Gene modulation for treating cancer

By genetically modifying stromal cells to inhibit specific genes that promote cancer invasion, the method effectively prevents metastasis and recurrence by creating a robust stromal barrier, addressing the limitations of traditional cancer therapies.

WO2026006832A1PCT designated stage Publication Date: 2026-01-02UNIV OF CONNECTICUT +2
View PDF 29 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035922
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-28
Filing Date
2025-06-30
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Current cancer treatments inadequately address the complex mechanisms by which cancer cells evade primary sites, leading to high metastasis and recurrence rates, with traditional therapies often targeting cancer cells directly and failing to effectively prevent invasion into the stroma.

Method used

Genetically engineering stromal cells, such as fibroblasts, to reduce or eliminate expression of specific genes that confer permissivity to cancer invasion, creating a barrier against metastasis by administering these cells to the primary tumor site, either alone or in combination with a carrier like a hydrogel.

Benefits of technology

The engineered stromal cells significantly reduce cancer dissemination and metastasis, enhancing stromal resistance and preventing chemotherapy drug resistance induced by cancer-associated fibroblasts, thereby improving patient outcomes and survival.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000016_0001
    Figure IMGF000016_0001
  • Figure IMGF000049_0001
    Figure IMGF000049_0001
  • Figure IMGF000050_0001
    Figure IMGF000050_0001
Patent Text Reader

Abstract

Compositions and methods including stromal cells that have been genetically engineered to knock down or silence one or more genes are disclosed herein. The compositions include a population of isolated stromal cells that have been genetically engineered to reduce or eliminate expression one or more genes which confers permissivity to invasion (referred to herein as INVGOI) in fibroblasts, or cancer associated fibroblasts (CAFs). The cell compositions can be administered to a subject in need thereof to reduce or eliminate expression of one or more genes which confer permissivity to cancer invasion. Alternatively, inhibitory functional nucleic acids which specifically target one or more INV-GOI can be administered to a subject to treat cancer and in additional to chemotherapy, to sensitize cancer cells to chemotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] GENE MODULATION FOR TREATING CANCER CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims benefit of U.S. Provisional Application No. 63 / 665,803, filed June 28, 2024. Application No. 63 / 665,803, filed June 28, 2024, is hereby incorporated herein by reference in its entirety.

[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0004] This invention was made with government support under HD105973 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0005] REFERENCE TO SEQUENCE LISTING

[0006] The Sequence Listing XML submitted as a file named “YU_9048_PCT_ST26.xml,” created on June 30, 2025, and having a size of 16,815 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.834(c)(1).

[0007] FIELD OF THE INVENTION

[0008] The present disclosure provides systems / compositions and methods for prevention of cancer malignancy using autologous patient’s stromal cells with gene modulation, and a method for determining or predicting at least one gene for modulation to increase stromal resistance to cancer spread. Especially, the systems / compositions and methods for prevention of cancer metastasis using gene modulation in non-cancerous stromal cells.

[0009] BACKGROUND OF THE INVENTION

[0010] The relentless challenge of cancer metastasis, responsible for approximately 90% of deaths in patients with solid tumors, underscores the urgent need for innovative therapeutic strategies. Remnant cancer cells after therapy are the principle driver of recurrence of cancer, which are also highly likely resistant to therapy, and contribute to cancer spread beyond their initial (primary) location, leading to high death rate. Stromal trespass, or invasion into the stroma is the first step in the “metastatic cascade”, before which a lesion may be classified as a tumor, but not a metastatic disease. Metastasis leads eventually to secondary growths in distant organs, with a high lethality burden. As an example, breast cancer has likelihood of disease return exceeding 30%, even after initial treatment successes. These recurrent cancers are more recalcitrant to therapy, but can metastasize to other organs causing very high death rate. Traditional treatments often inadequately address the complex mechanisms by which cancer cells evade primary sites, and often target mechanisms employed by cancer cells themselves. Therefore, there is an urgent and unmet need for treatment options limiting cancer invasion into the stroma to avoid or minimize occurrences of cancer metastasis. There are large variances in patient’s stromal response to cancer. Therefore, methods are required to both measure the inherent vulnerability of fibroblasts to cancer metastasis, to engineer fibroblasts to increase resistance in a measurable, predictable manner.

[0011] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.

[0012] BRIEF SUMMARY OF THE INVENTION

[0013] Compositions and methods including stromal cells that have been genetically engineered to knock down or silence one or more genes are disclosed herein.

[0014] A population of isolated stromal cells that have been genetically engineered to reduce or eliminate expression one or more genes which confers permissivity to invasion in fibroblasts, or cancer associated fibroblasts (CAFs) (referred to “herein as “invasion gene of interest” or “INV- GOI” and described further below), are disclosed.

