Synthetic internal ribosome entry sites

CircRNA with synthetic IRES addresses the limitations of DNA-based gene therapy by ensuring safe and efficient gene expression without genomic integration and promoter-induced issues, enhancing therapeutic efficacy.

WO2026006593A1PCT designated stage Publication Date: 2026-01-02ORNA THERAPEUTICS INC
View PDF 34 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035485
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-28
Filing Date
2025-06-26
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Conventional DNA-based gene therapy methods face risks of genomic integration, mutations, immune responses, and promoter-induced changes, while viral vectors are costly and difficult to deliver effectively.

Method used

The use of circular RNA (circRNA) with a synthetic internal ribosome entry site (IRES) for gene therapy, which avoids genomic integration and eliminates the need for strong promoters, enhancing translation efficiency and stability.

Benefits of technology

CircRNA with synthetic IRES provides safer and more efficient gene expression by bypassing nuclear entry and reducing adverse effects, offering improved therapeutic potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025035485_02012026_PF_FP_ABST
    Figure US2025035485_02012026_PF_FP_ABST
Patent Text Reader

Abstract

Circular RNA and precursor RNA polynucleotides comprising synthetic, non-naturally occurring, Internal Ribosome Entry Sites (IRES), along with related compositions and methods are described herein. In some embodiments, the synthetic IRESs comprise at least one addition, deletion, or substitution of a nucleotide, domain, or motif, as compared to a naturally occurring IRES. In some embodiments, the synthetic IRESs have improved function and / or expression and / or stability as compared to a naturally occurring IRES and / or are capable of increasing expression of operably linked expression sequences as compared to naturally occurring IRESs. Also presented herein are methods and compositions for the manufacture and preparation of the circularized RNAs comprising the synthetic IRESs, along with methods of administering said circular RNAs and related compositions to a subject in need thereof for treatment or prevention purposes.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No. 01318-0014-00PCT OR-043WO SYNTHETIC INTERNAL RIBOSOME ENTRY SITES SEQUENCE LISTING [1] The present application contains a Sequence Listing which has been submitted electronically in XML format. Said XML copy, created on June 24, 2025, is named “01318- 0014-60PCT-SL.xml” and is 31,301,409 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. [2] Conventional gene therapy involves the use of DNA for insertion of desired genetic information into host cells. The DNA introduced into the cell is usually integrated to a certain extent into the genome of one or more transfected cells, allowing for long-lasting action of the introduced genetic material in the host. While there may be substantial benefits to such sustained action, integration of exogenous DNA into a host genome may also have many deleterious effects. For example, it is possible that the introduced DNA will be inserted into an intact gene, resulting in a mutation which impedes or even totally eliminates the function of the endogenous gene. Thus, gene therapy with DNA may result in the impairment of a vital genetic function in the treated host, such as e.g., elimination or deleteriously reduced production of an essential enzyme or interruption of a gene critical for the regulation of cell growth, resulting in unregulated or cancerous cell proliferation. In addition, with conventional DNA based gene therapy it is necessary for effective expression of the desired gene product to include a strong promoter sequence, which again may lead to undesirable changes in the regulation of normal gene expression in the cell. It is also possible that the DNA based genetic material will result in the induction of undesired anti-DNA antibodies, which in turn, may trigger a possibly fatal immune response. Gene therapy approaches using viral vectors can also result in an adverse immune response. In some circumstances, the viral vector may even integrate into the host genome. In addition, production of clinical grade viral vectors is also expensive and time consuming. Targeting delivery of the introduced genetic material using viral vectors can also be difficult to control. Thus, while DNA based gene therapy has been evaluated for delivery of secreted proteins using viral vectors (U.S. Patent No.6,066,626; U.S. Publication No. US2004 / 0110709), these approaches may be limited for these various reasons. [3] In contrast to DNA, the use of RNA as a gene therapy agent is substantially safer because RNA does not involve the risk of being stably integrated into the genome of the transfected cell, thus eliminating the concern that the introduced genetic material will disrupt the normal functioning of an essential gene, or cause a mutation that results in deleterious or 1Attorney Docket No. 01318-0014-00PCT OR-043WO oncogenic effects, and extraneous promoter sequences are not required for effective translation of the encoded protein, again avoiding possible deleterious side effects. In addition, it is not necessary for RNA to enter the nucleus to perform its function, while DNA must overcome this major barrier. [4] Circular RNA (circRNA or oRNA®) is a stable form of RNA. Circular RNA can also be particularly interesting and useful for in vivo applications, especially in the research area of RNA-based control of gene expression and therapeutics, including, for example, protein replacement therapy and vaccination. [5] Many eukaryotic mRNAs are translated in the canonical cap-dependent manner (Koch, Nat Struct Mol Biol. 2020 Dec; 27(12): 1095–1104, incorporated by reference herein), in which the 5’ end of the linear precursor RNA polynucleotide contains a 5’ cap that recruits binding of the ribosome 40S subunit to initiate robust translation. (See Renaud-Gabardos, World J Exp Med. 2015 Feb 20; 5(1): 11–20 at Figure 1, incorporated by reference herein in its entirety). This general mechanism depends on the recognition of the 5’ cap by the translation eukaryotic initiation factor (eIF)-4F, which is composed of three polypeptides (eIF4A, eIF4E, and eIF4G). (Salas-Martinez, Front. Microbiol., 03 January 2018 Sec. Virology, Volume 8 Article 2629.) Circular RNA has no 5’ end and therefore no 5’ cap by which robust ribosome binding and translation can be initiated. Some eukaryotic linear mRNAs and viral RNAs contain an internal ribosome entry site (IRES) in the 5’ untranslated region, which can recruit ribosomes in a cap-independent manner. (See Koch 2020; Renaud- Gabardos 2015). “Cellular IRESs are very diverse, which makes them difficult to classify. In other words, there appear to be many different, as of yet uncharacterized, mechanisms that control cap-independent translation using endogenous IRESs.” (See Deviatkin, Vaccines. 2023; 11(2):238, incorporated by reference herein.) However, IRES-driven expression is generally lower than that of cap-dependent translation, for example initial studies showed lower efficiency of IRES-associated translation initiation compared to cap-dependent initiation. (Deviatkin 2023.) [6] Five different types of IRESs (Types I, II, III, IV, V) have been classified based on evolutionary conserved sequences and structural organization. Each type harbors a common RNA structure core maintained by evolutionary conserved covariant substitutions. (See Salas- Martinez 2018, incorporated by reference herein.) The IRESs are made of domains (e.g., Domains I, II, III, IV, V, VI, and VII). Within those domains are motifs or regions (e.g., GNRA, or C-rich, or EIF4G) that have different functions. While the different types of IRESs 2Attorney Docket No. 01318-0014-00PCT OR-043WO can vary structurally, certain domains and motifs are conserved across the different types of IRESs. (Id.) [7] As set forth herein, in some embodiments, the circular RNA comprises a TIE comprising a synthetic internal ribosome entry site (IRES) or a fragment or variant thereof and a coding element comprising an expression sequence encoding at least one therapeutic protein. In some embodiments, the synthetic IRES is capable of increasing expression of operably linked expression sequences as compared to naturally occurring IRESs. In some embodiments, the synthetic IRESs comprise nucleotide additions, nucleotide deletions, and nucleotide substitutions as compared to the naturally occurring counterpart of the synthetic IRES (i.e. a naturally occurring IRES without the changes, or the starting IRES before the changes are made). In some embodiments, the synthetic IRESs comprise at least one addition, deletion, or substitution of a nucleotide, domain, or motif, as compared to a naturally occurring IRES. In some embodiments, the synthetic IRES comprise at least one addition, deletion, or substitution of a nucleotide or motif in a domain as compared to a corresponding naturally occurring domain, or comprises a deletion or substitution of the domain in whole or in part. In some embodiments, the synthetic IRES comprises at least one naturally occurring domain. As set forth in further detail herein, in some embodiments, the synthetic IRES has improved function and / or expression and / or stability as compared to a naturally occurring IRES. BRIEF DESCRIPTION OF THE DRAWINGS [8] FIG. 1 depicts a graphical representation of exemplary high expressing internal ribosome entry sites (IRES) displayed in clusters for Type I, Type II, and Type V IRES. Expression was measured in primary human hepatocytes (PHH), T cell lymphocytes (TCL) and myotubes (MYO). [9] FIGs.2A-C depict coxsackievirus B3 (CVB3) IRES secondary structure alignment and folding based on homology of its domains. DETAILED DESCRIPTION

[0010] The present disclosure provides, among other things, precursor RNAs for producing circular RNAs and the produced circular RNAs. In some embodiments, such produced circular RNAs have improved properties, such as improved circularization efficiency. In some embodiments, the precursor RNAs comprise Group I or Group II exon and / or intron segments. In certain embodiments, the precursor RNAs and / or circular RNAs comprise one or more 3Attorney Docket No. 01318-0014-00PCT OR-043WO modified nucleotides or nucleosides. Also provided herein are related compositions (e.g., template DNAs or lipid nanoparticles). Also provided herein are methods for the selection, design, preparation, manufacture, formulation, and / or use of RNA preparations, such as precursor RNAs or circular RNAs.

[0011] Reference will now be made in detail to certain embodiments, examples of which are illustrated in the accompanying drawings. While the disclosure is described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the disclosure to those embodiments. On the contrary, the disclosure is intended to cover all alternatives, modifications, and equivalents, which may be included within the disclosure as defined by the appended claims and included embodiments.

[0012] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.

[0013] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. Also, the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings.

[0014] Unless specifically noted in the specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of” or “consisting essentially of” the recited components; embodiments in the specification that recite “consisting of” various components are also contemplated as “comprising” or “consisting essentially of” the recited components; and embodiments in the specification that recite “consisting essentially of” various components are also contemplated as “consisting of” or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims). The term “or” is used in an inclusive sense, i.e., equivalent to “and / or,” unless the context clearly indicates otherwise.

[0015] The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined in this specification or any other express 4Attorney Docket No. 01318-0014-00PCT OR-043WO content of this specification, this specification controls. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art. 1. DEFINITIONS

[0016] Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:

[0017] As used herein, linear nucleic acid molecules are said to have a “5’-terminus” (or “5’ end”) and a “3’-terminus” (or “3’ end”) because nucleic acid phosphodiester linkages occur at the 5’ carbon and 3’ carbon of the sugar moieties of the substituent mononucleotides. The end nucleotide of a polynucleotide at which a new linkage would be to a 5’ carbon is its 5’ terminal nucleotide. The end nucleotide of a polynucleotide at which a new linkage would be to a 3’ carbon is its 3’ terminal nucleotide. A “terminal nucleotide,” as used herein, is the nucleotide at the end position of the 3’- or 5’-terminus.

[0018] As used herein, the term “3’ intron segment” (or “3’ intron fragment”) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% similarity to the 3’-proximal end of a natural intron (e.g., a group I or group II intron). In certain embodiments, the 3’ intron segment includes the 5’ nucleotide of the splice site dinucleotide. “3’ exon segment” (or “3’ exon fragment”) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% similarity to the 5’-proximal end of an exon adjacent to a “3’ intron segment” as described herein. In certain embodiments, the 3’ exon segment includes the 3’ nucleotide of the splice site dinucleotide.

[0019] The term “5’ intron segment” (or “5’ intron fragment”) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher 100% similarity to the 5’-proximal end of a natural intron (e.g., a group I or group II intron). In certain embodiments, the 5’ intron segment includes the 3’ nucleotide of the splice site dinucleotide. “5’ exon segment” (or “5’ exon fragment”) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher 100% 5Attorney Docket No. 01318-0014-00PCT OR-043WO similarity to the 3’-proximal end of an exon adjacent to a “5’ intron segment” as described herein. In certain embodiments, the 5’ exon segment includes the 5’ nucleotide of the splice site dinucleotide.

[0020] In some embodiments, the 3’ intron segment and the 3’ exon segment together form a first portion of an autocatalytic or self-splicing intron-exon sequence. In some embodiments, the 5’ intron segment and the 5’ exon segment together form the remainder (i.e., second portion) of the autocatalytic or self-splicing intron-exon sequence. In these embodiments, a linear nucleic acid molecule, e.g., RNA, comprising the 3’ intron segment and the 3’ exon segment at the 5’ end of the linear nucleic acid molecule and further the 5’ intron segment and the 5’ exon segment at the 3’ end the linear nucleic acid molecule, is capable of autocatalytically self-splicing and thereby capable of forming a circular nucleic acid molecule, e.g., circular RNA. In these embodiments, the 3’ intron segment and the 5’ intron segments are excised from the circular nucleic acid molecule, e.g., circular RNA, and the 3’ exon segment and the 5’ exon segment are retained in the circular nucleic acid molecule, e.g., circular RNA. Each retained post-splicing exon segment may be referred to as a self-splicing or self-spliced exon segment, e.g., a 3’ self-splicing or self-spliced exon segment and a 5’ self-splicing or self- spliced exon segment.

[0021] In some embodiments, the intron segment is a “Group I intron” and the corresponding exon segment may be referred to as a “Group I exon” or “Group 1 self-splicing exon” or “Group I self-spliced exon segment” or the like. In some embodiments, the intron segment is a “Group II intron” and the corresponding exon segment may be referred to as a “Group II exon” or “Group II self-splicing exon” or “Group II self-spliced exon segment” or the like.

[0022] In some embodiments, the retained, post-splicing, self-splicing 3’ or 5’ exon segment is a non-coding sequence in the circular nucleic acid molecule, e.g., circular RNA. In some embodiments, the circular nucleic acid molecule, e.g., circular RNA, further comprises a desired coding sequence, and the retained, post-splicing, self-splicing 3’ or 5’ exon segment is (e.g., designed) to be a portion of the desired expression sequence, contiguous with the desired coding sequence, and / or in frame with the desired coding sequence.

[0023] Within a circular nucleic acid molecule, e.g., derived from a linear nucleic acid precursor, and comprising a coding sequence, the 5’ to 3’ orientation of the coding sequence may be used to inform whether other sequences within the circular nucleic acid are 5’ and / or 3’, e.g., for example, 5’ is nearer to the 5’ of the coding sequence, and the 3’ end is downstream 6Attorney Docket No. 01318-0014-00PCT OR-043WO of the coding sequence. As used herein, within a circular nucleic acid molecule, e.g., derived from a linear nucleic acid precursor, reference to a “5’” or “3’” portion of the molecule may correspond to the orientation of the sequence within the linear nucleic acid precursor.

[0024] As used herein, “splice site” refers to the junction consisting of a dinucleotide between an exon and an intron in an unspliced RNA. As used herein, the term “splice site” refers to a dinucleotide that is partially or fully included in a group I or group II intron and / or exon and between which a phosphodiester bond is cleaved during RNA circularization. A “splice site dinucleotide” refers two nucleotides: a 5’ splice site nucleotide and the 3’ splice site nucleotide. A “5’ splice site” refers to the natural 5’ dinucleotide of the intron and / or exon e.g., group I or group II intron and / or exon, while a “3’ splice site” refers to the natural 3’ dinucleotide of the intron and / or exon. Exemplary splice site dinucleotides are shown in the table below. Table: Exemplary Splice Site Dinucleotides7Attorney Docket No. 01318-0014-00PCT OR-043WO

[0025] As used herein, the term “permutation site” refers to a site in an intron and / or exon 8Attorney Docket No. 01318-0014-00PCT OR-043WO (e.g., a group I or II intron and / or exon) where a cut is made prior to permutation of the intron / or exon. For example, such a cut generates an intron sequence comprising a 3’ intron segment and a sequence comprising a 5’ intron segment (e.g., group I or group II intron fragments) that are permuted to be on either side of a stretch of precursor RNA to be circularized. The permuted intron segments are thereby called “3’ permuted intron segments” or “3’ permuted elements” and “5’ permuted intron segments” or “5’ permuted elements” in the context of said precursor RNA. As used herein, “permuted intron segment” and “permuted intron element” are used interchangeably. In some embodiments, the permutation site consists of a dinucleotide.

[0026] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a cell” includes combinations of two or more cells, or entire cultures of cells; reference to “a polynucleotide” includes, as a practical matter, many copies of that polynucleotide.

[0027] A used herein, the terms “about,” or “approximately” are understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. “About” can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term “about.”

[0028] As used herein, “accessory element” or “accessory sequences” refers to internal spacer(s), external spacer(s), and / or homology arm(s). As used herein, a “combined accessory element” or “combined accessory sequences” comprises the accessory element and further comprises an intron and / or exon segment. In some embodiments, the accessory element increases circularization efficiency and / or translation efficiency in a circular RNA as compared to a control circular RNA without the accessory sequences.

[0029] As used herein, an “affinity sequence” or “affinity tag” is a region of a polynucleotide sequence ranging from one (1) nucleotide to hundreds or thousands of nucleotides containing a repeated set of nucleotides for the purposes of aiding purification of a polynucleotide sequence. For example, an affinity sequence may comprise, but is not limited to, a polyA or polyAC sequence. In some embodiments, affinity tags are used in purification methods, referred to herein as “affinity-purification,” in which selective binding of a binding agent to molecules comprising an affinity tag facilitates separation from molecules that do not comprise an affinity tag. In some embodiments, an affinity-purification method is a “negative selection” purification method, in which unwanted species, such as linear RNA, are selectively 9Attorney Docket No. 01318-0014-00PCT OR-043WO bound and removed and wanted species, such as circular RNA, are eluted and separated from unwanted species.

[0030] An “antigen” refers to any molecule that provokes an immune response or is capable of being bound by an antibody or an antigen binding molecule. The immune response may involve either antibody production, or the activation of specific immunologically - competent cells, or both. A person of skill in the art would readily understand that any macromolecule, including virtually all proteins or peptides, may serve as an antigen. An antigen may be endogenously expressed, i.e. expressed by genomic DNA, or may be recombinantly expressed. An antigen may be specific to a certain tissue, such as a cancer cell, or it may be broadly expressed. In addition, fragments of larger molecules may act as antigens. In some embodiments, antigens are tumor antigens.

[0031] An “antigen binding molecule,” “antigen binding portion,” or “antibody fragment” refers to any molecule that specifically binds to a desired antigen. In some embodiments, an antigen binding molecule comprises the antigen binding parts (e.g., CDRs) of an antibody or antibody-like molecule. An antigen binding molecule may include the antigenic complementarity determining regions (CDRs). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, dAb, linear antibodies, scFv antibodies, and multispecific antibodies formed from antigen binding molecules. Peptibodies (i.e., Fc fusion molecules comprising peptide binding domains) are another example of suitable antigen binding molecules. In some embodiments, the antigen binding molecule binds to an antigen on a tumor cell. In some embodiments, the antigen binding molecule binds to an antigen on a cell involved in a hyperproliferative disease or to a viral or bacterial antigen. In further embodiments, the antigen binding molecule is an antibody fragment, including one or more of the complementarity determining regions (CDRs) thereof, that specifically binds to the antigen. In further embodiments, the antigen binding molecule is a single chain variable fragment (scFv). In some embodiments, the antigen binding molecule comprises or consists of avimers.

[0032] The term “antibody” (Ab) includes, without limitation, a glycoprotein immunoglobulin which binds specifically to an antigen. In general, an antibody may comprise at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or an antigen-binding molecule thereof. Each H chain may comprise a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region can comprise three constant domains, CH1, CH2 and CH3. Each light chain can comprise a light chain variable region (abbreviated herein as VL) and a light chain constant region. The 10Attorney Docket No. 01318-0014-00PCT OR-043WO light chain constant region can comprise one constant domain, CL. The VH and VL regions may be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR). CDRs may be described by numbering known in the art, for example, Kabat numbering, Chothia numbering, AbM numbering, or contact numbering. Each VH and VL may comprise three CDRs and four FRs, arranged from amino-terminus to carboxy- terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the Abs may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system. Antibodies may include, for example, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, engineered antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, an antibody light chain monomer, an antibody heavy chain monomer, an antibody light chain dimer, an antibody heavy chain dimer, an antibody light chain- antibody heavy chain pair, intrabodies, antibody fusions (sometimes referred to herein as “antibody conjugates”), heteroconjugate antibodies, single domain antibodies, monovalent antibodies, single chain antibodies or single- chain variable fragments (scFv), camelized antibodies, affybodies, Fab fragments, F(ab’)2 fragments, disulfide-linked variable fragments (sdFv), anti-idiotypic (anti-id) antibodies (including, e.g., anti-anti-Id antibodies), minibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as “antibody mimetics”), and antigen-binding fragments of any of the above. In some embodiments, antibodies described herein refer to polyclonal antibody populations.

[0033] An immunoglobulin may derive from any of the commonly known isotypes, including but not limited to IgA, secretory IgA, IgG and IgM. IgG subclasses are also well known to those in the art and include but are not limited to human IgG1, IgG2, IgG3 and IgG4. “Isotype” refers to the Ab class or subclass (e.g., IgM or IgG1) that is encoded by the heavy chain constant region genes. The term “antibody” includes, by way of example, both naturally occurring and non-naturally occurring Abs; monoclonal and polyclonal Abs; chimeric and humanized Abs; human or nonhuman Abs; wholly synthetic Abs; and single chain Abs. A nonhuman Ab may be humanized by recombinant methods to reduce its immunogenicity in 11Attorney Docket No. 01318-0014-00PCT OR-043WO humans. Where not expressly stated, and unless the context indicates otherwise, the term “antibody” also includes an antigen-binding fragment or an antigen-binding portion of any of the aforementioned immunoglobulins, and includes a monovalent and a divalent fragment or portion, and a single chain Ab.

[0034] As used herein, the terms “variable region” or “variable domain” are used interchangeably and are common in the art. The variable region typically refers to a portion of an antibody, generally, a portion of a light or heavy chain, typically about the amino-terminal 110 to 120 amino acids in the mature heavy chain and about 90 to 115 amino acids in the mature light chain, which differ extensively in sequence among antibodies and are used in the binding and specificity of a particular antibody for its particular antigen. The variability in sequence is concentrated in those regions called complementarity determining regions (CDRs) while the more highly conserved regions in the variable domain are called framework regions (FR). Without wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with antigen. In some embodiments, the variable region is a human variable region. In some embodiments, the variable region comprises rodent or murine CDRs and human framework regions (FRs). In particular embodiments, the variable region is a primate (e.g., non-human primate) variable region. In some embodiments, the variable region comprises rodent or murine CDRs and primate (e.g., non-human primate) framework regions (FRs). The terms “VL” and “VL domain” are used interchangeably to refer to the light chain variable region of an antibody or an antigen-binding molecule thereof. The terms “VH” and “VH domain” are used interchangeably to refer to the heavy chain variable region of an antibody or an antigen-binding molecule thereof.

[0035] As used herein, the terms “constant region” and “constant domain” are interchangeable and have a meaning common in the art. The constant region is an antibody portion, e.g., a carboxyl terminal portion of a light and / or heavy chain which is not directly involved in binding of an antibody to antigen but which may exhibit various effector functions, such as interaction with the Fc receptor. The constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence relative to an immunoglobulin variable domain.

[0036] As used herein, “aptamer” refers in general to either an oligonucleotide of a single defined sequence or a mixture of said nucleotides, wherein the mixture retains the properties of binding specifically to the target molecule (e.g., eukaryotic initiation factor, 40S ribosome, 12Attorney Docket No. 01318-0014-00PCT OR-043WO polyC binding protein, polyA binding protein, polypyrimidine tract-binding protein, argonaute protein family, Heterogeneous nuclear ribonucleoprotein K and La and related RNA-binding protein). Thus, as used herein “aptamer” denotes both singular and plural sequences of nucleotides, as defined hereinabove. The term “aptamer” is meant to refer to a single- or double-stranded nucleic acid which is capable of binding to a protein or other molecule. In general, aptamers preferably comprise about 10 to about 100 nucleotides, preferably about 15 to about 40 nucleotides, more preferably about 20 to about 40 nucleotides, in that oligonucleotides of a length that falls within these ranges are readily prepared by conventional techniques. Optionally, aptamers can further comprise a minimum of approximately 6 nucleotides, preferably 10, and more preferably 14 or 15 nucleotides, that are necessary to effect specific binding.

[0037] As used herein, “autoimmunity” is defined as persistent and progressive immune reactions to non-infectious self-antigens, as distinct from infectious non self-antigens from bacterial, viral, fungal, or parasitic organisms which invade and persist within mammals and humans. Autoimmune conditions include scleroderma, Grave's disease, Crohn's disease, Sjorgen's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrinopathy syndromes, Type I diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveoretinitis, polymyositis, colitis, and thyroiditis, as well as in the generalized autoimmune diseases typified by human Lupus.

[0038] “Autoantigen” or “self-antigen” as used herein refers to an antigen or epitope which is native to the mammal and which is immunogenic in said mammal.

[0039] The term “autologous” refers to any material derived from the same individual to which it is later to be re-introduced. For example, the engineered autologous cell therapy (eACT™) method described herein involves collection of lymphocytes from a patient, which are then engineered to express, e.g., a CAR construct, and then administered back to the same patient.

[0040] “Binding affinity” generally refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, “binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y may generally be represented by the dissociation constant (KDor Kd). Affinity may be measured and / or expressed in a number of ways known in the art, including, but not limited to, equilibrium 13Attorney Docket No. 01318-0014-00PCT OR-043WO dissociation constant (KD), and equilibrium association constant (KA or Ka). The KD is calculated from the quotient of koff / kon, whereas KAis calculated from the quotient of kon / koff. kon refers to the association rate constant of, e.g., an antibody to an antigen, and koff refers to the dissociation of, e.g., an antibody to an antigen. The kon and koff may be determined by techniques known to one of ordinary skill in the art, such as BIACORE® or KinExA.

[0041] As used herein, the term, “specifically binds,” refers to molecules that bind to an antigen (e.g., epitope or immune complex) as such binding is understood by one skilled in the art. For example, a molecule that specifically binds to an antigen may bind to other peptides or polypeptides, generally with lower affinity as determined by, e.g., immunoassays, BIACORE®, KinExA 3000 instrument (Sapidyne Instruments, Boise, ID), or other assays known in the art. In a specific embodiment, molecules that specifically bind to an antigen bind to the antigen with a KAthat is at least 2 logs, 2.5 logs, 3 logs, 4 logs or greater than the KAwhen the molecules bind to another antigen.

[0042] As used herein, “bicistronic RNA” refers to a polynucleotide that includes two expression sequences coding for two distinct proteins. These expression sequences can be separated by a nucleotide sequence encoding a cleavable peptide such as a protease cleavage site. They can also be separated by a ribosomal skipping element.

[0043] A “cancer” refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. A “cancer” or “cancer tissue” may include a tumor. Examples of cancers that may be treated by the methods disclosed herein include, but are not limited to, cancers of the immune system including lymphoma, leukemia, myeloma, and other leukocyte malignancies. In some embodiments, the methods disclosed herein may be used to reduce the tumor size of a tumor derived from, for example, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, multiple myeloma, Hodgkin's Disease, non- Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, cancer of the urethra, cancer of the penis, chronic or acute 14Attorney Docket No. 01318-0014-00PCT OR-043WO leukemia, acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia (ALL) (including non T cell ALL), chronic lymphocytic leukemia (CLL), solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary adenoma, epidermoid cancer, squamous cell cancer, T cell lymphoma, environmentally induced cancers including those induced by asbestos, other B cell malignancies, and combinations of said cancers. In some embodiments, the methods disclosed herein may be used to reduce the tumor size of a tumor derived from, for example, sarcomas and carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, Kaposi's sarcoma, sarcoma of soft tissue, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, hepatocellular carcinomna, lung cancer, colorectal cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma (for example adenocarcinoma of the pancreas, colon, ovary, lung, breast, stomach, prostate, cervix, or esophagus), sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, bladder carcinoma, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, carcinoma of the renal pelvis, CNS tumors (such as a glioma, astrocytoma, medulloblastoma, craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma and retinoblastoma). The particular cancer may be responsive to chemo- or radiation therapy or the cancer may be refractory. A refractory cancer refers to a cancer that is not amenable to surgical intervention and the cancer is either initially unresponsive to chemo- or radiation therapy or the cancer becomes unresponsive over time.

[0044] As used herein, the terms “circRNA,” “circular polyribonucleotide,” “circular RNA,” “circularized RNA,” “circular RNA polynucleotide” and “oRNA” are used interchangeably and refer to a single-stranded polyribonucleotide wherein the 3’ and 5’ ends that are normally present in a linear RNA polynucleotide have been joined together, e.g., by covalent bonds. As used herein, such terms also include preparations comprising circRNAs.

[0045] As used herein, the term “circularization efficiency” refers to a measurement of the rate of formation of amount of resultant circular polyribonucleotide as compared to its 15Attorney Docket No. 01318-0014-00PCT OR-043WO linear starting material.

[0046] The expression sequences in the polynucleotide construct may be separated by a “cleavage site” sequence which enables polypeptides encoded by the expression sequences, once translated, to be expressed separately by the cell, e.g., eukaryotic cell. A “self-cleaving peptide” refers to a peptide which is translated without a peptide bond between two adjacent amino acids, or functions such that when the polypeptide comprising the proteins and the self- cleaving peptide is produced, it is immediately cleaved or separated into distinct and discrete first and second polypeptides without the need for any external cleavage activity.

[0047] As used herein, “co-administering” refers to administering a therapeutic agent provided herein in conjunction with one or more additional therapeutic agents sufficiently close in time such that the therapeutic agent provided herein can enhance the effect of the one or more additional therapeutic agents, or vice versa.

[0048] As used herein, “coding element,” “coding sequence,” “coding nucleic acid,” or “coding region” is region located within the expression sequence and encodings for one or more proteins or polypeptides (e.g., therapeutic protein).

[0049] As used herein, a “noncoding element,” “noncoding sequence,” “non-coding nucleic acid,” or “noncoding nucleic acid” is a region located within the expression sequence. This sequence by itself does not encode for a protein or polypeptide, but may have other regulatory functions, including but not limited, allow the overall polynucleotide to act as a biomarker or adjuvant to a specific cell.

