, from 30 to 50, from 4 to 7, or from 8 to 10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed from latent structure in an engineered latent guide RNA upon hybridization of the engineered latent guide RNA to a target RNA and, thus, formation of a guide-target RNA scaffold. In some embodiments, structural features are not formed from latent structures and are, instead, preformed structures (e.g., a GluR2 recruitment hairpin or a hairpin from U7 snRNA).

[0149] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a mismatch refers to a single nucleotide in a guide RNA that is unpaired to an opposing single nucleotide in a target RNA within the guide-target RNA scaffold. A mismatch can comprise any two single nucleotides that do not base pair. Where the number of participating nucleotides on the guide RNA side and the target RNA side exceeds 1, the resulting structure is no longer considered a mismatch, but rather, is considered a bulge or an internal loop, depending on the size of the structural feature. In some embodiments, a mismatch is an A / C mismatch. An A / C mismatch can comprise a C in an engineered guide RNA of the present disclosure opposite an A in a target RNA. An A / C mismatch can comprise an A in an engineered guide RNA of the present disclosure opposite a C in a target RNA. A G / G mismatch can comprise a G in an engineered guide RNA of the present disclosure opposite a G in a target RNA.

[0150] In some embodiments, a mismatch positioned 5’ of the edit site can facilitate baseflipping of the target A to be edited. A mismatch can also help confer sequence specificity. Thus, a mismatch can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0151] In another aspect, a structural feature comprises a wobble base. A wobble base pair refers to two bases that weakly base pair. For example, a wobble base pair of the present disclosure can refer to a G paired with a U. Thus, a wobble base pair can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0152] In some cases, a structural feature can be a hairpin. As disclosed herein, a hairpin includes an RNA duplex wherein a portion of a single RNA strand has folded in upon itself to form the RNA duplex. The portion of the single RNA strand folds upon itself due to having nucleotide sequences that base pair to each other, where the nucleotide sequences are separated by an intervening sequence that does not base pair with itself, thus forming a basepaired portion and non-base paired, intervening loop portion. A hairpin can have from 10 to 500 nucleotides in length of the entire duplex structure. The loop portion of a hairpin can be from 3 to 15 nucleotides long. A hairpin can be present in any of the engineered guide RNAs disclosed herein. The engineered guide RNAs disclosed herein can have from 1 to 10 hairpins. In some embodiments, the engineered guide RNAs disclosed herein have 1 hairpin. In some embodiments, the engineered guide RNAs disclosed herein have 2 hairpins. As disclosed herein, a hairpin can include a recruitment hairpin or a non-recruitment hairpin. A hairpin can be located anywhere within the engineered guide RNAs of the present disclosure. In some embodiments, one or more hairpins is proximal to or present at the 3’ end of an engineered guide RNA of the present disclosure, proximal to or at the 5’ end of an engineered guide RNA of the present disclosure, proximal to or within the targeting domain (e.g., the targeting sequence) of the engineered guide RNAs of the present disclosure, or any combination thereof.

[0153] A recruitment hairpin, as disclosed herein, can recruit at least in part an RNA editing entity, such as ADAR. In some cases, a recruitment hairpin can be formed and present in the absence of binding to a target RNA. In some embodiments, a recruitment hairpin is a GluR2 domain or portion thereof. In some embodiments, a recruitment hairpin is an Alu domain or portion thereof. A recruitment hairpin, as defined herein, can include a naturally occurring ADAR substrate or truncations thereof. Thus, a recruitment hairpin such as GluR2 is a preformed structural feature that may be present in constructs comprising an engineered guideRNA, not a structural feature formed by latent structure provided in an engineered latent guide RNA.

[0154] In some aspects, a structural feature comprises a non-recruitment hairpin. A nonrecruitment hairpin, as disclosed herein, does not have a primary function of recruiting an RNA editing entity. A non-recruitment hairpin, in some instances, does not recruit an RNA editing entity. In some instances, a non-recruitment hairpin has a dissociation constant for binding to an RNA editing entity under physiological conditions that is insufficient for binding. For example, a non-recruitment hairpin has a dissociation constant for binding an RNA editing entity at 25 °C that is greater than about 1 mM, 10 mM, 100 mM, or 1 M, as determined in an in vitro assay. A non-recruitment hairpin can exhibit functionality that improves localization of the engineered guide RNA to the target RNA. In some embodiments, the non-recruitment hairpin improves nuclear retention. In some embodiments, the non-recruitment hairpin comprises a hairpin from U7 snRNA. Thus, a non-recruitment hairpin such as a hairpin from U7 snRNA is a pre-formed structural feature that can be present in constructs comprising engineered guide RNA constructs, not a structural feature formed by latent structure provided in an engineered latent guide RNA.

[0155] A hairpin of the present disclosure can be of any length. In an aspect, a hairpin can be from about 10-500 or more nucleotides. In some cases, a hairpin can comprise about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82,83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104,105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122,123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140,141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158,159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176,177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194,195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212,213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230,231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248,249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266,267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284,285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302,303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320,321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338,339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356,357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374,375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392,393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410,411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428,429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446,447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464,465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482,483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500 or more nucleotides. In other cases, a hairpin can also comprise 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 10 to 110, 10 to 120, 10 to 130, 10 to 140, 10 to 150, 10 to 160, 10 to 170, 10 to 180, 10 to 190, 10 to 200, 10 to 210, 10 to 220, 10 to 230, 10 to 240, 10 to 250, 10 to 260, 10 to 270, 10 to 280, 10 to 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to 370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to 460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.

[0156] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a bulge refers to the structure substantially formed only upon formation of the guide-target RNA scaffold, where contiguous nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand. A bulge can change the secondary or tertiary structure of the guide-target RNA scaffold. A bulge can independently have from 0 to 4 contiguous nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the target RNA side of the guide-target RNA scaffold or a bulge can independently have from 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the guide RNA side of the guide-target RNA scaffold. However, a bulge, as used herein, does not refer to a structure where a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA do not base pair - a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA that do not base pair isreferred to herein as a mismatch. Further, where the number of participating nucleotides on either the guide RNA side or the target RNA side exceeds 4, the resulting structure is no longer considered a bulge, but rather, is considered an internal loop. In some embodiments, the guide-target RNA scaffold of the present disclosure has 2 bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has 3 bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has 4 bulges. Thus, a bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0157] In some embodiments, the presence of a bulge in a guide-target RNA scaffold can position or can help to position ADAR to selectively edit the target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some embodiments, the presence of a bulge in a guide-target RNA scaffold can recruit or help recruit additional amounts of ADAR. Bulges in guide-target RNA scaffolds disclosed herein can recruit other proteins, such as other RNA editing entities. In some embodiments, a bulge positioned 5’ of the edit site can facilitate base-flipping of the target A to be edited. A bulge can also help confer sequence specificity for the A of the target RNA to be edited, relative to other A(s) present in the target RNA. For example, a bulge can help direct ADAR editing by constraining it in an orientation that yields selective editing of the target A.

[0158] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. A bulge can be a symmetrical bulge or an asymmetrical bulge. A bulge can be a symmetrical bulge or an asymmetrical bulge. A symmetrical bulge is formed when the same number of nucleotides is present on each side of the bulge. For example, a symmetrical bulge in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold target and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetrical bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0159] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. An asymmetrical bulge is formed when a different number of nucleotides is present on each side of the bulge. For example, an asymmetrical bulge in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guidetarget RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guidetarget RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNAscaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guidetarget RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 3 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetrical bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0160] In some embodiments, an asymmetric bulge can be a 1 / 0 asymmetric bulge. In some embodiments, a 1 / 0 asymmetric bulge can be a U deletion. A “U deletion” refers to a 1 / 0 asymmetric bulge in which a U nucleotide of an engineered guide RNA that would be situated opposite a non-target A of a target RNA in the guide-target RNA scaffold is deleted from the engineered guide RNA. In some instances, a 1 / 0 asymmetric bulge comprising a U deletion can reduce editing of the non-target A, relative to a comparable guide RNA lacking the U deletion.

[0161] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a targetRNA. In some cases, a structural feature can be an internal loop. As disclosed herein, an internal loop refers to the structure substantially formed only upon formation of the guidetarget RNA scaffold, where nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand and where one side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, has 5 nucleotides or more. Where the number of participating nucleotides on both the guide RNA side and the target RNA side drops below 5, the resulting structure is no longer considered an internal loop, but rather, is considered a bulge or a mismatch, depending on the size of the structural feature. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. Internal loops present in the vicinity of the edit site can help with base flipping of the target A in the target RNA to be edited.