[0015] The INV-GOI is selected from: ABHD2, ADCY7 AKAP13, ARHGEF11, ARRB1, ATG7, ATP1A1, ATP2B1, BAIAP2, BIRC6, BMP1, CBL, CCDC90B, CFAP46, CFLAR, CHRM2, CLASP1, C0L7A1, C0L8A1, CREB3L2, CREBBP, CSF3, CUL4B, CXCL8, DAPP1, DGKI, DNM2, DUSP22, DVL2, EGFR, ELM03, EPB41L5, ERBB2, EVC, F2R, FKBP5, F0XP1, GALT, GATA2, GFRA3, GMDS, GNB5, GRHL2, HECW2, HERC2, HERC4, HINFP, HM0X1, HTR2B, HUWE1, IL7R, INPP4B, IRF2, ITGA2, ITGA4, JDP2, JUN, KCNK1, KDM5A, LAMA1, MAFG, MANSC1, MCUR1, MDFI, MEGF8, MFSD2A, MICU2, MMP14, MMP17, MRPS10, MTMR3, NCSTN, NEK7, NFKB1, NUMA1, NUMBL, 0V0L2, 0XA1L, OXTR, PARD3, PARP12, PDE4B, PIEZO1, PIF1, PIK3C2A, PLCD3, PLCG1, PLXND1, PPL, PPP2R5C, PRG4, PRKAA, RCSD1, RECQL5, RGS9, RNF20, RTF1, SAMHD1, SEMA3A, SHC1, SLC18A2, SLC8B1, SMPD1, SNAI2, SOD2, SPINT2, SSTR1, TEK, TFDP1, TRIP12, UBE3C, VDR, WNK1, XRCC5, and ZBTB1.

[0016] In some forms, the INV-GOI is SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, VDR, AKAP13, ADCY7, CHRM2, PDE4B, PLCD3, ARRB1, ARHGEF11, or a combination thereof.

[0017] In some forms, the INV-GOI is SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, VDR, or a combination thereof.

[0018] In some forms, the stromal cells are fibroblasts.

[0019] In some forms, the genetically engineered stromal cells such as fibroblasts include one or more functional nucleic acid inhibitors which are specific for at least one or more INV-GOI. The genetically engineered stromal cells can be provided as a pharmaceutical compositions, including a pharmaceutically acceptable vehicle and / or excipient.

[0020] The compositions can be administered to a subject in need thereof, to prevent cancer spread, or dissemination, or to inhibit cancer progression in a subject or to prevent CAF (cancer associated fibroblast) induced resistance to chemotherapy drug response in a subject as shown and described herein

[0021] Thus, methods for preventing metastasis in a subject, are provided, wherein fibroblasts are isolated from subject’s biopsy, for example, from either skin, breast, or other tissues, or the surgically excised tumor itself; expanded in vitro-, transformed to resist invasion by genetically engineering the stromal cells to reduce or eliminate expression of at least one INV-GOI; and transplanted at a site of a primary tumor creating a barrier against cancer dissemination. The genetically engineered cells can be transplanted alone or in combination with a carrier, such as a hydrogel.

[0022] Also disclosed is a method for preventing CAF (cancer associated fibroblasts) or stroma induced resistance to drug response in a subject. The method include administering an effective amount of a composition including genetically engineered stromal cells as disclosed herein at a primary tumor site, and administering one or more therapeutic agents to the subject.

[0023] Also disclosed is a method of determining or predicting at least one gene for modulation based on patient’s stromal cell gene expression to improve stromal resistance to cancer spread in a subject as shown and described herein.

[0024] In an aspect, disclosed are rapidly assayed quantitative methods to measure the permissivity of subject’s fibroblasts in vitro, and in vivo, both native cells, as well as increase in resistivity after genetic modulation.

[0025] Also, disclosed is a method to determine the efficacy of patient’s fibroblasts, native of genetically modified, in regulating invasion of cancer cells in vitro and in vivo.

[0026] Additional advantages of the disclosed method and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or can be learned by practice of the disclosed method and compositions. The advantages of the disclosed method and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The accompanying drawings illustrate several embodiments of the disclosed method and compositions and together with the description, serve to explain the principles of the disclosed method and compositions.