[0050] A “costimulatory ligand,” as used herein, includes a molecule on an antigen presenting cell that specifically binds a cognate co-stimulatory molecule on a T cell. Binding of the costimulatory ligand provides a signal that mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like. A costimulatory ligand induces a signal that is in addition to the primary signal provided by a stimulatory molecule, for instance, by binding of a T cell receptor (TCR) / CD3 complex with a major histocompatibility complex (MHC) molecule loaded with peptide. A co-stimulatory ligand may include, but is not limited to, 3 / TR6, 4-IBB ligand, agonist or antibody that binds Toll-like receptor, B7-1 (CD80), B7-2 (CD86), CD30 ligand, CD40, CD7, CD70, CD83, herpes virus entry mediator (HVEM), human leukocyte antigen G (HLA-G), ILT4, immunoglobulin-like transcript (ILT) 3, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), ligand that specifically binds with B7-H3, lymphotoxin beta receptor, MHC class I chain-related protein A (MICA), MHC class I chain-related protein B (MICB), OX40 ligand, PD-L2, or programmed 16Attorney Docket No. 01318-0014-00PCT OR-043WO death (PD) LI. A co-stimulatory ligand includes, without limitation, an antibody that specifically binds with a co-stimulatory molecule present on a T cell, such as, but not limited to, 4-1BB, B7-H3, CD2, CD27, CD28, CD30, CD40, CD7, ICOS, ligand that specifically binds with CD83, lymphocyte function- associated antigen-1 (LFA-1), natural killer cell receptor C (NKG2C), OX40, PD-1, or tumor necrosis factor superfamily member 14 (TNFSF14 or LIGHT).

[0051] A “costimulatory molecule” is a cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, 4-1BB / CD137, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD 33, CD 45, CD100 (SEMA4D), CD103, CD134, CD137, CD154, CD16, CD160 (BY55), CD 18, CD19, CD19a, CD2, CD22, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 (alpha; beta; delta; epsilon; gamma; zeta), CD30, CD37, CD4, CD4, CD40, CD49a, CD49D, CD49f, CD5, CD64, CD69, CD7, CD80, CD83 ligand, CD84, CD86, CD8alpha, CD8beta, CD9, CD96 (Tactile), CD1- la, CDl-lb, CDl-lc, CDl-ld, CDS, CEACAM1, CRT AM, DAP-10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, ICAM-1, ICOS, Ig alpha (CD79a), IL2R beta, IL2R gamma, IL7R alpha, integrin, ITGA4, ITGA4, ITGA6, IT GAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), LTBR, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1 (CD1 la / CD18), MHC class I molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX40, PAG / Cbp, PD-1, PSGL1, SELPLG (CD162), signaling lymphocytic activation molecule, SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF, TNFr, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or fragments, truncations, or combinations thereof.

[0052] As used herein, an antigen binding molecule, an antibody, or an antigen binding molecule thereof “cross-competes” with a reference antibody or an antigen binding molecule thereof if the interaction between an antigen and the first binding molecule, an antibody, or an antigen binding molecule thereof blocks, limits, inhibits, or otherwise reduces the ability of the reference binding molecule, reference antibody, or an antigen binding molecule thereof to interact with the antigen. Cross competition may be complete, e.g., binding of the binding molecule to the antigen completely blocks the ability of the reference binding molecule to bind the antigen, or it may be partial, e.g., binding of the binding molecule to the antigen reduces 17Attorney Docket No. 01318-0014-00PCT OR-043WO the ability of the reference binding molecule to bind the antigen. In some embodiments, an antigen binding molecule that cross-competes with a reference antigen binding molecule binds the same or an overlapping epitope as the reference antigen binding molecule. In other embodiments, the antigen binding molecule that cross-competes with a reference antigen binding molecule binds a different epitope as the reference antigen binding molecule. Numerous types of competitive binding assays may be used to determine if one antigen binding molecule competes with another, for example: solid phase direct or indirect radioimmunoassay (RIA); solid phase direct or indirect enzyme immunoassay (EIA); sandwich competition assay (Stahli et al., 1983, Methods in Enzymology 9:242-253); solid phase direct biotin-avidin EIA (Kirkland et al., 1986, J. Immunol. 137:3614-3619); solid phase direct labeled assay, solid phase direct labeled sandwich assay (Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press); solid phase direct label RIA using 1-125 label (Morel et al., 1988, Molec. Immunol.25:7-15); solid phase direct biotin-avidin EIA (Cheung, et al., 1990, Virology 176:546-552); and direct labeled RIA (Moldenhauer et al., 1990, Scand. J. Immunol. 32:77-82).

[0053] A “cytokine,” as used herein, refers to a non-antibody protein that is released by one cell in response to contact with a specific antigen, wherein the cytokine interacts with a second cell to mediate a response in the second cell. A cytokine may be endogenously expressed by a cell or administered to a subject. Cytokines may be released by immune cells, including macrophages, B cells, T cells, neutrophils, dendritic cells, eosinophils and mast cells to propagate an immune response. Cytokines may induce various responses in the recipient cell. Cytokines may include homeostatic cytokines, chemokines, pro- inflammatory cytokines, effectors, and acute-phase proteins. For example, homeostatic cytokines, including interleukin (IL) 7 and IL-15, promote immune cell survival and proliferation, and pro- inflammatory cytokines may promote an inflammatory response. Examples of homeostatic cytokines include, but are not limited to, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p40, IL-12p70, IL-15, and interferon (IFN) gamma. Examples of pro-inflammatory cytokines include, but are not limited to, IL-la, IL-lb, IL- 6, IL-13, IL-17a, IL-23, IL-27, tumor necrosis factor (TNF)-alpha, TNF-beta, fibroblast growth factor (FGF) 2, granulocyte macrophage colony-stimulating factor (GM- CSF), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-1), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, and placental growth factor (PLGF). Examples of effectors include, but are not limited to, granzyme A, granzyme B, soluble Fas ligand (sFasL), TGF-beta, IL-35, and perforin. 18Attorney Docket No. 01318-0014-00PCT OR-043WO Examples of acute phase-proteins include, but are not limited to, C-reactive protein (CRP) and serum amyloid A (SAA).

[0054] The terms “deoxyribonucleic acid” and “DNA” as used herein mean a polymer composed of deoxyribonucleotides. The terms “ribonucleic acid” and “RNA” as used herein mean a polymer composed of ribonucleotides.

[0055] As used herein, the term “DNA template” refers to a DNA sequence capable of transcribing a linear RNA polynucleotide. For example, but not intending to be limiting, a DNA template may include a DNA vector, PCR product or plasmid.

[0056] As used herein, the terms “duplexed,” “double-stranded,” and “hybridized” are used interchangeably and refer to double-stranded nucleic acids formed by hybridization of two single strands of nucleic acids containing complementary sequences. Sequences of the two single-stranded nucleic acids can be fully complementary or partially complementary. In some embodiments, a nucleic acid provided herein may be fully double-stranded or partially double- stranded. In most cases, genomic DNA is double-stranded.

[0057] As used herein, two “duplex sequences,” “duplex forming sequences,” “duplex region,” “duplex forming regions,” “homology arms,” or “homology regions,” complement, or are complementary, fully or partially, to one another when the two regions share a sufficient level of sequence identity to one another’s reverse complement to act as substrates for a hybridization reaction. In some embodiments, two duplex forming sequences are thermodynamically favored to cross-pair in a sequence specific interaction. As used herein, polynucleotide sequences have “homology” when they are either identical or share sequence identity to a reverse complement or “complementary” sequence. The percent sequence identity between a homology region and a counterpart homology region’s reverse complement can be any percent of sequence identity that allows for hybridization to occur. In some embodiments, an internal duplex forming region of a polynucleotide disclosed herein is capable of forming a duplex with another internal duplex forming region and does not form a duplex with an external duplex forming region.

[0058] As used herein, the term “encode” refers broadly to any process whereby the information in a polymeric macromolecule is used to direct the production of a second molecule that is different from the first. The second molecule may have a chemical structure that is different from the chemical nature of the first molecule. For example, a DNA template (e.g., a DNA vector) may encode a RNA polynucleotide; a precursor RNA polynucleotide (e.g., a linear precursor RNA polynucleotide) may encode a mature RNA polynucleotide (e.g., a 19Attorney Docket No. 01318-0014-00PCT OR-043WO circular RNA polynucleotide).

[0059] As used herein, “endogenous” means a substance that is native to, i.e., naturally originated from, a biological system (e.g., an organism, a tissue, or a cell). For example, in some embodiments, a “endogenous polynucleotide” is normally expressed in a cell or tissue. In some embodiments, a polynucleotide is still considered endogenous if the control sequences, such as a promoter or enhancer sequences which activate transcription or translation, have been altered through recombinant techniques.

[0060] As used herein, the term “heterologous” means from any source other than naturally occurring sequences.

[0061] As used herein, an “endonuclease site” refers to a stretch of nucleotides within a polynucleotide that is capable of being recognized and cleaved by an endonuclease protein.

[0062] An “eukaryotic initiation factor” or “eIF” refers to a protein or protein complex used in assembling an initiator tRNA, 40S and 60S ribosomal subunits required for initiating eukaryotic translation.

[0063] As used herein, an “epitope” is a term in the art and refers to a localized region of an antigen to which an antibody may specifically bind. An epitope may be, for example, contiguous amino acids of a polypeptide (linear or contiguous epitope) or an epitope can, for example, come together from two or more non-contiguous regions of a polypeptide or polypeptides (conformational, non-linear, discontinuous, or non-contiguous epitope). In some embodiments, the epitope to which an antibody binds may be determined by, e.g., NMR spectroscopy, X-ray diffraction crystallography studies, ELISA assays, hydrogen / deuterium exchange coupled with mass spectrometry (e.g., liquid chromatography electrospray mass spectrometry), array -based oligo-peptide scanning assays, and / or mutagenesis mapping (e.g., site- directed mutagenesis mapping). For X-ray crystallography, crystallization may be accomplished using any of the known methods in the art (e.g., Giege R et al., (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4): 339-350; McPherson A (1990) Eur J Biochem 189: 1- 23; Chayen NE (1997) Structure 5: 1269- 1274; McPherson A (1976) J Biol Chem 251: 6300- 6303). Antibody: antigen crystals may be studied using well known X-ray diffraction techniques and may be refined using computer software such as X- PLOR (Yale University, 1992, distributed by Molecular Simulations, Inc.; see e.g. Meth Enzymol (1985) volumes 114 & 115, eds Wyckoff HW et al.; U.S. Patent Publication No. 2004 / 0014194), and BUSTER (Bricogne G (1993) Acta Crystallogr D Biol Crystallogr 49(Pt 1): 37-60; Bricogne G (1997) Meth Enzymol 276A: 361-423, ed Carter CW; Roversi P et al., (2000) Acta Crystallogr D Biol 20Attorney Docket No. 01318-0014-00PCT OR-043WO Crystallogr 56(Pt 10): 1316-1323).

[0064] As used herein, the term “expression sequence” refers to a nucleic acid sequence that encodes a product, e.g., a peptide or polypeptide, regulatory nucleic acid, or non-coding nucleic acid. An exemplary expression sequence that codes for a peptide or polypeptide can comprise a plurality of nucleotide triads, each of which can code for an amino acid and is termed as a “codon.”

[0065] As used herein, a “fusion protein” is a protein with at least two domains that are encoded by separate genes that have been joined to transcribe for a single peptide.

[0066] As used herein, the term “genetically engineered” or “engineered” refers to a method of modifying the genome of a cell, including, but not limited to, deleting a coding or non-coding region or a portion thereof or inserting a coding region or a portion thereof. In some embodiments, the cell that is modified is a lymphocyte, e.g., a T cell, which may either be obtained from a patient or a donor. The cell may be modified to express an exogenous construct, such as, e.g., a chimeric antigen receptor (CAR) or a T cell receptor (TCR), which is incorporated into the cell's genome.

[0067] As used herein, an “immune response” refers to the action of a cell of the immune system (for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils) and soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and / or elimination from a vertebrate's body of invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues.

[0068] As used herein, the term “immunogenic” or “immunostimulatory” refers to a potential to induce an immune response to a substance. An immune response may be induced when an immune system of an organism or a certain type of immune cells is exposed to an immunogenic substance. The term “non-immunogenic” refers to a lack of or absence of an immune response above a detectable threshold to a substance. No immune response is detected when an immune system of an organism or a certain type of immune cells is exposed to a non- immunogenic substance. In some embodiments, a non-immunogenic circular polyribonucleotide as provided herein, does not induce an immune response above a pre- determined threshold when measured by an immunogenicity assay. In some embodiments, no innate immune response is detected when an immune system of an organism or a certain type 21Attorney Docket No. 01318-0014-00PCT OR-043WO of immune cells is exposed to a non-immunogenic circular polyribonucleotide as provided herein. In some embodiments, no adaptive immune response is detected when an immune system of an organism or a certain type of immune cell is exposed to a non-immunogenic circular polyribonucleotide as provided herein.

[0069] As used herein, an “internal ribosome entry site” or “IRES” refers to an RNA sequence or structural element ranging in size from 10 nt to 1000 nt or more, capable of initiating translation of a polypeptide in the absence of a typical RNA cap structure. An exemplary IRES can be about 500 nt to about 700 nt in length.

[0070] As used herein, an “intervening region” refers to the portion of an RNA sequence that comprises one or more noncoding or one or more coding elements, or combinations thereof (e.g., translation initiation element, coding element, and / or stop codon) between splice sites. In some embodiments, the intervening regions are between the 5’ combined accessory element and the 3’ combined accessory element or between the 3’ intron fragment and the 5’ intron fragment in a precursor RNA polynucleotide. In some embodiments, the intervening region is between the monotron element and terminal element in other precursor RNA polynucleotides.

[0071] As used herein, “isolated” or “purified” generally refers to isolation of a substance (for example, in some embodiments, a compound, a polynucleotide, a protein, a polypeptide, a polynucleotide composition, or a polypeptide composition) such that the substance comprises a significant percent (e.g., greater than 1%, greater than 2%, greater than 5%, greater than 10%, greater than 20%, greater than 50%, or more, usually up to about 90%-100%) of the sample in which it resides. In certain embodiments, a substantially purified component comprises at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% of the sample. In additional embodiments, a substantially purified component comprises about, 80%-85%, or 90%-95%, 95-99%, 96-99%, 97-99%, or 95-100% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density. Generally, a substance is purified when it exists in a sample in an amount, relative to other components of the sample, that is more than as it is found naturally.

[0072] As used herein, a “leading untranslated sequence” is a region of polynucleotide sequences ranging from 1 nucleotide to hundreds of nucleotides located at the upmost 5' end of a polynucleotide sequence. The sequences can be defined or can be random. A leading untranslated sequence is non-coding.

[0073] As used herein, a “terminal untranslated sequence” is a region of polynucleotide 22Attorney Docket No. 01318-0014-00PCT OR-043WO sequences ranging from 1 nucleotide to hundreds of nucleotides located at the downmost 3' end of a polynucleotide sequence. The sequences can be defined or can be random. A terminal untranslated sequence is non-coding.

[0074] As used herein, the terms “terminal sequence” or “terminal element” are used interchangeably to refer to an RNA sequence capable of complexing with a monotron sequence or monotron element. The terminal sequence comprises a splice site nucleotide from the natural group I or group II intron present in the monotron. In some embodiments, the terminal sequence further comprises a natural exon or a fragment thereof and / or a synthetic sequence.

[0075] The term “lymphocyte” as used herein includes natural killer (NK) cells, T cells, or B cells. NK cells are a type of cytotoxic (cell toxic) lymphocyte that represent a major component of the innate immune system. NK cells reject tumors and cells infected by viruses. It works through the process of apoptosis or programmed cell death. They were termed “natural killers” because they do not require activation in order to kill cells. T cells play a major role in cell-mediated-immunity (no antibody involvement). T cell receptors (TCR) differentiate T cells from other lymphocyte types. The thymus, a specialized organ of the immune system, is the primary site for T cell maturation. There are numerous types of T cells, including: helper T cells (e.g., CD4+ cells), cytotoxic T cells (also known as TC, cytotoxic T lymphocytes, CTL, T-killer cells, cytolytic T cells, CD8+ T cells or killer T cells), memory T cells ((i) stem memory cells (TSCM), like naive cells, are CD45RO-, CCR7+, CD45RA+, CD62L+ (L- selectin), CD27+, CD28+ and IL-7Ra+, but also express large amounts of CD95, IL-2R, CXCR3, and LFA-1, and show numerous functional attributes distinctive of memory cells); (ii) central memory cells (TCM) express L-selectin and CCR7, they secrete IL-2, but not IFNγ or IL-4, and (iii) effector memory cells (TEM), however, do not express L-selectin or CCR7 but produce effector cytokines like IFNγ and IL-4), regulatory T cells (Tregs, suppressor T cells, or CD4+CD25+ or CD4+ FoxP3+ regulatory T cells), natural killer T cells (NKT) and gamma delta T cells. B-cells, on the other hand, play a principal role in humoral immunity (with antibody involvement). B-cells make antibodies, are capable of acting as antigen- presenting cells (APCs) and turn into memory B-cells and plasma cells, both short-lived and long-lived, after activation by antigen interaction. In mammals, immature B-cells are formed in the bone marrow.

[0076] As used herein, a “miRNA site” refers to a stretch of nucleotides within a polynucleotide that is capable of forming a duplex with at least 8 nucleotides of a natural miRNA sequence. 23Attorney Docket No. 01318-0014-00PCT OR-043WO

[0077] As used herein, the terms “monotron,” “monotron sequence,” or “monotron element” are used interchangeably to refer a segment of a precursor RNA polynucleotide that is located at either the 5’ or 3’ end of the polynucleotide, i.e., either 5’ or 3’ from the intervening region. A monotron element refers to a sequence with 70% or higher similarity to a natural group I or group II intron including the splice site dinucleotide. In some embodiments, the monotron is capable of contributing to ribozymatic activity that allows it to enzymatically self- cleave. In some embodiments, the monotron is capable of forming a phosphodiester bond with a terminal sequence, i.e., a sequence containing a splice site dinucleotide and optionally a natural exon sequence or fragment thereof. In some embodiments, the terminal sequence is upstream of the monotron in a linear precursor. In some embodiments, the monotron sequence is upstream of the terminal sequence in a linear precursor. When the terminal sequence is upstream to the monotron in a linear precursor, the monotron can perform two transesterification reactions, e.g., sequentially, self-cleavage and formation of a phosphodiester bond with the terminal sequence. In embodiments in which the terminal sequence is upstream to the monotron in the linear precursor, (a) the monotron is capable of interacting with a nucleophile that is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron, and (b) the cleavage product of (a), i.e., the 5’ splice site nucleotide, e.g., having a 3’ hydroxyl group, engages in a transesterification reaction (cleaves) at the splice site nucleotide of the terminal sequence, yielding a circular RNA or oRNA. In these embodiments, the monotron interacts with the nucleophile (e.g., a guanosine, e.g., a free guanosine that is introduced to the precursor) by forming a binding pocket with the nucleophile, and the linear precursor is capable of adopting a conformation in which the nucleophile is in proximity to and is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron. When the monotron is upstream of the terminal sequence in a linear precursor, the monotron can also perform two transesterification reactions. In embodiments in which the monotron is upstream of the terminal sequence in the linear precursor, (a) the monotron is capable of interacting with a nucleophile that is capable of cleaving at the splice site nucleotide of the terminal element, and (b) the cleavage product of (a), i.e., the 5’ splice site nucleotide, e.g., having a 3’ hydroxyl group, engages in a transesterification reaction (cleaves) at the splice site dinucleotide at or near the 3’ end of the monotron, yielding a circular RNA or oRNA. In these embodiments, the monotron interacts with the nucleophile (e.g., a guanosine, e.g., a free guanosine that is introduced to the precursor) by forming a binding pocket with the nucleophile, and the linear precursor is capable of adopting a conformation in which the nucleophile is in proximity to and 24Attorney Docket No. 01318-0014-00PCT OR-043WO is capable of cleaving the splice site nucleotide of the terminal element.

[0078] In some embodiments, the monotron comprises a 5’ proximal end of a natural group I or group II intron including the splice site dinucleotide and optionally a natural exon sequence or fragment thereof. In some embodiments, the 5’ end of the monotron refers to nucleotides within the 5’ half of the monotron. In some embodiments, the 3’ end of the monotron refers to nucleotides within the 3’ half of the monotron. In some embodiments, at or near the 5’ end of the monotron refers to within the 5’ half of the monotron. In some embodiments, at or near the 5’ end of the monotron refers to within the first ten 5’ positions in the monotron. In some embodiments, at the 5’ end of the monotron refers to the first 5’ position(s) in the monotron. In some embodiments, at or near the 3’ end of the monotron refers to within the 3’ half of the monotron. In some embodiments, at or near the 3’ end of the monotron refers to within the last ten 3’ positions in the monotron. In some embodiments, at the 3’ end of the monotron refers to last 3’ position(s) in the monotron.

[0079] The term “naturally occurring” or “wild-type” (used interchangeably) IRES, or IRES domain or motif as used herein refers to, e.g., an IRES that does not contain a change that is present in a synthetic IRES. A “naturally occurring IRES” or a “wild-type IRES” refers to an IRES that has not been engineered to contain at least one addition, deletion, or substitution of a nucleotide, domain, or motif. Similarly, a “naturally occurring domain,” (e.g., “naturally occurring Domain II”) or “naturally occurring motif,” (e.g., “naturally occurring GNRA motif”) refers to a domain or a motif within a naturally occurring IRES or synthetic IRES where the domain or motif has not been engineered to contain at least one addition, deletion, or substitution of a nucleotide therein, or a deletion or substitution of the domain or motif in whole or in part. A synthetic IRES can comprise naturally occurring domains or motifs but can also comprise synthetic other domains or motifs. For example, a synthetic IRES can contain nucleotide additions, deletions, or substitutions within Domain I, while also containing a wild- type Domain II, Domain III, Domain IV, and Domain V. In such case, there would be no nucleotide additions, deletions, or substitutions within the wild-type Domain II, Domain III, Domain IV, or Domain V and no additions, deletions, or substitutions of Domain II, Domain III, Domain IV, or Domain V in whole or in part. In some embodiments, the “naturally occurring” IRES, domain, or motif refers to the starting IRES, domain, or motif before any changes are induced. As used herein, the term “retaining” or “preserving” or “conserving” a naturally occurring domain or motif refers to preserving the sequence of the naturally occurring domain or motif within an otherwise modified synthetic IRES. For example, if 25Attorney Docket No. 01318-0014-00PCT OR-043WO Domain II is retained or conserved, the synthetic IRES comprises a naturally occurring Domain II.

[0080] In certain instances where a synthetic IRES comprises a substitution of an entire domain or motif, the replacement domain or motif may be derived from a different IRES, e.g., from a second higher-expressing, naturally occurring, IRES. Replacing the domain or motif with that of a different IRES renders the initial IRES synthetic, even if the domain or motif does not contain any nucleotide modifications. For example, in some embodiments, the synthetic IRES comprises a substitution of a PPT tract in Domain IV, where the PPT tract sequence is from a second different IRES, e.g., a higher-expressing, naturally occurring, IRES. In that embodiment, the PPT tract in Domain IV of the synthetic IRES is not conserved because it differs from the PPT tract of the starting IRES. In some embodiments, the entirety of Domain IV is substituted with a Domain IV from a second different IRES. In some embodiments, the second different IRES is a higher-expressing, naturally occurring, IRES. In those embodiments, the resultant synthetic IRES neither is naturally occurring nor contains a naturally occurring Domain IV, even if the replacement Domain IV does not contain any individual nucleotide additions or deletions therein as compared to its sequence in the second different naturally occurring IRES.

[0081] The term “nucleophile” refers to a nucleophilic nucleotide or nucleoside capable of initiating a nucleophilic attack at a splice site and / or transesterification reaction (cleavage) at a splice site.

[0082] The term “nucleotide” and “nucleoside” refer to a ribonucleotide, a deoxyribonucleotide, or an analog thereof. Nucleotides include species that comprise purines, e.g., adenine, hypoxanthine, guanine, and their derivatives and analogs, as well as pyrimidines, e.g., cytosine, uracil, thymine, and their derivatives and analogs. Nucleosides are similar to nucleotides, e.g., comprising purines and pyrimidines, but without the additional phosphate group.

[0083] “Modified nucleotide or nucleosides,” or nucleoside or nucleotide “analogs” include nucleotides or nucleoside having modifications in the chemical structure of the base, sugar and / or phosphate, including, but not limited to, 5’-position pyrimidine modifications, 8’- position purine modifications, modifications at cytosine exocyclic amines, and substitution of 5-bromo-uracil; and 2’-position sugar modifications, including but not limited to, sugar- modified ribonucleotides in which the 2’-OH is replaced by a group such as an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety as defined herein. Nucleotide 26Attorney Docket No. 01318-0014-00PCT OR-043WO or nucleoside modifications are also meant to include nucleotides or nucleoside with bases such as inosine, queuosine, xanthine; sugars such as 2’-methyl ribose; non-natural phosphodiester linkages such as methylphosphonate, phosphorothioate and peptide linkages. Nucleotide or nucleoside modifications include 5-methoxyuridine, 1-methylpseudouridine, and 6- methyladenosine. Exemplary nucleotide or nucleotide modifications are described herein. As exhibited by the exemplary nucleotide or nucleotide modifications described in more detail herein (see section “Modified nucleotides or nucleosides”), such modifications differ from mutations selected from insertions, deletions, addition, or subtraction of nucleotides, for example, the mutations in a permuted Group I and Group II intron segment; or the additions, deletions, or substitutions of a nucleotide, domain, or motif present in a synthetic IRES (as compared to the naturally occurring IRES).

[0084] As used herein, a nucleotide or nucleoside “comprising no nucleotide or nucleoside modifications” (i.e., comprising 0% modifications) can be interchangeable with “an unmodified nucleotide or nucleoside” in context. A modified nucleotide or nucleoside can have a modification, e.g., between 1% and 100%, 1% and 2%, 1% and 3%, 1% and 4%, 1% and 5%, 5% and 6%, 5% and 7%, 5% and 8%, 5% and 9%, 5% and 10%, 10% and 20%, 20% and 30%, 30% and 40%, 40% and 50%, 50% and 60%, 60% and 70%, 70% and 80%, 80% and 90% or 90% and 100% of the nucleotides or nucleosides are modified. In some embodiments, “% modification” refers to the level of incorporation within a polynucleotide, i.e., the number of modified nucleotides or nucleosides in a polynucleotide sequence divided by the total number of nucleotides or nucleosides (modified or unmodified) in the polynucleotide sequence. In some embodiments, “% modification” refers to the relative quantity of modified nucleotide or nucleoside used to generate the polynucleotide (e.g., 5% modified adenosine refers to feeding 5 mM modified adenosine and 95 mM unmodified adenosine to generate a polynucleotide sequence).

[0085] All nucleotide sequences disclosed herein can represent an RNA sequence or a corresponding DNA sequence. It is understood that deoxythymidine (dT or T) in a DNA is transcribed into a uridine (U) in an RNA. As such, “T” and “U” may be used interchangeably herein in nucleotide sequences.

[0086] The terms “nucleic acid”, “polynucleotide”, and “nucleic acid molecule,” are used interchangeably herein to describe a polymer of any length, e.g., greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, or up to about 10,000 or more bases, composed of nucleotides, e.g., 27Attorney Docket No. 01318-0014-00PCT OR-043WO deoxyribonucleotides or ribonucleotides, and may be produced enzymatically or synthetically (e.g., as described in U.S. Pat. No. 5,948,902 and the references cited therein), which can hybridize with naturally occurring nucleic acids in a sequence specific manner analogous to that of two naturally occurring nucleic acids, e.g., can participate in Watson-Crick base pairing interactions. A nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy or 2’ halide substitutions. Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5- methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N4-methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza- pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5- methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6- methylaminopurine, O6-methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4- dimethylhydrazine-pyrimidines, and O4-alkyl-pyrimidines; US Pat. No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11th ed., 1992). Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (US Pat. No. 5,585,481). A nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2’ methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Naturally occurring nucleic acids are comprised of nucleotides, including guanine, cytosine, adenine, thymine, and uracil containing nucleotides (G, C, A, T, and U respectively).

[0087] As used herein, an “oligonucleotide” is a polynucleotide comprising fewer than 1000 nucleotides, such as a polynucleotide comprising fewer than 500 nucleotides or fewer than 100 nucleotides.

[0088] As used herein, “polyA” means a polynucleotide or a portion of a polynucleotide consisting of nucleotides comprising adenine. As used herein, “polyT” means a polynucleotide or a portion of a polynucleotide consisting of nucleotides comprising thymine. As used herein, “polyAC” means a polynucleotide or a portion of a polynucleotide consisting of nucleotides comprising adenine or cytosine. 28Attorney Docket No. 01318-0014-00PCT OR-043WO

[0089] As used herein, the term “ribosomal skipping element” refers to a nucleotide sequence encoding a short peptide sequence capable of causing generation of two peptide chains from translation of one RNA molecule. While not wishing to be bound by theory, it is hypothesized that ribosomal skipping elements function by (1) terminating translation of the first peptide chain and re-initiating translation of the second peptide chain; or (2) cleavage of a peptide bond in the peptide sequence encoded by the ribosomal skipping element by an intrinsic protease activity of the encoded peptide, or by another protease in the environment (e.g., cytosol).

[0090] The terms “sequence identity,” or “sequence similarity” as used herein, refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid- by-amino acid basis over a window of comparison. Thus, a “percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. Included are nucleotides and polypeptides having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the reference sequences described herein, typically where the polypeptide variant maintains at least one biological activity of the reference polypeptide.

[0091] As used herein, a “spacer” refers to a region of a polynucleotide sequence ranging from 1 nucleotide to hundreds or thousands of nucleotides separating two other elements along a polynucleotide sequence. The sequences can be defined or can be random. A spacer is typically non-coding. In some embodiments, spacers include duplex regions.

[0092] As used here, the term “splicing efficiency” refers to a measurement of the rate of splicing activity (e.g., none, low, or high) in a splicing or self-splicing reaction, for example, in portions of a precursor RNA polynucleotide capable of self-circularization. In some embodiments, the splicing activity of, e.g., a monotron element or intron segment, is affected by the structure and / or sequence of the linear RNA polynucleotide.

[0093] As used herein, “structured” with regard to RNA refers to an RNA sequence that is predicted by the RNAFold software or similar predictive tools to form a structure (e.g., a 29Attorney Docket No. 01318-0014-00PCT OR-043WO hairpin loop) with itself or other sequences in the same RNA molecule. As used herein, “unstructured” with regard to RNA refers to an RNA sequence that is not predicted by RNA structure predictive tools to form a structure (e.g., a hairpin loop) with itself or other sequences in the same RNA molecule. In some embodiments, unstructured RNA can be functionally characterized using nuclease protection assays.