[0162] One side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, can be formed by from 5 to 150 nucleotides. One side of the internal loop can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides, or any number of nucleotides there between. One side of the internal loop can be formed by 5 nucleotides. One side of the internal loop can be formed by 10 nucleotides. One side of the internal loop can be formed by 15 nucleotides. One side of the internal loop can be formed by 20 nucleotides. One side of the internal loop can be formed by 25 nucleotides. One side of the internal loop can be formed by 30 nucleotides. One side of the internal loop can be formed by 35 nucleotides. One side of the internal loop can be formed by 40 nucleotides. One side of the internal loop can be formed by 45 nucleotides. One side of the internal loop can be formed by 50 nucleotides. One side of the internal loop can be formed by 55 nucleotides. One side of the internal loop can be formed by 60 nucleotides. One side of the internal loop can be formed by 65 nucleotides. One side of the internal loop can be formed by 70 nucleotides. One side of the internal loop can be formed by 75 nucleotides. One side of the internal loop can be formed by 80 nucleotides. One side of the internal loop can be formed by 85 nucleotides. One side of the internal loop can be formed by 90 nucleotides. One side of the internal loop can be formed by 95 nucleotides.One side of the internal loop can be formed by 100 nucleotides. One side of the internal loop can be formed by 110 nucleotides. One side of the internal loop can be formed by 120nucleotides. One side of the internal loop can be formed by 130 nucleotides. One side of the internal loop can be formed by 140 nucleotides. One side of the internal loop can be formed by 150 nucleotides. One side of the internal loop can be formed by 200 nucleotides. One side of the internal loop can be formed by 250 nucleotides. One side of the internal loop can be formed by 300 nucleotides. One side of the internal loop can be formed by 350 nucleotides. One side of the internal loop can be formed by 400 nucleotides. One side of the internal loop can be formed by 450 nucleotides. One side of the internal loop can be formed by 500 nucleotides. One side of the internal loop can be formed by 600 nucleotides. One side of the internal loop can be formed by 700 nucleotides. One side of the internal loop can be formed by 800 nucleotides. One side of the internal loop can be formed by 900 nucleotides. One side of the internal loop can be formed by 1000 nucleotides. Thus, an internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0163] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. A symmetrical internal loop is formed when the same number of nucleotides is present on each side of the internal loop. For example, a symmetrical internal loop in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold target and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. Asymmetrical internal loop of the present disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 15 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 15 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 20 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 20 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 30 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 30 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 40 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 40 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 60 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 60 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 70 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 70 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 80 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 80 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 90 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 100 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 110 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 120 nucleotides on theengineered polynucleotide side of the guide-target RNA scaffold target and 120 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 130 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 130 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 140 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 140 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 200 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 250 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 250 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 300 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 350 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 350 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 400 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 450 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 500 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 600 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 600 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 700 nucleotides on the engineered polynucleotide side of theguide-target RNA scaffold target and 700 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 800 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 800 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 900 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 900 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 1000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetrical internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0164] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. An asymmetrical internal loop is formed when a different number of nucleotides is present on each side of the internal loop. For example, an asymmetrical internal loop in a guidetarget RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.

[0165] An asymmetrical internal loop of the present disclosure can be formed by from 5 to 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and from 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides is the different on the engineered side of the guide-target RNA scaffold target than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by from 5 to 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and from 5 to 1000 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides is the different on the engineered side of the guide-target RNA scaffold target than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guideRNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 7 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on theengineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guidetarget RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-targetRNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formedby 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineeredguide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetrical internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0166] As disclosed herein, a “base paired (bp) region” refers to a region of the guide-target RNA scaffold in which bases in the guide RNA are paired with opposing bases in the target RNA. Base paired regions can extend from one end or proximal to one end of the guidetarget RNA scaffold to or proximal to the other end of the guide-target RNA scaffold. Base paired regions can extend between two structural features. Base paired regions can extend from one end or proximal to one end of the guide-target RNA scaffold to or proximal to a structural feature. Base paired regions can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, a base paired region has from 1 bp to 100 bp, from 1 bp to 90 bp, from 1 bp to 80 bp, from 1 bp to 70 bp, from 1 bp to 60 bp, from 1 bp to 50 bp, from 1 bp to 45 bp, from 1 bp to 40 bp, from 1 bp to 35 bp, from 1 bp to 30 bp, from 1 bp to 25 bp, from 1 bp to 20 bp, from 1 bp to 15 bp, from 1 bp to 10 bp, from 1 bp to 5 bp, from 5 bp to 10 bp, from 5 bp to 20 bp, from 10 bp to 20 bp, from 10 bp to 50 bp, from 5 bp to 50 bp, at least 1 bp, at least 2 bp, at least 3 bp, at least 4 bp, at least 5 bp, at least 6 bp, at least 7 bp, at least 8 bp, at least 9 bp, at least 10 bp, at least 12 bp, at least 14 bp, at least 16 bp, at least 18 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 60 bp, at least 70 bp, at least 80 bp, at least 90 bp, at least 100 bp.

[0167] The present disclosure provides engineered guide RNAs (SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, or SEQ ID NO: 112 - SEQ ID NO: 117) that target a sequence of an SNCA target RNA (for example, the SNCA Codon 1 TIS of Exon 2). The present disclosure also provides engineered guide RNAs (SEQ ID NO: 147 - SEQ ID NO: 148) that target a sequence of an SNCA target RNA (for example, the SNCA TIS pre-mRNA).

[0168] In some embodiments, an engineered guide RNA of the present disclosure that targets the SNCA Codon 1 TIS in Exon 2 comprises one or more structural features when hybridized to a target RNA. In some embodiments, an engineered guide RNA of the present disclosure that targets the SNCA Codon 1 TIS in Exon 2 comprises one or more structural features when hybridized to a target RNA. In some embodiments, an engineered guide RNA of the present disclosure that targets the SNCA TIS pre-mRNA comprises one or more structural features when hybridized to a target RNA.

[0169] In some embodiments, a first 6 / 6 symmetric internal loop is at position -6, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1mismatch at position 0 relative to the target adenosine at position 0, a 2-2 symmetric bulge at position 5 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 26 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 41.

[0170] In some embodiments, a first 6 / 6 symmetric internal loop is at position -8, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 wobble base pair at position 2 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 40.

[0171] In some embodiments, a first 8 / 8 symmetric internal loop is at position -4, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 wobble base pair at position 2 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 33 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 50.

[0172] In some embodiments, a first 6 / 6 symmetric internal loop is at position -8, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-0 asymmetric bulge at position -4 relative to the target adenosine at position 0, a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 wobble base pair at position 2 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 51.

[0173] In some embodiments, a first 6 / 6 symmetric internal loop is at position -10, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 0-1asymmetric bulge at position -6 relative to the target adenosine at position 0, a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 mismatch at position 4 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 52.

[0174] In some embodiments, a first 6 / 6 symmetric internal loop is at position -10, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 3-3 symmetric bulge at position -4 relative to the target adenosine at position 0, a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 mismatch at position 4 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 53.

[0175] In some embodiments, a first 6 / 6 symmetric internal loop is at position -8, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 wobble base pair at position 2 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 112.

[0176] In some embodiments, a first 6 / 6 symmetric internal loop is at position -10, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 0-1 asymmetric bulge at position -6 relative to the target adenosine at position 0, a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 mismatch at position 4 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 113.

[0177] In some embodiments, a first 6 / 6 symmetric internal loop is at position -18, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of a 3-3 symmetric bulge at position -6 relative to the target adenosine at position 0, a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 mismatch at position 6 relative to the target adenosine at position 0, a 1-1 mismatch at position 10 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 30 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 114

[0178] In some embodiments, a first 6 / 6 symmetric internal loop is at position -6, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 2-2 symmetric bulge at position 5 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 33 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 115.

[0179] In some embodiments, a first 6 / 6 symmetric internal loop is at position -6, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 mismatch at position 13 relative to the target adenosine at position 0, a 1-1 mismatch at position 15 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 32 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 116.

[0180] In some embodiments, a first 6 / 6 symmetric internal loop is at position -6, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 wobble base pair at position 2 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 33 relative to the target adenosine at position 0, and any combination thereof. Insome embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 117.

[0181] In some embodiments, a first 8 / 8 symmetric internal loop is at position -4, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 wobble base pair at position 2 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 33 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 67.

[0182] In some embodiments, a first 6 / 6 symmetric internal loop is at position -8, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 wobble base pair at position 2 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 28 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 70.

[0183] In some embodiments, a first 6 / 6 symmetric internal loop is at position -8, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 mismatch at position 13 relative to the target adenosine at position 0, a 1-1 mismatch at position 15 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 32 relative to the target adenosine at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 147.