[0028] FIG. 1A-1B show the identification of putative genes which can confer stromal resistance, obtained through a rigorous analysis of the gene changes accompanying mammalian evolution of non-invasive placentation. (FIG. 1A) Phylogenetic analysis of mammalian evolution highlights species that have evolved with very little placental invasion (cows, sheep, horses), while humans are characterized by very deep placentation invasion. (FIG. IB) Inventors obtained transcriptomic data from endometrial fibroblasts and skin fibroblasts of these species and based on many criteria, including the gene changes accompanying decidualization, identified “ELI” genes, which are predicted to contribute to stromal vulnerability. Shown are their ELI value (size of bubble), as well as p-values (color). These analyses, coupled with the parallel changes in decidualization highlighted genes which, when engineered to reduce or eliminate expression of the gene, will enhance stromal resistance to epithelial invasion based on our ELI framework. The genes in FIG. IB are as follows (in the order from top to bottom): SSTR1, OXTR, CHRM2, CREBBP, PDE4B, CREB3L2, EP300, ADCY9, ATP2B 1, NFKB1, F2R, ATP1A1, ADCY7, MMP14, ERBB2, IL7R, RTF1, CUL3, PDGFRB, CAD, DGKI, INPP4B, CBL, SOS1, CDC23, IL6ST, EPB41L5, PIK3C3, SMAD3, UBE2G2, ATF6B, OGT, ARRB1, SMAD2, XRCC5, GLI3, HDAC2, BAIAP2, AKAP13, PI4KB, TEK, UBE3C, PTK2, PLCD3, GNB5, CLASP1, NUMBL, PRKAA1, TRIP12, RECQL5, SIN3A, PPP1R10, DUSP22, ZMPSTE24, CSNK1D, ACVR1, EVC, PIP4K2B, PIF1, MC0LN1, STAT6, SOS2, SEMA3C, SEMA3A, NEK7, MTMR2, ATG7, HERC2, HERC4, ZBTB 17, DAG1, WNK1, ATP6V0A1, SMPD1, NUMA1, HECW2, PIP5K1A, LAMA1, ITGA2, CFLAR, EXT2, TRAPPC12, PIK3C2A, TGFB1, C0L8A1, SACM1L, PLCG1, BIRC6, ATP6V1A, PLXND1, MEGF8, CUL4B, INPP5K, CLTC, DAB2IP, DNM2, ITGA4, SMG5, DVL2, TNKS, UBE2Z, SHC1, MMP17, RNF20, FRS2, KDM5A, JAK1, CUL5, EGFR, IP6K1, HTR2B, HUWE1, ARHGEF11, FBXW11, PPP2R5C, PLXNA1, NCSTN, LRP6, MTMR3. FIG. 1C-1D. Evolved stromal genes contributing to vulnerability to cancer and trophoblast invasion identified by comparative mammalian transcriptomics and phenotyping. (FIG. 1C) ELLscore (change across epitheliochorial to hemochorial mammalian stroma) and fold change between decidualized and undifferentiated endometrial fibroblasts. (FIG. ID) TFs P-values identified by change in copy number of TF binding sites explaining the gene expression variance across species based on copy number of TF binding sites in cis-regulatory regions of a given gene. FIG. 2 shows the comprehensive in vitro assays to test the efficacy of patient’s derived fibroblasts in resisting cancer invasion, in its native state or when engineered to eliminate or reduce expression for a predicted ELI gene. (A) Biopsies from patient’s normal tissue, or excised cancer will be used to isolate fibroblasts, or cancer-associated fibroblasts (CAFs). (FB) Fibroblasts will be cultured on a substrate created by directional nanowrinkling as monolayers. Cancer cells will interact with fibroblasts either as (C) spheroids, or (D) as monolayers to create an interface orthogonal to the underlying nanopattems. This is achieved by stencil with magnetic beads which can be pulled by a powerful magnet, or by creating a scratch with a tip coated with a soft material to prevent damage to nanopattems (D). Extent of invasion in C, and D are measured by microscopy. (E) Fibroblasts are also RNA sequenced to identify changes in ELI, or ELI regulated genes, as well as to predict the most likely ELI gene which can induce maximal increase in stromal resistance. (F) Together, the in vitro invasion measurements and model predictions are integrated to create a prognostic metric of “stromal vulnerability” in a patientfibroblast sample, as well as to test the efficacy of a given gene therapy in reducing the vulnerability.

[0029] FIG. 3A-3C show the fast in vivo assaying for measurement of stromal vulnerability / or resistance to cancer invasion. (FIG. 3A) Patient derived stromal fibroblasts (from biopsies or excised cancer) are embedded in matrigel, or any other hydrogel which can be crosslinked rapidly, and injected subcutaneously in mouse. At the time of injection, pre-prepared fluorescent cancer spheroids are mixed with the hydrogel at uniform density. The gel is gelated either by temperature, or by appropriate cross-linking. (FIG. 3B) After 3-5 days, gel inserts are removed and (FIG. 3C) extent of invasion measured by microscopy to measure the capability of fibroblasts to resist dissemination, and the effect of gene-therapy in engineered fibroblasts, engineered to reduce or eliminate expression of a gene. Shown is an illustration of MAFG gene knockdown in endometrial fibroblasts, reducing invasion of HTR8 trophoblast cells.