[0094] As used herein, the terms “synthetic IRES” or “synthetic TIE” or “synthetic domain” or “synthetic motif” and the like, refer to IRESs, TIES, and domains or motifs therein that have been engineered to contain structural changes in the IRES, domains, or motifs, or nucleotides therein that are not naturally occurring. As set forth in detail herein, the synthetic IRESs can comprise at least one addition, deletion, or substitution of a nucleotide, domain, or motif such that the sequences in the synthetic IRESs differ from the corresponding a corresponding naturally occurring IRES. Where the synthetic IRES contains a domain or motif has been substituted in whole or in part, the domain or motif itself can be naturally occurring, but the substitution still renders the synthetic IRES “synthetic.” Synthetic IRESs, TIEs, domains, or motifs have been designed to increase expression of operably linked expression sequences as compared to naturally occurring counterparts. These effects differ from the modifications (e.g., modified nucleotides or nucleosides in intronic or exonic sequences) described elsewhere herein that seek to improve circularization efficiency or splicing efficiency. These effects also differ from naturally occurring IRESs derived from naturally occurring untranslated regions (UTR); truncations or deletions of nucleotides / nucleosides of a naturally occurring UTR sequence to select for a sequence that allows for translation initiation comprise derivations from a naturally occurring IRES, but do not comprise engineering of a synthetic IRES.

[0095] As used herein, the term “therapeutic protein” refers to any protein that, when administered to a subject directly or indirectly in the form of a translated nucleic acid, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect.

[0096] As used herein, “translation initiation element” or “TIE” refers to a portion of the intervening region comprising a sequence to allow translation efficiency of an encoded protein. In some embodiments, core functional elements comprising one or more coding elements will further comprise one or more TIEs. In some embodiments, where the intervening region comprises one or more noncoding elements, the TIE can be part of the noncoding element. In some embodiments, the TIE comprises an internal ribosome entry site (IRES). In some 30Attorney Docket No. 01318-0014-00PCT OR-043WO embodiments, the TIE comprises a naturally occurring IRES or synthetic IRES.

[0097] As used herein, “transcription” refers to the formation or synthesis of an RNA molecule by an RNA polymerase using a DNA molecule as a template. The disclosure is not limited with respect to the RNA polymerase that is used for transcription. For example, in some embodiments, a T7-type RNA polymerase can be used.

[0098] As used herein, “translation” refers to the formation of a polypeptide molecule by a ribosome based upon an RNA template.

[0099] As used herein, the term “translation efficiency” refers to a rate or amount of protein or peptide production from a ribonucleotide transcript. In some embodiments, translation efficiency can be expressed as amount of protein or peptide produced per given amount of transcript that codes for the protein or peptide.

[0100] As used herein, the term “transfect” or “transfection” refers to the intracellular introduction of one or more encapsulated materials (e.g., nucleic acids and / or polynucleotides) into a cell, or preferably into a target cell. The term “transfection efficiency” refers to the relative amount of such encapsulated material (e.g., polynucleotides) up-taken by, introduced into and / or expressed by the target cell which is subject to transfection. In some embodiments, transfection efficiency may be estimated by the amount of a reporter polynucleotide product produced by the target cells following transfection. In some embodiments, a transfer vehicle has high transfection efficiency. In some embodiments, a transfer vehicle has at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% transfection efficiency.

[0101] As used herein, “transfer vehicle” includes any of the standard pharmaceutical carriers, diluents, excipients, and the like, which are generally intended for use in connection with the administration of biologically active agents, including nucleic acids. In certain embodiments of the present disclosure, the transfer vehicles (e.g., lipid nanoparticles) are prepared to encapsulate one or more materials or therapeutic agents (e.g., circRNA). The process of incorporating a desired therapeutic agent (e.g., circRNA) into a transfer vehicle is referred to herein as or “loading” or “encapsulating” (Lasic, et al., FEBS Lett., 312: 255-258, 1992). The transfer vehicle-loaded or -encapsulated materials (e.g., circRNA) may be completely or partially located in the interior space of the transfer vehicle, within a bilayer membrane of the transfer vehicle, or associated with the exterior surface of the transfer vehicle.

[0102] The terms “treat,” and “prevent” as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention of which one of ordinary skill in the art recognizes 31Attorney Docket No. 01318-0014-00PCT OR-043WO as having a potential benefit or therapeutic effect. The treatment or prevention provided by the method disclosed herein can include treatment or prevention of one or more conditions or symptoms of the disease. Also, for purposes herein, “prevention” can encompass delaying the onset of the disease, or a symptom or condition thereof, e.g., prophylaxis of disease.

[0103] As used herein, the terms “upstream” and “downstream” refer to relative positions of genetic code, e.g., nucleotides, sequence elements, in polynucleotide sequences. In some embodiments, in an RNA polynucleotide, upstream is toward the 5’ end of the polynucleotide and downstream is toward the 3’ end. In some embodiments, in a DNA polynucleotide, upstream is toward the 5’ end of the coding strand for the gene in question and downstream is toward the 3’ end.

[0104] As used herein, a “vaccine” refers to a composition for generating immunity for the prophylaxis and / or treatment of diseases. Accordingly, vaccines are medicaments which comprise antigens and are intended to be used in humans or animals for generating specific defense and protective substances upon administration to the human or animal. A. LIPID DEFINITIONS

[0105] As used herein, the phrase “biodegradable lipid” or “degradable lipid” refers to any of a number of lipid species that are broken down in a host environment on the order of minutes, hours, or days ideally making them less toxic and unlikely to accumulate in a host over time. Common modifications to lipids include ester bonds, and disulfide bonds among others to increase the biodegradability of a lipid.

[0106] As used herein, the phrase “biodegradable PEG lipid” or “degradable PEG lipid” refers to any of a number of lipid species where the PEG molecules are cleaved from the lipid in a host environment on the order of minutes, hours, or days ideally making them less immunogenic. Common modifications to PEG lipids include ester bonds, and disulfide bonds among others to increase the biodegradability of a lipid.

[0107] As used herein, the term “cationic lipid” or “ionizable lipid” refers to any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH 4 and a neutral charge at other pHs such as physiological pH 7.

[0108] As used herein, the term “PEG” means any polyethylene glycol or other polyalkylene ether polymer.

[0109] As generally defined herein, a “PEG-OH lipid” (also referred to herein as “hydroxy-PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (–OH) groups 32Attorney Docket No. 01318-0014-00PCT OR-043WO on the lipid.

[0110] As used herein, a “phospholipid” is a lipid that includes a phosphate moiety and one or more carbon chains, such as unsaturated fatty acid chains.

[0111] As used herein, the term “structural lipid” refers to sterols and also to lipids containing sterol moieties. As defined herein, “sterols” are a subgroup of steroids consisting of steroid alcohols.

[0112] The terms “head-group” and “tail-group,” when used herein to describe the compounds (e.g., lipids) of the present disclosure, and in particular functional groups that are comprised in such compounds, are used for ease of reference to describe the orientation of such compounds or of one or more functional groups relative to other functional groups. For example, in certain embodiments, a hydrophilic head-group (e.g., guanidinium) is bound (e.g., by one or more of hydrogen-bonds, van der Waals' forces, ionic interactions and covalent bonds) to a cleavable functional group (e.g., a disulfide group), which in turn is bound to a hydrophobic tail-group (e.g., cholesterol). In certain embodiments, the compounds disclosed herein comprise, for example, at least one hydrophilic head-group and at least one hydrophobic tail-group, each bound to at least one cleavable group, thereby rendering such compounds amphiphilic.

[0113] As used herein, the term “amphiphilic” means the ability to dissolve in both polar (e.g., water) and non-polar (e.g., lipid) environments. For example, in certain embodiments, the compounds (e.g., lipids) disclosed herein comprise at least one lipophilic tail-group (e.g., cholesterol or a C6-20 alkyl) and at least one hydrophilic head-group (e.g., imidazole), each bound to a cleavable group (e.g., disulfide).

[0114] As used herein, the term “hydrophilic” is used to indicate in qualitative terms that a functional group is water-preferring, and typically such groups are water-soluble. For example, disclosed herein are compounds (e.g., ionizable lipids) that comprise a cleavable group (e.g., a disulfide (S—S) group) bound to one or more hydrophilic groups (e.g., a hydrophilic head-group), wherein such hydrophilic groups comprise or are selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, an optionally-substituted alkyl amino (e.g., an alkyl amino such as dimethylamino) and pyridyl.

[0115] As used herein, the term “hydrophobic” is used to indicate in qualitative terms that a functional group is water-avoiding, and typically such groups are not water soluble. In certain embodiments, at least one of the functional groups of moieties that comprise the compounds disclosed herein is hydrophobic in nature (e.g., a hydrophobic tail-group comprising a naturally 33Attorney Docket No. 01318-0014-00PCT OR-043WO occurring lipid such as cholesterol). For example, disclosed herein are compounds (e.g., ionizable lipids) that comprise a cleavable functional group (e.g., a disulfide (S—S) group) bound to one or more hydrophobic groups, wherein such hydrophobic groups may comprise, or may be selected from, one or more naturally occurring lipids such as cholesterol, an optionally substituted, variably saturated or unsaturated C6-C20alkyl, and / or an optionally substituted, variably saturated or unsaturated C6-C20 acyl.

[0116] As used herein, the term “liposome” generally refers to a vesicle composed of lipids (e.g., amphiphilic lipids) arranged in one or more spherical bilayer or bilayers. Such liposomes may be unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the encapsulated circRNA to be delivered to one or more target cells, tissues and organs.

[0117] As used herein, the phrase “lipid nanoparticle” or “LNP” refers to a transfer vehicle comprising one or more cationic or ionizable lipids, stabilizing lipids, structural lipids, and helper lipids.

[0118] In certain embodiments, the compositions described herein comprise one or more liposomes or lipid nanoparticles. Examples of suitable lipids (e.g., ionizable lipids) that may be used to form the liposomes and lipid nanoparticles contemplated include one or more of the compounds disclosed herein (e.g., HGT4001, HGT4002, HGT4003, HGT4004 and / or HGT4005). Such liposomes and lipid nanoparticles may also comprise additional ionizable lipids such as C12-200, dLin-KC2-DMA, and / or HGT5001, helper lipids, structural lipids, PEG-modified lipids, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE, HGT5000, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, kLin-K-DMA, dLin-K-XTC2-DMA, HGT4003, and combinations thereof.

[0119] In some embodiments, a lipid, e.g., an ionizable lipid, disclosed herein comprises one or more cleavable groups. The terms “cleave” and “cleavable” are used in this regard to mean that one or more chemical bonds (e.g., one or more of covalent bonds, hydrogen-bonds, van der Waals' forces and / or ionic interactions) between atoms in or adjacent to the subject functional group are broken (e.g., hydrolyzed) or are capable of being broken upon exposure to selected conditions (e.g., upon exposure to enzymatic conditions). In certain embodiments, the cleavable group is a disulfide functional group, and in particular embodiments is a disulfide group that is capable of being cleaved upon exposure to selected biological conditions (e.g., intracellular conditions). In certain embodiments, the cleavable group is an ester functional 34Attorney Docket No. 01318-0014-00PCT OR-043WO group that is capable of being cleaved upon exposure to selected biological conditions. For example, the disulfide groups may be cleaved enzymatically or by a hydrolysis, oxidation or reduction reaction. Upon cleavage of such disulfide functional group, the one or more functional moieties or groups (e.g., one or more of a head-group and / or a tail-group) that are bound thereto may be liberated. Exemplary cleavable groups may include, but are not limited to, disulfide groups, ester groups, ether groups, and any derivatives thereof (e.g., alkyl and aryl esters). In certain embodiments, the cleavable group is not an ester group or an ether group. In some embodiments, a cleavable group is bound (e.g., bound by one or more of hydrogen-bonds, van der Waals’ forces, ionic interactions and covalent bonds) to one or more functional moieties or groups (e.g., at least one head-group and at least one tail-group). In certain embodiments, at least one of the functional moieties or groups is hydrophilic (e.g., a hydrophilic head-group comprising one or more of imidazole, guanidinium, amino, imine, enamine, optionally-substituted alkyl amino and pyridyl). B. CHEMICAL DEFINITIONS

[0120] The disclosure may include compounds and pharmaceutically acceptable salts thereof, pharmaceutical compositions containing such compounds and methods of using such compounds and compositions, and the following terms, if present, have the following meanings unless otherwise indicated. It should also be understood that when described herein any of the moieties defined forth below may be substituted with a variety of substituents, and that the respective definitions are intended to include such substituted moieties within their scope as set out below. Unless otherwise stated, the term “substituted” is to be defined as set out below. It should be further understood that the terms “groups” and “radicals” can be considered interchangeable when used herein.

[0121] Compounds described herein may also comprise one or more isotopic substitutions. For example, H may be in any isotopic form, including1H,2H (D or deuterium), and3H (T or tritium); C may be in any isotopic form, including12C,13C, and14C; O may be in any isotopic form, including16O and18O; F may be in any isotopic form, including18F and19F; and the like.

[0122] When a range of values is listed, it is intended to encompass each value and sub– range within the range. For example, “C1–6 alkyl” is intended to encompass, C1, C2, C3, C4, C5, C6, C1–6, C1–5, C1–4, C1–3, C1–2, C2–6, C2–5, C2–4, C2–3, C3–6, C3–5, C3–4, C4–6, C4–5, and C5–6 alkyl.

[0123] As used herein, the term “aliphatic” or “aliphatic group,” means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is 35Attorney Docket No. 01318-0014-00PCT OR-043WO completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “carbocycle,” “cycloaliphatic” or “cycloalkyl”), that has a single point of attachment to the rest of the molecule or multiple points of attachment to the rest of the molecule, as would be readily apparent to a person of ordinary skill in the art based on the context of the described molecule. In some embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” (or “carbocycle” or “cycloalkyl”) refers to a monocyclic, bicyclic, or polycyclic C3-C14hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. Exemplary aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl. Examples of bicyclic and polycyclic cycloalkyls include bridged, fused, and spirocyclic carbocyclyls.

[0124] As used herein, the term “alkyl” refers to both straight and branched chain C1-40hydrocarbons (e.g., C6-20 hydrocarbons), and include both saturated and unsaturated hydrocarbons. In certain embodiments, the alkyl may comprise one or more cyclic alkyls and / or one or more heteroatoms such as oxygen, nitrogen, or sulfur and may optionally be substituted with substituents (e.g., one or more of alkyl, halo, alkoxyl, hydroxy, amino, aryl, ether, ester or amide). In certain embodiments, a contemplated alkyl includes (9Z,12Z)-octadeca-9,12- dien. The use of designations such as, for example, “C6-20” is intended to refer to an alkyl (e.g., straight or branched chain and inclusive of alkenes and alkyls) having the recited range carbon atoms. In some embodiments, an alkyl group has 1 to 10 carbon atoms (“C1–10 alkyl”). In some embodiments, an alkyl group has 1 to 9 carbon atoms (“C1–9alkyl”). In some embodiments, an alkyl group has 1 to 8 carbon atoms (“C1–8alkyl”). In some embodiments, an alkyl group has 1 to 7 carbon atoms (“C1–7 alkyl”). In some embodiments, an alkyl group has 1 to 6 carbon atoms (“C1–6 alkyl”). In some embodiments, an alkyl group has 1 to 5 carbon atoms (“C1–5 alkyl”). In some embodiments, an alkyl group has 1 to 4 carbon atoms (“C1–4alkyl”). In some embodiments, an alkyl group has 1 to 3 carbon atoms (“C1–3 alkyl”). In some embodiments, an 36Attorney Docket No. 01318-0014-00PCT OR-043WO alkyl group has 1 to 2 carbon atoms (“C1-2 alkyl”). In some embodiments, an alkyl group has 1 carbon atom (“C1alkyl”). Examples of C1–6alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, hexyl, and the like.

[0125] As used herein, “alkenyl” refers to a radical of a straight–chain or branched hydrocarbon group having from 2 to 20 carbon atoms, one or more carbon–carbon double bonds (e.g., 1, 2, 3, or 4 carbon–carbon double bonds), and optionally one or more carbon– carbon triple bonds (e.g., 1, 2, 3, or 4 carbon–carbon triple bonds) (“C2–20 alkenyl”). In certain embodiments, alkenyl does not contain any triple bonds. In some embodiments, an alkenyl group has 2 to 10 carbon atoms (“C2–10alkenyl”). In some embodiments, an alkenyl group has 2 to 9 carbon atoms (“C2–9 alkenyl”). In some embodiments, an alkenyl group has 2 to 8 carbon atoms (“C2–8 alkenyl”). In some embodiments, an alkenyl group has 2 to 7 carbon atoms (“C2–7alkenyl”). In some embodiments, an alkenyl group has 2 to 6 carbon atoms (“C2–6alkenyl”). In some embodiments, an alkenyl group has 2 to 5 carbon atoms (“C2–5 alkenyl”). In some embodiments, an alkenyl group has 2 to 4 carbon atoms (“C2–4 alkenyl”). In some embodiments, an alkenyl group has 2 to 3 carbon atoms (“C2–3alkenyl”). In some embodiments, an alkenyl group has 2 carbon atoms (“C2 alkenyl”). The one or more carbon– carbon double bonds can be internal (such as in 2–butenyl) or terminal (such as in 1–butenyl). Examples of C2–4alkenyl groups include ethenyl (C2), 1–propenyl (C3), 2–propenyl (C3), 1– butenyl (C4), 2–butenyl (C4), butadienyl (C4), and the like. Examples of C2–6alkenyl groups include the aforementioned C2–4 alkenyl groups as well as pentenyl (C5), pentadienyl (C5), hexenyl (C6), and the like. Additional examples of alkenyl include heptenyl (C7), octenyl (C8), octatrienyl (C8), and the like.

[0126] As used herein, “alkynyl” refers to a radical of a straight–chain or branched hydrocarbon group having from 2 to 20 carbon atoms, one or more carbon–carbon triple bonds (e.g., 1, 2, 3, or 4 carbon–carbon triple bonds), and optionally one or more carbon–carbon double bonds (e.g., 1, 2, 3, or 4 carbon–carbon double bonds) (“C2–20 alkynyl”). In certain embodiments, alkynyl does not contain any double bonds. In some embodiments, an alkynyl group has 2 to 10 carbon atoms (“C2–10alkynyl”). In some embodiments, an alkynyl group has 2 to 9 carbon atoms (“C2–9alkynyl”). In some embodiments, an alkynyl group has 2 to 8 carbon atoms (“C2–8 alkynyl”). In some embodiments, an alkynyl group has 2 to 7 carbon atoms (“C2– 7 alkynyl”). In some embodiments, an alkynyl group has 2 to 6 carbon atoms (“C2–6 alkynyl”). In some embodiments, an alkynyl group has 2 to 5 carbon atoms (“C2–5alkynyl”). In some embodiments, an alkynyl group has 2 to 4 carbon atoms (“C2–4 alkynyl”). In some 37Attorney Docket No. 01318-0014-00PCT OR-043WO embodiments, an alkynyl group has 2 to 3 carbon atoms (“C2–3 alkynyl”). In some embodiments, an alkynyl group has 2 carbon atoms (“C2alkynyl”). The one or more carbon– carbon triple bonds can be internal (such as in 2–butynyl) or terminal (such as in 1–butynyl). Examples of C2–4 alkynyl groups include, without limitation, ethynyl (C2), 1–propynyl (C3), 2– propynyl (C3), 1–butynyl (C4), 2–butynyl (C4), and the like. Examples of C2–6alkenyl groups include the aforementioned C2–4 alkynyl groups as well as pentynyl (C5), hexynyl (C6), and the like. Additional examples of alkynyl include heptynyl (C7), octynyl (C8), and the like.

[0127] As used herein, “alkylene,” “alkenylene,” and “alkynylene,” refer to a divalent radical of an alkyl, alkenyl, and alkynyl group respectively. When a range or number of carbons is provided for a particular “alkylene,” “alkenylene,” or “alkynylene” group, it is understood that the range or number refers to the range or number of carbons in the linear carbon divalent chain. “Alkylene,” “alkenylene,” and “alkynylene” groups may be substituted or unsubstituted with one or more substituents as described herein.

[0128] The term “alkoxy,” as used herein, refers to an alkyl group which is attached to another moiety via an oxygen atom (–O(alkyl)). Non-limiting examples include e.g., methoxy, ethoxy, propoxy, and butoxy.

[0129] As used herein, the term “aryl” refers to aromatic groups (e.g., monocyclic, bicyclic and tricyclic structures) containing six to ten carbons in the ring portion. The aryl groups may be optionally substituted through available carbon atoms and in certain embodiments may include one or more heteroatoms such as oxygen, nitrogen or sulfur. In some embodiments, an aryl group has six ring carbon atoms (“C6 aryl”; e.g., phenyl). In some embodiments, an aryl group has ten ring carbon atoms (“C10aryl”; e.g., naphthyl such as 1–naphthyl and 2–naphthyl).

[0130] As used herein, the term “bicyclic ring” or “bicyclic ring system” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or having one or more units of unsaturation, having one or more atoms in common between the two rings of the ring system. Thus, the term comprises any permissible ring fusion, such as ortho-fused or spirocyclic. As used herein, the term “heterobicyclic” is a subset of “bicyclic” that requires that one or more heteroatoms are present in one or both rings of the bicycle. Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfones and sulfonates), phosphorus (including oxidized forms such as phosphonates and phosphates), boron, etc. In some embodiments, a bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. As used herein, the term “bridged 38Attorney Docket No. 01318-0014-00PCT OR-043WO bicyclic” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or partially unsaturated, having at least one bridge. As defined by IUPAC, a “bridge” is an unbranched chain of atoms or an atom or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of the ring system which is bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, a bridged bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Such bridged bicyclic groups are well known in the art and include those groups set forth below where each group is attached to the rest of the molecule at any substitutable carbon or nitrogen atom. Unless otherwise specified, a bridged bicyclic group is optionally substituted with one or more substituents as set forth for aliphatic groups. Additionally or alternatively, any substitutable nitrogen of a bridged bicyclic group is optionally substituted. Exemplary bicyclic rings include:Exemplary bridged bicyclics include: 39Attorney Docket No. 01318-0014-00PCT OR-043WO

[0131] The term “cycloalkyl” refers to a monovalent saturated cyclic, bicyclic, or bridged cyclic (e.g., adamantyl) hydrocarbon group of 3-12, 3-8, 4-8, or 4-6 carbons, referred to herein, e.g., as "C4-8cycloalkyl," derived from a cycloalkane. Exemplary cycloalkyl groups include, but are not limited to, cyclohexanes, cyclopentanes, cyclobutanes and cyclopropanes.

[0132] As used herein, “cyano” refers to –CN.

[0133] As used herein, “heteroaryl” refers to a radical of a 5–10 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 electrons shared in a cyclic array) having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“5–10 membered heteroaryl”). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heteroaryl” includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more carbocyclyl or heterocyclyl groups wherein the point of attachment is on the heteroaryl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heteroaryl ring system. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is 40Attorney Docket No. 01318-0014-00PCT OR-043WO either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused (aryl / heteroaryl) ring system. Bicyclic heteroaryl groups wherein one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, and the like) the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2–indolyl) or the ring that does not contain a heteroatom (e.g., 5– indolyl).

[0134] As used herein, “heterocyclyl” or “heterocyclic” refers to a radical of a 3– to 10– membered non–aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (“3–10 membered heterocyclyl”). In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. A heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”), and can be saturated or can be partially unsaturated. Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heterocyclyl” also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more carbocyclyl groups wherein the point of attachment is either on the carbocyclyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” may be used interchangeably.

[0135] The terms “halo” and “halogen” as used herein refer to an atom selected from fluorine (fluoro, F), chlorine (chloro, Cl), bromine (bromo, Br), and iodine (iodo, I). In certain embodiments, the halo group is either fluoro or chloro.

[0136] As used herein, “oxo” refers to –C=O.

[0137] In general, the term “substituted”, whether preceded by the term “optionally” or not, means that at least one hydrogen present on a group (e.g., a carbon or nitrogen atom) is replaced with a permissible substituent, e.g., a substituent which upon substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a “substituted” group has a substituent at one or more substitutable positions of the group, and when more than one position in any given structure is substituted, the substituent is either the 41Attorney Docket No. 01318-0014-00PCT OR-043WO same or different at each position. Illustrative substituents include, but are not limited to, halogens, hydroxyl groups, or any other organic groupings containing any number of carbon atoms, for example, 1-14 carbon atoms, and optionally include one or more heteroatoms such as oxygen, sulfur, or nitrogen grouping in linear, branched, or cyclic structural formats. Representative substituents include alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, phenyl, substituted phenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, halo, hydroxyl, alkoxy, substituted alkoxy, phenoxy, substituted phenoxy, aroxy, substituted aroxy, alkylthio, substituted alkylthio, phenylthio, substituted phenylthio, arylthio, substituted arylthio, cyano, isocyano, substituted isocyano, carbonyl, substituted carbonyl, carboxyl, substituted carboxyl, amino, substituted amino, amido, substituted amido, sulfonyl, substituted sulfonyl, sulfonic acid, phosphoryl, substituted phosphoryl, phosphonyl, substituted phosphonyl, polyaryl, substituted polyaryl, C3-C20cyclic, substituted C3-C20 cyclic, heterocyclic, substituted heterocyclic, aminoacid, peptide, and polypeptide groups. Combinations of substituents envisioned by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds. The term "stable", as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.

[0138] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are independently halogen; —(CH2)0-4R∘; —(CH2)0-4OR∘; —O(CH2)0-4R∘, — O—(CH2)0-4C(O)OR∘; —(CH2)0-4CH(OR∘)2; —(CH2)0-4SR∘; —(CH2)0-4Ph, which may be substituted with R∘; —(CH2)0-4O(CH2)0-1Ph which may be substituted with R∘; —CH═CHPh, which may be substituted with R∘; —(CH2)0-4O(CH2)0-1-pyridyl which may be substituted with R∘; —NO2; —CN; —N3; —(CH2)0-4N(R∘)2; —(CH2)0-4N(R∘)C(O)R∘; —N(R∘)C(S)R∘; —(CH2)0-4N(R∘)C(O)NR∘2; —N(R∘)C(S)NR∘2; —(CH2)0-4N(R∘)C(O)OR∘; —N(R∘)N(R∘)C(O)R∘; — N(R∘)N(R∘)C(O)NR∘2; —N(R∘)N(R∘)C(O)OR∘; —(CH2)0-4C(O)R∘; —C(S)R∘; —(CH2)0-4C(O)OR∘; —(CH2)0-4C(O)SR∘; —(CH2)0-4C(O)OSiR∘3; —(CH2)0-4OC(O)R∘; —OC(O)(CH2)0-4SR∘, SC(S)SR∘; —(CH2)0-4SC(O)R∘;—(CH2)0-4C(O)NR∘2; —C(S)NR∘2; —C(S)SR∘; —SC(S)SR∘, —(CH2)0-4OC(O)NR∘2; —C(O)N(OR∘)R∘; —C(O)C(O)R∘; —C(O)CH2C(O)R∘; —C(NOR∘)R∘; — (CH2)0-4SSR∘; —(CH2)0-4S(O)2R∘; —(CH2)0-4S(O)2OR∘; —(CH2)0-4OS(O)2R∘; —S(O)2NR∘2; — (CH2)0-4S(O)R∘; —N(R∘)S(O)2NR∘2; —N(R∘)S(O)2R∘; —N(OR∘)R∘; —C(NH)NR∘2; —P(O)2R∘; — P(O)R∘2; —OP(O)R∘2; —OP(O)(OR∘)2; SiR∘3; —(C1-4 straight or branched alkylene)O—N(R∘)2; 42Attorney Docket No. 01318-0014-00PCT OR-043WO or—(C1-4 straight or branched alkylene)C(O)O—N(R∘)2, wherein each R∘may be substituted as defined below and is independently hydrogen, C1-6 aliphatic, —CH2Ph, —O(CH2)0-1Ph, —CH2- (5-6 membered heteroaryl ring), or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R∘, taken together with their intervening atom(s), form a 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.

[0139] Suitable monovalent substituents on R∘(or the ring formed by taking two independent occurrences of R∘together with their intervening atoms), are independently halogen, —(CH2)0-2R●, -(haloR●), —(CH2)0-2OH, —(CH2)0-2OR●, —(CH2)0-2CH(OR●)2; — O(haloR●), —CN, —N3, —(CH2)0-2C(O)R●, —(CH2)0-2C(O)OH, —(CH2)0-2C(O)OR●, —(CH2)0- 2SR●, —(CH2)0-2SH, —(CH2)0-2NH2, —(CH2)0-2NHR●, —(CH2)0-2NR●2, —NO2, —SiR●3, — OSiR●3, —C(O)SR●, —(C1-4straight or branched alkylene)C(O)OR●, or—SSR●wherein each R●is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently selected from C1-4 aliphatic, —CH2Ph, —O(CH2)0-1Ph, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R∘include ═O and ═S.

[0140] Suitable divalent substituents on a saturated carbon atom of an "optionally substituted" group include the following: ═O, ═S, ═NNR*2, ═NNHC(O)R*, ═NNHC(O)OR*, ═NNHS(O)2R*, ═NR*, ═NOR*, —O(C(R*2))2-3O—, or —S(C(R*2))2-3S—, wherein each independent occurrence of R* is selected from hydrogen, C1-6aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an "optionally substituted" group include:—O(CR*2)2-3O—, wherein each independent occurrence of R* is selected from hydrogen, C1-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0141] Suitable substituents on the aliphatic group of R* include halogen, —R●, -(haloR●), —OH, —OR●, —O(haloR●), —CN, —C(O)OH, —C(O)OR●, —NH2, —NHR●, —NR●2, or —NO2, 43Attorney Docket No. 01318-0014-00PCT OR-043WO wherein each R●is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently C1-4aliphatic, —CH2Ph, —O(CH2)0-1Ph, or a 5-6- membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0142] Suitable substituents on a substitutable nitrogen of an "optionally substituted" group include —R†, —NR†2, —C(O)R†, —C(O)OR†, —C(O)C(O)R†, —C(O)CH2C(O)R†, —S(O)2R†, — S(O)2NR†2, —C(S)NR†2, —C(NH)NR†2, or —N(R†)S(O)2R†; wherein each R†is independently hydrogen, C1-6 aliphatic which may be substituted as defined below, unsubstituted—OPh, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R†, taken together with their intervening atom(s) form an unsubstituted 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0143] Suitable substituents on the aliphatic group of R†are independently halogen, —R●, -(haloR●), —OH, —OR●, —O(haloR●), —CN, —C(O)OH, —C(O)OR●, —NH2, —NHR●, —NR●2, or —NO2, wherein each R●is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently C1-4 aliphatic, —CH2Ph, —O(CH2)0-1Ph, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0144] Heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. It is understood that "substitution" or "substituted" comprises the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, i.e., a compound that does not spontaneously undergo transformation, for example, by rearrangement, cyclization, or elimination.