[0184] In some embodiments, a first 8 / 8 symmetric internal loop is at position -4, relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprises at least one structural feature selected from the group consisting of: a 1-1 mismatch at position 0 relative to the target adenosine at position 0, a 1-1 wobble base pair at position 2 relative to the target adenosine at position 0, a second 6 / 6 symmetric internal loop at position 33 relative to the target adenosine at position 0, and any combination thereof. Insome embodiments, the engineered guide RNA comprises at least about: 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 148.D. Guides with Macro-Footprints

[0185] Guide RNAs of the present disclosure can further comprise a macro-footprint. In some embodiments, the macro-footprint comprises a barbell macro-footprint. A microfootprint can serve to guide an RNA editing enzyme and direct its activity towards the target adenosine to be edited. A “barbell” as described herein refers to a pair of internal loop latent structures that manifest upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is positioned towards the 5' end or the 3' end of the guidetarget RNA scaffold formed upon hybridization of the guide RNA and the target RNA. In some embodiments, each internal loop flanks opposing sides of the micro-footprint sequence. Insertion of a barbell macro-footprint sequence flanking opposing sides of the micro-footprint sequence, upon hybridization of the guide RNA to the target RNA, results in formation of barbell internal loops on opposing sides of the micro-footprint. In some cases, barbell internal loops can comprise at least one structural feature that facilitates editing of a specific target RNA.

[0186] As described herein, a “micro-footprint” sequence refers to a sequence with latent structures that, when manifested, facilitate editing of the adenosine of a target RNA via an adenosine deaminase enzyme. A macro-footprint can serve to guide an or focus RNA editing entity (e.g., ADAR) and direct its activity towards a micro-footprint. In some embodiments, included within the micro-footprint sequence is a nucleotide that is positioned such that, when the guide RNA is hybridized to the target RNA, said nucleotide is opposite the adenosine to be edited by the ADAR enzyme and does not base pair with the adenosine to be edited. This nucleotide is referred to herein as the “mismatched position” or “mismatch” and can be a cytosine. Micro-footprint sequences as described herein have upon hybridization of the engineered guide RNA and target RNA, at least one structural feature selected from the group consisting of: a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof. Engineered guide RNAs with superior micro-footprint sequences can be selected based on their ability to facilitate editing of a specific target RNA. Engineered guide RNAsselected for their ability to facilitate editing of a specific target are capable of adopting various micro-footprint latent structures, which can vary on a target-by-target basis.

[0187] As disclosed herein, a “macro-footprint” sequence can be positioned such that it flanks a micro-footprint sequence. Further, while a macro-footprint sequence can flank a micro-footprint sequence, additional latent structures can be incorporated that flank either end of the macro-footprint as well. In some embodiments, such additional latent structures are included as part of the macro-footprint. In some embodiments, such additional latent structures are separate, distinct, or both separate and distinct from the macro-footprint.

[0188] In some embodiments, the presence of barbells flanking the micro-footprint can improve one or more aspects of editing. For example, the presence of a barbell macrofootprint in addition to a micro-footprint can result in a higher amount of on-target adenosine editing, relative to an otherwise comparable guide RNA lacking the barbells. Additionally, and or alternatively, the presence of a barbell macro-footprint in addition to a micro-footprint can result in a lower amount of local off-target adenosine editing, relative to an otherwise comparable guide RNA lacking the barbells. Further, while the effect of various microfootprint structural features can vary on a target-by-target basis based on selection in a high throughput screen, the increase in the one or more aspects of editing provided by the barbell macro-footprint structures can be independent of the particular target RNA. For example, macro-footprints (e.g., barbell macro-footprints) and micro-footprints can provide an increased amount of on-target adenosine editing relative to an otherwise comparable guide RNA lacking the barbells. In other embodiments, the presence of the barbell macro-footprint in addition to the micro-footprint described here can result in a lower amount of local off- target adenosine editing, relative to an otherwise comparable guide RNA, upon hybridization of the guide RNA and target RNA to form a guide-target RNA scaffold lacking the barbells.

[0189] A dumbbell design in an engineered guide RNA comprises two symmetrical internal loops, wherein the target A to be edited is positioned between the two symmetrical loops for selective editing of the target A. The two symmetrical internal loops are each formed by 6 nucleotides on the guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a dumbbell can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0190] In some embodiments, the first internal loop of the barbell or the second internal loop of the barbell is positioned at least about 5 bases (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) away from the A / C mismatch with respect to the base of the first internal loop or the second internal loop that is the most proximal to the A / C mismatch. In some embodiments, the first internal loop of the barbell or the second internal loop of the barbell is positioned at most about 50 bases away from the A / C mismatch (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5) with respect to the base of the first internal loop or the second internal loop that is the most proximal to the A / C mismatch.

[0191] In some embodiments, a first internal loop or a second internal loop independently comprises a number of bases of at least about 5 bases or greater (e.g., 6, 7, 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or fewer (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15,14, 13, 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5- 150, 6-145, 7-140, 8-135, 9-130, 10-125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17- 90, 18-85, 19-80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-50) of the engineered guide RNA and a number of bases of at least about 5 bases or greater (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or fewer (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10-125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19-80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-50) of the target RNA.

[0192] In some embodiments, provided herein are engineered guide RNAs comprising a barbell macro-footprint. In some embodiments, provided herein are engineered guide RNAs comprising a micro-footprint. In some embodiments, provided herein are engineered guide RNAs comprising a macro-footprint and a micro-footprint. In some cases, an engineered guide RNA disclosed herein can comprise a micro-footprint in the absence of a macrofootprint. In some cases, an engineered guide RNA disclosed herein can comprise a macrofootprint in the absence of a micro-footprint.

[0193] In some embodiments, a macro-footprint sequence can comprise a barbell macrofootprint sequence comprising latent structures that, when manifested, produce a first internal loop and a second internal loop.

[0194] In some examples, a first internal loop is positioned near the 5' end of the guidetarget RNA scaffold and a second internal loop is positioned near the 3' end of the guide-target RNA scaffold. The length of the dsRNA comprises a 5' end and a 3' end, where up to half of the length of the guide-target RNA scaffold at the 5' end can be considered to be “near the 5' end” while up to half of the length of the guide-target RNA scaffold at the 3' end can be considered “near the 3' end.” Non-limiting examples of the 5' end can include about 50% or less of the total length of the dsRNA at the 5' end, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, or about 5%. Non-limiting examples of the 3' end can include about 50% or less of the total length of the dsRNA at the 3' end about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, or about 5%.

[0195] In some embodiments, the engineered guide RNAs of the disclosure comprising a barbell macro-footprint sequence (that manifests as a first internal loop and a second internal loop) can improve RNA editing efficiency, increase the amount or percentage of RNA editing generally, as well as for on-target nucleotide editing, such as on-target adenosine. In some embodiments, the engineered guide RNAs of the disclosure comprising a first internal loop and a second internal loop can also facilitate a decrease in the amount of or reduce off-target nucleotide editing, such as off-target adenosine or unintended adenosine editing. The decrease or reduction in some examples can be of the number of off-target edits or the percentage of off-target edits.

[0196] Each of the first and second internal loops of the barbell macro-footprint can independently be symmetrical or asymmetrical, where symmetry is determined by the number of bases or nucleotides of the engineered guide RNA and the number of bases or nucleotides of the target RNA, that together form each of the first and second internal loops.E. Engineered Polynucleotides Encoding Engineered Guide RNAs

[0197] An engineered polynucleotide as described herein can comprise one or more polynucleotide sequence(s) that encode one or more engineered guide RNA(s). For example, an engineered polynucleotide can comprise 1, 2, 3, 4, or more than 4 polynucleotide sequence(s) that encode 1, 2, 3, 4, or more than 4 engineered guide RNAs.

[0198] In some instances, the engineered polynucleotide can comprise one or more polynucleotide sequence(s) encoding one or more engineered guide RNA(s) that independently hybridize to (target): (1) different target sequences of the same target RNA, or (2) different target sequences of different target RNAs. For example, a first engineered guide RNA encoded by a first polynucleotide sequence can hybridize to a target sequence of a first target RNA while a second engineered guide RNA encoded by a secondpolynucleotide sequence can hybridize to a target sequence of a second target RNA, in some instances resulting in ADAR-mediated editing of an adenosine in the target sequence of the first target RNA and an adenosine in the target sequence of the second target RNA.

[0199] In some instances, the engineered polynucleotide can comprise one or more polynucleotide sequence(s) encoding one or more engineered guide RNA(s) that independently hybridize to (target) the same target sequence of a target RNA. For example, the one or more engineered guide RNA(s) encoded by the one or more polynucleotide sequence(s) can each independently hybridize to a target sequence of a target RNA and / or facilitate editing of the same adenosine in the target sequence of the target RNA via ADAR. In some cases, the one or more engineered guide RNA(s) that hybridize to (target) the same target sequence of a target RNA have identical sequences (i.e., the one or more engineered guide RNAs are copies of each other).