[0030] FIG. 4A-4D show the stromal avatar model to demonstrate species-wide differences in stromal resistance to cancer, as well as a novel model to test the efficacy of stromal gene therapy on regulating cancer dissemination. Patient stromal avatar model. (FIG. 4A) A375 cells (EF-1 driven luciferase) mixed with patient (or mammalian) skin fibroblasts (SkFb) in collagen gel and injected in SCID mouse on right flank. BLI showed that bovine SkFbs confine melanoma locally, while metastasis occurs with human SkFbs. (FIG. 4B) H&E stain showing metastatic nodes in lung sections in a human avatar, while bovine stromal avatar shows no metastasis. (FIG. 4C-4D) Bovine SkFbs avatar mice retain their tumorless weight and survive, in contrast to human stromal avatar (n = 5). FIG. 5 is a schematic diagram illustrating certain aspects of the invention. In this pipeline, (1) Patient biopsy of a normal tissue (for example, skin / breast, or any other suitable source of stromal cells such as fat tissue), or excised cancer will be obtained, (2) fibroblast cells will be isolated from a biopsy and characterized. (3) The gene (s) will be engineered by appropriate methodology (electroporation, LNP, CRISPR / Cas9, TALEN, ARK bridge etc.), and (4) cells will be expanded in vitro (ex vivo). (5) Finally, the gene-edited fibroblast will be injected at the tumor site after quality control, safety and off-target tests to prevent cancer dissemination into, and beyond the stroma.

[0031] FIG. 6A-6C. Gene silencing / knockout / knockdown of evolved stromal genes increase resistance to many cancer types in stromal fibroblasts. (FIG. 6A) Representative example of HCT116 spheroids (brightly labeled with H2B-mCherry) invading into a monolayer of fibroblasts (black region) at 0, and 44 hours for control (scrambled), and a silenced gene (here, ABHD2). (FIG. 6B) Extent of invasion of HCT116 colon cancer spheroids into the patient derived primary dermal fibroblasts silenced for genes; (FIG. 6C) Extent of invasion of HCT116 colon cancer spheroids into patient derived lung primary fibroblasts silenced for indicated genes. Student-t tests show significance against NCI (scrambled): p-value< 0.05: *; 0.01: **; ).001: ***; 0.0001: ****. FIG. 6D shows the effect of gene silencing in patient derived breast fibroblasts in reducing cancer invasion vs control (scrambled). Statistics by student- t-tests; p- value < : 0.05: *; 0.01: **; 0.001: ****; 0.0001: ****

[0032] FIG. 7A-7D show demonstration of disclosed stromal gene therapy in patient fibroblasts. Here, silencing for a gene, SSTR1 (labeled as GenelOl) enhances patient / subject’s fibroblasts resistance to breast cancer invasion. (FIG. 7A) ANSIA based quantification of the extent of breast cancer invasion in fibroblasts from 6 patients without (gray shade), and with Gene- 101 silencing (green); Error bars: stdev; mean shown as horizontal bar. (FIG. 7B) BLI showing luciferase activity in A375 cells co-engrafted with wild-type patient fibroblasts, and those which were silenced for GenelOl. No distal metastasis (star) was observed for our strategy. (FIG. 7C) Tumor-less weight of animal upon sacrifice 8 weeks after engraftment; when patient fibroblasts were gene-edited, no weight was lost, while control fibroblasts containing mice lost substantial weight. (FIG. 7D) Survival curves show that while all control avatar mice did not survive beyond 5 weeks, only 1 death was reported for gene-edited avatar (n = 6 mice).

[0033] FIG. 8 shows that stromal modulation of ELI genes, here silencing of SSTR1 in CAFs, can prevent CAF induced drug resistance in cancer cells. Shown is the MDA-MB-231 breast cancer survival at different concentrations of doxorubicin measured by luciferase activity in MDA-MB-231 cells. Top panel shows that presence of CAFs with MDA-MB-231 requires a higher dosage of drug to kill 50% of cells (1C50). Bottom panel shows that if CAFs have silenced SSTR1 gene, the decreased stromal induced drug resistance is reversed. Conditioned medium from SSTR1 silenced CAFs also show the same result.

[0034] DETAILED DESCRIPTION OF THE INVENTION

[0035] The disclosed method and compositions can be understood more readily by reference to the following detailed description of particular embodiments and the Example included therein and to the Figures and their previous and following description.