[0145] In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described herein. The permissible substituents can be one or more and the same or different for appropriate organic compounds. The heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valencies of 44Attorney Docket No. 01318-0014-00PCT OR-043WO the heteroatoms.

[0146] In various embodiments, the substituent is selected from alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, ketone, nitro, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone, each of which optionally is substituted with one or more suitable substituents. In some embodiments, the substituent is selected from alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cycloalkyl, ester, ether, formyl, haloalkyl, heteroaryl, heterocyclyl, ketone, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone, wherein each of the alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cycloalkyl, ester, ether, formyl, haloalkyl, heteroaryl, heterocyclyl, ketone, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone can be further substituted with one or more suitable substituents.

[0147] Examples of substituents include, but are not limited to, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido, ketone, aldehyde, thioketone, ester, heterocyclyl, –CN, aryl, aryloxy, perhaloalkoxy, aralkoxy, heteroaryl, heteroaryloxy, heteroarylalkyl, heteroaralkoxy, azido, alkylthio, oxo, acylalkyl, carboxy esters, carboxamido, acyloxy, aminoalkyl, alkylaminoaryl, alkylaryl, alkylaminoalkyl, alkoxyaryl, arylamino, aralkylamino, alkylsulfonyl, carboxamidoalkylaryl, carboxamidoaryl, hydroxyalkyl, haloalkyl, alkylaminoalkylcarboxy, aminocarboxamidoalkyl, cyano, alkoxyalkyl, perhaloalkyl, arylalkyloxyalkyl, and the like. In some embodiments, the substituent is selected from cyano, halogen, hydroxyl, and nitro.

[0148] As used herein, “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1–19. Pharmaceutically acceptable salts include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, 45Attorney Docket No. 01318-0014-00PCT OR-043WO tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2–hydroxy–ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2–naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3– phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p–toluenesulfonate, undecanoate, valerate salts, and the like. Pharmaceutically acceptable salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C1–4alkyl)4salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.

[0149] In typical embodiments, the present disclosure is intended to encompass the compounds disclosed herein, and the pharmaceutically acceptable salts, pharmaceutically acceptable esters, tautomeric forms, polymorphs, and prodrugs of such compounds. In some embodiments, the present disclosure includes a pharmaceutically acceptable addition salt, a pharmaceutically acceptable ester, a solvate (e.g., hydrate) of an addition salt, a tautomeric form, a polymorph, an enantiomer, a mixture of enantiomers, a stereoisomer or mixture of stereoisomers (pure or as a racemic or non-racemic mixture) of a compound described herein.

[0150] Compounds described herein can comprise one or more asymmetric centers, and thus can exist in various isomeric forms, e.g., enantiomers and / or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw–Hill, 46Attorney Docket No. 01318-0014-00PCT OR-043WO NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p.268 (E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972). The disclosure additionally encompasses compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.

[0151] In certain embodiments, the compounds (e.g., ionizable lipids) and the transfer vehicles (e.g., lipid nanoparticles) of which such compounds are a component exhibit an enhanced (e.g., increased) ability to transfect one or more target cells. Accordingly, also provided herein are methods of transfecting one or more target cells. Such methods generally comprise the step of contacting the one or more target cells with the compounds and / or pharmaceutical compositions disclosed herein such that the one or more target cells are transfected with the circular RNA encapsulated therein.

[0152] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive. Unless defined herein and below in the reminder of the specification, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. 2. CIRCULAR RNA, PRECURSOR RNA & DNA TEMPLATE A. CIRCULAR RNA

[0153] Provided herein are circular RNAs, in some instances produced by the precursor RNA polynucleotides described elsewhere herein.

[0154] In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ self-spliced exon segment, an intervening region, and a 5’ self-spliced exon segment. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ self-spliced exon segment, a coding sequence, and a 5’ self-spliced exon segment. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ self-spliced exon segment, a translation initiation element (TIE), a coding sequence, and a 5’ self-spliced exon segment. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ self-spliced exon segment, a translation initiation element (TIE), a coding sequence with which the TIE is not naturally associated, and a 5’ self-spliced exon segment. In some embodiments, the TIE comprises an IRES that is a synthetic IRES. 47Attorney Docket No. 01318-0014-00PCT OR-043WO

[0155] In some embodiments, provided herein is a circular RNA polynucleotide comprising: i) a 5’ combined accessory element; ii) an intervening region; and iii) a 3’ combined accessory element, where the intervening region is between the 5’ combined accessory element and the 3’ combined accessory element.

[0156] In some embodiments, the 5’ combined accessory element comprises a 3’ self- spliced exon segment. In some embodiments, the 3’ self-spliced exon segment comprises an exon segment or fragment thereof. In some embodiments, the 3’ self-spliced exon segment comprises a 3ʹ nucleotide of a 3ʹ splice site dinucleotide. In some embodiments, the 3’ self- spliced exon segment comprises an exon segment and a 3’ nucleotide of a 3’ splice site dinucleotide. In some embodiments, the exon segment comprises a natural exon sequence or non-naturally occurring sequence. In some embodiments, the 3' splice site dinucleotides are distinct from the natural splice site dinucleotide(s) associated with a natural Group I or Group II intron sequence.

[0157] In some embodiments, the 3’self-spliced exon segment comprises a sequence having a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from Table A or Table B. In some embodiments, the 3’ self-spliced exon segment is selected from an exon segment disclosed herein, e.g., in Table A or Table B. In some embodiments, the self-spliced exon segment is, e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides from the exonic sequences of Table A or is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides from the exonic sequences of Table B.

[0158] In some embodiments, the 3’ combined accessory element comprises a 5’ self- spliced exon segment. In some embodiments, the 5’ self-spliced exon segment comprises an exon segment or fragment thereof. In some embodiments, the 5’ self-spliced exon segment comprises a 5ʹ nucleotide of a 5ʹ splice site dinucleotide. In some embodiments, the 5’ self- spliced exon segment comprises an exon segment and a 5’ nucleotide of a 5’ splice site dinucleotide. In some embodiments, the exon segment comprises a natural exon sequence or non-naturally occurring sequence. In some embodiments, the 5’splice site dinucleotides are distinct from the natural splice site dinucleotide(s) associated with a natural Group I or Group 48Attorney Docket No. 01318-0014-00PCT OR-043WO II intron sequence.

[0159] In some embodiments, the 5’self-spliced exon segment comprises a sequence having a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from, e.g., in Table A or Table B. In some embodiments, the 5’ self-spliced exon segment is selected from an exon segment disclosed herein, e.g., in Table A or Table B. See, e.g., supra. In some embodiments, the self- spliced exon segment is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides from the exonic sequences of Table A or is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides from the exonic sequences of Table B. In some embodiments, as set forth herein, the intervening region comprises a noncoding region or a coding region. In some embodiments, the intervening region comprises at least one translation initiation element (TIE). In some embodiments, the TIE comprises a viral or eukaryotic internal ribosome entry site (IRES) and a noncoding or coding region. In some embodiments, the IRES is a synthetic IRES, as described in further detail herein. In some embodiments, the IRES comprises a sequence selected from the sequences in Table 2 or a fragment thereof or a sequence selected from SEQ ID NOS: 1-2989, 3282-3303, and 14067- 24829 (GIRES 0-10762). In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence selected from the sequences in Table 2 or a fragment thereof or a sequence selected from SEQ ID NOS: 1-2989, 3282-3303, and 14067-24829 (GIRES 0- 10762). See, e.g., infra. In some embodiments, the synthetic IRES comprises a sequence set forth in Table 1 herein.

[0160] In some embodiments the TIE comprises a coding sequence with which the TIE is not naturally associated.

[0161] In some embodiments, the intervening region comprises an untranslated region (UTR). In some embodiments, the UTR comprises one or more noncoding elements. In some embodiments, the one or more noncoding elements are selected from, e.g., a natural 3ʹ Untranslated Region (UTR), a natural 5ʹ Untranslated Region (UTR), a synthetic spacer sequence, an aptamer, and lncRNA, miRNA, and a miRNA sponge. In some embodiments, 49Attorney Docket No. 01318-0014-00PCT OR-043WO the noncoding element is or comprises the TIE.

[0162] In some embodiments, the intervening region comprises a comprises a coding element or coding region. In some embodiments, the coding element comprises a sequence encoding at least one therapeutic protein. In some embodiments, the coding element encodes two or more polypeptides. In some embodiments, the coding element or coding region comprises a sequence encoding, for example, a therapeutic protein, cytokine, immune checkpoint inhibitor, an agonist, a chimeric antigen receptor, an inhibitory receptor agonist or inhibitory receptor, an inhibitory receptor antagonist, one or more TCR chains, a secreted T cell or immune cell engager, a transcription factor, an immunosuppressive enzyme, or a TvHd, as set forth in detail herein. In some embodiments, the coding element or coding region comprises one or more expression sequences or portions thereof, e.g., Table 3, infra.

[0163] In some embodiments, provided herein are circular RNA polynucleotides comprising, in the following order, i) a 5’ combined accessory element comprising a 3’ self- spliced exon segment; ii) an intervening region; and iii) a 3’ combined accessory element comprising a 5’ self-spliced exon segment. In some embodiments, the 3’ self-spliced exon segment and / or the 5’ self-spliced exon segment is selected from an exon segment disclosed herein, e.g., in Table A or Table B.

[0164] In some embodiments, provided herein are circular RNA polynucleotides comprising, in the following order, i) a 5’ combined accessory element comprising a 3’ self- spliced exon segment, wherein the 3’ self-spliced exon segment comprises an exon segment; ii) an intervening region; and iii) a 3’ combined accessory element comprising a 5’ self-spliced exon segment, wherein the 5’ self-spliced exon segment comprises an exon segment. In some embodiments, the 3’ self-spliced exon segment and / or the 5’ self-spliced exon segment is selected from an exon segment disclosed herein, e.g., in Table A or Table B.

[0165] In some embodiments, provided herein are circular RNA polynucleotides comprising, in the following order, i) a 5’ combined accessory element comprising a 3’ self- spliced exon segment, wherein the 3’ self-spliced exon segment comprises an exon segment and a 3’ nucleotide of a 3’ splice site dinucleotide; ii) an intervening region; and iii) a 3’ combined accessory element comprising a 5’ self-spliced exon segment, wherein the 5’ self- spliced exon segment comprises an exon segment and a 5’ nucleotide of a 5’ splice site dinucleotide. In some embodiments, the 3’ self-spliced exon segment and / or the 5’ self-spliced exon segment is selected from an exon segment disclosed herein, e.g., in Table A or Table B.

[0166] A circular RNA polynucleotide comprising, in the following order, a 3’ self-spliced 50Attorney Docket No. 01318-0014-00PCT OR-043WO exon segment, an intervening region, and a 5’ self-spliced exon segment, wherein at least one of the 3’ or 5’ self-spliced exon segments is selected from an exon segment comprising a sequence selected from Table A or Table B.

[0167] As a non-limiting example, a circular RNA polynucleotide comprises the following elements operably connected and arranged in the following sequence: (a) a 3ʹ exon segment comprising a Group I or Group II exon 3ʹ nucleotide of a 3ʹ splice site dinucleotide; (b) an intervening region; and (c) a 5ʹ exon segment comprising a Group I or Group II exon 5ʹ nucleotide of a 5ʹ splice site dinucleotide.

[0168] As set forth in detail herein, in some embodiments, a circular RNA polynucleotide comprises a retained portion of a monotron element. See, e.g., supra. In some embodiments, a circular RNA polynucleotide comprises: a 5’ internal spacer, a 5’ internal duplex, at least a portion of a terminal element (or sequence or segment), at least a portion of a monotron element (or sequence or segment), a 3’ internal duplex, a 3’ internal spacer, a coding or noncoding region, and an intervening region. In some embodiments, the circular RNA polynucleotide comprises a coding region and the intervening region comprises an IRES. In some embodiments, the IRES is a synthetic IRES, as described in further detail herein. In some embodiments, the monotron element present in the precursor RNA polynucleotide, of which a portion is retained in the circular RNA polynucleotide, comprises a polynucleotide sequence that has a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from Table A or Table B.

[0169] In some embodiments, the circular RNA polynucleotide comprises the following elements operably connected and arranged in the following sequence: (a) a 5’ internal spacer, (b) a 5’ internal duplex, (c) at least a portion of a terminal element, (d) at least a portion of a monotron element, (e) a 3’ internal duplex, (f) a 3’ internal spacer, and (g) an intervening region, optionally comprising a coding region, and IRES. In some embodiments, the IRES is a synthetic IRES, as described in further detail herein.

[0170] In some embodiments, the circular RNA polynucleotide comprises the following 51Attorney Docket No. 01318-0014-00PCT OR-043WO elements operably connected and arranged in the following sequence: (a) a 5’ internal spacer, (b) a 5’ internal duplex, (c) at least a portion of a monotron element, (d) at least a portion of a terminal element, (e) a 3’ internal duplex, (f) a 3’ internal spacer, and (g) an intervening region, optionally comprising a coding region, and IRES. In some embodiments, the IRES is a synthetic IRES, as described in further detail herein.

[0171] As a further non-limiting example, a circular RNA polynucleotide comprises the following elements operably connected and arranged in the following sequence: (a) at least a portion of a terminal element, (b) a 3ʹ exon segment comprising a 3ʹ nucleotide of a 3ʹ splice site dinucleotide, (c) an intervening region, (d) a 5ʹ exon segment comprising a 5ʹ nucleotide of a 5ʹ splice site dinucleotide, and (e) at least a portion of a monotron element; wherein the 5' and / or 3' splice site dinucleotides are distinct from the natural splice site dinucleotide(s) associated with a natural Group I or Group II intron sequence.

[0172] In some embodiments, element (d) comprises the first nucleotide of a 5ʹ Group I or Group II splice site dinucleotide and a natural exon sequence. In some embodiments, element (b) comprises the second nucleotide of a 3ʹ Group I or Group II exon splice site dinucleotide and a natural exon sequence.

[0173] In some embodiments, in the circular RNA polynucleotide, the 5ʹ exon element comprises the second nucleotide of a 3ʹ Group I or Group II exon splice site dinucleotide and a natural exon sequence. In some embodiments, the 3ʹ exon element fragment comprises the first nucleotide of a 5ʹ Group I or Group II splice site dinucleotide and a natural exon sequence. In some embodiments, the 5ʹ exon element comprises a 5ʹ internal duplex; and the 3ʹ exon element comprises a 3ʹ internal duplex. In some embodiments, the 5ʹ exon element comprises a 5ʹ internal spacer. In some embodiments, the 3ʹ exon element comprises a 3ʹ internal spacer.

[0174] In some embodiments, the circular RNA polynucleotide comprises a 5’ internal duplex and a 3’ internal duplex. See, e.g., supra.

[0175] In some embodiments, the circular RNA polynucleotide comprises a 5’ internal homology region and / or a 3’ internal homology region. See, e.g., supra. 52Attorney Docket No. 01318-0014-00PCT OR-043WO

[0176] In some embodiments, the circular RNA polynucleotide comprises internal spacers (IS) of different lengths, e.g., a 5’internal spacer and / or a 3’ internal spacer. See, e.g., supra.

[0177] In some embodiments, the circular RNA polynucleotide retains portions of the precursor RNA polynucleotides, described elsewhere herein in detail. In some embodiments, portions of the precursor RNA polynucleotide are removed upon circularization. For example, in some embodiments, the circular RNA polynucleotide does not comprise a 5’ external spacer and / or a 3’ external spacer. In some embodiments, the circular RNA polynucleotide does not comprise a 5’ intron segment and / or 3’ intron segment. In some embodiments, the circular RNA polynucleotide does not comprise affinity tags. In some embodiments, the circular RNA polynucleotide does not retain a portion of a monotron element. In certain embodiments, the circular RNA polynucleotide does not retain a monotron element.

[0178] In some embodiments, and as described in more detail elsewhere herein, the circular RNA polynucleotide comprises modified nucleotides and / or modified nucleosides, namely comprising at least one modified A, C, G, or U / T nucleotide or nucleoside. Exemplary modifications are described in detail elsewhere herein. See, e.g., infra. In some embodiments, a circular RNA polynucleotide comprises modified nucleotides and / or modified nucleosides where between 1% and 100%, 1% and 2%, 1% and 3%, 1% and 4%, 1% and 5%, 5% and 6%, 5% and 7%, 5% and 8%, 5% and 9%, 5% and 10%, 10% and 20%, 20% and 30%, 30% and 40%, 40% and 50%, 50% and 60%, 60% and 70%, 70% and 80%, 80% and 90%, or 90% and 100% of the nucleotides or nucleosides are modified. As exhibited by the exemplary nucleotide or nucleotide modification presented in more detail, such modifications differ from mutations selected from insertions, deletions, addition, or subtraction of nucleotides, for example, the mutations in a permuted Group I and Group II intron segment; or the additions, deletions, or substitutions of a nucleotide, domain, or motif present in a synthetic IRES (as compared to the naturally occurring IRES).

[0179] In some embodiments, portions of the polynucleotide comprise between 1% and 10% modification of the nucleotides or nucleosides. In some embodiments, portions of the circular RNA polynucleotide comprise less than 10% modification. In some embodiments, portions of the polynucleotide or the polynucleotide in its entirety comprise no nucleotide or nucleoside modifications. In some embodiments, a circular RNA polynucleotide may lack modifications, where the linear precursors used to produce the circular RNA polynucleotide contained modifications (e.g., in the introns). In some embodiments, incorporation of a nucleotide or nucleoside modification to a precursor RNA polynucleotide hinders or lowers the 53Attorney Docket No. 01318-0014-00PCT OR-043WO capacity of the circular RNA to circularize, splice, or express.

[0180] In some embodiments, the circular RNA polynucleotide is from about 50 nucleotides to about 15 kilobases in length.

[0181] In some embodiments, the circular RNA polynucleotide has an in vivo duration of therapeutic effect in a subject of at least about 10 hours. In some embodiments, the circular RNA polynucleotide has a functional half-life of at least about 10 hours. In some embodiments, the circular RNA polynucleotide has a duration of therapeutic effect in a cell greater than or equal to that of an equivalent linear RNA polynucleotide comprising the same expression sequence. In some embodiments, the circular RNA polynucleotide has a functional half-life in a cell greater than or equal to that of an equivalent linear RNA polynucleotide comprising the same expression sequence. In some embodiments, the circular RNA polynucleotide has an in vivo duration of therapeutic effect in a subject greater than that of an equivalent linear RNA polynucleotide having the same expression sequence. In some embodiments, the circular RNA polynucleotide has an in vivo functional half-life in a subject greater than that of an equivalent linear RNA polynucleotide having the same expression sequence.

[0182] In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), a coding sequence (e.g., with which the TIE is not naturally associated), and a means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), a coding sequence (e.g., with which the TIE is not naturally associated), and a means for self-circularization. In some embodiments, provided herein is provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), a coding sequence (e.g., with which the TIE is not naturally associated), and an autocatalytic intron-exon means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), a coding sequence (e.g., with which the TIE is not naturally associated), and an autocatalytic intron-exon means for self-circularization. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment means for self-splicing, a translation initiation element, a coding sequence, and a 5’ exon segment means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment means for self-circularization, a translation initiation element, a coding sequence, and a 5’ exon segment means for self-circularization. In some 54Attorney Docket No. 01318-0014-00PCT OR-043WO embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment, a translation initiation element, a coding sequence, and a 5’ exon segment, wherein the exon segments are means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment, a translation initiation element, a coding sequence, and a 5’ exon segment, wherein the exon segments are means for self-circularization. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ exon segment means for self-circularization, a translation initiation element, a coding sequence, and a 5’ exon segment means for self-circularization. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ exon segment, a translation initiation element, a coding sequence, and a 5’ exon segment, wherein the exon segments are means for self-splicing. B. INTERVENING REGION

[0183] In various embodiments, a provided polynucleotide (e.g., a DNA template, a linear precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises an intervening region. a. TRANSLATION INITIATION ELEMENT and INTERNAL RIBOSOME ENTRY SITE

[0184] In some embodiments, the DNA template, linear precursor RNA polynucleotide, and circular RNA polynucleotide comprise an intervening region and / or core functional element. In some embodiments, the intervening region and / or core functional element comprises a coding and / or noncoding element. In some embodiments, the intervening region and / or core functional element further comprises a translation initiation element (TIE) upstream to the coding or noncoding element, and / or a termination element.

[0185] In some embodiments, the polynucleotide comprises a translation initiation element (TIE). In some embodiments, the intervening region comprises at least one TIE. In some embodiments, the TIE is upstream to a coding element. In some embodiments, TIEs are designed to allow translation efficiency of an encoded protein. Accordingly, in some embodiments, an intervening region comprising one or more coding elements further comprises one or more TIEs. In other embodiments, an intervening region comprising only noncoding elements lacks any TIEs.

[0186] In some embodiments, a TIE comprises an aptamer complex, synthetic IRES, or other engineered TIE capable of initiating translation of a linear RNA or circular RNA 55Attorney Docket No. 01318-0014-00PCT OR-043WO polynucleotide. In some embodiments, a TIE comprises an internal ribosome entry site (IRES). In certain embodiments, the TIE provided herein comprise a viral or eukaryotic internal ribosome entry site (IRES) or a fragment or variant thereof. In some embodiments, inclusion of an IRES permits the translation of one or more open reading frames from a circular RNA (e.g., open reading frames that form the expression sequences). In some embodiments, IRES attracts a eukaryotic ribosomal translation initiation complex and promotes translation initiation. See, e.g., PCT Application No. WO202261490, which is incorporated herein by reference in its entirety. In some embodiments, the IRES is a synthetic IRES.

[0187] In some embodiments, the TIE additionally comprises an aptamer complex wherein one or more aptamer sequences are capable of binding to a component of a eukaryotic initiation factor to either enhance or initiate translation. In some embodiments, an aptamer may be used to enhance translation in vivo and in vitro by promoting specific eukaryotic initiation factors (eIF) (e.g., certain aptamers disclosed in International Pat. Appl. No. PCT / EP2018 / 078794 are capable of binding to eukaryotic initiation factor 4F (eIF4F)). In some embodiments, an aptamer or a complex of aptamers may be capable of binding to EIF4G, EIF4E, EIF4A, EIF4B, EIF3, EIF2, EIF5, EIF1, EIF1A, 40S ribosome, PCBP1 (polyC binding protein), PCBP2, PCBP3, PCBP4, PABP1 (polyA binding protein), PTB, Argonaute protein family, HNRNPK (heterogeneous nuclear ribonucleoprotein K), or La protein. i. Synthetic Internal Ribosome Entry Sites (IRES) and TIEs

[0188] In some embodiments herein, the circular RNA comprises a sequence, e.g., encoding for a therapeutic protein (i.e. the payload). In certain embodiments, as provided herein, the payload encoded by the circular RNA polynucleotide may be optimized through use of a specific internal ribosome entry sites (IRES), including a synthetic IRES, within the translation initiation element (TIE). In some embodiments, IRES specificity within a circular RNA can promote or significantly enhance expression of specific proteins encoded within the coding element. In some embodiments, the IRES comprises a viral IRES or eukaryotic IRES. In some embodiments, the IRES is a synthetic IRES.

[0189] In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide therein. In some embodiments, at least one addition, deletion, or substitution thereof yields a synthetic IRES with increased or improved function and / or expression and / or stability as compared to the naturally occurring IRES. Synthetic IRESs, and domains or motifs thereof, have been designed to increase expression of operably linked expression sequences as compared to naturally occurring counterparts. In 56Attorney Docket No. 01318-0014-00PCT OR-043WO some embodiments, the synthetic IRESs, and domains or motifs thereof, have improved expression, function, and / or stability in hepatocytes, immune cells (e.g., lymphocytes, T cells), muscle cells (e.g., myotubes), for example, as compared to a naturally occurring IRES, the naturally occurring counterpart, or a CVB3 IRES or comparative IRES 1, described below. In some embodiments, the synthetic IRES increases expression of a coding sequence operably linked to the IRES as compared to the naturally occurring IRES. In some embodiments, the synthetic IRES is capable of enhancing expression of the therapeutic protein as compared to a naturally occurring IRES.

[0190] A multitude of IRES sequences are available and include sequences derived from a wide variety of viruses, such as from leader sequences of picornaviruses such as the encephalomyocarditis virus (EMCV) UTR (Jang et al., J. Virol. (1989) 63: 1651-1660), the polio leader sequence, the hepatitis A virus leader, the hepatitis C virus IRES, human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100(25): 15125- 15130), an IRES element from the foot and mouth disease virus (Ramesh et al., Nucl. Acid Res. (1996) 24:2697- 2700), a giardiavirus IRES (Garlapati et al., J. Biol. Chem. (2004) 279(5):3389-3397), and the like. Five different “types” of IRESs (Types I, II, III, IV, V) have been classified based on evolutionary conserved sequences. Each type harbors a common RNA structure core maintained by evolutionary conserved covariant substitutions. (See Salas-Martinez 2018, incorporated by reference herein.) For example, Type I IRES elements occur in RNA genome of enterovirus, including poliovirus (PV), coxsackievirus B3 (CVB3), enterovirus 71 (EV71), and human rhinovirus (HRV). Type II IRES elements occur in cardiovirus (EMCV) and aphthovirus (FMDV) RNAs. Type I and Type II IRESs require the C-terminal region of eIF4G, eIF4A, eIF2, and eIF3 to assemble 48S initiation complexes in vitro, but are independent of eIF4E. Translation initiation driven by Type III, present in hepatitis A virus (HAV) RNA, was reported to depend on the integrity of eIF4G. Type IV IRES elements are eIF4G-dependent but depend on eIF2 and eIF3. As reported by Salas-Martinez 2018, the coxsackievirus B3 (CVB3) Type I IRES noted above is well-studied. This exemplary Type I IRES has 7 domains and various motifs within these domains. As set forth in, e.g., Martinez-Salas at Figure 4, and is known in the art, certain domains and motifs are conserved across the Types I, II, III, IV, V IRESs.

[0191] Inclusion of an IRES permits the translation of one or more open reading frames from a circular RNA (e.g., open reading frames that form the expression sequences). The IRES element attracts a eukaryotic ribosomal translation initiation complex and promotes translation 57Attorney Docket No. 01318-0014-00PCT OR-043WO initiation. See, e.g., Kaufman et al., Nuc. Acids Res. (1991) 19:4485-4490; Gurtu et al., Biochem. Biophys. Res. Comm. (1996) 229:295-298; Rees et al., BioTechniques (1996) 20: 102-110; Kobayashi et al., BioTechniques (1996) 21 :399-402; and Mosser et al., BioTechniques 1997 22 150-161. In some embodiments, the IRES is capable of facilitating expression of a protein encoded by the precursor RNA in a cell. In some embodiments, the IRES is capable of facilitating expression of the protein, such that the expression level of the protein is comparable to or higher than when a control IRES is used. In some embodiments, where the IRES is a synthetic IRES, the control IRES is the naturally occurring or wild-type IRES, namely a version of the IRES that has not been engineered to comprise any comprise any additions, deletions, or substitutions. In other embodiments where the synthetic IRES comprises a modification in a particular domain or motif, the control IRES can be either naturally occurring or synthetic so long as it comprises a naturally occurring or wild-type version of the domain or motif. In other embodiments, where the synthetic IRES comprises a substitution of a domain or motif with a domain or motif from a second IRES, the control IRES can comprise, for example, the IRES without the substitution of the domain or motif (i.e. naturally occurring domain or motif) or the control IRES can comprise the second IRES.

[0192] Different IRES sequences, including synthetic IRES sequences, have varying ability to drive protein expression, and the ability of any particular identified or predicted IRES sequence to drive protein expression from linear mRNA or circular RNA constructs is unknown and unpredictable. As demonstrated herein, such IRES sequences may have differing effects on protein expression capability depending on cell type, for example in T cells, B cells, NK cells, blood cells, whole blood cells, peripheral blood cells, spleen cells, bone marrow cells, liver cells, or muscle cells. In some embodiments, the novel synthetic IRES sequences described herein may have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or 100 fold increased expression in a particular cell type compared to control IRES sequences. In some embodiments, the novel synthetic IRES sequences described herein may have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or 100 fold increased expression in hepatocytes, immune cells (e.g., lymphocytes, T cells), muscle cells (e.g., myotubes) compared to control IRES sequences. In some embodiments, the control IRES sequence can be a previously described IRES sequence. In some embodiments for a synthetic IRES, the control IRES is the naturally occurring or wild- type IRES, namely a version of the IRES that has not been engineered to comprise any comprise any additions, deletions, or substitutions. In other embodiments where the synthetic IRES comprises a modification in a particular domain or motif, the control IRES can be either 58Attorney Docket No. 01318-0014-00PCT OR-043WO naturally occurring or synthetic so long as it comprises a naturally occurring or wild-type version of the domain or motif. In other embodiments where the synthetic IRES comprises a substitution of a domain or motif with a domain or motif from a second IRES, the control IRES can comprise, for example, the IRES without the substitution of the domain or motif (i.e. naturally occurring domain or motif) or the control IRES can comprise the second IRES.

[0193] In some embodiments, for driving protein expression, a polynucleotide (e.g., a DNA template, a linear precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises an IRES (naturally occurring or synthetic) operably linked to a protein coding sequence.

[0194] In some embodiments, the synthetic IRES is a Type I IRES, a Type II IRES, a Type III IRES, a Type IV IRES, or Type V IRES. In some embodiments, the synthetic IRES contains Domain I, Domain II, Domain III, Domain IV, Domain V, Domain VI, and Domain VII. The structure of the different types of IRESs are known in the art, as well as what domains and motifs are conserved across the Type II, III, IV, V IRESs. (See Salas-Martinez 2018.)