[0200] Alternatively, two or more engineered guide RNA(s) that hybridize to (target) the same target sequence of a target RNA can comprise different sequences. For example, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to: 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some instances, a first engineered guide RNA encoded by an engineered polynucleotide can have at least about 70% to about 99% sequence identity, at least about 60% to about 99% sequence identity, at least about 80% to about 99% sequence identity, at least about 60% to about 70% sequence identity, at least about 70% to about 80% sequence identity, at least about 75% to about 85% sequence identity, at least about 85% to about 99% sequence identity, at least about 85% to about 90% sequence identity, at least about 88% to about 93% sequence identity, at least about 90% to about 95% sequence identity, at least about 92% to about 99% sequence identity, or at least about 95% to about 99% sequence identity to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about60% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 61% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 62% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 63% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 64% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 65% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 66% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 67% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a firstengineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 68% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 69% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 70% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 71% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 72% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 73% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 74% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 75% to a second engineered guide RNA encoded by the engineered polynucleotide, wherethe second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 76% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 77% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 78% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 79% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 80% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 81% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 82% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequenceidentity of less than, greater than, or equal to about 83% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 84% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 85% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 86% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 87%, to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 88% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 89% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 90% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of atarget RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 91% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 92% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 93% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 94% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 95% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 96% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 97% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 98% to a second engineered guide RNAencoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 99% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some embodiments, polynucleotides encoding a first engineered guide RNA, a second engineered guide RNA, or both can be delivered via an AAV. In some instances, the AAV can be formulated in a composition, such as any of the pharmaceutical compositions disclosed herein.F. Additional Engineered Guide RNA Components

[0201] The present disclosure provides for engineered guide RNAs with additional structural features and components. For example, an engineered guide RNA described herein can be circular. In another example, an engineered guide RNA described herein can comprise a U7, an SmOPT sequence, or a combination of both sequences.

[0202] In some cases, an engineered guide RNA can be circularized. In some cases, an engineered guide RNA provided herein can be circularized or in a circular configuration. In some aspects, an at least partially circular guide RNA lacks a 5’ hydroxyl or a 3’ hydroxyl. In some embodiments, a circular engineered guide RNA can comprise a guide RNA comprising a polynucleotide sequence of any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, or SEQ ID NO: 112 - SEQ ID NO: 117 that targets the SNCA Codon 1 TIS of Exon 2. In some embodiments, a circular engineered guide RNA can comprise a guide RNA comprising a polynucleotide sequence of any one of SEQ ID NO: 147 - SEQ ID NO: 148 that targets the SNCA pre-mRNA TIS.

[0203] In some examples, an engineered guide RNA can comprise a backbone comprising a plurality of sugar and phosphate moieties covalently linked together. In some examples, a backbone of an engineered guide RNA can comprise a phosphodiester bond linkage between a first hydroxyl group in a phosphate group on a 5’ carbon of a deoxyribose in DNA or ribose in RNA and a second hydroxyl group on a 3’ carbon of a deoxyribose in DNA or ribose in RNA.

[0204] In some embodiments, a backbone of an engineered guide RNA can lack a 5’ reducing hydroxyl, a 3’ reducing hydroxyl, or both, capable of being exposed to a solvent. Insome embodiments, a backbone of an engineered guide can lack a 5’ reducing hydroxyl, a 3’ reducing hydroxyl, or both, capable of being exposed to nucleases. In some embodiments, a backbone of an engineered guide can lack a 5’ reducing hydroxyl, a 3’ reducing hydroxyl, or both, capable of being exposed to hydrolytic enzymes. In some instances, a backbone of an engineered guide can be represented as a polynucleotide sequence in a circular 2-dimensional format with one nucleotide after the other. In some instances, a backbone of an engineered guide can be represented as a polynucleotide sequence in a looped 2-dimensional format with one nucleotide after the other. In some cases, a 5’ hydroxyl, a 3’ hydroxyl, or both, can be joined through a phosphorus-oxygen bond. In some cases, a 5’ hydroxyl, a 3’ hydroxyl, or both, can be modified into a phosphoester with a phosphorus-containing moiety.

[0205] As described herein, an engineered guide can comprise a circular structure. An engineered polynucleotide can be circularized from a precursor engineered polynucleotide. Such a precursor engineered polynucleotide can be a precursor engineered linear polynucleotide. In some cases, a precursor engineered linear polynucleotide can be a precursor for a circular engineered guide RNA. For example, a precursor engineered linear polynucleotide can be a linear mRNA transcribed from a plasmid, which can be configured to circularize within a cell using the techniques described herein. A precursor engineered linear polynucleotide can be constructed with domains such as a ribozyme domain and a ligation domain that allow for circularization when inserted into a cell. A ribozyme domain can include a domain that is capable of cleaving the linear precursor RNA at specific sites (e.g., adjacent to the ligation domain). A precursor engineered linear polynucleotide can comprise, from 5’ to 3’ : a 5’ ribozyme domain, a 5’ ligation domain, a circularized region, a 3’ ligation domain, and a 3’ ribozyme domain. In some cases, a circularized region can comprise a guide RNA described herein. In some cases, the precursor polynucleotide can be specifically processed at both sites by the 5’ and the 3’ ribozymes, respectively, to free exposed ends on the 5’ and 3’ ligation domains. The free exposed ends can be ligation competent, such that the ends can be ligated to form a mature circularized structure. For instance, the free ends can include a 5’-OH and a 2’, 3’-cyclic phosphate that are ligated via RNA ligation in the cell. The linear polynucleotide with the ligation and ribozyme domains can be transfected into a cell where it can circularize via endogenous cellular enzymes. In some cases, a polynucleotide can encode an engineered guide RNA comprising the ribozyme and ligation domains described herein, which can circularize within a cell. For example, PCT / US2021 / 034301 provides a description of circular guide RNAs and their structures,sequences of circular guide RNAs, and methods of engineering circularized polynucleotide domains, and each of these descriptions in PCT / US2021 / 034301 is herein incorporated by reference.

[0206] An engineered polynucleotide as described herein (e.g., a circularized guide RNA) can include spacer domains. As described herein, a spacer domain can refer to a domain that provides space between other domains. A spacer domain can be used to between a region to be circularized and flanking ligation sequences to increase the overall size of the mature circularized guide RNA. Where the region to be circularized includes a targeting domain as described herein that is configured to associate to a target sequence, the addition of spacers can provide improvements (e.g., increased specificity, enhanced editing efficiency, etc.) for the engineered polynucleotide to the target polynucleotide, relative to a comparable engineered polynucleotide that lacks a spacer domain. In some instances, the spacer domain is configured to not hybridize with the target RNA. In some embodiments, a precursor engineered polynucleotide or a circular engineered guide, can comprise, in order of 5’ to 3’ : a first ribozyme domain; a first ligation domain; a first spacer domain; a targeting domain that can be at least partially complementary to a target RNA, a second spacer domain, a second ligation domain, and a second ribozyme domain. In some cases, the first spacer domain, the second spacer domain, or both are configured to not bind to the target RNA when the targeting domain binds to the target RNA.

[0207] A circular or looped RNA can be formed by employing a self-cleaving entity, such as a ribozyme, tRNA, aptamer, catalytically active fragment of any of these, or any combination thereof. For example, a ribozyme, a tRNA, an aptamer, a catalytically active fragment of any of these, or any combination thereof can be added to a 3’ end, a 5’ end, or both of a precursor engineered RNA. In another example, a ribozyme, a tRNA, an aptamer, a catalytically active fragment of any of these, or any combination thereof can be added to a 3’ terminal end, a 5’ terminal end, or both of a precursor engineered RNA. A self-cleaving ribozyme can comprise, for example, an RNase P RNA a Hammerhead ribozyme (e.g., a Schistosoma mansoni ribozyme), a glmS ribozyme, an HDV-like ribozyme, an R2 element, a peptidyl transferase 23 S rRNA, a GIRI branching ribozyme, a leadzyme, a group II intron, a hairpin ribozyme, a VS ribozyme, a CPEB3 ribozyme, a CoTC ribozyme, or a group I intron. In some cases, the self-cleaving ribozyme can be a trans-acting ribozyme that joins one RNA end on which it is present to a separate RNA end. In some embodiments, an aptamer can be added to each end of the engineered guide RNA. A ligase can be contacted with the aptamersat each end of the engineered guide RNA to form a covalent linkage between the aptamers thereby forming a circular engineered guide RNA. In some cases, a self-cleaving element or an aptamer can be configured to facilitate self-circularization of an engineered polynucleotide or a pro-polynucleotide (e.g., from a precursor engineered polypeptide) after transcription in a cell. In some instances, circularization of a guide RNA can be shown by PCR. For example, primers can be developed that bind to the end of a guide RNA and are directed outward such that a product is only formed when guides are circularized.