[0036] Before the disclosed processes and materials are described, it is to be understood that the aspects described herein are not limited to specific embodiments, or examples, and as such can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting.

[0037] In response to the challenge of cancer metastasis, the disclosed technology seeks to revolutionize the current state of cancer treatment through the development of a novel stroma centric approach, combined with novel gene therapy inspired by evolutionary medicine. Leveraging the evolution of resistance to cancer metastasis in certain mammals, the disclosed approach focuses on genetically fortifying fibroblasts obtained from a subject / patient to form a robust stromal barrier against metastatic spread. By aiming to shift the paradigm in cancer treatment, this innovative therapy targets the dual challenges of metastasis and cancer recurrence at their roots, offering a promising avenue for dramatically improving outcomes and quality of life for cancer patients. The disclosed methods and compositions include a gene identification and modulation-based therapeutic strategy targeted to autologously obtained fibroblasts or stromal cells, specifically designed to address the challenge of solid cancer metastasis as shown and described herein. The strategy includes subject’ s own fibroblasts which are genetically engineered to reduce or eliminate expression of a gene, enabling them to confine cancer from dissemination, and prevent or limit metastasis.

[0038] It is to be understood that the disclosed method and compositions are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0039] I. DEFINITIONS

[0040] The following terms are used to describe the invention of the present disclosure. In instances where a term is not specifically defined herein, that term is given an art-recognized meaning by those of ordinary skill applying that term in context to its use in describing the present disclosure.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein.

[0042] As used herein, the term “gene” refers to a nucleic acid (e.g., DNA or RNA) sequence that including coding sequences necessary for the production of a polypeptide, RNA (e.g., including, but not limited to, mRNA, tRNA and rRNA) or precursor. The polypeptide, RNA, or precursor can be encoded by a full-length coding sequence or by any portion thereof. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The term “gene” encompasses both cDNA and genomic forms of a gene, which may be made of DNA, or RNA. A genomic form or clone of a gene may contain the coding region interrupted with non-coding sequences termed “introns” or “intervening regions” or “intervening sequences.” Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation. For the purpose of this disclosure it may be considered that genes include regions that regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and / or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions.

[0043] As used herein, the term “inhibit” or other forms of the word such as “inhibiting” or “inhibition” means to hinder or restrain a particular characteristic, for example, to reduce, decrease or prevent, either partially or entirely. It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. As used herein, the terms “subject,” “individual,” and “patient” refer to any individual who is the target of treatment using the disclosed compositions. The subject can be a vertebrate, for example, a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, and a whale), a bird (e.g., a duck or a goose), and a shark. Thus, the subject can be a human. The subjects can be symptomatic or asymptomatic. The term does not denote a particular age or sex. Thus, adult and newborn subjects, whether male or female, are intended to be covered. A subject can include a control subject or a test subject.

[0044] As used herein, “mammal” includes both humans and non-humans and include but is not limited to humans, non-human primates, canines, felines, bovines, equines, and porcines.

[0045] As used herein, a “vector” is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. The vectors described herein can be expression vectors.

[0046] As used herein, an “expression vector” is a vector that includes one or more expression control sequences.

[0047] As used herein, an “expression control sequence” is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence.

[0048] As used herein, the term “treating” includes alleviating the symptoms associated with a specific disorder or condition and / or preventing or eliminating the symptoms, e.g., arresting or reducing the development of the pathological condition, disorder, or disease or its clinical symptoms; or relieving the pathological condition, disorder, or disease, e.g., causing regression of the pathological condition, disorder, or disease or its clinical symptoms. Treatment means any way the symptoms of a pathological condition, disorder, or disease are ameliorated or otherwise beneficially altered. These terms also encompass therapy and cure.

[0049] “Operably linked” refers to a juxtaposition wherein the components are configured so as to perform their usual function. For example, control sequences or promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence, and an organelle localization sequence operably linked to protein will direct the linked protein to be localized at the specific organelle.

[0050] As used herein, “transformed” and “transfected” encompass the introduction of a nucleic acid (e.g. a vector) into a cell by a number of techniques known in the art. As used herein, the term “carrier” or “excipient” refers to an organic or inorganic ingredient, natural or synthetic inactive ingredient in a formulation, with which one or more active ingredients are combined.

[0051] As used herein, the term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.

[0052] As used herein, the term “pharmaceutically acceptable carrier” encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water and emulsions such as an oil / water or water / oil emulsion, and various types of wetting agents.