[0195] In some embodiments, the synthetic IRES is a Type I IRES. In some embodiments, the Type I IRES is derived from enterovirus, such as a poliovirus (PV), coxsackievirus B3 (CVB3), enterovirus 71 (EV71), and human rhinovirus (HRV). In some embodiments, the Type I IRES is a coxsackievirus B3 (CVB3) Type I IRES that has 7 domains and various known motifs within the domains. In some embodiments, the Type II IRES is derived from cardiovirus (EMCV) and aphthovirus (FMDV) RNAs. In some embodiments, the Type III IRES is derived from hepatitis A virus.

[0196] In some embodiments, the IRES (naturally occurring or synthetic) is derived from Aalivirus, Ailurivirus, Ampivirus, Anativirus, Aphthovirus, Aquamavirus, Avihepatovirus, Avisivirus, Boosepivirus, Bopivirus, Caecilivirus, Cardiovirus, Cosavirus, Crahelivirus, Crohivirus, Danipivirus, Dicipivirus, Diresapivirus, Enterovirus, Erbovirus, Felipivirus, Fipivirus, Gallivirus, Gruhelivirus, Grusopivirus, Harkavirus, Hemipivirus, Hepatovirus, Hunnivirus, Kobuvirus, Kunsagivirus, Limnipivirus, Livupivirus, Ludopivirus, Malagasivirus, Marsupivirus, Megrivirus, Mischivirus, Mosavirus, Mupivirus, Myrropivirus, Orivirus, Oscivirus, Parabovirus, Parechovirus, Pasivirus, Passerivirus, Pemapivirus, Poecivirus, Potamipivirus, Pygoscepivirus, Rabovirus, Rafivirus, Rajidapivirus, Rohelivirus, Rosavirus, Sakobuvirus, Salivirus, Sapelovirus, Senecavirus, Shanbavirus, Sicinivirus, Symapivirus, Teschovirus, Torchivirus, Tottorivirus, Tremovirus, Tropivirus, Hepacivirus, Pegivirus, 59Attorney Docket No. 01318-0014-00PCT OR-043WO Pestivirus, or Flavivirus. In some embodiments herein, the IRES is selected from an Enterovirus, Kobuvirus, Parechovirus, Hunnivirus, Passerivirus, Mischivirus, and Cardiovirus.

[0197] In some embodiments, the IRES (naturally occurring or synthetic) is an IRES sequence derived from Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian Virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1, Plautia stali intestine virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus- 1, Human Immunodeficiency Virus type 1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna- like virus, Encephalomyocarditis virus, Drosophila C Virus, Human coxsackievirus B3, Crucifer tobamovirus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black Queen Cell Virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1, Drosophila antennapedia, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1 alpha, Human n.myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-1, Mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae YAP1, tobacco etch virus, turnip crinkle virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, Picobirnavirus, HCV QC64, Human Cosavirus E / D, Human Cosavirus F, Human Cosavirus JMY, Rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus A SH1, Salivirus FHB, Salivirus NG-J1, Human Parechovirus 1, Crohivirus B, Yc-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A 2, Echovirus E14, Human Parechovirus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivirus A 1220, Pasivirus A 3, Sapelovirus, Rosavirus B, Bakunsa Virus, Tremovirus A, Swine Pasivirus 1, PLV-CHN, Pasivirus A, Sicinivirus, Hepacivirus K, Hepacivirus A, BVDV1, Border Disease Virus, BVDV2, CSFV- PK15C, SF573 Dicistrovirus, Hubei Picorna-like Virus, CRPV, Salivirus A BN5, Salivirus A BN2, Salivirus A 02394, Salivirus A GUT, Salivirus A CH, Salivirus A SZ1, Salivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24, or an aptamer to eIF4G.

[0198] In some embodiments, the IRES (naturally occurring or synthetic) comprises in whole or in part a eukaryotic or cellular IRES. In certain embodiments, the IRES is an IRES 60Attorney Docket No. 01318-0014-00PCT OR-043WO sequence derived from a human gene, wherein the human gene is ABCF1, ABCG1, ACAD10, ACOT7, ACSS3, ACTG2, ADCYAP1, ADK, AGTR1, AHCYL2, AHI1, AKAP8L, AKR1A1, ALDH3A1, ALDOA, ALG13, AMMECR1L, ANGPTL4, ANK3, AOC3, AP4B1, AP4E1, APAF1, APBB1, APC, APH1A, APOBEC3D, APOM, APP, AQP4, ARHGAP36, ARL13B, ARMC8, ARMCX6, ARPC1A, ARPC2, ARRDC3, ASAP1, ASB3, ASB5, ASCL1, ASMTL, ATF2, ATF3, ATG4A, ATP5B, ATP6V0A1, ATXN3, AURKA, AURKA, AURKA, AURKA, B3GALNT1, B3GNTL1, B4GALT3, BAAT, BAG1, BAIAP2, BAIAP2L2, BAZ2A, BBX, BCAR1, BCL2, BCS1L, BET1, BID, BIRC2, BPGM, BPIFA2, BRINP2, BSG, BTN3A2, C12orf43, C14orf93, C17orf62, C1orf226, C21orf62, C2orf15, C4BPB, C4orf22, C9orf84, CACNA1A, CALCOCO2, CAPN11, CASP12, CASP8AP2, CAV1, CBX5, CCDC120, CCDC17, CCDC186, CCDC51, CCN1, CCND1, CCNT1, CD2BP2, CD9, CDC25C, CDC42, CDC7, CDCA7L, CDIP1, CDK1, CDK11A, CDKN1B, CEACAM7, CEP295NL, CFLAR, CHCHD7, CHIA, CHIC1, CHMP2A, CHRNA2, CLCN3, CLEC12A, CLEC7A, CLECL1, CLRN1, CMSS1, CNIH1, CNR1, CNTN5, COG4, COMMD1, COMMD5, CPEB1, CPS1, CRACR2B, CRBN, CREM, CRYBG1, CSDE1, CSF2RA, CSNK2A1, CSTF3, CTCFL, CTH, CTNNA3, CTNNB1, CTNNB1, CTNND1, CTSL, CUTA, CXCR5, CYB5R3, CYP24A1, CYP3A5, DAG1, DAP3, DAP5, DAXX, DCAF4, DCAF7, DCLRE1A, DCP1A, DCTN1, DCTN2, DDX19B, DDX46, DEFB123, DGKA, DGKD, DHRS4, DHX15, DIO3, DLG1, DLL4, DMD UTR, DMD ex5, DMKN, DNAH6, DNAL4, DUSP13, DUSP19, DYNC1I2, DYNLRB2, DYRK1A, ECI2, ECT2, EIF1AD, EIF2B4, EIF4G1, EIF4G2, EIF4G3, ELANE, ELOVL6, ELP5, EMCN, ENO1, EPB41, ERMN, ERVV- 1, ESRRG, ETFB, ETFBKMT, ETV1, ETV4, EXD1, EXT1, EZH2, FAM111B, FAM157A, FAM213A, FBXO25, FBXO9, FBXW7, FCMR, FGF1, FGF1, FGF1A, FGF2, FGF2, FGF-9, FHL5, FMR1, FN1, FOXP1, FTH1, FUBP1, G3BP1, GABBR1, GALC, GART, GAS7, gastrin, GATA1, GATA4, GFM2, GHR, GJB2, GLI1, GLRA2, GMNN, GPAT3, GPATCH3, GPR137, GPR34, GPR55, GPR89A, GPRASP1, GRAP2, GSDMB, GSTO2, GTF2B, GTF2H4, GUCY1B2, HAX1, HCST, HIGD1A, HIGD1B, HIPK1, HIST1H1C, HIST1H3H, HK1, HLA-DRB4, HMBS, HMGA1, HNRNPC, HOPX, HOXA2, HOXA3, HPCAL1, HR, HSP90AB1, HSPA1A, HSPA4L, HSPA5, HYPK, IFFO1, IFT74, IFT81, IGF1, IGF1R, IGF1R, IGF2, IL11, IL17RE, IL1RL1, IL1RN, IL32, IL6, ILF2, ILVBL, INSR, INTS13, IP6K1, ITGA4, ITGAE, KCNE4, KERA, KIAA0355, KIAA0895L, KIAA1324, KIAA1522, KIAA1683, KIF2C, KIZ, KLHL31, KLK7, KRR1, KRT14, KRT17, KRT33A, KRT6A, KRTAP10-2, KRTAP13-3, KRTAP13-4, KRTAP5-11, KRTCAP2, LACRT, LAMB1, 61Attorney Docket No. 01318-0014-00PCT OR-043WO LAMB3, LANCL1, LBX2, LCAT, LDHA, LDHAL6A, LEF1, LINC-PINT, LMO3, LRRC4C, LRRC7, LRTOMT, LSM5, LTB4R, LYRM1, LYRM2, MAGEA11, MAGEA8, MAGEB1, MAGEB16, MAGEB3, MAPT, MARS, MC1R, MCCC1, METTL12, METTL7A, MGC16025, MGC16025, MIA2, MIA2, MITF, MKLN1, MNT, MORF4L2, MPD6, MRFAP1, MRPL21, MRPS12, MSI2, MSLN, MSN, MT2A, MTFR1L, MTMR2, MTRR, MTUS1, MYB, MYC, MYCL, MYCN, MYL10, MYL3, MYLK, MYO1A, MYT2, MZB1, NAP1L1, NAV1, NBAS, NCF2, NDRG1, NDST2, NDUFA7, NDUFB11, NDUFC1, NDUFS1, NEDD4L, NFAT5, NFE2L2, NFE2L2, NFIA, NHEJ1, NHP2, NIT1, NKRF, NME1-NME2, NPAT, NR3C1, NRBF2, NRF1, NTRK2, NUDCD1, NXF2, NXT2, ODC1, ODF2, OPTN, OR10R2, OR11L1, OR2M2, OR2M3, OR2M5, OR2T10, OR4C15, OR4F17, OR4F5, OR5H1, OR5K1, OR6C3, OR6C75, OR6N1, OR7G2, p53, P2RY4, PAN2, PAQR6, PARP4, PARP9, PC, PCBP4, PCDHGC3, PCLAF, PDGFB, PDZRN4, PELO, PEMT, PEX2, PFKM, PGBD4, PGLYRP3, PHLDA2, PHTF1, PI4KB, PIGC, PIM1, PKD2L1, PKM, PLCB4, PLD3, PLEKHA1, PLEKHB1, PLS3, PML, PNMA5, PNN, POC1A, POC1B, POLD2, POLD4, POU5F1, PPIG, PQBP1, PRAME, PRPF4, PRR11, PRRT1, PRSS8, PSMA2, PSMA3, PSMA4, PSMD11, PSMD4, PSMD6, PSME3, PSMG3, PTBP3, PTCH1, PTHLH, PTPRD, PUS7L, PVRIG, QPRT, RAB27A, RAB7B, RABGGTB, RAET1E, RALGDS, RALYL, RARB, RCVRN, REG3G, RFC5, RGL4, RGS19, RGS3, RHD, RINL, RIPOR2, RITA1, RMDN2, RNASE1, RNASE4, RNF4, RPA2, RPL17, RPL21, RPL26L1, RPL28, RPL29, RPL41, RPL9, RPS11, RPS13, RPS14, RRBP1, RSU1, RTP2, RUNX1, RUNX1T1, RUNX1T1, RUNX2, RUSC1, RXRG, S100A13, S100A4, SAT1, SCHIP1, SCMH1, SEC14L1, SEMA4A, SERPINA1, SERPINB4, SERTAD3, SFTPD, SH3D19, SHC1, SHMT1, SHPRH, SIM1, SIRT5, SLC11A2, SLC12A4, SLC16A1, SLC25A3, SLC26A9, SLC5A11, SLC6A12, SLC6A19, SLC7A1, SLFN11, SLIRP, SMAD5, SMARCAD1, SMN1, SNCA, SNRNP200, SNRPB2, SNX12, SOD1, SOX13, SOX5, SP8, SPARCL1, SPATA12, SPATA31C2, SPN, SPOP, SQSTM1, SRBD1, SRC, SREBF1, SRPK2, SSB, SSB, SSBP1, ST3GAL6, STAB1, STAMBP, STAU1, STAU1, STAU1, STAU1, STAU1, STK16, STK24, STK38, STMN1, STX7, SULT2B1, SYK, SYNPR, TAF1C, TAGLN, TANK, TAS2R40, TBC1D15, TBXAS1, TCF4, TDGF1, TDP2, TDRD3, TDRD5, TESK2, THAP6, THBD, THTPA, TIAM2, TKFC, TKTL1, TLR10, TM9SF2, TMC6, TMCO2, TMED10, TMEM116, TMEM126A, TMEM159, TMEM208, TMEM230, TMEM67, TMPRSS13, TMUB2, TNFSF4, TNIP3, TP53, TP53, TP73, TRAF1, TRAK1, TRIM31, TRIM6, TRMT1, TRMT2B, TRPM7, TRPM8, TSPEAR, TTC39B, TTLL11, 62Attorney Docket No. 01318-0014-00PCT OR-043WO TUBB6, TXLNB, TXNIP, TXNL1, TXNRD1, TYROBP, U2AF1, UBA1, UBE2D3, UBE2I, UBE2L3, UBE2V1, UBE2V2, UMPS, UNG, UPP2, USMG5, USP18, UTP14A, UTRN, UTS2, VDR, VEGFA, VEGFA, VEPH1, VIPAS39, VPS29, VSIG10L, WDHD1, WDR12, WDR4, WDR45, WDYHV1, WRAP53, XIAP, XPNPEP3, YAP1, YWHAZ, YY1AP1, ZBTB32, ZNF146, ZNF250, ZNF385A, ZNF408, ZNF410, ZNF423, ZNF43, ZNF502, ZNF512, ZNF513, ZNF580, ZNF609, ZNF707, or ZNRD1.

[0199] In some embodiments, the cell is a myotube. In some embodiments, the IRES (naturally occurring or synthetic) is derived from Bopivirus, Oscivirus, Hunnivirus, Passerivirus, Mischivirus, Kobuvirus, Enterovirus, Cardiovirus, Salivirus, Rabovirus, Parechovirus, Gallivirus, or Sicinivirus. In some embodiments, the IRES is derived from Hunnivirus, Passerivirus, Kobuvirus, Bopivirus, or Enterovirus. In some embodiments, the IRES is derived from Enterovirus I, Enterovirus F, Enterovirus E, Enterovirus J, Enterovirus C, Enterovirus A, Enterovirus B, Aichivirus B, Parechovirus A, Cardiovirus F, Cardiovirus B, or Cardiovirus E.

[0200] In some embodiments, the cell is a hepatocyte. In some embodiments, the IRES (naturally occurring or synthetic) is derived from Enterovirus, Bopivirus, Mischivirus, Gallivirus, Oscivirus, Cardiovirus, Kobuvirus, Rabovirus, Salivirus, Parechovirus, Hunnivirus, Tottorivirus, Passerivirus, Cosavirus, or Sicinivirus. In some embodiments, the IRES is derived from Enterovirus, Mischivirus, Kobuvirus, Bopivirus, or Gallivirus. In some embodiments, the IRES is derived from Enterovirus B, Enterovirus A, Enterovirus D, Enterovirus J, Enterovirus C, Rhinovirus B, Enterovirus H, Enterovirus I, Enterovirus E, Enterovirus F, Aichivirus B, Aichivirus A, Parechovirus A, Cardiovirus F, Cardiovirus E, or Cardiovirus B.

[0201] In some embodiments, the cell is a T cell. In some embodiments, the IRES (naturally occurring or synthetic) is derived from Passerivirus, Bopivirus, Hunnivirus, Mischivirus, Enterovirus, Kobuvirus, Rabovirus, Tottorivirus, Salivirus, Cardiovirus, Parechovirus, Megrivirus, Allexivirus, Oscivirus, or Shanbavirus. In some embodiments, the IRES is derived from Passerivirus, Hunnivirus, Mischivirus, Enterovirus, or Kobuvirus. In some embodiments, the IRES is derived from Enterovirus I, Enterovirus D, Enterovirus C, Enterovirus A, Enterovirus J, Enterovirus H, Aichivirus B, Parechovirus A, or Cardiovirus B. ii. Synthetic IRES: engineered additions, deletions, or substitutions

[0202] In certain embodiments, a TIE provided herein is a synthetic TIE and / or the IRES provided herein is a synthetic IRES. In some embodiments, the synthetic IRES is a Type I IREs, a Type II IRES, a Type III IRES, a Type IV IRES, or Type V IRES. 63Attorney Docket No. 01318-0014-00PCT OR-043WO

[0203] In some embodiments, the TIE comprises a synthetic IRES engineered to comprise at least one addition, deletion, or substitution in a nucleotide, domain, or motif, as compared to a naturally occurring IRES. In some embodiments, the synthetic IRES contains at least one substitution or deletion of entire domains or motifs, or regions thereof. Where the addition, deletion, or substitution includes substituting an entire domain or motif, or region thereof, the newly substituted domain or motif or region can be from a second IRES. In some embodiments, the second IRES is a second higher-expressing, naturally occurring, IRES.

[0204] As exhibited by the exemplary synthetic IRES sequences presented herein, at least one addition, deletion, or substitution of a nucleotide, domain, or motif in a synthetic IRES (as compared to the naturally occurring IRES) differ from the mutations in a permuted Group I and / or Group II intron segment presented herein and the modifications that make up, for example, a modified nucleotide or nucleoside described in detail herein, e.g., present in intronic or exonic elements, e.g., where the modified nucleoside is, e.g., a 5-methylcytidine, 5- methoxyuridine, 1-methyl-pseudouridine, N6-methyladenosine, and / or pseudouridine. Those modifications seek to improve circularization efficiency or splicing efficiency, whereas the changes engineered into the sequences of synthetic IRESs seek to improve function and / or expression and / or stability, as compared to a naturally occurring IRES.

[0205] In some embodiments, for example, the synthetic IRES is an EMCV IRES that contains two Pol III terminal signals, and comprises an alteration in at least one of the Pol III termination elements. In some embodiments, conserved Pol III terminal signals in the PTB binding motif are modified and / or stop codons are changed in the synthetic IRES. For example, in some embodiments, the synthetic IRES comprises replacing a “UCUUU” or “UUUAU” sequence that binds to polypyrimidine binding tract (PTB) with a “UUCUCU” or “UCUCU” or “UCUAU” PTB binding motif. See Unti, Cell Chemical Biology 31, 163–176, January 18, 2024 (incorporated by reference herein in its entirety). In some embodiments, the Pol III termination signal is replaced with a related sequence from a falcon picornavirus, which does not have a PolIII termination element in the corresponding region. See Unti 2024. In some embodiments, a viral P2A sequence was included, which induces ribosome skipping and cleaves the polypeptide chain. In some embodiments an IRES can also include point mutations and the circular RNA can include stop codon insertions.

[0206] In some embodiments the oRNA comprises a synthetic IRES. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one domain. In some embodiments, the synthetic IRES 64Attorney Docket No. 01318-0014-00PCT OR-043WO comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one of Domain I, Domain II, Domain III, Domain IV, Domain V, and Domain VI, as compared to a naturally occurring corresponding domain.

[0207] In certain instances where the oRNA comprises a synthetic IRES comprising a substitution of an entire domain or motif, the replacement domain or motif may be derived from a different IRES, e.g., from a second higher-expressing, naturally occurring, IRES. Replacing the domain or motif with that of a different IRES renders the initial IRES synthetic, even if the domain or motif does not contain any nucleotide modifications and retains the sequence as present in the second, naturally occurring, IRES.

[0208] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in Domain I as compared to a naturally occurring Domain I, or comprises a deletion or substitution of Domain I in whole or in part. In some embodiments, the synthetic IRES comprises a deletion of Domain I in whole or in part. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain I or comprises a deletion or substitution of Domain I in whole or in part as compared to a naturally occurring Domain I, while the other domains are retained. In some embodiments, the synthetic IRES comprises a naturally occurring Domain I. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one domain, wherein the domain is not Domain I and the naturally occurring sequence of Domain I is conserved.

[0209] In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain I, and comprises a naturally occurring Domain II, Domain III, Domain IV, and Domain V. In some embodiments, the synthetic IRES comprises a deletion of Domain I whole or in part, and comprises a naturally occurring Domain II, Domain III, Domain IV, and Domain V. In some embodiments, engineering the synthetic IRES to comprise at least one addition, deletion, or substitution of a nucleotide or motif in Domain I is shown to improve IRES function as compared to a naturally occurring IRES or an IRES with a naturally occurring Domain I. In some embodiments, retaining Domain II is shown to improve IRES function, as compared to a synthetic Domain II. In some embodiments, retaining Domain III is shown to improve IRES function, as compared to a synthetic Domain III. In some embodiments, retaining Domain IV is shown to improve IRES function, as compared to a synthetic Domain IV. In some embodiments, retaining Domain V is shown to improve IRES function, as compared to a synthetic Domain V. 65Attorney Docket No. 01318-0014-00PCT OR-043WO

[0210] In some embodiments, the synthetic IRES comprises a combination of domains from multiple naturally occurring IRESs. For example, a synthetic IRES may comprise a combination of Domains I, II, and III from a first naturally occurring IRES and Domains IV, V, VI, and VII from a different second naturally occurring IRES. In certain embodiments, combining domains from a first and second naturally occurring IRES retains the IRES function of the synthetic IRES.

[0211] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in Domain II as compared to a naturally occurring Domain II, or comprises a deletion or substitution of Domain II in whole or in part. In some embodiments, the synthetic IRES comprises a deletion of Domain II in whole or in part. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain II or comprises a deletion or substitution of Domain II in whole or in part as compared to a naturally occurring Domain II, while the other domains are retained. In some embodiments, the synthetic IRES comprises a naturally occurring Domain II. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one domain, wherein the domain is not Domain II and the naturally occurring sequence of Domain II is conserved.

[0212] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in Domain III as compared to a naturally occurring Domain III, or comprises a deletion or substitution of Domain III in whole or in part. In some embodiments, the synthetic IRES comprises a deletion of Domain III in whole or in part. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain III or comprises a deletion or substitution of Domain III in whole or in part as compared to a naturally occurring Domain III, while the other domains are retained. In some embodiments, the synthetic IRES comprises a naturally occurring Domain III. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one domain, wherein the domain is not Domain III and the naturally occurring sequence of Domain III is conserved.

[0213] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in Domain IV as compared to a naturally occurring Domain IV, or comprises a deletion or substitution of Domain IV in whole or in part. In some embodiments, the synthetic IRES comprises a deletion of Domain IV in whole or in part. In some embodiments, the synthetic IRES comprises at least one addition, 66Attorney Docket No. 01318-0014-00PCT OR-043WO deletion, or substitution of a nucleotide or motif in Domain IV or comprises a deletion or substitution of Domain IV in whole or in part as compared to a naturally occurring Domain IV, while the other domains are retained. In some embodiments, the synthetic IRES comprises a naturally occurring Domain IV. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one domain, wherein the domain is not Domain IV and the naturally occurring sequence of Domain IV is conserved.

[0214] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in Domain IV as compared to a naturally occurring Domain IV, or comprises a deletion or substitution of Domain IV in whole or in part. In some embodiments, the synthetic IRES comprises a substitution of Domain IV as a whole, wherein Domain IV is replaced with a Domain IV from a second IRES. In some embodiments, the entirety of Domain IV is replaced with a Domain IV from a second, higher- expressing, naturally occurring, IRES. See WO2023182948A1, which is incorporated by reference herein in its entirety (describing a domain IV substitution).

[0215] Domain IV can be conserved between IRES types. Domain IV of a Type 1 IRES, for example, is known to contain a GNRA tetra loop (where N stands for any nucleotide, and R for purine), a C-rich loop, and a EIF2 / EIF4G binding site. (See Breyne, PNAS, vol.106: 23, 2009, 9197-9202 and Mailliot & Martin, WIREs RNA 2018, 9:e1458, both incorporated by reference herein). In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide in the GNRA tetra loop, C-rich loop, or EIF2 / EIF4G binding site in Domain IV.

[0216] In some embodiments, the at least one addition, deletion, or substitution in Domain IV comprises an addition of an EIF4 aptamer sequence at the 5’ end of Domain IV. In some embodiments, the at least one addition, deletion, or substitution in Domain IV comprises an addition of an EIF3 / EIF4G aptamer sequence to the 2 nucleotide bulge and / or 3 nucleotide bulge of Domain IV. Exemplary aptamer EIF4E sequences are Aptamer EIF4E sequence 1: TGTTCAACCAGAGTGAAACCACTAACGGGTCAGAGCCCC (SEQ ID NO: 24901) and Aptamer EIF4E sequence 2: GCCAGAGCAACAACCTTCCGAGCCGCGGGATAAAACCGAG (SEQ ID NO: 24902).

[0217] In some embodiments where the synthetic IRES comprises at least one addition, deletion, or substitution in Domain IV, the synthetic IRES comprises a naturally occurring Domain VII. For example, in some embodiments, the synthetic IRES comprises an addition of an EIF4 or EIF3 / EIF4G aptamer sequence in Domain IV, and does not comprise a 67Attorney Docket No. 01318-0014-00PCT OR-043WO replacement of nucleotides from the 5’ end of the terminal stem of Domain VII to the 3’ end of the IRES sequence with a EIF4 aptamer sequence.

[0218] In some embodiments, at least one addition, deletion, or substitution in Domain IV comprises an addition of a Polypyrimidine tract (PPT) in Domain IV. In some embodiments, the PPT tract of the synthetic IRES is replaced with a PPT tract from a second, higher- expressing, naturally occurring, IRES. For example, where the starting IRES (i.e. synthetic IRES before engineered changes) has lower and / or comparable expression levels, replacing the PPT sequence with a donor PPT sequence from a higher-expressing IRES improves the IRES function of the resultant synthetic IRES. In some embodiments, the higher-expressing IRES is a higher-expressing, naturally occurring, IRES. In other embodiments, the synthetic IRES comprises a naturally occurring whole PPT sequence in Domain IV. In some embodiments, the synthetic IRES does not contain an added PTBP1 consensus sequence. In such embodiments, adding a PTBP1 consensus sequence could worsen IRES function.

[0219] In some embodiments, the at least one addition, deletion, or substitution in Domain IV comprises an addition, deletion, or substitution in a GNRA tetra loop in Domain IV. The native function of the GNRA tetra loop is EIF recruitment and additions, deletions, or substitutions in the GNRA tetra loop in Domain IV are shown to enhance EIF recruitment leading to improved IRES function. In some embodiments, substitution of a GNRA consensus sequence may improve IRES function.

[0220] In some embodiments, the at least one addition, deletion, or substitution in Domain IV comprises an addition, deletion, or substitution in a negative IRES transacting factor (“- ITAF”), optionally comprising a mutation or deletion of a FBP2 / KHSRP binding region, optionally wherein the mutation or deletion is in frame. The FBP2 / KHSRP binding region in Domain IV is an internal mechanism to attenuate expression. A synthetic IRES comprising a negative ITAF (“-ITAF”) mutation or deletion of FBP2 / KHSRP binding region, preferably in frame, improves IRES function.

[0221] In some embodiments where the synthetic IRES comprises at least one addition, deletion, or substitution in Domain IV, the C-Loop Region of Domain IV recognized by either PCBP1 or PCBP2 of the synthetic IRES is naturally occurring. Retaining the C-Loop region recognized by either PCBP1 or PCBP2, improves IRES function. The C-Loop at the outer edge of the IRES is required for exposure to protein PCBP1 / 2 to attract ribosomes. Accordingly, deleting or otherwise mutating the C-loop region recognized by PCBP1 or PCBP2 is shown to worsen IRES function in Domain IV. 68Attorney Docket No. 01318-0014-00PCT OR-043WO

[0222] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in Domain V as compared to a naturally occurring Domain V, or comprises a deletion or substitution of Domain V in whole or in part. In some embodiments, the synthetic IRES comprises a deletion of Domain V in whole or in part. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain V or comprises a deletion or substitution of Domain V in whole or in part as compared to a naturally occurring Domain V, while the other domains are retained. In some embodiments, the synthetic IRES comprises a naturally occurring Domain V. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one domain, wherein the domain is not Domain V and the naturally occurring sequence of Domain V is conserved. In some embodiments, retaining Domain V is shown to improve IRES function.

[0223] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif therein, but the synthetic IRES does not comprise a J-K / L Loop of a Type II IRES in Domain V.

[0224] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in Domain VI as compared to a naturally occurring Domain VI, or comprises a deletion or substitution of Domain VI in whole or in part. In some embodiments, the synthetic IRES comprises a deletion of Domain VI in whole or in part. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain VI or comprises a deletion or substitution of Domain VI in whole or in part as compared to a naturally occurring Domain VI, while the other domains are retained. In some embodiments, the synthetic IRES comprises a naturally occurring Domain VI. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one domain, wherein the domain is not Domain VI and the naturally occurring sequence of Domain VI is conserved. In some embodiments, retaining Domain VI is shown to improve IRES function.

[0225] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in Domain VII as compared to a naturally occurring Domain VII, or comprises a deletion or substitution of Domain VII in whole or in part. In some embodiments, the synthetic IRES comprises a deletion of Domain VII in whole or in part. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain VII or comprises a deletion or 69Attorney Docket No. 01318-0014-00PCT OR-043WO substitution of Domain VII in whole or in part as compared to a naturally occurring Domain VII, while the other domains are retained. In some embodiments, the synthetic IRES comprises a naturally occurring Domain VII. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in at least one domain, wherein the domain is not Domain VII and the naturally occurring sequence of Domain VII is conserved. In some embodiments, retaining Domain VII is shown to improve IRES function.

[0226] In some embodiments, the oRNA comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a nucleotide or motif in the post-Domain VII terminal loop as compared to a naturally occurring post-Domain VII terminal loop, or comprises a deletion or substitution of the post-Domain VII terminal loop in whole or in part. In some embodiments, the synthetic IRES comprises a deletion of a naturally occurring post-Domain VII terminal stem and an addition of a 15-nt scanning tract comprising the sequence AUN- AUN-AUN-AUN-AUN, wherein N is a U or A. Deleting the post-Domain VII terminal stem and adding a 15-nt scanning tract is shown to improve IRES function as compared to IRES that retains the native (naturally occurring) post-Domain VII terminal stem.