[0208] In some cases, circularization can occur by back-slicing and ligation of an exon. For example, an RNA can be engineered from 5’ to 3’ to comprise a forward complementary sequence intron, an exon (which can comprise the guide sequence), followed by a reverse complementary sequence intron. Once transcribed, the complementary sequence introns can hybridize and form dsRNA. The internal exon containing the guide sequence can be removed by splicing and ligated by an endogenous ligase to form a circular guide. In one example, an engineered guide RNA can initiate circularization in a cell by autocatalytic reactions of encoded ribozymes. After cleavage by one or more ribozymes, the linear polynucleotide will undergo intracellular RNA ligation of the 5’ and the 3’ end of ligation sequences by an endogenous ligase to circularize the guide RNA.

[0209] A suitable self-cleaving molecule can include a ribozyme. For example, a ribozyme domain can create an autocatalytic RNA. A ribozyme can comprise an RNase P, an rRNA (such as a Peptidyl transferase 23 S rRNA), Leadzyme, Group I intron ribozyme, Group II intron ribozyme, a GIRI branching ribozyme, a glmS ribozyme, a hairpin ribozyme, a Hammerhead ribozyme, an HDV ribozyme, a Twister ribozyme, a Twister sister ribozyme, a VS ribozyme, a Pistol ribozyme, a Hatchet ribozyme, a viroid, or any combination thereof. A ribozyme can include a P3 twister U2A ribozyme. A ribozyme can comprise 5’ GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGC CT 3’ (SEQ ID NO: 9). A ribozyme can comprise 5’ GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCG CCU 3’ (SEQ ID NO: 10). A ribozyme can comprise at least about: 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to 5’GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGC CT 3’ (SEQ ID NO: 9). A ribozyme can comprise at least about: 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to 5’ GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU 3’ (SEQ ID NO: 10). A ribozyme can include a Pl Twister Ribozyme. A ribozyme can include 5’AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACG C 3’ (SEQ ID NO: 11). A ribozyme can include 5’ AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCAC GC 3’ (SEQ ID NO: 12). A ribozyme can comprise at least about: 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to 5’ AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACG C 3’ (SEQ ID NO: 11). A ribozyme can comprise at least about: 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to 5’ AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCAC GC 3’ (SEQ ID NO: 12).

[0210] A ligation domain can facilitate a linkage, covalent or non-covalent, of a first nucleotide to a second nucleotide. In some embodiments, a ligation domain can recruit a ligating entity to facilitate a ligation reaction. In some cases, a ligation domain can recruit a recombining entity to facilitate a homologous recombination. In some instances, a first ligation domain can facilitate a linkage, covalent or non-covalent, to a second ligation domain. In some embodiments, a first ligation domain can facilitate the complementary pairing of a second ligation domain. In some cases, a ligation domain can comprise 5’ AACCATGCCGACTGATGGCAG 3’ (SEQ ID NO: 13). In some embodiments, a ligation domain can comprise 5’ GATGTCAGGTGCGGCTGACTACCGTC 3’ (SEQ ID NO: 14). In some cases, a ligation domain can comprise 5’ AACC AUGCCGACUGAUGGC AG 3 ’ (SEQ ID NO: 15). In some cases, a ligation domain can comprise 5’ GAUGUCAGGUGCGGCUGACUACCGUC 3’ (SEQ ID NO: 16). In some cases, a ligation domain can comprise at least about: 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to 5 ’AACCATGCCGACTGATGGCAG 3’ (SEQ ID NO: 13). In some cases, a ligation domain can comprise at least about: 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to 5’ GATGTCAGGTGCGGCTGACTACCGTC 3’ (SEQ ID NO: 14). In some cases, a ligation domain can comprise at least about: 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to 5’ AACC AUGCCGACUGAUGGC AG 3’ (SEQ ID NO: 15). In some cases, a ligation domain can comprise at least about: 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to 5’ GAUGUCAGGUGCGGCUGACUACCGUC 3’ (SEQ ID NO: 16).

[0211] The compositions and methods of the present disclosure can provide for engineered polynucleotides encoding for guide RNAs that are operably linked to a portion of a small nuclear ribonucleic acid (snRNA) sequence. The engineered polynucleotide can include at least a portion of a small nuclear ribonucleic acid (snRNA) sequence. The U7 and U1 small nuclear RNAs, whose natural role is in spliceosomal processing of pre-mRNA, have for decades been re-engineered to alter splicing at desired disease targets. Replacing the first 18 nt of the U7 snRNA (which naturally hybridizes to the spacer element of histone pre-mRNA) with a short targeting (or antisense) sequence of a disease gene, redirects the splicing machinery to alter splicing around that target site. Furthermore, converting the wild type U7 Sm-domain binding site to an optimized consensus Sm-binding sequence (SmOPT) can increase the expression level, activity, and subcellular localization of the artificial antisense- engineered U7 snRNA. Many subsequent groups have adapted this modified U7 SmOPT snRNA chassis with antisense sequences of other genes to recruit spliceosomal elements and modify RNA splicing for additional disease targets.

[0212] An snRNA is a class of small RNA molecules found within the nucleus of eukaryotic cells. They are involved in a variety of important processes such as RNA splicing (removal of introns from pre-mRNA), regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintaining the telomeres. They are always associated with specific proteins, and the resulting RNA-protein complexes are referred to as small nuclear ribonucleoproteins (snRNP) or sometimes as snurps. There are many snRNAs, which are denominated Ul, U2, U3, U4, U5, U6, U7, U8, U9, and U10.

[0213] The snRNA of the U7 type is normally involved in the maturation of histone mRNA. This snRNA has been identified in a great number of eukaryotic species (56 so far) and the U7 snRNA of each of these species should be regarded as equally convenient for this disclosure.

[0214] Wild-type U7 snRNA includes a stem-loop structure, the U7-specific Sm sequence, and a sequence antisense to the 3' end of histone pre-mRNA.

[0215] In addition to the SmOPT domain, U7 comprises a sequence antisense to the 3' end of histone pre-mRNA. When this sequence is replaced by a targeting sequence that is antisense to another target pre-mRNA, U7 is redirected to the new target pre-mRNA. Accordingly, the stable expression of modified U7 snRNAs containing the SmOPT domain and a targeting antisense sequence has resulted in specific alteration of mRNA splicing.

[0216] The engineered polynucleotide can comprise at least in part an snRNA sequence. The snRNA sequence can be Ul, U2, U3, U4, U5, U6, U7, U8, U9, or a U10 snRNA sequence.

[0217] In some instances, an engineered polynucleotide that comprises at least a portion of an snRNA sequence (e.g. an snRNA promoter, an snRNA hairpin, and the like) can have superior properties for treating or preventing a disease or condition, relative to a comparable polynucleotide lacking such features. For example, as described herein an engineered polynucleotide that comprises at least a portion of an snRNA sequence can facilitate exon skipping of an exon at a greater efficiency than a comparable polynucleotide lacking such features. Further, as described herein an engineered polynucleotide that comprises at least a portion of an snRNA sequence can facilitate an editing of a base of a nucleotide in a target RNA (e.g. a pre-mRNA or a mature RNA) at a greater efficiency than a comparable polynucleotide lacking such features. Promoters and snRNA components are described in PCT / US2021 / 028618 and PCT / US2022 / 078801, and each of these descriptions in PCT / US2021 / 028618 and PCT / US2022 / 078801 are herein incorporated by reference.

[0218] Disclosed herein are engineered RNAs comprising (a) an engineered guide RNA as described herein, and (b) a U7 snRNA hairpin sequence, a SmOPT sequence, or a combination thereof. In some embodiments, the U7 hairpin comprises a human U7 Hairpin sequence, or a mouse U7 hairpin sequence. In some cases, a human U7 hairpin sequence comprises TAGGCTTTCTGGCTTTTTACCGGAAAGCCCCT (SEQ ID NO: 17 or RNA: UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU SEQ ID NO: 18). In some cases, a mouse U7 hairpin sequence comprises CAGGTTTTCTGACTTCGGTCGGAAAACCCCT (SEQ ID NO: 19 or RNA: CAGGUUUUCUGACUUCGGUCGGAAAACCCCU SEQ ID NO: 20). In some embodiments, the SmOPT sequence has a sequence of AATTTTTGGAG (SEQ ID NO: 21 or RNA: AAUUUUUGGAG SEQ ID NO: 22). In some embodiments, a guide RNA comprising a polynucleotide sequence of any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, or SEQ ID NO: 112 - SEQ ID NO: 117 that target the SNCA Codon 1 TIS of Exon 2 can comprise a guide RNA comprising a U7 hairpin sequence (e.g., a human or a mouse U7 hairpin sequence), an SmOPT sequence, or a combination thereof. In some embodiments, a guide RNA comprising a polynucleotide sequence of any one of SEQ ID NO: 147 - SEQ ID NO: 148 that target the SNCA TIS pre-mRNA can comprise a guide RNA comprising a U7 hairpin sequence (e.g. , a human or a mouse U7 hairpin sequence), an SmOPT sequence, or acombination thereof. In some cases, a combination of a U7 hairpin sequence and a SmOPT sequence can comprise a SmOPT U7 hairpin sequence, wherein the SmOPT sequence is linked to the U7 sequence. In some cases, a U7 hairpin sequence, an SmOPT sequence, or a combination thereof is downstream e.g., 3’) of the engineered guide RNA disclosed herein.