[0053] "Effective amount" and “therapeutically effective amount,” used interchangeably, as applied to pharmaceutical compositions described herein, mean the quantity necessary to render the desired therapeutic result. For example, an effective amount is a level effective to treat, cure, or alleviate the symptoms of a disease for which the composition and / or therapeutic agent, or pharmaceutical composition, is / are being administered. An effective amount can require more than one dose. As used herein, the term “prophylaxis” refers to preventing or reducing the progression of a disorder, either to a statistically significant degree or to a degree detectable by a person of ordinary skill in the art.

[0054] As used herein, the term “operably linked” refers to a juxtaposition wherein the components are configured so as to perform their usual function. For example, control sequences or promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence, and an organelle localization sequence operably linked to protein will direct the linked protein to be localized at the specific organelle.

[0055] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.

[0056] Use of the term “about” is intended to describe values either above or below the stated value in a range of approx. + / - 10%; in other embodiments the values may range in value either above or below the stated value in a range of approx. + / - 5%; in other embodiments the values may range in value either above or below the stated value in a range of approx. + / - 2%; in other embodiments the values may range in value either above or below the stated value in a range of approx. + / - 1%. The preceding ranges are intended to be made clear by context, and no further limitation is implied. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any nonclaimed element as essential to the practice of the invention.

[0057] Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed method and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a ligand is disclosed and discussed and a number of modifications that can be made to a number of molecules including the ligand are discussed, each and every combination and permutation of ligand and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited, each is individually and collectively contemplated. Thus, in this example, each of the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Further, each of the materials, compositions, components, etc. contemplated and disclosed as above can also be specifically and independently included or excluded from any group, subgroup, list, set, etc. of such materials.

[0058] These concepts apply to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods, and that each such combination is specifically contemplated and should be considered disclosed.

[0059] Unless otherwise indicated, the disclosure encompasses conventional techniques of molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. Unless otherwise noted, technical terms are used according to conventional usage, and in the art, such as in the references cited herein, each of which is specifically incorporated by reference herein in its entirety.

[0060] IL COMPOSITIONS

[0061] A. Genetically Engineered Stromal Cells

[0062] Originally described as noncancerous cells within a tumor, stromal cells are now typically defined as connective tissue cells of an organ. Stroma is comprised of the extracellular matrix and a number of cell types, including mesenchymal cells such as fibroblasts and pericytes, as well as endothelial cells. Stromal cells provide structural support for organs, producing extracellular matrix proteins and basement membrane components.

[0063] Fibroblasts are the most common cells of connective tissue in animals. Fibroblasts produce the ECM's structural proteins (e.g., fibrous collagen and elastin), adhesive proteins (e.g., laminin and fibronectin), and ground substances (e.g., glycosaminoglycans, such as hyaluronan and glycoproteins). However, fibroblasts also play various additional roles beyond extracellular matrix (ECM) production. For example, fibroblasts play pivotal roles in ECM maintenance and reabsorption, wound healing, inflammation, angiogenesis, cancer progression, and in physiological as well as pathological tissue fibrosis. Fibroblasts are mesenchymal cells derived from the embryonic mesoderm tissue, and they are not terminally differentiated. They can be activated by a variety of chemical signals that promote proliferation and cellular differentiation to form myofibroblasts with an up-regulated rate of matrix production. Inventors have surprisingly discovered that fibroblasts in certain mammals have evolved differently, and in these mammals, can strongly resist invasion by other cells, including cancers, forming a barrier around invasive processes.

[0064] A population of isolated stromal cells that have been genetically engineered to reduce or eliminate expression one or more genes which confers permissivity to invasion in fibroblasts, or cancer associated fibroblasts (CAFs) are provided. In some forms the stromal cell is a fibroblast cell. When referring to cells, the “Isolated” means that the cell is at least substantially free from at least one other component with which they are naturally associated in nature.

[0065] The genetically engineered stromal cells such as fibroblast, are cells that have been transfected with at least one functional nucleic acid as disclosed herein for targeted reduction in expression of one or more INV-GOI i.e., the disclosed population of cells include one or more INV-GOI that have been engineered or modulated for reduced or no expression. The terms “genetically engineer,” “genetically modify, ’’and “genetically manipulate,” may be used interchangeably herein to refer to the direct artificial manipulation, modification, or recombination of DNA or other nucleic acid molecules in order to modify an organism, population of organisms, a cell or cells of an organism. More specifically, genetic engineering encompasses the set of technologies used to change the genetic makeup of cells, including the transfer of genetic material within and across species boundaries to produce improved or novel organisms. Likewise, the terms “modulated” or “engineered” is used herein indicate the involvement of the hand of human.