[0227] In some embodiments, the synthetic IRES comprises a deletion of a naturally occurring post-Domain VII terminal stem and an addition of a 9-nt Kozak sequence in Domain VII. Synthetically engineering the IRES to delete the post-Domain VII terminal stem and adding the 9-nt Kozak sequence is shown to improve IRES function as compared to IRES that retains the native (naturally occurring) post-Domain VII terminal stem. Notably, such a synthetic IRES differs from a naturally occurring IRES having a Kozak sequence in its native form. (See WO2019118919A1.) Such a synthetic IRES also differs from, e.g., a circular RNA simply adding a Kozak sequence, for example, the IRES described in, e.g., WO2022037692A1, where the Kozak sequence is not a replacement of the terminal stem of Domain VII, but rather is simply an addition following the 3’ end of the IRES. In some embodiments, the Kozak sequences that are added to Domain VII can comprise alterations whereby the last three nucleotides of the Kozak sequence can comprise an “AUG” sequence.

[0228] In some embodiments, the synthetic IRES comprises a deletion of a naturally occurring post-Domain VII terminal stem and an addition of an 11-nt consensus sequence comprising “AACACAACAAA.” (SEQ ID NO: 24903) In some embodiments, the synthetic IRES comprises replacing the naturally occurring post-Domain VII terminal stem with an 11- nt consensus sequence selected from comprising “AACACAACAAA.” (SEQ ID NO: 24903) Synthetically engineering the IRES to replace the post-Domain VII terminal stem with the 11- 70Attorney Docket No. 01318-0014-00PCT OR-043WO nt consensus sequence comprising “AACACAACAAA” (SEQ ID NO: 24903) is shown to improve IRES function as compared to IRES that retains the native (naturally occurring) post- Domain VII terminal stem.

[0229] In some embodiments, the synthetic IRES comprises a naturally occurring Domain VII. In some embodiments, retaining Domain VII is shown to improve IRES function. In some embodiments, the nucleotides from the 5’ end of the terminal stem of Domain VII to the 3’ end of the synthetic IRES are retained, and, e.g., are not replaced with an EIF4 aptamer sequence.

[0230] In some embodiments, the oRNA comprises a synthetic IRES, wherein the synthetic IRES does not contain an addition, deletion, or substitution of a nucleotide in any cryptic codons or contain a deletion or substitution of any cryptic codons in whole or in part. In some embodiments, the synthetic IRES does not contain a deletion of any cryptic codons in part or in whole anywhere in the IRES. A cryptic initiation codon can refer to any AUG anywhere along the IRES and is neither specific to any particular type of IRES nor confined to a specific domain. Retaining cryptic codons is shown to maintain or improve IRES function compared to IRES in which cryptic codons are deleted in part or whole. A cryptic initiation codon can also comprise other non-AUG initiation codons for translation.

[0231] In some embodiments, the synthetic IRES comprises at least one addition of a cryptic codon in any domain. In some embodiments, the synthetic IRES comprises at least one addition of a cryptic codon in Domain VII. Adding cryptic codon in, e.g., Domain VII, can maintain or improve IRES function. These embodiments wherein the IRESs are synthetically engineered to have an “AUG” cryptic codon sequence in, e.g., Domain VII, differ from IRESs that have naturally occurring AUG cryptic codons present in the IRESs’ native (naturally occurring) form. See WO2019118919A1.

[0232] IRESs derived computationally from native UTRs have non-canonical stem loop regions (“SL region”). In some embodiments, the synthetic IRES comprises naturally occurring non-canonical SL regions, wherein the SL regions neither contain any additions deletions, or substitutions of a nucleotide in the SL regions nor contain a deletion or substitution of any SL regions in whole or in part. In some embodiments, the synthetic IRES does not contain a: (a) deletion of SL1 in whole or in part, (b) deletion of SL2 in whole or in part, (c) deletion of SL3 in whole or in part, and / or (d) deletion of SL4 in whole or in part. In some embodiments, the synthetic IRES does not contain an addition of a SL4 to an IRES natively lacking a SL4. 71Attorney Docket No. 01318-0014-00PCT OR-043WO

[0233] In some embodiments, alterations or deletions of the SL regions in a synthetic IRES can hinder the function of the synthetic IRES. For example, some synthetic IRESs are shown to have a SL1, SL2, and SL3 in replacement of Domain I and / or upstream to Domain II, a SL4 in between Domain IV and V, and a SL5 following domain VII retained from the naturally occurring IRES as compared to a more canonical Type I IRES, such as CVB3. In some embodiments, deletion of one or more SL regions in these synthetic IRES is shown to hinder overall IRES function

[0234] If lower expression is desirable, e.g., for stability of gene expression, a synthetic IRES can be engineered to retain Domain I, and / or provide at least one addition, deletion, or substitution of a nucleotide or motif in Domain II in whole or in part, and / or provide at least one addition, deletion, or substitution of a nucleotide or motif in Domain III in whole or in part, and / or provide at least one addition, deletion, or substitution of a nucleotide or motif in Domain IV in whole or in part, and / or provide at least one addition, deletion, or substitution of a nucleotide or motif in Domain V in whole or in part. In some embodiments, the synthetic Ires is engineered to retain Domain I, and / or to delete Domain II in whole or in part, and / or to delete Domain III in whole or in part, and / or to delete Domain V in whole or in part, and / or to substitute Domain V with a J-K / L Loop of a Type II IRES.

[0235] In some embodiments, the oRNA comprises a synthetic IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an IRES sequence in Table 1, or a fragment thereof. In some embodiments, the oRNA comprises a synthetic IRES comprising a sequence in Table 1, or a fragment thereof. In some embodiments, the precursor RNA polynucleotide, circular RNA constructs and related pharmaceutical compositions disclosed herein comprise a synthetic IRES sequence comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an IRES sequence in Table 1, or a fragment thereof. In some embodiments, the precursor RNA polynucleotide, circular RNA constructs and related pharmaceutical compositions disclosed herein comprise a synthetic IRES sequence comprising a sequence in Table 1, or a fragment thereof. Table 1: Synthetic IRES Sequences72Attorney Docket No. 01318-0014-00PCT OR-043WO73Attorney Docket No. 01318-0014-00PCT OR-043WO74Attorney Docket No. 01318-0014-00PCT OR-043WO75Attorney Docket No. 01318-0014-00PCT OR-043WO76Attorney Docket No. 01318-0014-00PCT OR-043WO77Attorney Docket No. 01318-0014-00PCT OR-043WO78Attorney Docket No. 01318-0014-00PCT OR-043WO79Attorney Docket No. 01318-0014-00PCT OR-043WO80Attorney Docket No. 01318-0014-00PCT OR-043WO81Attorney Docket No. 01318-0014-00PCT OR-043WO82Attorney Docket No. 01318-0014-00PCT OR-043WO83Attorney Docket No. 01318-0014-00PCT OR-043WO84Attorney Docket No. 01318-0014-00PCT OR-043WO85Attorney Docket No. 01318-0014-00PCT OR-043WO86Attorney Docket No. 01318-0014-00PCT OR-043WO87Attorney Docket No. 01318-0014-00PCT OR-043WO88Attorney Docket No. 01318-0014-00PCT OR-043WO89Attorney Docket No. 01318-0014-00PCT OR-043WO90Attorney Docket No. 01318-0014-00PCT OR-043WO91Attorney Docket No. 01318-0014-00PCT OR-043WO92Attorney Docket No. 01318-0014-00PCT OR-043WO93Attorney Docket No. 01318-0014-00PCT OR-043WO94Attorney Docket No. 01318-0014-00PCT OR-043WO95Attorney Docket No. 01318-0014-00PCT OR-043WO96Attorney Docket No. 01318-0014-00PCT OR-043WO97Attorney Docket No. 01318-0014-00PCT OR-043WO98Attorney Docket No. 01318-0014-00PCT OR-043WO99Attorney Docket No. 01318-0014-00PCT OR-043WO100Attorney Docket No. 01318-0014-00PCT OR-043WO101Attorney Docket No. 01318-0014-00PCT OR-043WO102Attorney Docket No. 01318-0014-00PCT OR-043WO103Attorney Docket No. 01318-0014-00PCT OR-043WO104Attorney Docket No. 01318-0014-00PCT OR-043WO105Attorney Docket No. 01318-0014-00PCT OR-043WO106Attorney Docket No. 01318-0014-00PCT OR-043WO107Attorney Docket No. 01318-0014-00PCT OR-043WO108Attorney Docket No. 01318-0014-00PCT OR-043WO109Attorney Docket No. 01318-0014-00PCT OR-043WO110Attorney Docket No. 01318-0014-00PCT OR-043WO111Attorney Docket No. 01318-0014-00PCT OR-043WO112Attorney Docket No. 01318-0014-00PCT OR-043WO113Attorney Docket No. 01318-0014-00PCT OR-043WO114Attorney Docket No. 01318-0014-00PCT OR-043WO115Attorney Docket No. 01318-0014-00PCT OR-043WO116Attorney Docket No. 01318-0014-00PCT OR-043WO117Attorney Docket No. 01318-0014-00PCT OR-043WO118Attorney Docket No. 01318-0014-00PCT OR-043WO119Attorney Docket No. 01318-0014-00PCT OR-043WO120Attorney Docket No. 01318-0014-00PCT OR-043WO121Attorney Docket No. 01318-0014-00PCT OR-043WO122Attorney Docket No. 01318-0014-00PCT OR-043WO123Attorney Docket No. 01318-0014-00PCT OR-043WO124Attorney Docket No. 01318-0014-00PCT OR-043WO125Attorney Docket No. 01318-0014-00PCT OR-043WO126Attorney Docket No. 01318-0014-00PCT OR-043WO127Attorney Docket No. 01318-0014-00PCT OR-043WO128Attorney Docket No. 01318-0014-00PCT OR-043WO129Attorney Docket No. 01318-0014-00PCT OR-043WO130Attorney Docket No. 01318-0014-00PCT OR-043WO131Attorney Docket No. 01318-0014-00PCT OR-043WO132Attorney Docket No. 01318-0014-00PCT OR-043WO133Attorney Docket No. 01318-0014-00PCT OR-043WO134Attorney Docket No. 01318-0014-00PCT OR-043WO135Attorney Docket No. 01318-0014-00PCT OR-043WO136Attorney Docket No. 01318-0014-00PCT OR-043WO137Attorney Docket No. 01318-0014-00PCT OR-043WO138Attorney Docket No. 01318-0014-00PCT OR-043WO139Attorney Docket No. 01318-0014-00PCT OR-043WO140Attorney Docket No. 01318-0014-00PCT OR-043WO141Attorney Docket No. 01318-0014-00PCT OR-043WO142Attorney Docket No. 01318-0014-00PCT OR-043WO143Attorney Docket No. 01318-0014-00PCT OR-043WO144Attorney Docket No. 01318-0014-00PCT OR-043WO145Attorney Docket No. 01318-0014-00PCT OR-043WO146Attorney Docket No. 01318-0014-00PCT OR-043WO147Attorney Docket No. 01318-0014-00PCT OR-043WO148Attorney Docket No. 01318-0014-00PCT OR-043WO149Attorney Docket No. 01318-0014-00PCT OR-043WO150Attorney Docket No. 01318-0014-00PCT OR-043WO151Attorney Docket No. 01318-0014-00PCT OR-043WO152Attorney Docket No. 01318-0014-00PCT OR-043WO153Attorney Docket No. 01318-0014-00PCT OR-043WO154Attorney Docket No. 01318-0014-00PCT OR-043WO155Attorney Docket No. 01318-0014-00PCT OR-043WO156Attorney Docket No. 01318-0014-00PCT OR-043WO157Attorney Docket No. 01318-0014-00PCT OR-043WO158Attorney Docket No. 01318-0014-00PCT OR-043WO159Attorney Docket No. 01318-0014-00PCT OR-043WO160Attorney Docket No. 01318-0014-00PCT OR-043WO

[0236] In some embodiments, the oRNA comprising a synthetic IRES, or domains or motifs thereof, comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an IRES sequence in Table 1, or a fragment thereof exhibits improved expression and / or function and / or stability in hepatocytes, immune cells (e.g., lymphocytes, T cells), muscle cells (e.g., myotubes), for example, as compared to a naturally occurring IRES, the naturally occurring counterpart, or a CVB3 IRES or comparative IRES 1. In some embodiments, the oRNA comprising a synthetic IRES, or domains or motifs thereof, comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an IRES sequence comprising IRES 307-314 from Table 1 (SEQ ID NOs: 25452-25459), or a fragment thereof exhibits improved expression and / or function and / or stability in hepatocytes, immune cells (e.g., lymphocytes, T cells), muscle cells (e.g., myotubes), for example, as compared to a naturally occurring IRES, the naturally occurring counterpart, or a CVB3 IRES or comparative IRES 1. In some embodiments, the synthetic IRES increases expression of a coding sequence operably linked to the IRES as compared to the naturally occurring IRES. In some embodiments, the synthetic IRES is capable of enhancing expression of the therapeutic protein as compared to a naturally occurring IRES. iii. Exemplary Corresponding Naturally Occurring IRES Sequences

[0237] In some embodiments, for driving protein expression, a provided circular RNA comprises an IRES operably linked to a protein coding sequence. In some embodiments, the IRES is synthetic. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence selected from SEQ ID NOS: 1-2989, 3282-3303, and 14067-24829 (GIRES 0- 10762) or Table 2 below, or SEQ ID NOs: 1-2983 and 3282-3287 of PCT Application No. US2022 / 33091 (WO202261490) or a fragment thereof. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide 161Attorney Docket No. 01318-0014-00PCT OR-043WO as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from SEQ ID NOs: 1-2989, 3282-3303, and 14067-24829 or Table 2 below, or a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287 of PCT Application No. US2022 / 33091 (WO202261490) or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises a synthetic IRES sequence comprising at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from SEQ ID NOs: 1-2989, 3282-3303, and 14067-24829 or Table 2 below, or a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287 of PCT Application No. US2022 / 33091 (WO202261490) or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises a synthetic IRES sequence comprising at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence selected from SEQ ID NOs: 1-2989, 3282-3303, and 14067-24829 or Table 2 below or a fragment thereof, or SEQ ID NOs: 1-2983 and 3282-3287 of PCT Application No. US2022 / 33091 (WO202261490) or a fragment thereof. In some embodiments, such circular RNAs, or domains or motifs thereof, exhibit improved expression and / or function and / or stability in hepatocytes, immune cells (e.g., lymphocytes, T cells), muscle cells (e.g., myotubes), for example, as compared to a naturally occurring IRES, the naturally occurring counterpart, or a CVB3 IRES or comparative IRES 1.

[0238] Further exemplary naturally occurring IRES sequences are provided in Table 2. In some embodiments, the precursor RNA polynucleotide, circular RNA constructs and related pharmaceutical compositions disclosed herein comprise a synthetic IRES sequence comprising at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an IRES sequence in Table 2, or a fragment thereof. In some embodiments, the precursor RNA polynucleotide, circular RNA constructs and related pharmaceutical compositions disclosed herein comprise a synthetic IRES sequence comprising at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence in Table 2. Table 2: IRES Sequences162Attorney Docket No. 01318-0014-00PCT OR-043WO163Attorney Docket No. 01318-0014-00PCT OR-043WO164Attorney Docket No. 01318-0014-00PCT OR-043WO165Attorney Docket No. 01318-0014-00PCT OR-043WO166Attorney Docket No. 01318-0014-00PCT OR-043WO167Attorney Docket No. 01318-0014-00PCT OR-043WO

[0239] In some embodiments, the IRES comprises comparative IRES 1, wherein the comparative IRES 1 consists of a sequence of: TTTGCTCAGCGTAACTTCTCCGGGTTACGTGGAGACCAAAAGGCTACGGAGACTC GGGCTACGGCCCTGGAGCACCTAGGTGCTCCTAAAGACGTTAGAAGTTGTACAA ACTCGCCCAATAGGGCCCCCCAACCAGGGGGGTAGCGGGCAAGCACTTCTGTTT CCCCGGTATGATCTCATAGGCTGTACCCACGGCTGAAAGAGAGATTATCGTTACC CGCCTCACTACTTCGAGAAGCCCAGTAATGGTTCATGAAGTTGATCTCGTTGACC CGGTGTTTCCCCCACACCAGAAACCTGTGATGGGGGTGGTCATCCCGGTCATGGC GACATGACGGACCTCCCCGCGCCGGCACAGGGCCTCTTCGGAGGACGAGTGACA TGGATTCAACCGTGAAGAGCCTATTGAGCTAGTGTTGATTCCTCCGCCCCCGTGA ATGCGGCTAATCCCAACTCCGGAGCAGGCGGGCCCAAACCAGGGTCTGGCCTGT CGTAACGCGAAAGTCTGGAGCGGAACCGACTACTTTCGGGAAGGCGTGTTTCCTT TTATTTTTATCATGGCTTTTTATGGTGACAACTCCTGGTAGACGTTTTATTGCGTTT ATTGAGAGATTTCCAACAATTGAACAGACTAGAACCACTTGTTTTATCAAACCCT CACAGAATAAGATAACA. (SEQ ID NO: 25228)

[0240] As set forth in detail above, synthetic IRESs can be engineered to include at least one addition, deletion, or substitution in a nucleotide, domain, or motif, as compared to a naturally occurring IRES, to increase or reduce IRES activities. Nonlimiting examples of changes that can be engineered include, for example, truncating the 5’ and / or 3’ ends of an IRES, adding a spacer 5’ to an IRES, modifying the 6 nucleotides 5’ to the translation initiation site (Kozak sequence), changing alternative translation initiation sites, and creating chimeric / hybrid IRES sequences. In some embodiments, the synthetic IRES sequence in the 168Attorney Docket No. 01318-0014-00PCT OR-043WO polynucleotide disclosed herein comprises one or more of these changes relative to a natural or native IRES. Additional additions, deletions, or substitutions as compared to naturally occurring IRESs are described above.

[0241] In some embodiments, the IRES is a synthetic IRES sequence comprising at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence selected from the sequences in Table 2 or a fragment thereof or a sequence selected from SEQ ID NOS: 1-2989 and 3282-3303 or a fragment thereof. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the sequences in Table 2 or a sequence selected from SEQ ID NOS: 1-2989 and 3282-3303, or a fragment thereof. See also, e.g., PCT Application No. US2022 / 33091 (WO202261490), which is incorporated herein by reference in its entirety.

[0242] In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence of any one of SEQ ID NOS: 14067-24829 (GIRES-1 through GIRES-10762) or a fragment thereof. In some embodiments, the synthetic IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence set forth in any one of SEQ ID NOS: 14067-24829 (GIRES-1 through GIRES-10762), or a fragment thereof, optionally barcoded with a barcode sequence selected from SEQ ID NOs: 3304-14066 (e.g., the IRES of SEQ ID NO: 14067 is barcoded with the barcode sequence of SEQ ID NO: 3304, the IRES of SEQ ID NO: 14068 is barcoded with the barcode sequence of SEQ ID NO: 3305, the IRES of SEQ ID NO: 14069 is barcoded with the barcode sequence of SEQ ID NO: 3306, and sequentially thereon). In some embodiments, the unmodified or naturally occurring TIE or IRES comprises a consensus sequence as set forth in the Table of Exemplary Consensus Sequences herein (SEQ ID NOs: 24867-24892), wherein N is any nucleotide (e.g., pursuant to IUPAC). In some embodiments, the naturally occurring TIE comprises at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, or at least 700 nucleotides (e.g., contiguous nucleotides) of said consensus sequence. 169Attorney Docket No. 01318-0014-00PCT OR-043WO

[0243] Disclosed herein, in certain embodiments, is a circular RNA polynucleotide (oRNA), comprising a core functional element, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE), wherein the TIE comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to a sequence having at least 85% sequence identity to a sequence set forth in any one of SEQ ID NOS: 1-2989, 3282-3303, and 14067-24829, or a fragment thereof. Disclosed herein, in certain embodiments, is a circular RNA polynucleotide (oRNA), comprising a core functional element, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE), wherein the TIE comprises a synthetic IRES comprising at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence having at least 85% sequence identity to a sequence set forth in Table 2, or a fragment thereof.

[0244] Disclosed herein, in certain embodiments, is a circular RNA polynucleotide (oRNA), comprising a core functional element, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE), wherein the TIE comprises a synthetic IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence having at least 85% sequence identity to a sequence set forth in any one of SEQ ID NOs: 793, 876, 1017, 1216, and 3291, wherein the oRNA is capable of expressing a therapeutic protein.

[0245] Disclosed herein, in certain embodiments, is a circular RNA polynucleotide (oRNA), comprising a core functional element, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation initiation element (TIE), wherein the TIE comprises a synthetic IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence having at least 85% sequence identity to a sequence set forth in any one of SEQ ID NOs: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302, wherein the oRNA is capable of expressing a therapeutic protein.

[0246] Disclosed herein, in certain embodiments, is a circular RNA polynucleotide (oRNA), comprising a core functional element, and a pharmaceutically acceptable salt, buffer, diluent, or combination thereof; wherein the core functional element comprises a translation 170Attorney Docket No. 01318-0014-00PCT OR-043WO initiation element (TIE), wherein the TIE a synthetic IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence having at least 85% sequence identity to a sequence set forth in any one of SEQ ID NOs: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301, wherein the oRNA is capable of expressing a therapeutic protein.

[0247] In certain embodiments, the TIE comprises an internal ribosome entry site (IRES). In some embodiments, the IRES is a synthetic IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence of any one of SEQ ID NOS: 14067-24829 or a fragment thereof. In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence of any one of the IRES sequences SEQ ID NOS: 14067-24829 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence of any one of SEQ ID NOS: 14067-24829 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence of any one of SEQ ID NOS: 14067-24829 or a fragment thereof.

[0248] In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES a sequence set forth in any one of SEQ ID NOs: 793, 876, 1017, 1216, and 3291 or a fragment thereof. In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence set forth in any one of SEQ ID NOs: 793, 876, 1017, 1216, and 3291 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES comprising at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES 171Attorney Docket No. 01318-0014-00PCT OR-043WO comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 793, 876, 1017, 1216, and 3291 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence set forth in any one of SEQ ID NOs: 793, 876, 1017, 1216, and 3291 or a fragment thereof. In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence set forth in any one of SEQ ID NOs: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302 or a fragment thereof. In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence set forth in any one of SEQ ID NOs: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence set forth in any one of SEQ ID NOs: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence set forth in any one of SEQ ID NOs: 785, 823, 840, 857, 861, 862, 864, 983, 1023, 1168, 1169, 1171, 1179, 1192, 1284, 1287, 2285, 2742, 2777, 2778, 3283, 3290, 3293, and 3302 or a fragment thereof. In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence set forth in any one of SEQ ID NOs: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 or a fragment thereof. In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, 172Attorney Docket No. 01318-0014-00PCT OR-043WO motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence set forth in any one of SEQ ID NOs: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to set forth in any one of SEQ ID NOs: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence set forth in any one of SEQ ID NOs: 75, 77, 137, 532, 566, 580, 648, 693, 752, 787, 791, 820, 839, 843, 852, 863, 871, 874, 922, 959, 984, 1015, 1026, 1041, 1047, 1059, 1068, 1134, 1177, 1178, 1180, 1189, 1193, 1198, 1263, 1276, 1280, 1282, 2601, 2615, 2616, 2617, 2618, 2627, 2667, 2681, 2746, 2758, 3284, 3285, 3289, 3292, 3294, 3295, 3296, 3297, 3298, 3299, and 3301 or a fragment thereof.

[0249] In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287 or a fragment thereof. In some embodiments, the IRES comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287 or a fragment thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from SEQ ID NOs: 1-2983 and 3282-3287 or a fragment 173Attorney Docket No. 01318-0014-00PCT OR-043WO thereof. In some embodiments, the circular RNA disclosed herein comprises an IRES that comprises at least one addition, deletion, or substitution of a domain, motif, or nucleotide as compared to an IRES comprising a sequence selected from SEQ ID NOs: 1-2983 and 3282- 3287 or a fragment thereof.

[0250] Modifications of IRES sequences are disclosed in further detail elsewhere herein to increase or reduce IRES activities, for example, by truncating the 5’ and / or 3’ ends of the IRES, adding a spacer 5’ to the IRES, modifying the 6 nucleotides 5’ to the translation initiation site (Kozak sequence), modification of alternative translation initiation sites, and creating chimeric / hybrid IRES sequences. In some embodiments, the IRES sequence in the circular RNA disclosed herein comprises one or more of these modifications relative to a naturally occurring IRES (e.g., SEQ ID NOS: 1-2989, 3282-3303, and 14067-24829). In some embodiments, the IRES sequence in the circular RNA disclosed herein comprises one or more of these modifications in a domain or motif relative to a native domain or motif. iv. IRES CONSENSUS SEQUENCES

[0251] In some embodiments, a TIE disclosed herein comprises a naturally occurring and / or synthetic IRES sequence and includes an IRES consensus sequence or synthetic IRES designed from the IRES consensus sequence. In some embodiments, the IRES comprises a consensus sequence as set forth in the Table of Exemplary Consensus Sequences, below, wherein N is any nucleotide (e.g., pursuant to IUPAC) or a synthetic IRES comprising at least one addition, deletion, or substitution of the consensus sequence. In some embodiments, the TIE or IRES comprises at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, or at least 700 nucleotides (e.g., contiguous nucleotides) of said consensus sequence. Table of Exemplary Consensus Sequences174Attorney Docket No. 01318-0014-00PCT OR-043WO175Attorney Docket No. 01318-0014-00PCT OR-043WO176Attorney Docket No. 01318-0014-00PCT OR-043WO177Attorney Docket No. 01318-0014-00PCT OR-043WO178Attorney Docket No. 01318-0014-00PCT OR-043WO179Attorney Docket No. 01318-0014-00PCT OR-043WO180Attorney Docket No. 01318-0014-00PCT OR-043WO181Attorney Docket No. 01318-0014-00PCT OR-043WOb. CODING AND NONCODING ELEMENT

[0252] In some embodiments, the intervening region and / or core functional element comprises one or more coding elements. In some embodiments, the intervening region and / or core functional element comprises a combination of coding and noncoding elements. In some embodiments, the intervening region and / or core functional element comprises noncoding elements, e.g., microRNA binding site, IRES transacting factor region, restriction site, a RNA editing region, structural or sequence element, a granule site, a zip code element, or an RNA trafficking element. In some embodiments, the coding region is a part of the core functional 182Attorney Docket No. 01318-0014-00PCT OR-043WO element or intervening region located between the 5’ end and 3’ end of the linear precursor RNA polynucleotide and resultant circular RNA.

[0253] In some embodiments, the coding element comprises an expression sequence. In some embodiments, the coding element comprises a sequence encoding at least one therapeutic protein. In some embodiments, the coding element encodes two or more polypeptides. In some embodiments, the sequences encoding the two or more polypeptides are separated by a ribosomal skipping element or a nucleotide sequence encoding a protease cleavage site. In certain embodiments, the ribosomal skipping element encodes thosea-asigna virus 2A peptide (T2A), porcine teschovirus-1 2 A peptide (P2A), foot-and-mouth disease virus 2 A peptide (F2A), equine rhinitis A vims 2A peptide (E2A), cytoplasmic polyhedrosis vims 2A peptide (BmCPV 2A), or flacherie vims of B. mori 2A peptide (BmIFV 2A). Coding elements or regions and payloads are described in further detail elsewhere herein.

[0254] In some embodiments, the intervening region comprises at least one translation initiation element (TIE). TIEs are designed to allow translation efficiency of an encoded protein. In some embodiments, core functional elements comprising one or more coding elements will further comprise one or more TIEs. In some embodiments, a translation initiation element (TIE) comprises a synthetic TIE. In some embodiments, a synthetic TIE comprises aptamer complexes, synthetic IRES or other engineered TIEs capable of initiating translation of a linear RNA or circular RNA polynucleotide. In certain embodiments, the TIE provided herein comprise an internal ribosome entry site (IRES). In certain embodiments, the TIE provided herein comprise a viral or eukaryotic internal ribosome entry site (IRES) or a fragment or variant thereof. In certain embodiments, the IRES comprises one or more modified nucleotides compared to the wild-type viral IRES or eukaryotic IRES. See, e.g., PCT Application No. US2022 / 33091, which is incorporated herein by reference in its entirety. In some embodiments, the TIE comprises a synthetic IRES engineered to comprise at least one addition, deletion, or substitution in a nucleotide, domain, or motif, as compared to a naturally occurring IRES. As set forth in detail elsewhere herein, the synthetic IRES maintains or improves IRES expression and / or function and / or stability as compared to an unmodified or naturally occurring IRES or an IRES that otherwise does not comprise certain engineered modifications. In some embodiments, the synthetic IRES maintain IRES function as compared to an unmodified or a naturally occurring IRES.

[0255] In some embodiments, the intervening region comprises one or more noncoding elements. In some embodiments, the noncoding element comprises an untranslated region 183Attorney Docket No. 01318-0014-00PCT OR-043WO (UTR) or fragment thereof. In some embodiments, the noncoding element is a natural 5ʹ UTR. In some embodiments, the noncoding element is a natural 3ʹ UTR. In some embodiments, the noncoding element is a synthetic spacer sequence. In some embodiments, the noncoding element is an aptamer. In some embodiments, the noncoding element is or comprises a translation initiation element (TIE). In some embodiments, the noncoding element comprises a lncRNA, miRNA, or a miRNA sponge.

[0256] In some embodiments, the intervening region comprises a TIE comprising an untranslated region (UTR) or a fragment thereof, an aptamer complex or a fragment thereof, or a combination thereof. In certain embodiments, the TIE contains modified nucleotides or nucleosides.