[0219] The compositions and methods of the present disclosure can provide for engineered polynucleotides encoding for guide RNAs that are operably linked to a portion of a SmOPT and U7 hairpin sequence. The engineered polynucleotide and / or guide RNAs can include at least a portion of a SmOPT and U7 hairpin sequence. In some instances, a guide RNA comprises the SmOPT and U7 hairpin sequence that is downstream (e.g., 3’) of the guide sequence. In some cases, the sequence encoding the SmOPT and U7 hairpin sequence comprises AATTTTTGGAACAGGGTTTTCTGCCTTCGGGCGGAAAACCCCCT (SEQ ID NO: 33). In some cases, the sequence encoding the SmOPT and U7 hairpin sequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 33. In some cases, the sequence encoding the SmOPT and U7 hairpin sequence can be incorporated into an engineered polynucleotide in the forward direction or the reverse direction. The RNA sequence of the SmOPT and U7 hairpin sequence comprisesAAUUUUUGGAACAGGGUUUUCUGCCUUCGGGCGGAAAACCCCCU (SEQ ID NO: 42). In some cases, the SmOPT and U7 hairpin sequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 42. In some cases, the sequence encoding the SmOPT and U7 hairpin sequence 2 comprises AATTTTTGGAACAGGGTTTTCTGACTTCGGTCGGAAAACCCCCT (SEQ ID NO: 84). In some cases, the sequence encoding the SmOPT and U7 hairpin sequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 84. In some cases, the sequence encoding the SmOPT and U7 hairpin sequence can be incorporated into an engineered polynucleotide in the forward direction or the reverse direction. The RNA sequence of the SmOPT and U7 hairpin sequence 2 comprises AAUUUUUGGAACAGGGUUUUCUGACUUCGGUCGGAAAACCCCCU (SEQ ID NO: 96). In some cases, the SmOPT and U7 hairpin sequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 96. In some cases, the sequence encoding the SmOPT and U5 hairpinsequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 120. In some cases, the sequence encoding the SmOPT and U5 hairpin sequence can be incorporated into an engineered polynucleotide in the forward direction or the reverse direction.

[0220] The compositions and methods of the present disclosure can provide for engineered polynucleotides encoding for guide RNAs that are operably linked to a portion of a hnRNPAl sequence. The engineered polynucleotide and / or guide RNAs can include at least a portion of a hnRNPAl sequence. In some instances, a guide RNA comprises the hnRNPAl sequence that is upstream (e.g., 5’) of the guide sequence. In some cases, the sequence encoding the hnRNPAl sequence comprises TATGATAGGGACTTAGGGTG (SEQ ID NO: 82). In some cases, the sequence encoding the hnRNPAl sequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 82. In some cases, the sequence encoding the hnRNPAl sequence can be incorporated into an engineered polynucleotide in the forward direction or the reverse direction. The RNA sequence of the hnRNPAl sequence comprises UAUGAUAGGGACUUAGGGUG (SEQ ID NO: 97). In some cases, the hnRNPAl sequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 97. In some embodiments, the inclusion of an hnRNPAl sequence (e.g., SEQ ID NO: 82) to an engineered guide RNA as described herein can increase the exon skipping of the SNCA TIS target.

[0221] The compositions and methods of the present disclosure can provide for engineered polynucleotides encoding for guide RNAs that are operably linked to a portion of a Sm- hairpin sequence. The engineered polynucleotide and / or guide RNAs can include at least a portion of a Sm-hairpin sequence. In some instances, a guide RNA comprises the Sm-hairpin sequence that is downstream (e.g., 3’) of the guide sequence. In some cases, the sequence encoding the Sm-hairpin sequence comprises AATTTTTGGTAGTGGGGGACTGCGTTCGCGCTTTCCCCTG (SEQ ID NO: 44). In some cases, the sequence encoding the Sm- hairpin sequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 44. In some cases, the sequence encoding the Sm-hairpin sequence can be incorporated into an engineered polynucleotide in the forward direction or the reverse direction. The RNA sequence of the Sm-hairpin sequence comprises AAUUUUUGGUAGUGGGGGACUGCGUUCGCGCUUUCCCCUG (SEQ ID NO: 45). Insome cases, the Sm-hairpin sequence can have at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 45.

[0222] Also disclosed herein are promoters for driving the expression of a guide RNA disclosed herein. In some cases, the promoters for driving expression can be upstream (e.g., 5’) to the guide RNA sequence disclosed herein. In some cases, a promoter can comprise a U1 promoter, a U7 promoter, a U6 promoter or any combination thereof. In some cases, a promoter can comprise a CMV promoter. In some cases, a U7 promoter, or a U6 promoter can be a mouse U7 promoter, or a mouse U6 promoter. In some cases, a U1 promoter, a U7 promoter, or a U6 promoter can be a human U1 promoter, a human U7 promoter, or a human U6 promoter. In some cases, a U7 promoter can be an engineered mouse U7 promoter. In some cases, a U1 promoter can be an engineered human U1 promoter. In some cases, a promoter can comprise an auxiliary promoter. In some cases, a promoter herein can be oriented in the forward or the reverse direction on a polynucleotide encoding a guide RNA.

[0223] In some embodiments, a polynucleotide herein (e.g., a plasmid) can comprise an engineered mU7 promoter. In some cases, an engineered mU7 promoter comprises the sequence: TAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATGC AAATCAAGAGAAATGCAAATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGA GCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGC TTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATAAGTCACC ATGAGTGTAAAGGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGC (SEQ ID NO: 30). In some cases, an engineered mU7 promoter has at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 30. In some cases, an engineered mU7 promoter can comprise the reverse complement sequence such as SEQ ID NO: 94. In some cases, an engineered mU7 promoter has at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 94.

[0224] In some embodiments, a polynucleotide herein (e.g., a plasmid) can comprise an engineered promoter sequence. In some cases, an engineered promoter sequence comprises the sequence: ATTTAATAGCAGTCTTTATTTAAAAGAAATCAAACTCAGACGTACAAATACACAA AACAGATAAAACCCGAGTCTCTGACCAGGAAAGCGTTATTTTCCAGCCAGCCAGI l lTCTTCGGCTTCGCCCCCTAACGGTGACATAAGGCACTCTGTGAAATGCTCTGTTC CGGAATCAAAAGATTGATCCGATTATTTGCATACCCATAATGCACTGCTCACAGT ACAAATTTAAAAAGGCAAAATCAAACATTTTTATTCTAAGCATATTCTGTGAAAG TTAGACTTTTGTTTAAACAATACTCTTAAAATTTTTTTCTAGGTATAGAACCTTGG CATTCACTAGTCACCATCACTATACTAGGAGTTTCTGTTACCCGAGAAACGAGTT ATGAAATTAACAAGC (SEQ ID NO: 35). In some cases, an engineered promoter sequence has at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 35.

[0225] In some embodiments, a polynucleotide herein (e.g., a plasmid) can comprise an engineered promoter sequence. In some cases, an engineered promoter sequence comprises the sequence:TCGCCCCCTAACGGTGACATAAGGCACTCTGTGAAATGCTCTGTTCCGGAATCAA AAGATTGATCCGATTATTTGCATACCCATAATGCACTGCTCACAGTACAAATTTA AAAAGGCAAAATCAAACATTTTTATTCTAAGCATATTCTGTGAAAGTTAGACTTT TGTTTAAACAATACTCTTAAAATTTTTTTCTAGGTATAGAACCTTGGCATTCACTA GTCACCATCACTATACTAGGAGTTTCTGTTACCCGAGAAACGAGTTATGAAATTA ACAAGC (SEQ ID NO: 88). In some cases, an engineered promoter sequence has at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 88.

[0226] In some cases, a human U6 promoter comprises a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTA GAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATA CGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT AAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTT ATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 23). In some cases, a mouse U6 promoter can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:GTACTGAGTCGCCCAGTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGC CGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTA ATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACA GATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTC ACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAA AGCCTTGTTTG (SEQ ID NO: 24). In some cases, a human U7 promoter can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:TTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGA ACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTT AAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTG TTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATT GTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA (SEQ ID NO: 25). In some cases, a mouse U7 promoter can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:TTAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATT TGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCT TTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATAT CAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGT TGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGC (SEQ ID NO: 26).