[0066] As used herein, “transformed” and “transfected” encompass the introduction of a nucleic acid molecule (e.g., a vector) into a cell by one of a number of techniques. Although not limited to a particular technique, a number of these techniques are well established within the art. The expression vectors containing the recombinant nucleic acids can be transfected into mammalian cells by techniques including, without limitation, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes and / or cationic polymers), non-chemical transformation methods (e.g., electroporation, optical transformation, gene electrotransfer and / or hydrodynamic delivery) and / or particle-based methods (e.g., impalefection, using a gene gun and / or magnetofection).

[0067] Physical methods for introducing an expression vector into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells including vectors and / or exogenous nucleic acids are well- known in the art. See, e.g., Sambrook et al. (2001), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. Chemical methods for introducing an expression vector into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

[0068] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0069] In an aspect, disclosed is a population of cells such as stromal cells that are genetically engineered to reduce or eliminate expression of one or more genes which confer permissivity to cancer invasion (INV-GOI).

[0070] In an embodiment, the one or more INV-GOI include at least one nucleotide truncated, or removed, or changed in comparison to the amino acid sequence of their natural counterpart.

[0071] In an embodiment, the gene is engineered such that at least one portion of the gene is truncated, or removed, or changed such that the gene product is not formed, or is dysfunctional, and the expression of the gene is reduced or eliminated. In certain embodiments, the one or more modulated / engineered genes are silenced.

[0072] The isolated genetically engineered cells (such as stromal cells) include at least one INV- GOI selected from the group consisting of ABHD2, ADCY7 AKAP13, ARHGEF11, ARRB1, ATG7, ATP1A1, ATP2B1, BAIAP2, BIRC6, BMP1, CBL, CCDC90B, CFAP46, CFLAR, CHRM2, CLASP1 , C0L7A1 , COL8A1 , CREB3L2, CREBBP, CSF3, CUL4B, CXCL8, DAPP1, DGKI, DNM2, DUSP22, DVL2, EGFR, ELM03, EPB41L5, ERBB2, EVC, F2R, FKBP5, FOXP1, GALT, GATA2, GFRA3, GMDS, GNB5, GRHL2, HECW2, HERC2, HERC4, HINFP, HM0X1, HTR2B, HUWE1, IL7R, INPP4B, IRF2, ITGA2, ITGA4, JDP2, JUN, KCNK1, KDM5A, LAMA1, MAFG, MANSC1, MCUR1, MDFI, MEGF8, MFSD2A, MICU2, MMP14, MMP17, MRPS10, MTMR3, NCSTN, NEK7, NFKB1, NUMA1, NUMBL, 0V0L2, 0XA1L, OXTR, PARD3, PARP12, PDE4B, PIEZO1, PIF1, PIK3C2A, PLCD3, PLCG1, PLXND1, PPL, PPP2R5C, PRG4, PRKAA, RCSD1, RECQL5, RGS9, RNF20, RTF1, SAMHD1, SEMA3A, SHC1, SLC18A2, SLC8B1, SMPD1, SNAI2, SOD2, SPINT2, SSTR1, TEK, TFDP1, TRIP12, UBE3C, VDR, WNK1, XRCC5, and ZBTB1, modulated for decreased expression or absence of expression.

[0073] In some forms, the one or more genes that are modulated have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the amino acid sequence of their natural counterpart.

[0074] In some forms, the genetically engineered stromal cells include at least one functional nucleic acid specific for the modulated INV-GOI, such as siRNA, shRNA, Antisense oligonucleotides (ASOs), or a CRISPER / CAS system including a gRNA specific for the INV- GOI.

[0075] In some forms, the isolated genetically engineered stromal cells include at least one INV-GOI selected from the group consisting of SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, VDR, AKAP13, ADCY7, CHRM2, PDE4B, PLCD3, ARRB 1, and ARHGEF11, modulated for decreased expression or absence of expression.

[0076] In some forms, the isolated genetically engineered stromal cells include at least one INV- GOI selected from the group consisting of SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, and VDR.

[0077] In an embodiment, the INV-GOI is SSTR1. In an embodiment, INV-GOI is ABHD2. In an embodiment, INV-GOI is ATP1A1. In an embodiment, the INV-GOI is ATP2B1. In an embodiment, the INV-GOI is CREB3L2. In an embodiment, the INV-GOI is F2R. In an embodiment, the INV-GOI is JDP2. In an embodiment, the INV-GO1 is NR2F6. In an embodiment, the INV-GOI is VDR.

[0078] In an embodiment, the one or more INV-GOI are modulated with guide RNA and the engineered cell includes gRNA specific for one or more INV-GOI and a CRISPR / cas enzyme, such as SpCas9, SaCas9, Casl2a, and functionally equivalent endonucleases. In some forms, the cells include an expression vector encoding the guide RNA (gRNA) and a nucleic acid encoding the CRISPR / cas enzyme.