[0257] In some embodiments, the noncoding element comprises an untranslated region (UTR). In some embodiments, the noncoding element is a natural 5’ UTR. In some embodiments, the noncoding element is a natural 3’ UTR. In some embodiments, the noncoding element is a synthetic spacer sequence. In some embodiments, the noncoding element is an aptamer or synthetic aptamer. In some embodiments, the noncoding element is or comprises a translation initiation element (TIE). c. STOP CODON OR STOP CASSETTE

[0258] In various embodiments, the intervening region and / or core functional element comprises a stop codon or stop cassette. In some embodiments, the sequence is located downstream to a TIE and coding element. In some embodiments, the sequence is located downstream to a coding element and upstream to a TIE. In some embodiments, the intervening region comprises a stop codon. In one embodiment, the intervening region comprises a stop cassette. In some embodiments, the stop cassette comprises at least 2 stop codons. In some embodiments, the stop cassette comprises at least 2 frames of stop codons. In the same embodiment, the frames of the stop codons in a stop cassette each comprise 1, 2 or more stop codons. In some embodiments, the stop cassette comprises a LoxP or a RoxStopRox, or frt- flanked stop cassette. In the same embodiment, the stop cassette comprises a lox-stop-lox stop cassette. C. INTRON ELEMENTS, EXON ELEMENTS & TERMINAL ELEMENTS

[0259] Polynucleotides provided herein (e.g., DNA templates, precursor RNA polynucleotides, or circular RNA polynucleotides) may comprise one or more intron elements, exon elements, and / or terminal elements. In some embodiments, each intron element, exon 184Attorney Docket No. 01318-0014-00PCT OR-043WO element, and terminal element may independently comprise one or more spacers, intron segments, exon segments, duplex regions, affinity sequences, and / or untranslated elements. These sequence elements within the intron elements, exon elements, or terminal elements are arranged to optimize circularization and / or protein expression. a. INTRON AND EXON ELEMENTS

[0260] In various embodiments, an intron element (e.g., 3’ intron element or 5’ intron element) comprises a permuted intron segment. In some embodiments, a 3’ permuted intron segment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to a 3’ proximal fragment of a natural intron (e.g., a group I or group II intron) including the 5’ nucleotide of the 3’ splice site dinucleotide. In some embodiments, a 5’ permuted intron fragment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to a 5’ proximal fragment of a natural intron (e.g., a group I or group II intron) including the 3’ nucleotide of the 5’ splice site dinucleotide. Exemplary splice site dinucleotides are described in the Table herein.

[0261] In some embodiments, an intron element comprises an intron derived from a trans- splicing ribozyme. In some embodiments, the intron element comprises a Group I trans- splicing ribozyme (e.g., a Tetrahymena trans-splicing ribozyme) segment. In some embodiments, the trans-splicing ribozyme segment along with an exon segment that may cleave a target site (e.g., a sequence of interest and / or a coding element) and subsequently ligate cleaved targe site to a 3’ exon to form a circular RNA product.

[0262] In various embodiments, a provided polynucleotide (e.g., a DNA template or a precursor RNA polynucleotide) comprises a 5’ exon element located upstream to the intervening region. In some embodiments, a provided polynucleotide comprises a 3’ intron element located downstream to the intervening region. In various embodiments, a provided polynucleotide comprises a 3’ exon element located upstream to the intervening region. In some embodiments, a provided polynucleotide comprises a 3’ intron element located upstream to the intervening region.

[0263] According to the present disclosure, the 3’ exon element and 5’ exon element each comprise an exon segment. In some embodiments, the 5’ exon element comprises a 3’ exon segment. In some embodiments, the 3’ exon element comprises a 5’ exon segment. In some embodiments, the 3’ and / or 5’ exon segment is a self-spliced or self-splicing exon segment. In some embodiments, the self-spliced and / or self-splicing exon segment comprises in part or in 185Attorney Docket No. 01318-0014-00PCT OR-043WO whole a naturally occurring exon sequence from a virus, bacterium or eukaryotic DNA vector. In other embodiments, the self-spliced and / or self-splicing exon segment comprises in part or in whole a non-naturally occurring sequence.

[0264] In some embodiments, a 3’ exon segment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to the 5’-proximal end of an exon adjacent a 3’ intron segment as described herein, including the 3’ nucleotide of the splice site dinucleotide. In some embodiments, a 5’ exon segment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to the 3’-proximal end of an exon adjacent a 5’ intron segment as described herein, including the 5’ nucleotide of the splice site dinucleotide.

[0265] In some embodiments, at least one of the exon segments is less than 15 nucleotides in length. In some embodiments, the 3ʹ exon segment and / or 5ʹ exon segment comprises a Group I exon segment or a Group II exon segment less than 15 nucleotides in length.

[0266] In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides from the exonic sequences of Table A (in which sequences are shown as 15-nucleotide exonic sequence, intronic sequence, 15-nucleotide exonic sequence), e.g., contiguous nucleotides from the 5’ or 3’ end of the exonic sequences of Table A. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides from the exonic sequences of Table B (in which sequences are shown as 10- nucleotide exonic sequence, intronic sequence, 10-nucleotide exonic sequence), e.g., contiguous nucleotides from the 5’ or 3’ end of the exonic sequences of Table B.

[0267] In some embodiments, the intron segment is a Group I intron and the exon segment comprises a Group I self-splicing exon segment. In some embodiments, the intron segment is a Group II intron and the exon segment comprises a Group II self-splicing exon segment.

[0268] In some embodiments, the exon element comprises a sequence directed to a native Group I intron-adjacent exon segment sequence or Group II intron-adjacent exon segment sequence, or fragment thereof. In some embodiments, the exon element comprises at least one 186Attorney Docket No. 01318-0014-00PCT OR-043WO mutation of a native Group I intron-adjacent exon segment sequence or Group II intron- adjacent exon segment sequence, or fragment thereof. In some embodiments, the exon element comprises at least one deletion of a native Group I intron-adjacent exon segment sequence or Group II intron-adjacent exon segment sequence, or fragment thereof. In some embodiments, the exon element comprises at least one insertion of a native Group I intron-adjacent exon segment sequence or Group II intron-adjacent exon segment sequence, or fragment thereof. In some embodiments, the native Group I intron segment or Group II intron segment sequences are selected from a sequence in Table A or Table B, below. b. TERMINAL ELEMENTS

[0269] In various embodiments, a provided polynucleotide (e.g., a DNA template or a precursor RNA polynucleotide) comprises a terminal element. In some embodiments, the terminal element is located upstream to the intervening region. In some embodiments, the terminal element is non-intronic. In some embodiments, the terminal element lacks one or both nucleotides of a natural splice site dinucleotide associated with a natural Group I or Group II intron sequence. In some embodiments, a portion or the entire terminal element is excised after circularization of a precursor RNA polynucleotide comprising said terminal element.

[0270] In some embodiments, a polynucleotide comprises a terminal element, an intervening region, and a monotron. In some embodiments, the polynucleotide comprises, in the following order, a terminal element, an intervening region, and a monotron. In some embodiments, the polynucleotide comprises, in the following order, a monotron, an intervening region, and a terminal element. In some embodiments, the terminal element comprises a splice site nucleotide capable of engaging in a transesterification reaction with the monotron.

[0271] In some embodiments, the terminal element comprises an excised terminal segment and a retained terminal segment. In the same embodiments, the retained terminal segment is retained after circularization of a precursor RNA polynucleotide comprising such a terminal element. In the same embodiments, the exercised terminal segment is not retained after circularization of a precursor RNA polynucleotide comprising such a terminal element. In still the same embodiments, the nucleotide sequence of the terminal element is non-natural or synthetic.

[0272] In some embodiments, the terminal element comprises a natural exon or a fragment thereof. In some embodiments, the terminal element is retained after circularization of a precursor RNA polynucleotide comprising said terminal element.

[0273] In some embodiments, the terminal element is capable of binding to a 3’ intron 187Attorney Docket No. 01318-0014-00PCT OR-043WO element (e.g., the 3’ intron element comprised in the same polynucleotide). In some embodiments, the terminal element is capable of directing or functionalizing the splicing activity of a 3’ intron element (e.g., the 3’ intron element comprised in the same polynucleotide). c. EXEMPLARY INTRON ELEMENTS, EXON ELEMENTS & TERMINAL ELEMENTS

[0274] For means of example and not intended to be limiting, in some embodiments, a 5’ intron element comprises, in the following 5’ to 3’ order: a 5’ leading sequence, an optional 5’ external duplex, a 5’ affinity tag, a 5’ external spacer, and a 3’ permuted intron segment. In the same embodiments, the 5’ exon element comprises, in the following 5’ to 3’ order: a 3’ exon segment, an optional 5’ internal duplex, and a 5’ internal spacer. In the same embodiments, the 3’ exon element comprises, in the following 5’ to 3’ order: a 3’ internal spacer, an optional 3’ internal duplex, and a 5’ exon segment. In still the same embodiments, the 3’ intron element comprises, in the following 5’ to 3’ order: a 5’ permuted intron segment, a 3’ external spacer, an optional 3’ external duplex, a 3’ affinity tag, and a 3’ lagging sequence.

[0275] As another exemplary embodiment, a terminal element comprises, in the following 5’ to 3’ order: a 5’ leading sequence, a 5’ external spacer, an excised terminal segment, a retained terminal segment, an optional 5’ internal duplex, and a 5’ internal spacer. In the same embodiments, the 3’ exon element comprises, in the following 5’ to 3’ order: a 3’ internal spacer, an optional 3’ internal duplex, and a 5’ exon segment. In still the same embodiments, the 3’ intron element comprises, in the following 5’ to 3’ order: a 5’ permuted intron segment, a 3’ external spacer, an optional 3’ external duplex, and a 3’ lagging sequence.

[0276] In some embodiments, the terminal element sequence has a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to an exon fragment of a sequence selected from Tables A or B.

[0277] For means of example and not intended to be limiting, in some embodiments, a 3’ intron element comprises in the following 5’ to 3’ order: a leading untranslated sequence, a 5’ affinity tag, an optional 5’ external duplex region, a 5’ external spacer, and a 3’ intron fragment. In the same embodiments, the 3’ exon element comprises in the following 5’ to 3’ order: a 3’ exon fragment, an optional 5’ internal duplex region, an optional 5’ internal duplex region, and a 5’ internal spacer. In the same embodiments, the 5’ exon element comprises in the following 5’ to 3’ order: a 3’ internal spacer, an optional 3’ internal duplex region, and a 5’ exon fragment. In still the same embodiments, the 3’ intron element comprises in the following 5’ to 3’ order: a 5’ intron fragment, a 3’ external spacer, an optional 3’ external duplex region, a 3’ affinity 188Attorney Docket No. 01318-0014-00PCT OR-043WO tag, and a trailing untranslated sequence. In some embodiments, the affinity tag is a polyA affinity tag.

[0278] In some embodiments, the 5ʹ intron element is located 5ʹ to the 5ʹ exon element. In some embodiments, the 5ʹ intron element is adjacent to the 5ʹ exon element. In some embodiments, the 3ʹ intron element is located 3ʹ to the 3ʹ exon element. In some embodiments, the 3ʹ intron element is adjacent to the 3ʹ exon element.

[0279] In some embodiments, the 5ʹ exon element comprises a 5ʹ internal duplex sequence located 3ʹ to the 3ʹ exon segment. In some embodiments, the 3ʹ exon element comprises a 3ʹ internal duplex sequence located 5ʹ to the 5ʹ exon segment. In some embodiments, the 5ʹ intron element comprises a 5ʹ external duplex sequence located 5ʹ to the 3ʹ permuted intron segment. In some embodiments, the 3ʹ intron element comprises a 3ʹ external duplex sequence located 3ʹ to the 5ʹ permuted intron segment. In some embodiments, the 5ʹ intron element is adjacent to the 5ʹ exon element. In some embodiments, the 3ʹ intron element is located 3ʹ to the 3ʹ exon element. In some embodiments, the 3ʹ intron element is adjacent to the 3ʹ exon element.

[0280] In some embodiments, the 5ʹ intron comprises a 5ʹ affinity tag, a 5ʹ external spacer, and the 3ʹ permuted intron segment. In some embodiments, the 5ʹ exon comprises the 3ʹ exon segment, a 5ʹ internal duplex sequence, and a 5ʹ internal spacer. In some embodiments, the 5ʹ affinity tag is adjacent to the 5ʹ external spacer. In some embodiments, the 5ʹ affinity tag is located 5ʹ to the 5ʹ external spacer. In some embodiments, the 5ʹ internal duplex sequence is adjacent to the 5ʹ internal spacer. In some embodiments, the 5ʹ internal duplex sequence is located 5ʹ to the 5ʹ internal spacer. In some embodiments, the 3ʹ exon comprises a 3ʹ internal spacer, 3ʹ internal duplex sequence, and the 5ʹ exon segment. In some embodiments, the 3ʹ intron comprises the 5ʹ permuted intron segment, a 3ʹ external spacer, and a 3ʹ affinity tag. In some embodiments, the 3ʹ affinity tag is adjacent to the 3ʹ external spacer. In some embodiments, the 3ʹ affinity tag is located 3ʹ to the 3ʹ external spacer. In some embodiments, the 3ʹ internal duplex sequence is adjacent to the 3ʹ internal spacer. In some embodiments, the 3ʹ internal duplex sequence is located 3ʹ to the 3ʹ internal spacer. In some embodiments, the affinity tag is a polyA affinity tag.

[0281] In some embodiments, the 5ʹ exon comprises a 5ʹ internal duplex sequence located between the 3ʹ exon segment and the intervening region. In some embodiments, the 3ʹ exon comprises a 3ʹ internal duplex sequence positioned between the intervening region and the 5ʹ exon segment. In some embodiments, the polynucleotide comprises a 5ʹ internal duplex sequence and a 3ʹ internal duplex sequence. 189Attorney Docket No. 01318-0014-00PCT OR-043WO

[0282] In some embodiments, the 3ʹ and 5ʹ permuted intron segments each independently comprise a Group I intron segment, a Group II intron segment, a synthetic intron segment, or a variant thereof. In some embodiments, the 3ʹ permuted intron segment comprises a 3ʹ Group I intron segment or a variant thereof. In some embodiments, the 5ʹ permuted intron segment comprises a 5ʹ Group I intron segment or a variant thereof. In some embodiments, the 3ʹ permuted intron segment comprises a 3ʹ Group II intron segment or a variant thereof. In some embodiments, the 5ʹ permuted intron segment comprises a 5ʹ Group II intron segment or a variant thereof.

[0283] In some embodiments, the 3ʹ permuted intron segment or element, 5ʹ permuted intron segment or element, or both the 3ʹ and 5ʹ permuted intron segments or elements are at least 100, at least 90, at least 80, at least 70, at least 60, and / or at least 50 nucleotides in length. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements are at least 50 nucleotides in length. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements have a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more to a naturally occurring intron.

[0284] In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise a native Group I intron segment or Group II intron segment sequence. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise one or more nucleotide substitutions of a native Group I intron segment or Group II intron segment sequence. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise one or more nucleotide insertions of a native Group I intron segment or Group II intron segment sequence. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise one or more nucleotide deletions of a native Group I intron segment or Group II intron segment sequence. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise a nucleotide substitution of one or both the dinucleotide of a native Group I or Group II intron splice site dinucleotide. In some embodiments, the 3ʹ Group I or Group II intron segment or the 5ʹ Group I or Group II intron segment comprises one, two, three, four, five, six, seven, eight, nine, ten, or more mutations of a native Group I intron or Group II intron sequence. In some embodiments, the mutations are selected from insertion, deletion, mutation, addition, and 190Attorney Docket No. 01318-0014-00PCT OR-043WO subtraction. In some embodiments, the mutations are deletions of two or more nucleotides of the 3ʹ Group I or Group II intron segment or the 5ʹ Group I or Group II intron segment, or combinations thereof. In some embodiments, the mutations are two or more deletions of the 5ʹ Group I intron segment at the 3ʹ end or two or more deletions of the 3ʹ Group I intron segment at the 5ʹ end.

[0285] In some embodiments, the native Group I intron segment or Group II intron segment sequences are selected from a sequence in Table A or Table B, below. In some embodiments, the 3ʹ and / or 5ʹ permuted intron element comprise a polynucleotide sequence having a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more to a naturally occurring intron selected from a sequence set forth in Table A or Table B, below, or a fragment or segment thereof. In some embodiments, the 3ʹ and / or 5ʹ permuted intron element comprise a polynucleotide sequence selected from a sequence set forth in Table A or Table B. In some embodiments, the 3ʹ and / or 5ʹ permuted intron element comprise a polynucleotide sequence selected from a sequence set forth in Table A or Table B.

[0286] In some embodiments, the 3ʹ permuted intron segment comprises a 3ʹ Group I or Group II intron segment derived from a gene selected from a genus and / or species selected from column 2 of Tables A or B; and / or the 5ʹ permuted intron segment comprises a 5ʹ Group I or Group II intron segment derived from a gene selected from a genus and / or species selected from column 2 of Tables A or B.

[0287] In some embodiments, the 3ʹ Group I or Group II intron segment or the 5ʹ Group I or Group II intron segment are derived from a gene selected from a species selected from: Cyanobacterium Anabaena sp., T4 phage, Hypocrea pallida, Bulbithecium hyalosporum, Myoarachis inversa, Geosmithia argillacea, Coxiella burnetii, Agrobacterium tumefaciens, Azoarcus, Nostoc, Cordyceps capitata, Prochlorothrix hollandica, Tilletiopsis orzyzicola, Tetrahymena thermophila, and Staphylococcus phage Twort. Table A: Group I introns (flanked by 15nt exons)191Attorney Docket No. 01318-0014-00PCT OR-043WO192Attorney Docket No. 01318-0014-00PCT OR-043WO193Attorney Docket No. 01318-0014-00PCT OR-043WO194Attorney Docket No. 01318-0014-00PCT OR-043WO195Attorney Docket No. 01318-0014-00PCT OR-043WO196Attorney Docket No. 01318-0014-00PCT OR-043WO197Attorney Docket No. 01318-0014-00PCT OR-043WO198Attorney Docket No. 01318-0014-00PCT OR-043WO199Attorney Docket No. 01318-0014-00PCT OR-043WO200Attorney Docket No. 01318-0014-00PCT OR-043WO201Attorney Docket No. 01318-0014-00PCT OR-043WO202Attorney Docket No. 01318-0014-00PCT OR-043WO203Attorney Docket No. 01318-0014-00PCT OR-043WO204Attorney Docket No. 01318-0014-00PCT OR-043WOTable B: Group II introns (flanked by 10nt exons)205Attorney Docket No. 01318-0014-00PCT OR-043WO206Attorney Docket No. 01318-0014-00PCT OR-043WO207Attorney Docket No. 01318-0014-00PCT OR-043WO208Attorney Docket No. 01318-0014-00PCT OR-043WO209Attorney Docket No. 01318-0014-00PCT OR-043WO210Attorney Docket No. 01318-0014-00PCT OR-043WO211Attorney Docket No. 01318-0014-00PCT OR-043WO212Attorney Docket No. 01318-0014-00PCT OR-043WO213Attorney Docket No. 01318-0014-00PCT OR-043WO214Attorney Docket No. 01318-0014-00PCT OR-043WO215Attorney Docket No. 01318-0014-00PCT OR-043WO216Attorney Docket No. 01318-0014-00PCT OR-043WO217Attorney Docket No. 01318-0014-00PCT OR-043WO218Attorney Docket No. 01318-0014-00PCT OR-043WO219Attorney Docket No. 01318-0014-00PCT OR-043WO220Attorney Docket No. 01318-0014-00PCT OR-043WO221Attorney Docket No. 01318-0014-00PCT OR-043WO222Attorney Docket No. 01318-0014-00PCT OR-043WO223Attorney Docket No. 01318-0014-00PCT OR-043WO224Attorney Docket No. 01318-0014-00PCT OR-043WO225Attorney Docket No. 01318-0014-00PCT OR-043WO226Attorney Docket No. 01318-0014-00PCT OR-043WO227Attorney Docket No. 01318-0014-00PCT OR-043WO228Attorney Docket No. 01318-0014-00PCT OR-043WO

[0288] In some embodiments, the 3ʹ or 5’ intron segments and / or 3’ or 5’ exon segments are derived from a gene selected from a species selected from: Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort. In some embodiments, the 3’ or 5’ intron segment and / or 3’ or 5’ exon segment are developed from permuting at a position along a Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort intron and / or exon sequence. In some embodiments, the 5’ or 3 monotron element are derived from a gene selected from a species selected from: Cyanobacterium Anabaena sp., T4 phage, 229Attorney Docket No. 01318-0014-00PCT OR-043WO Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort. In some embodiments, the 3’ or 5’ intron segment and / or 3’ or 5’ exon segment are developed from permuting at a position along a Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort intron and / or exon sequence.

[0289] In some embodiments, the intron segments and / or exon segments of a provided polynucleotide are derived from a gene from the same species (e.g., a polynucleotide comprises Azoarcus 3’ and 5’ exon segments and Azoarcus 3’ and 5’ intron segments). In other embodiments, the 3’ or 5’ intron segments or 3’ or 5’ exon segments of a provided polynucleotide are derived from genes of different species (e.g., a polynucleotide comprises an Anabaena intron segment and Staphylococcus phage Twort exon segment). In certain embodiments, the monotron element of a provided polynucleotide is derived from a gene of a different species than the 3’ or 5’ intron segments and / or 3’ or 5’ exon segments (e.g., a polynucleotide comprises a Staphylococcus phage Twort montron element and an Anabaena intron segment). In some embodiments, use of genes of one species of an intron segment and / or exon segment may allow for more efficient or effective circularization or self-splicing of one or more polynucleotides as compared to another gene of a different species. In certain embodiments, the gene used of one species develop an intron segment may more efficiently promote the interaction between an intron segment and a nucleophile (e.g., form a more efficient or effective binding pocket that promotes the transesterification reaction of a splice site nucleotide) as compared to an intron segment developed from a gene of a different species. In some embodiments, the gene of one species from which an intron segment is derived may be more efficient in forming a binding pocket for a nucleophile as compared to a different gene of the same species. In some embodiments, the species of gene from which the intron segment is derived may be more efficient in forming a binding pocket for a nucleophile as compared to a species of genes comprising the same and / or homologous sequence from a different species.

[0290] As described herein, in some embodiments, a provided polynucleotide comprises an intron segment and / or exon segment derived from permuting at a position along a Group I or Group II gene selected from Table A or Table B. Location or position of the permutation sites may enhance the ability of an intron segment to effectively splice and / or circularize in a provided polynucleotide. In some embodiments, the Group I or Group II genes are permuted at a position that enhances splicing or circularization activity of an intron segment of a provided polynucleotide as compared to a different permutation site. In certain embodiments, the Group 230Attorney Docket No. 01318-0014-00PCT OR-043WO I or II genes are permuted at a position in an intron segment of a provided polynucleotide that enhances the provided polynucleotide’s ability to self-circularize as compared to a different permutation site. In some embodiments, the Group I or II genes are permuted at a position that enhances or promotes the splicing activity of an intron segment to another intron segment, monotron element and / or exon segment. In some embodiments, the Group I or II genes are permuted at a position that allows the intron segment to more efficiently splice or self-splice than an intron segment permuted at a different position. In certain embodiments, a position of a permutation site may promote the interaction between an intron segment and a nucleophile (e.g., form a more efficient or effective binding pocket that promotes the transesterification reaction of a splice site nucleotide).

[0291] As described herein, permutation sites positions are described to mean that the permutation of the natural or synthetic intron occurs at the junction between the listed amino acid and the adjacent downstream amino acid (e.g., an Anabaena position 189 permutation site corresponds herein to a permutation site between amino acids 189 and 190).

[0292] In some embodiments, a provided polynucleotide comprises an intron segment derived from permuting at a position along a gene selected from a species selected from: Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting a Cyanobacterium Anabaena sp. gene. In these embodiments, the permutation site of the Cyanobacterium Anabaena sp. gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 231Attorney Docket No. 01318-0014-00PCT OR-043WO 260, 261, 262, 263, 264, or 265 of the Cyanobacterium Anabaena sp. gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting an Azoarcus gene. In these embodiments, the permutation site of the Azoarcus gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, or 221 of the Azoarcus gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting an Coxiella burnetii gene. In these embodiments, the permutation site of the Coxiella burnetii gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 232Attorney Docket No. 01318-0014-00PCT OR-043WO 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, or 390 of the Coxiella burnetii gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting a Tetrahymena thermophila gene. In these embodiments, the permutation site of the Tetrahymena thermophila gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, or 436 of a Tetrahymena thermophila gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting an T4 phage (td) gene. In these embodiments, the permutation site of the T4 phage (td) gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 233Attorney Docket No. 01318-0014-00PCT OR-043WO 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, or 289 of the T4 phage (td) gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting a Staphylococcus phage Twort gene. In these embodiments, the permutation site of the Staphylococcus phage Twort gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, or 281 of the Staphylococcus phage Twort gene.

[0293] Also provided herein are methods of identifying an exon and / or intron element or identifying a combined accessory element comprising a mutated Group I or Group II exon and / or intron segment (as described herein) that allows production of a circular RNA that is 234Attorney Docket No. 01318-0014-00PCT OR-043WO translatable or biologically active inside a eukaryotic cell. In some embodiments, such a method comprises: (i) inserting 5ʹ and 3ʹ Group I or Group II intronic sequences derived from a database of native intronic sequence into a precursor RNA polynucleotide; (ii) transcribing the polynucleotide into RNA in vitro or allowing the polynucleotide to be transcribed into RNA by a cell; and (iii) determining the circularization efficiency of the RNA produced by the polynucleotide by identifying the amount of circularized RNA, the amount of excised intronic sequences, the amount of precursor RNA remaining after circularization, and combinations thereof.

[0294] In some embodiments, the mutated Group I or Group II exon and / or intron element or segment comprises a deletion, insertion or substitution of at least one nucleotide, including but not limited to a nucleotide substitution of one or both the dinucleotides of the 5ʹ and / or 3ʹ Group I splice site dinucleotides. In some embodiments, the 5ʹ or 3ʹ Group I or Group II intronic sequences, or combinations thereof are sequenced. In some embodiments, the method further comprises comparing the circularization efficiency of the polynucleotide with a polynucleotide comprising a native intronic sequence, or a parent polynucleotide.

[0295] Also provided herein are methods of identifying or determining a polynucleotide sequence that improves RNA circularization efficiency compared to a polynucleotide comprising a native intronic sequence or to a parent polynucleotide with a known sequence, the method comprising modifying a DNA sequence encoding the precursor RNA polynucleotide described herein comprising: (i) modifying at least one nucleotide and / or altering the length of the 5ʹ intron element and / or 3ʹ intron element of the DNA sequence encoding the precursor RNA polynucleotide described herein; (ii) altering the length of the 5ʹ and / or 3ʹ internal and / or external spacer sequence of the DNA sequence encoding precursor RNA polynucleotide; (iii) altering the length of the 5ʹ and / or 3ʹ internal duplex sequence of the DNA sequence encoding the precursor RNA polynucleotide; (iv) altering the length of the 5ʹ and / or 3ʹ exon sequence of the DNA sequence encoding the precursor RNA polynucleotide; or (v) combinations thereof; and 235Attorney Docket No. 01318-0014-00PCT OR-043WO transcribing the polynucleotide comprising the DNA sequence into RNA in vitro or allowing the polynucleotide comprising the DNA sequence to be transcribed into RNA by a cell; and determining the circularization efficiency of the RNA produced by the polynucleotide comprising the DNA sequence by identifying the amount of circularized RNA, the amount of excised intronic sequences, the amount of precursor RNA remaining after circularization, and combinations thereof. In some embodiments, the method further comprises comparing the circularization efficiency of the polynucleotide with a polynucleotide comprising a native intronic sequence, or a parent polynucleotide. d. SPACER

[0296] In various embodiments, a provided polynucleotide (e.g., a DNA template, a precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises one or more spacers.

[0297] In certain embodiments, the DNA template, precursor linear RNA polynucleotide and circular RNA provided herein comprise a 5’ and / or a 3’ spacer. In some embodiments, the polynucleotide comprises one or more spacers in the intron elements. In some embodiments, the polynucleotide comprises one or more spacers in the exon elements. In some embodiments, the polynucleotide comprises a spacer in the 3’ intron fragment (also referred to as “5’ external spacer”). In some embodiments, the polynucleotide comprises a spacer in the 5’ intron fragment (also referred to as “3’ external spacer”). In some embodiments, the polynucleotide comprises a spacer in the 3’ exon fragment (also referred to as “5’ internal spacer”). In some embodiments, the polynucleotide comprises a spacer in the 5’ exon fragment (also referred to as “3’ internal spacer”).

[0298] In certain embodiments, the polynucleotide comprises a spacer in the 3’ intron fragment and / or a spacer in the 5’ intron fragment. In some embodiments, the 5ʹ external spacer is located 5ʹ to the 3ʹ permuted intron segment. In some embodiments, the 5ʹ internal spacer is located 3ʹ to the 3ʹ exon segment. In some embodiments, the 3ʹ external spacer is located 3ʹ to the 5ʹ permuted intron segment. In some embodiments, the 3ʹ external spacer is located 5ʹ to the 5ʹ exon segment.

[0299] In certain embodiments, the polynucleotide comprises a 5ʹ external spacer located between a leading untranslated sequence and the 5ʹ or 3ʹ intron element. In certain embodiments, the polynucleotide comprises a 3ʹ external spacer located between the 3ʹ or 5ʹ intron element and a lagging untranslated sequence.

[0300] In certain embodiments where the polynucleotide comprises a monotron, the 236Attorney Docket No. 01318-0014-00PCT OR-043WO polynucleotide can comprise an internal spacer sequence positioned between the terminal element and the intervening region, and / or between the intervening region and the monotron element. In certain embodiments, the polynucleotide can comprise an external spacer positioned adjacent to the terminal element and / or an external spacer positioned adjacent to the monotron element.

[0301] In certain embodiments, the spacers aid with circularization or protein expression due to symmetry created in the overall sequence of the precursor RNA polynucleotide. In certain embodiments, including a 5’ internal spacer and / or including a spacer between the 3’ group I intron fragment and the intervening region may conserve secondary structures in those regions by preventing them from interacting, thus increasing splicing efficiency. In certain embodiments, there is a spacer, for example, between the 3’ permuted intron segment and the intervening region, wherein the spacer may prevent structured regions of an IRES or aptamer of a TIE comprised in the intervening region from interfering with the folding of the 3’ permuted intron segment or reduces the extent to which this occurs.

[0302] In some embodiments, the polynucleotide further comprises an aptamer. In some embodiments, the aptamer is synthetic.

[0303] In some embodiments, the first spacer (e.g., between the 3’ group I or II intron fragment and intervening region) and second spacer (e.g., between the two expression sequences and intervening region) comprise additional base pairing regions that are predicted to base pair with each other and not to the first and second duplex regions. In other embodiments, the first spacer (e.g., between 3’ group I or II intron fragment and intervening region) and second spacer (e.g., between the one of the intervening region and 5’ group I or II intron fragment) comprise additional base pairing regions that are predicted to base pair with each other and not to the first and second duplex regions.