[0227] In some cases, a human U1 promoter can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:TAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGGGCGGGAGGGAAAAAGG GAGAGGCAGACGTCACTTCCTCTTGGCGACTCTGGCAGCAGATTGGTCGGTTGAG TGGCAGAAAGGCAGACGGGGACTGGGCAAGGCACTGTCGGTGACATCACGGAC AGGGCGACTTCTATGTAGATGAGGCAGCGCAGAGGCTGCTGCTTCGCCACTTGCT GCTTCGCCACGAAGGGAGTTCCCGTGCCCTGGGAGCGGGTTCAGGACCGCTGAT CGGAAGTGAGAATCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGTGCGC GGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCA GAGCCCGAAGATCTC (SEQ ID NO: 27). In some cases, a CMV promoter can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:ATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTC ATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATG TTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTT ACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCC CCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGA CCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACC ATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCAC GGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCA AAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAAT GGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAA CCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACAC CGGGACCGATCCAGCCTCCGGACTCTAGAGGATCGAACC (SEQ ID NO: 28).

[0228] In some cases, an auxiliary promoter can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:CCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACAT CTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAAT GGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACG TCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTA TATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACG CTGTTTTGACCTCCATAGTAGA (SEQ ID NO: 90).

[0229] Also described herein are sequences encoding for an auxiliary thy sequence. In some cases, an auxiliary thy sequence can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:ATGAACCCCGCCATCTCCGTTGCTTTGCTCCTTTCCGTGCTTCAAGTCAGCAGGG GACAAAAAGTAACATCACTGACAGCGTGTCTGGTCAATCAAAACCTTAGGCTGG ACTGCCGCCATGAAAACAATACCAAGGATAATTCAATCCAGCACGAGTTTTCCCT TACTCGAGAGAAGCGAAAGCATGTCCTCTCCGGCACCCTCGGAATCCCTGAACA TACATACAGGAGCAGGGTTACACTCTCCAATCAACCCTATATAAAAGTGTTGACA TTGGCGAATTTTACCACTAAGGATGAGGGAGATTACTTTTGCGAGTTGCAAGTCT CAGGAGCAAATCCAATGTCCTCCAATAAGTCAATCTCCGTCTATCGGGATAAACT TGTAAAATGTGGTGGGATTAGCCTTCTGGTACAGAATACCTCCTGGATGCTCTTGCTGCTGCTCTCCCTTTCCCTCCTTCAAGCCCTCGACTTTATTTCTCTTTAA (SEQ ID NO: 91). In some cases, an auxiliary thy sequence can be a marker, for example a transfection or a transduction marker.

[0230] Also described herein are sequences encoding for a filler sequence. In some cases, a filler sequence can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to: GTACTAAGATTGCGGCCTGGCCACTGACTAAGATAGAAGCTGTAACTTGCCTCAG ATTGTGGCCGCTGAT (SEQ ID NO: 93).

[0231] Also described herein are terminator sequences (also called termination sequences) for enhanced expression of a guide RNA disclosed herein. In some cases, a polynucleotide encoding a guide RNA can comprise a terminator sequence. In some cases, the terminator sequence can be located downstream (e.g., 3’) of the sequence encoding the SmOPT and U7 hairpin sequence or a sequence encoding a guide RNA sequence. In some cases, the terminator sequence comprises a terminator sequence 1 and / or a terminator sequence 2. In some cases, a terminator sequence 1 can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to: AATTTTTGTAATGAAAAAATAGACGGCAAGGGTTATTCTTAAAACTGCAGTTTTG TAGCTTGGGTGGCATGTTAAGTGTTCTCCTTACAGTCGCAACGATGGGAAACAGA AAGTAACGTGTTATCCTCTCCGCCGCCGTGAGCTCTTTTAACACTAGCTAAGTGG CCGCAGGGCTCTTCTCTTTCCTTTCCACTTGGGGC (SEQ ID NO: 34). In some cases, a terminator sequence 2 can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to: ATCATGTTTTATAAAAAAAGACTTAAAGAGGAAAACATTATGGTGCAACTTTAG GCTTAAGTGATTCATTGTCACTGTTTGTTTAAACATTGTGTAACAGAACTTGCAA AGACAGTTAACTCTTGTTTTCCATGTCAAAGGTCTGAATACTTGCATGATAAAAG TCTGTGTAACTTTCCCTGGTGACATCTGACTTGCTA (SEQ ID NO: 36). In some cases, a terminator sequence 3 can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to: CCCAATTTCACTGGTTTCAAAAACAGAAAAACAGTTCTCTTCCCCG (SEQ ID NO: 86). In some cases, a terminator sequence 4 can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to:TATAAAGCTGTTAAAAAATCAGATTGACTTCATTTAGGGTGTTTCTTACAGATAT CGTTTAAGTTTTCGGTTCTGCTTGTAAACGCTTCAATCGC (SEQ ID NO: 89). In some cases, a terminator sequence 5 can comprise a sequence with at least about: 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to: CTTAGTAAGTTTAAAAACAGAAAAAAAACCGTGTTGCTACAGCTATAAACTTCA AACATGCAGTTTATAGCAGTGGGCAACACGTCTCATCTCAAAAATTCAGCACTCA AACATTACACAGGAAGAGGATGTAATTTTTTAAAATGAAAGCTCTGAAGTAATTT GAGTATTCTCTGTCCTTTTTGTAAAAAAAATTACGA (SEQ ID NO: 135). In some cases, a terminator sequence is in the forward direction or the reverse direction on a polynucleotide encoding a guide...

Claims

CLAIMS1. A recombinant AAV encapsidating a vector, wherein the vector comprises a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 128, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 78, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 127, SEQ ID NO: 129 - SEQ ID NO: 132, SEQ ID NO: 163 - SEQ ID NO: 165, or SEQ ID NO: 167 - SEQ ID NO: 172 and an AAV inverted terminal repeat.

2. The recombinant AAV encapsidating the vector of claim 1, wherein the vector comprises a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 120, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 119, SEQ ID NO: 121 - SEQ ID NO: 124, SEQ ID NO: 152 - SEQ ID NO: 154, or SEQ ID NO: 156 - SEQ ID NO: 161.

3. The recombinant AAV encapsidating the vector of claim 2, wherein the vector comprises a sequence of SEQ ID NO: 120.

4. The recombinant AAV encapsidating the vector of claim 2, wherein the vector comprises a sequence of SEQ ID NO : 151.

5. The recombinant AAV encapsidating the vector of claim 2, wherein the vector comprises a sequence of SEQ ID NO: 155.

6. The recombinant AAV encapsidating the vector of claim 2, wherein the vector comprises a sequence of SEQ ID NO: 38.

7. The recombinant AAV encapsidating the vector of claim 2, wherein the vector comprises a sequence of SEQ ID NO: 125.

8. The recombinant AAV encapsidating the vector of claim 2, wherein the vector comprises a sequence of SEQ ID NO: 126.

9. The recombinant AAV encapsidating the vector of claim 2, wherein the vector encodes an engineered guide RNA, wherein the engineered guide RNA, upon hybridization to a region of a target SNCA RNA, forms a guide-target RNA scaffold that comprises one or more structural features.

10. The recombinant AAV encapsidating the vector of claim 9, wherein the engineered guide RNA when hybridized to the region of the target SNCA RNA facilitates a knockdown of alpha-synuclein protein encoded by the target SNCA RNA.

11. The recombinant AAV encapsidating the vector of claim 9, wherein the target SNCA RNA comprises a SNCA Codon 1 translation initiation site (TIS) of Exon 2 and optionally wherein the SNCA Codon 1 translation initiation site of Exon 2 corresponds to position 226 of an SNCA transcript variant 1 of accession number NM_000345.4.

12. The recombinant AAV encapsidating the vector of claim 9, wherein the target SNCA RNA comprises a SNCA pre-mRNA translation initiation site (TIS).

13. The recombinant AAV encapsidating the vector of claim 9, wherein the one or more structural features comprises a bulge, an internal loop, a wobble base pair, a hairpin, or any combination thereof.

14. The recombinant AAV encapsidating the vector of claim 13, wherein the engineered guide RNA comprises at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 - SEQ ID NO: 65, SEQ ID NO: 112 - SEQ ID NO: 117, or SEQ ID NO: 147 - SEQ ID NO: 148.

15. The recombinant AAV encapsidating the vector of claim 11, wherein the engineered guide RNA when hybridized to the region of the target SNCA RNA facilitates RNA editing by an RNA editing entity of one or more adenosines in the SNCA Codon 1 translation initiation site of Exon 2.

16. The recombinant AAV encapsidating the vector of claim 15, wherein the RNA editing entity comprises a human AD ARI, or a human ADAR2.

17. A recombinant AAV encapsidating a vector that comprises a sequence encoding an engineered guide RNA sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 31 - SEQ ID NO: 32, SEQ ID NO: 46 - SEQ ID NO: 49, SEQ ID NO: 54 - SEQ ID NO: 65, SEQ ID NO: 106 - SEQ ID NO: 111, or SEQ ID NO: 145 - SEQ ID NO: 146.

18. The recombinant AAV encapsidating the vector of claim 17, wherein upon hybridization of the engineered guide RNA to the target SNCA RNA, the engineered guide RNA facilitates RNA editing of an adenosine in the target SNCA RNA by an RNA editing entity.

19. The recombinant AAV encapsidating the vector of claim 17, wherein the engineered guide RNA facilitates at least about: 30%, 40%, 50%, 60% or 70% RNA editing of a target adenosine in the target SNCA RNA by an RNA editing entity, as measured by an in vitro assay as compared to an otherwise identical control that lacks the engineered guide RNA.

20. The recombinant AAV encapsidating the vector of claim 17, wherein the engineered guide RNA facilitates at least about: 30%, 40%, 50%, 60% or 70% RNA knockdown of the target SNCA RNA, as measured by an in vitro assay as compared to an otherwise identical control that lacks the engineered guide RNA.

21. The recombinant AAV encapsidating the vector of claim 17, wherein the engineered guide RNA facilitates at least about: 30%, 40%, 50%, 60% or 70% protein knockdown of a SNCA protein encoded by the target SNCA RNA, as measured by an in vitro assay as compared to an otherwise identical control that lacks the engineered guide RNA.

22. The recombinant AAV encapsidating the vector of claim 18, wherein the engineered guide RNA when hybridized to the region of the target SNCA RNA facilitates (i) RNA editing of a SNCA TIS in the target SNCA RNA, (ii) skipping of Exon 2 in the target SNCA RNA, (iii) reducing a level of SNCA mRNA expression, or (iv) any combination of (i), (ii), and (iii), thereby resulting in a reduction of alpha-synuclein protein encoded by the target SNCA RNA23. The recombinant AAV encapsidating the vector of claim 18, wherein the target SNCA RNA comprises a SNCA Codon 1 translation initiation site of Exon 2 and optionally wherein the SNCA Codon 1 translation initiation site of Exon 2 corresponds to position 226 of an SNCA transcript variant 1 of accession number NM_000345.4.

24. The recombinant AAV encapsidating the vector of claim 18, wherein the target SNCA RNA comprises a SNCA pre-mRNA translation initiation site.

25. The recombinant AAV encapsidating the vector of claim 17, wherein the recombinant AAV comprises an AAV1 virion, AAV2 virion, AAV3 virion, AAV4 virion, AAV5 virion, AAV6 virion, AAV7 virion, AAV8 virion, AAV9 virion, AAV10 virion, AAV11 virion, or a derivative, a chimera, or a variant thereof.

26. A plasmid encoding an engineered guide RNA, wherein the plasmid comprises a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 128, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 78, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 127, SEQ ID NO: 129 - SEQ ID NO: 132, SEQ ID NO: 163 - SEQ ID NO: 165, or SEQ ID NO: 167 - SEQ ID NO: 172 and an AAV inverted terminal repeat.

27. An engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA comprises at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 40 - SEQ ID NO: 41, SEQ ID NO: 50 - SEQ ID NO: 53, SEQ ID NO: 54 SEQ ID NO: 65, SEQ ID NO: 112 SEQ ID NO: 117, or SEQ ID NO: 147 - SEQ ID NO: 148.

28. An engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA comprises a sequence with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 147 or SEQ ID NO: 148.

29. The engineered guide RNA of claim 28, wherein the engineered guide RNA is capable of hybridizing to a target SNCA RNA with at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 150.

30. The engineered guide RNA of claim 29, wherein the target SNCA RNA is a SNCA TIS pre- mRNA.

31. An engineered RNA that comprises (a) an engineered guide RNA comprising a targeting sequence that binds to a target SNCA RNA, and a first Near Sm-Site Structure (NSS) sequence that is positioned 5’ of the targeting sequence or 3’ of the targeting sequence; and (b) an Sm-binding sequence that is positioned 3’ of the engineered guide RNA.

32. The engineered RNA of claim 31, wherein the first NSS sequence is positioned 5’ of the targeting sequence and is reverse complementary to a 3’ end of the targeting sequence.

33. The engineered RNA of claim 31, wherein the first NSS sequence is positioned 3’ of the targeting sequence and is reverse complementary to a 5’ end of the targeting sequence.

34. The engineered RNA of claim 31, wherein the engineered guide RNA further comprises a second NSS sequence, wherein:(a) the first NSS sequence is reverse complementary to the second NSS sequence, or(b) one of the first NSS sequence or the second NSS sequence is positioned 5’ of the targeting sequence and the other of the first NSS sequence or the second NSS sequence is positioned 3’ of the targeting sequence.

35. The engineered RNA of claim 31, wherein the second NSS sequence is at least about 5 to about 20 nucleotides in length.

36. The engineered RNA of any one of claims 31-35, wherein the first NSS sequence is at least about 5 to about 20 nucleotides in length.

37. The engineered RNA of any one of claims 31-36, wherein hybridization of the first NSS sequence to the second NSS sequence, a 5’ end of the targeting sequence, or a 3’ end of the targeting sequence prevents hybridization of the Sm-binding sequence to the targeting sequence.

38. The engineered RNA of any one of claims 31-37, wherein the first NSS sequence forms not less than 5 and not more than 15 base pair interactions with the second NSS sequence, a 5’ end of the targeting sequence, or a 3’ end of the targeting sequence.

39. The engineered RNA of any one of claims 31-38, wherein the first or the second NSS sequence is positioned 5’ of the Sm-binding sequence.

40. A pharmaceutical composition comprising: a) the recombinant AAV encapsidating the vector of any one of claims 1-25, the plasmid encoding the engineered guide RNA of claim 26, the engineered guide RNA of any one of claims 28-30, or the engineered RNA of any one of claims 31-39, and b) a pharmaceutically acceptable: excipient, carrier, or diluent.

41. A method of administering to a subject an effective amount of the recombinant AAV encapsidating the vector of any one of claims 1-25, the plasmid encoding the engineered guide RNA of claim 26, the engineered guide RNA of any one of claims 28-30, the engineered RNA of any one of claims 31-39, or the pharmaceutical composition of claim 40.

42. The method of claim 41, wherein the subject is a mouse, a non-human primate, or a human.

43. The method of any one of claims 41-42, comprising administering the pharmaceutical composition that is in unit dose form.

44. A method of treating an alpha-synucleinopathy in a subject comprising administering to a subject an effective amount of the recombinant AAV encapsi dating the vector of any one of claims 1-25, the plasmid encoding the engineered guide RNA of claim 26, the engineered guide RNA of any one of claims 28-30, the engineered RNA of any one of claims 31-39, or the pharmaceutical composition of claim 40, wherein the administering treats the alpha- synucleinopathy in the subject.

45. The method of claim 44, wherein the alpha-synucleinopathy is a Parkinson’s disease, a dementia with Lewy bodies, or a multiple system atrophy.

46. The method of claim 44 or 45, wherein the subject is a mouse, a non-human primate, or a human.

47. The method of any one of claims 44-46, comprising administering the pharmaceutical composition that is in unit dose form.

48. A method of editing an SNCA RNA transcript in a subject comprising administering to a subject an effective amount of the recombinant AAV encapsidating the vector of any one of claims 1-25, the plasmid encoding the engineered guide RNA of claim 26, the engineered guide RNA of any one of claims 28-30, the engineered RNA of any one of claims 31-39, or the pharmaceutical composition of claim 40, wherein after the administering the SNCA RNA transcript is edited in the subject.

49. The method of claim 48, wherein the subject is a mouse, a non-human primate, or a human.

50. The method of any one of claims 48-49, comprising administering the pharmaceutical composition that is in unit dose form.

51. The method of any one of claims 48-50, wherein the editing of the SNCA transcript comprises editing of a SNCA Codon 1 translation initiation site of Exon 2.

52. The method of claim 51, wherein the editing of SNCA Codon 1 translation initiation site of Exon 2 transcript comprises editing of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the total SNCA transcripts in a brain or a region of a brain of the subject.

53. The method of any one of claims 48-50, wherein the editing of the SNCA transcript comprises editing of a SNCA pre-mRNA translation initiation site.

54. The method of claim 51, wherein the editing of the SNCA pre-mRNA translation initiation site comprises editing of at least about 20%, at least about 30%, at least about 40%, at leastabout 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the total SNCA transcripts in a brain or a region of a brain of the subject.

Images