[0304] In certain embodiments, the polynucleotide comprises a first (5’) and a second (3’) spacer. In some embodiments, the polynucleotide comprises a 5’ external spacer and a 3’ external spacer, wherein the spacers comprise additional base pairing regions that are predicted to base pair with each other and not to the first and second duplex regions. In other embodiments, the polynucleotide comprises a 5’ internal spacer and a 3’ internal spacer, wherein the spacers comprise additional base pairing regions that are predicted to base pair with each other and not to the first and second duplex regions. In some embodiments, such spacer base pairing brings the permuted intron segments in close proximity to each other, which may increase splicing efficiency. Additionally, in some embodiments, the combination of base 237Attorney Docket No. 01318-0014-00PCT OR-043WO pairing between the first and second duplex regions, and separately, base pairing between the first and second spacers, promotes the formation of a splicing bubble containing the permuted intron segments flanked by adjacent regions of base pairing.

[0305] Typical spacers are contiguous sequences with one or more of the following qualities: (1) predicted to avoid interfering (e.g., forming duplex) with proximal structures, for example, the IRES, expression sequence, aptamer, or intron; (2) is at least 5 nt long and no longer than 100 nt; (3) is located adjacent to the permuted intron segment; and (4) contains one or more of the following: (a) an unstructured region at least 5 nt long, (b) a region of base pairing at least 5 nt long to a distal sequence, such as another spacer, and (c) a structured region at least 5 nt long limited in scope to the sequence of the spacer. In various embodiments, a spacer is not predicted to form a duplex of more than 8 nucleotides in length with any sequences within 250 nucleotides in either direction. In some embodiments, the spacer is not predicted to form a duplex of more than 8 nucleotides in length with any sequences within 1000 nucleotides in either direction. In some embodiments, the spacer comprises an unstructured, structured or randomly generated polynucleotide sequence. Spacers may have several regions, including an unstructured region, a base pairing region, a hairpin / structured region, and combinations thereof. In an embodiment, the spacer has a structured region with high GC content. In an embodiment, a region within a spacer base pairs with another region within the same spacer. In an embodiment, a region within a spacer base pairs with a region within another spacer. In an embodiment, a spacer comprises one or more hairpin structures. In an embodiment, a spacer comprises one or more hairpin structures with a stem of 4 to 12 nucleotides and a loop of 2 to 10 nucleotides.

[0306] In some embodiments, a spacer sequence is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, a spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, a spacer sequence is between 5 and 50, 10 and 50, 20 and 50, 20 and 40, and / or 25 and 35 nucleotides in length. In certain embodiments, a spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In some embodiments, the spacer sequence is at least 5 nucleotides in length, and / or about 5 to about 60 nucleotides in length.

[0307] In some embodiments, a spacer sequence is a polyA sequence. In some embodiments, a spacer sequence is a polyAC sequence. In some embodiments, a spacer 238Attorney Docket No. 01318-0014-00PCT OR-043WO comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polyAC content. In some embodiments, a spacer comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polypyrimidine (C / T or C / U) content. e. DUPLEX

[0308] In various embodiments, a provided polynucleotide (e.g., a DNA template, a precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises one or more duplexes.

[0309] In some embodiments, the polynucleotide comprises a 5’ external duplex located within the 3’ intron fragment. In some embodiments, the polynucleotide comprises a 3’ external duplex located within the 5’ intron fragment. In some embodiments, the polynucleotide comprises a 5ʹ internal duplex sequence and a 3ʹ internal duplex sequence. In some embodiments, the polynucleotide comprises a 5’ internal duplex located within the 3’ exon fragment. In some embodiments, the 5ʹ internal duplex sequence is positioned between the 5ʹ exon element and the intervening region. In some embodiments, the polynucleotide comprises a 3’ internal duplex located within the 5’ exon fragment. In some embodiments, the 3ʹ internal duplex sequence is positioned between the intervening region and the 3ʹ exon element. In certain embodiments, the polynucleotide comprises a 5’ external duplex located within the 3’ intron fragment and a 3’ external duplex located within the 5’ intron fragment. In some embodiments, the polynucleotide comprises a 5’ internal duplex located within the 3’ exon fragment and a 3’ internal duplex located within the 5’ exon fragment. In some embodiments, the polynucleotide comprises a 5’ external duplex, 5’ internal duplex, a 3’ internal duplex region, and a 3’ external duplex.

[0310] In some embodiments, the polynucleotide comprises a monotron element, intervening region, and terminal element, and a 5ʹ internal duplex sequence and a 3ʹ internal duplex sequence. In some embodiments, if the terminal element is upstream of the monotron element, the 5ʹ internal duplex sequence is positioned between the terminal element and the intervening region, and the 3ʹ internal duplex sequence is positioned between the intervening region and the monotron element. In some embodiments, if the monotron element is upstream of the terminal element, the 5ʹ internal duplex sequence is positioned between monotron and the intervening region, and the 3ʹ internal duplex sequence is positioned between the intervening region and the terminal element. In some embodiments, the 5’ or 3’ internal duplex is positioned adjacent to a 5’ or 3’ internal spacer. 239Attorney Docket No. 01318-0014-00PCT OR-043WO

[0311] In some embodiments, the polynucleotide comprises a first (5’) duplex and a second (3’) duplex (e.g., a 5’ external duplex region and a 3’ external duplex region). In certain embodiments, the first and second duplex regions may form perfect or imperfect duplexes. Thus, in certain embodiments, at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the first duplex and second duplex may be base paired with one another. In some embodiments, the duplexes regions are predicted to have less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, less than 25%) base pairing with unintended sequences in the RNA (e.g., non-duplex sequences). In some embodiments, the 5ʹ internal duplex sequence and 3ʹ internal duplex sequence are at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary. In some embodiments, including such first duplex and second duplex on the 5’ and 3’ ends of the precursor RNA strand, respectively, and adjacent or very close to the permuted intron segment, bring the permuted intron segments in close proximity to each other, increasing splicing efficiency.

[0312] In some embodiments, a duplex, whether, e.g., a 5’ internal duplex sequence or 3’ internal duplex sequence, is 3-100 nt in length (e.g., 3-75 nt in length, 3-50 nt in length, 20-50 nt in length, 35-50 nt in length, 5-25 nt in length, 5-20 nt in length, 9-19 nt in length). In some embodiments, a duplex has a length of about 9 to about 50 nt. In one embodiment, a duplex has a length of about 9 to about 19 nt. In one embodiment, a duplex has a length of about 5 to about 20 nt nucleotides in length, inclusive. In one embodiment, the 5ʹ internal duplex sequence and 3ʹ internal duplex sequence are each independently about 9 to about 50 nt, about 9 to about 19 nt, or about 5 to about 20 nt nucleotides in length, inclusive. In one embodiment, a duplex has a length of about 20 to about 40 nt. In some embodiments, a duplex is about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nt in length. In certain embodiments, a duplex has a length of about 30 nt. In certain embodiments, the 5' and 3' internal duplex sequences are predicted to form a contiguous duplex. In some embodiments, the contiguous duplex has a length of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nt in length. In some embodiments, the contiguous duplex has a length of no longer than 35 nucleotides. In some embodiments, at least one of the exon segments is less than 15 nucleotides in length.

[0313] In some embodiments, the 5ʹ internal duplex sequence and / or 3ʹ internal duplex 240Attorney Docket No. 01318-0014-00PCT OR-043WO sequence each have a GC content of at least 10%.

[0314] In other embodiments, the polynucleotide does not comprise of any duplex to optimize translation or circularization. f. AFFINITY SEQUENCES

[0315] In various embodiments, a provided polynucleotide (e.g., a DNA template, a precursor linear RNA polynucleotide, or a circular RNA polynucleotide) may comprise an affinity sequence (or affinity tag) In some embodiments, a precursor RNA polynucleotide comprises at least one affinity tag. In some embodiments, the affinity tag is located in the 3’ intron element. In some embodiments, the affinity tag is located in the 5’ intron element. In some embodiments, both (3’ and 5’) intron elements each comprise an affinity tag. In some embodiments, the 5ʹ affinity tag is located 5ʹ to the 3ʹ permuted intron segment. In some embodiments, the 3ʹ affinity tag is located 3ʹ to the 5ʹ permuted intron segment.

[0316] In some embodiments, the polynucleotide comprises a monotron element comprising an affinity tag and / or terminal element comprising an affinity tag. In some embodiments, the terminal element comprises (a) a 5ʹ affinity tag if the terminal element is located upstream of the monotron element, wherein the 5ʹ affinity tag is located 5ʹ to the terminal element; or (b) a 3ʹ affinity tag if the monotron element is located upstream of the terminal element, wherein the 3ʹ affinity tag is located 3ʹ to the terminal element. In some embodiments, the monotron element comprises (a) a 3ʹ affinity tag if the terminal element is located upstream of the monotron element, wherein the 3ʹ affinity tag is located 3ʹ to the monotron element; or (b) a 5ʹ affinity tag if the monotron element is located upstream of the terminal element, wherein the 5ʹ affinity tag is located 5ʹ to the monotron element. In some embodiments, if the precursor RNA polynucleotide comprises an external spacer, the 5’ or 3’ affinity tag is positioned adjacent to the external spacer.

[0317] In one embodiment, an affinity tag of the 3’ intron element is the length as an affinity tag in the 5’ intron element. In some embodiments, an affinity tag of the 3’ intron element is the same sequence as an affinity tag in the 5’ intron element. In some embodiments, the affinity sequence is placed to optimize oligo-dT purification.

[0318] In some embodiments, the one or more affinity tags present in a precursor RNA polynucleotide are removed upon circularization. See, for example, Figures 97A and 97B from WO2022261490, which are incorporated by reference herein in entirety. In some embodiments, affinity tags are added to remaining linear RNA after circularization of precursor RNA is performed. In some such embodiments, affinity tags are added enzymatically to linear RNA. 241Attorney Docket No. 01318-0014-00PCT OR-043WO The presence of one or more affinity tags in linear RNA and their absence from circular RNA can facilitate purification of circular RNA. In some embodiments, such purification is performed using a negative selection or affinity-purification method. In some embodiments, such purification is performed using a binding agent that preferentially or specifically binds to the affinity tag.

[0319] In some embodiments, an affinity sequence, such as biotin, is added to linear RNA by ligation. In some embodiments, an oligonucleotide comprising an affinity sequence is ligated to linear RNA. In some embodiments, an oligonucleotide conjugated to an affinity handle is ligated to the linear RNA. In some embodiments, a solution comprising the linear RNA ligated to the affinity sequence or handle and the circular RNA that does not comprise an affinity sequence or handle are contacted with a binding agent comprising a solid support conjugated to an oligonucleotide complementary to the affinity sequence or to a binding partner of the affinity handle, such that the linear RNA binds to the binding agent, and the circular RNA is eluted or separated from the solid support.

[0320] In some embodiments, an affinity tag comprises a polyA sequence or is a polyA affinity tag. In some embodiments the polyA sequence is at least 15, 30, or 60 nt in length. In some embodiments, the affinity tag comprising a polyA sequence is present in two places in a precursor linear RNA. In some embodiments, one or both polyA sequences are 15-50 nt in length. In some embodiments, one or both polyA sequences are 20-25 nt in length. In some embodiments, the polyA sequence(s) is removed upon circularization. Thus, an oligonucleotide hybridizing with the polyA sequence, such as a deoxythymidine oligonucleotide (oligo(dT)) conjugated to a solid surface (e.g., a resin), can be used to separate circular RNA from its precursor RNA.

[0321] Any purification method for circular RNA described herein may comprise one or more buffer exchange steps. In some embodiments, buffer exchange is performed after in vitro transcription (IVT) and before additional purification steps. In some such embodiments, the IVT reaction solution is buffer exchanged into a buffer comprising Tris. In some embodiments, the IVT reaction solution is buffer exchanged into a buffer comprising greater than 1 mM or greater than 10 mM one or more monovalent salts, such as NaCl or KCl, and optionally comprising EDTA. In some embodiments, buffer exchange is performed after purification of circular RNA is complete. In some embodiments, buffer exchange is performed after IVT and after purification of circular RNA. In some embodiments, the buffer exchange that is performed after purification of circular RNA comprises exchange of the circular RNA into water or 242Attorney Docket No. 01318-0014-00PCT OR-043WO storage buffer. In some embodiments, the storage buffer comprises 1mM sodium citrate, pH 6.5. g. LEADING SEQUENCES & LAGGING SEQUENCES

[0322] In various embodiments, provided polynucleotide (e.g., a DNA template, a precursor linear RNA polynucleotide, or a circular RNA polynucleotide) comprises a leading untranslated sequence. In some embodiments, the leading untranslated sequence is located at the 5’ end in the 3’ intron fragment (also referred to as “5’ leading sequence”). In some embodiments, the leading untranslated sequence comprises the last nucleotide of a transcription start site (TSS). In some embodiments, the TSS is chosen from a viral, bacterial, or eukaryotic DNA template. In one embodiment, the leading untranslated sequence comprises the last nucleotide of a TSS and 0 to 100 additional nucleotides. In some embodiments, the TSS is a spacer. In some embodiments, the leading untranslated sequence contains a guanosine at the 5’ end.

[0323] In various embodiments, provided polynucleotide (e.g., a DNA template, a precursor linear RNA polynucleotide, or a circular RNA polynucleotide) comprises a lagging untranslated sequence (also referred to as “trailing sequence”). In some embodiments, the lagging untranslated sequence is located at the 3’ end. In some embodiments, the polynucleotide comprises a 3ʹ external spacer located between the 3ʹ intron element and a lagging untranslated sequence. In some embodiments, the polynucleotide a leading untranslated sequence at the 5ʹ end. In some embodiments, the polynucleotide comprises a 5ʹ external spacer located between a leading untranslated sequence and the 5ʹ intron element.

[0324] In some embodiments, the polynucleotide comprises a monotron element and a leading untranslated sequence. In some embodiments, the polynucleotide comprises a 5ʹ external spacer positioned between a leading untranslated sequence and either the terminal element or monotron element. In some embodiments, the polynucleotide comprises a monotron element and a lagging untranslated sequence. In some embodiments, the polynucleotide comprises a 3’ external spacer positioned between the lagging untranslated sequence and either the monotron element or terminal element.

[0325] In some embodiments, the lagging untranslated sequence comprises a restriction site sequence or a fragment thereof. In certain embodiments, the restriction site sequence or fragment thereof is used to linearize the polypeptide (e.g., DNA template). In some embodiments, the restriction site sequence is derived from a natural viral, bacterial or eukaryotic DNA template. 243Attorney Docket No. 01318-0014-00PCT OR-043WO D. MONOTRON ELEMENT

[0326] Provided herein is a precursor RNA polynucleotide comprising a monotron (also called a monotron element or monotron sequence) and a terminal element (also called a terminal sequence). In some embodiments, the monotron has ribozymatic activity that allows it to enzymatically self-cleave. In some embodiments, the monotron is capable of forming a phosphodiester bond with a terminal sequence, i.e., a sequence containing a splice site dinucleotide and optionally a natural exon sequence or fragment thereof. In some embodiments, the precursor RNA polynucleotide comprises a terminal element; an intervening region, and a monotron element.

[0327] In some embodiments, the precursor RNA polynucleotide comprises, in the following order, (a) a terminal element; (b) an intervening region, and (c) a monotron element. In some embodiments, the terminal sequence is upstream of the monotron sequence in the precursor RNA polynucleotide. In such embodiments: (i) the terminal element comprises a splice site nucleotide, (ii) the monotron element comprises a splice site dinucleotide at or near the 5’ end of the monotron, and (iii) the monotron element is capable of interacting with a nucleophile that is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron, where the cleavage product of (iii) comprises a 5’ splice site nucleotide that is capable of cleaving at the splice site nucleotide of the terminal element. In some embodiments, the nucleophile is a free nucleophile that is introduced to the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the nucleophile is a guanosine that is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron. In some embodiments, the guanosine is a free guanosine that is introduced to the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the cleavage product of (iii) comprises a 5’ splice site nucleotide having a 3’ hydroxyl group that is capable of cleaving at the splice site nucleotide of the terminal element.

[0328] In some embodiments, the precursor RNA polynucleotide comprises, in the following order, (a) a monotron element; (b) an intervening region, and (c) terminal element. In some embodiments, the monotron sequence is upstream of the terminal sequence in the precursor RNA polynucleotide. In such embodiments: (i) the monotron element comprises a splice site dinucleotide at or near the 3’ end of the monotron, (ii) the terminal element comprises a splice site nucleotide, and (iii) the monotron element is capable of interacting with a nucleophile that is capable of cleaving at the splice site nucleotide of the terminal element, 244Attorney Docket No. 01318-0014-00PCT OR-043WO where the cleavage product of (iii) comprises a 5’ splice site nucleotide that is capable of cleaving at the splice site dinucleotide at or near the 3’ end of the monotron. In some embodiments, the nucleophile is a free nucleophile that is introduced to the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the nucleophile is a guanosine that is capable of cleaving at the splice site nucleotide of the terminal element. In some embodiments, the guanosine is a free guanosine that is introduced to the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the cleavage product of (iii) comprises a 5’ splice site nucleotide having a 3’ hydroxyl group that is capable of cleaving at the splice site nucleotide of the terminal element.

[0329] In some embodiments where the terminal sequence is upstream to the monotron, the monotron can perform two transesterification reactions. The monotron can (a) self-cleave and (b) form a phosphodiester bond with the terminal sequence. In some embodiments, the reactions (a) and (b) are sequential. In some embodiments, (a) the monotron is capable of interacting with a nucleophile that is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron, and (b) the cleavage product of (a), i.e., the 5’ splice site nucleotide, e.g., having a 3’ hydroxyl group, engages in a transesterification reaction (cleaves) at the splice site nucleotide of the terminal sequence, yielding a circular RNA or oRNA. In these embodiments, the monotron interacts with the nucleophile by forming a binding pocket with the nucleophile, and the linear precursor is capable of adopting a conformation in which the nucleophile is in proximity to and is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron. In some embodiments, the nucleophile can be a guanosine, e.g., a free guanosine that is introduced to the precursor RNA polynucleotide.

[0330] In some embodiments where the monotron sequence is upstream of the terminal sequence, the monotron can also perform two transesterification reactions. In some embodiments, (a) the monotron is capable of interacting with a nucleophile that is capable of cleaving at the splice site nucleotide of the terminal element, and (b) the cleavage product of (a), i.e., the 5’ splice site nucleotide, e.g., having a 3’ hydroxyl group, engages in a transesterification reaction (cleaves) at the splice site dinucleotide at or near the 3’ end of the monotron, yielding a circular RNA or oRNA. In these embodiments, the monotron interacts with the nucleophile by forming a binding pocket with the nucleophile, and the linear precursor is capable of adopting a conformation in which the nucleophile is in proximity to and is capable of cleaving the splice site nucleotide of the terminal element. In some embodiments, the 245Attorney Docket No. 01318-0014-00PCT OR-043WO nucleophile can be a guanosine, e.g., a free guanosine that is introduced to the precursor RNA polynucleotide.

[0331] In some embodiments, the monotron comprises a 5’ proximal end of a natural group I or group II intron including the splice site dinucleotide and optionally a natural exon sequence or fragment thereof. In some embodiments, the 5’ end of the monotron refers to nucleotides within the 5’ half of the monotron. In some embodiments, the 3’ end of the monotron refers to nucleotides within the 3’ half of the monotron. In some embodiments, at or near the 5’ end of the monotron refers to within the 5’ half of the monotron. In some embodiments, at or near the 5’ end of the monotron refers to within the first ten 5’ positions in the monotron. In some embodiments, at the 5’ end of the monotron refers to the first 5’ position(s) in the monotron. In some embodiments, at or near the 3’ end of the monotron refers to within the 3’ half of the monotron. In some embodiments, at or near the 3’ end of the monotron refers to within the last ten 3’ positions in the monotron. In some embodiments, at the 3’ end of the monotron refers to last 3’ position(s) in the monotron.

[0332] In some embodiments, the splice site nucleotide of the terminal element is not a natural splice site dinucleotide associated with a natural Group I or Group II intron sequence. In some embodiments, the terminal element comprises at least a portion of a natural exon or a fragment of a natural exon. In some embodiments, the natural exon is a Group I or Group II exon. In some embodiments, the natural exon or fragment thereof is 10-20 nucleotides in length. In some embodiments, the terminal element comprises a synthetic derivative of a natural exon or fragment thereof. In some embodiments, the terminal element comprises an exon or synthetic nucleotides that are longer than the splice site nucleotide that can help with splicing.

[0333] In some embodiments, the terminal element sequence has a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to an exon fragment of a sequence selected from Tables A or B. In...

Claims

Attorney Docket No. 01318-0014-00PCT OR-043WO What is claimed is:

1. A circular RNA polynucleotide (oRNA) comprising a translation initiation element (TIE), wherein the TIE comprises at least one synthetic internal ribosome entry site (IRES) comprising a sequence comprising at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, or at least 700 nucleotides of a sequence selected from SEQ ID NOs: 24867-24892, wherein N is any nucleotide.

2. A circular RNA polynucleotide (oRNA) comprising a translation initiation element (TIE), wherein the TIE comprises at least one synthetic internal ribosome entry site (IRES) comprising at least one addition, deletion, or substitution of a nucleotide, domain, or motif, as compared to a naturally occurring IRES.

3. The oRNA of claim 2, wherein the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain I as compared to a naturally occurring Domain I, or comprises a deletion or substitution of Domain I in whole or in part.

4. The oRNA of claim 3, wherein the synthetic IRES comprises a deletion of Domain I in whole or in part.

5. The oRNA of any one of claims 1-4, wherein the synthetic IRES comprises a naturally occurring Domain II.

6. The oRNA of any one of claims 1-5, wherein the synthetic IRES comprises a naturally occurring Domain III.

7. The oRNA of any one of claims 1-6, wherein the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain IV as compared to a naturally occurring Domain IV, or comprises a deletion or substitution of Domain IV in whole or in part. 671Attorney Docket No. 01318-0014-00PCT OR-043WO 8. The oRNA of claim 7, wherein the synthetic IRES comprises a substitution of Domain IV as a whole, wherein Domain IV is replaced with a Domain IV from a second, higher- expressing, naturally occurring IRES.

9. The oRNA of claim 7, wherein the at least one addition, deletion, or substitution comprises at least one of: (a) an addition of an EIF4 aptamer sequence at the 5’ end of Domain IV; (b) an addition of an EIF3 / EIF4G aptamer sequence to the 2 nucleotide bulge and / or 3 nucleotide bulge of Domain IV; (c) an addition or substitution of a Polypyrimidine tract (PPT) in Domain IV with a PPT tract from a second, higher-expressing, naturally occurring IRES; (d) an addition, deletion, or substitution in a GNRA tetra loop in Domain IV; and (e) an addition, deletion, or substitution in a negative IRES transacting factor (“- ITAF”), optionally comprising a mutation or deletion of a FBP2 / KHSRP binding region, optionally wherein the mutation or deletion is in frame.

10. The oRNA of claim 9, wherein the at least one addition, deletion, or substitution comprises an addition of an EIF4 aptamer sequence at the 5’ end of Domain IV, and wherein Domain VII is naturally occurring.

11. The oRNA of any one of claims 1-6, wherein the synthetic IRES comprises a naturally occurring Domain IV.

12. The oRNA of any one of claims 1-11, wherein the C-Loop Region of Domain IV recognized by either PCBP1 or PCBP2 of the synthetic IRES is naturally occurring.

13. The oRNA of any one of claims 1-12, wherein the synthetic IRES comprises (a) a naturally occurring PPT sequence of Domain IV; or (b) does not contain an added PTBP1 consensus sequence.

14. The oRNA of any one of claims 1-13, wherein the synthetic IRES comprises a naturally occurring Domain V. 672Attorney Docket No. 01318-0014-00PCT OR-043WO 15. The oRNA of any one of claims 1-14, wherein Domain V does not comprise a J-K / L Loop of Type II IRES.

16. The oRNA of any one of claims 1-15, wherein the synthetic IRES comprises a naturally occurring Domain VI.

17. The oRNA of any one of claims 1-16, wherein the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in Domain VII as compared to a naturally occurring Domain VII, or comprises a deletion or substitution of Domain VII in whole or in part.

18. The oRNA of any one of claims 1-17, wherein the synthetic IRES comprises at least one addition, deletion, or substitution of a nucleotide or motif in the post-Domain VII terminal loop as compared to a naturally occurring post-Domain VII terminal loop, or comprises a deletion or substitution of the post-Domain VII terminal loop in whole or in part.

19. The oRNA of claim 18, wherein the synthetic IRES comprises a deletion of a naturally occurring post-Domain VII terminal stem and (a) an addition of a 15-nt scanning tract comprising the sequence AUN-AUN-AUN- AUN-AUN, wherein N is a U or A; (b) an addition of a 9-nt Kozak sequence; or (c) an addition of an 11-nt consensus sequence, wherein the 11-nt consensus sequence comprises AACACAACAAA.

20. The oRNA of any one of claims 1-16, wherein the synthetic IRES comprises a naturally occurring Domain VII.

21. The oRNA of claim 20, wherein the nucleotides from the 5’ end of the terminal stem of Domain VII to the 3’ end of the synthetic IRES do not comprise an EIF4 aptamer sequence.

22. The oRNA of any one of claims 1-21, wherein the synthetic IRES does not contain an addition, deletion, or substitution of a nucleotide in any cryptic codons or contain a deletion or substitution of any cryptic codons in whole or in part. 673Attorney Docket No. 01318-0014-00PCT OR-043WO 23. The oRNA of any one of claims 1-21, wherein the synthetic IRES comprises at least one addition of a cryptic codon.

24. The oRNA of any one of claims 1-21, wherein the synthetic IRES does not contain a deletion of any cryptic codons in part or in whole.

25. The oRNA of any one of claims 1-24, wherein the synthetic IRES comprises naturally occurring non-canonical stem loop regions (“SL regions”).

26. The oRNA of any one of claims 1-25, wherein the synthetic IRES does not contain: (a) a deletion of SL1 in whole or in part, (b) a deletion of SL2 in whole or in part, (c) a deletion ofSL3 in whole or in part, (d) a deletion of SL4 in whole or in part, or (e) an addition of a SL4 to an IRES natively lacking a SL4.

27. The oRNA of claim 2, wherein the synthetic IRES comprises combining Domains I, II, and III from a first naturally occurring IRES with Domains IV, V, VI, and VII from a second naturally occurring IRES.

28. The oRNA of any one of claims 3-6, 8-15, 18-27, wherein the synthetic IRES has improved function and / or expression and / or stability as compared to a naturally occurring IRES.

29. The oRNA of any one of claims 3-6, 8-15, 18-27, wherein the synthetic IRES has improved function and / or expression and / or stability in hepatocytes, immune cells, and / or muscle cells as compared to a naturally occurring IRES.

30. The oRNA of any one of claims 28 or 29, wherein the synthetic IRES increases expression of a coding sequence operably linked to the IRES as compared to the naturally occurring IRES.

31. The oRNA of any one of any one of claims 1-30, wherein the synthetic IRES is a Type I IRES, a Type II IRES, a Type III IRES, a Type IV IRES, or a Type V IRES. 674Attorney Docket No. 01318-0014-00PCT OR-043WO 32. The oRNA of claim 31, wherein the synthetic IRES is a Type I IRES, optionally wherein the Type I IRES is a coxsackievirus B3 (CVB3).

33. The oRNA polynucleotide of any one of claims 1-32, further comprising a sequence encoding for a therapeutic protein, wherein the synthetic IRES is capable of enhancing expression of the therapeutic protein as compared to a naturally occurring IRES.

34. The oRNA polynucleotide of claim 33, wherein the sequence encoding for a therapeutic protein is selected from a chimeric antigen receptor (CAR), T-cell receptor (TCR), B-cell receptor (BCR), immune cell activation or inhibitory receptor, recombinant fusion protein, chimeric mutant protein, fusion protein, an antibody, nanobody, non-antibody protein, immune modulatory ligand, receptor, structural protein, growth factor ligand or receptor, hormone or hormone receptor, transcription factor, checkpoint inhibitor or agonist, Fc fusion protein, anticoagulant, blood clotting factor, chaperone protein, antimicrobial protein, structural protein, biochemical enzyme, tight junction protein, mitochondrial stress response, cytoskeletal protein, metal-binding protein, or small molecule.

35. A precursor polynucleotide for making the oRNA of any one of the preceding claims.

36. The oRNA of any one of claims 1-34 or the precursor polynucleotide of claim 35, wherein the synthetic IRES comprises a sequence having at least 80 % sequence identity to a sequence selected from Table 1, or a fragment thereof.

37. The oRNA of any one of claims 1-34 or the precursor RNA polynucleotide of claim 36, wherein the synthetic IRES comprises a sequence selected from Table 1, or a fragment thereof.

38. A method of making the circular RNA polynucleotide of any one of claims 1-34, comprising circularizing a precursor RNA polynucleotide formed by transcribing a vector or DNA comprising a PCR product, a linearized plasmid, non-linearized plasmid, linearized minicircle, a non-linearized minicircle, viral vector, cosmid, ceDNA, or an artificial chromosome.

39. A pharmaceutical composition comprising the circular RNA polynucleotide of any one of claims 1-34, a pharmaceutically acceptable salt, buffer, diluent, or combination, and 675Attorney Docket No. 01318-0014-00PCT OR-043WO optionally a transfer vehicle, wherein the transfer vehicle optionally comprises a nanoparticle, and wherein the nanoparticle optionally comprises one or more cationic lipids, non-cationic lipids, ionizable lipids, poly β-amino esters, and / or is a lipid nanoparticle, a core-shell nanoparticle, a biodegradable nanoparticle, a biodegradable lipid nanoparticle, a polymer nanoparticle, a polyplex, or a biodegradable polymer nanoparticle; and / or comprises one or more PEG-modified lipids, polyglutamic acid lipids, or hyaluronic acid lipids; and / or cholesterol; and / or arachidonic acid, leukotriene, or oleic acid.

40. A method for enhancing expression of a therapeutic protein in a cell, comprising contacting the cell with the circular RNA polynucleotide of any one of claims 1-34 or the pharmaceutical composition of claim 39.

41. A method of treating a subject in need thereof comprising administering a therapeutically effective amount of the circular RNA polynucleotide of any one of claims 1-34 or the pharmaceutical composition of claim 39. 676

Citation Information

Patent Citations

  • Beta-secretase crystals and methods for preparing and using the same

    US20040014194A1

  • Genetic modification of the lung as a portal for gene delivery

    US20040110709A1

  • Circular rnas and their use in immunomodulation

    US20190345503A1

  • Genetic elements driving circular RNA translation and methods of use

    US20220251578A1

  • Circular RNA modification and methods of use

    US20220288176A1