[0079] Exemplary gRNA encoding sequences include the following sequences in the Table below, with the gene they target identified in the first column:

[0080] B. Formulations

[0081] The disclosed genetically engineered cells can be formulated as a pharmaceutical composition and into any of many possible forms of application, such as, but not limited to, encapsulation in a hydrogel, encapsulated in a biocompatible foam, encapsulated in a biocompatible construct, injected in a polymerizable construct, in a 3D formulated construct to fill cavity created by surgical removal of tumor, in the form of modified fibroblasts adhered to silicon, in the form of direct injection of cells suspended in aqueous solution, in the form of cell suspension in decellularized matrix, in the form of fibroblast suspension on a biomimetic construct, in the form of fibroblast suspension with other cells such as, but not limited to, macrophages, NK cells, vascular cells, mesenchymal stromal cells, adipocyte derived stromal cells.

[0082] The disclosed cells can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, emulsions or microemulsions, and enemas. The compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol or dextran. The suspension can also contain stabilizers. The pharmaceutical composition of the present disclosure may also include a pharmaceutical carrier or excipient.

[0083] “Pharmaceutical compositions” means compositions comprising at least one active agent, such as a compound or salt of Formula (I), and at least one other substance, such as a carrier. Pharmaceutical compositions meet the U.S. FDA’s GMP (good manufacturing practice) standards for human or non-human drugs.

[0084] “Carrier” means a diluent, excipient, or vehicle with which an active compound is administered. A “pharmaceutically acceptable carrier” means a substance, e.g., excipient, diluent, or vehicle, that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes a carrier that is acceptable for veterinary use as well as human pharmaceutical use. A “pharmaceutically acceptable carrier” includes both one and more than one such carrier.

[0085] III. Methods of Making and Using

[0086] In an aspect, disclosed is a modulation-based therapeutic strategy targeted to autologously obtained fibroblasts or stromal cells, specifically designed to address the challenge of solid cancer metastasis as shown and described herein. The strategy includes subject’s own fibroblasts which are genetically engineered, engineered to reduce or eliminate expression of a gene, enabling them to confine cancer from dissemination, and prevent or limit metastasis.

[0087] The methods may be performed ex vivo or in vivo. “Ex vivo” refers to methods conducted within or on cells or tissue in an artificial environment outside an organism with minimum alteration of natural conditions. In contrast, the term “in vivo” refers to a method that is conducted within living organisms in their normal, intact state, while an “in vitro” method is conducted using components of an organism that have been isolated from its usual biological context. When the cell is contacted with the composition in vivo, the composition may be administered to an animal, such as a mammal, particularly a human, using standard administration techniques and routes, such as those described herein. In some forms, the method includes (a) isolating stromal cells from biopsy of a healthy tissue, including but not limited to skin, breast, gut, or from the surgically removed cancer itself, (b) genetically engineering to silence one or more genes, and (c) administering the genetically engineered population of stromal cells to the location of the tumor in the subject, whereupon the transformed fibroblasts inhibits escape of cancer cells.

[0088] In an embodiment, the method includes: 1) isolating fibroblasts from a biopsy (for example from skin or any other tissue including the surgically removed cancer itself) of the subject; 2) sequencing the fibroblasts for RNA, and testing for their inherent potential to resist cancer via rapid in vitro and in vivo model of stromal invasion; 3) selecting genes based on fibroblast gene expression signature and their functional capacity to resist invasion; 4) geneediting selected genes; and 5) transplanting the fibroblasts autologously in the subject as shown and described herein. The fibroblasts isolated from patients will be sequenced (RNA), and tested in the platforms (Fig. 2 and Fig. 3) to assess their inherent capability to resist invasion, and to identify the best gene targeting approach (based on gene signature).

[0089] A. Methods of Making

[0090] Stromal cells such as fibroblasts are isolated from subject’s biopsy, for example, from either skin, breast, adipose or suitable other tissues, or the surgically excised tumor itself; expanded in vitro and transformed to resist invasion. In certain embodiments, the cells are sourced by a skin biopsy, breast tissue fibroblasts, surgically removed cancer tissue, cryopreserved tissue, or a combination thereof.

[0091] In certain embodiments, fibroblasts are obtained by differentiation of induced pluripotent stem cells (iPSCs) reprogrammed from patient’s cells (white blood cells, urinary epithelial cells, skin cells, or any other nucleated cell) to allow rapid expansion and cryopreservation for future usage.

[0092] The cells are genetically engineered to modulate (for example, knocked down or silenced, or overexpressed) one or more genes that are regulated in cancer-associated fibroblasts (CAFs). In an embodiment, the one or more genes that are engineered to reduce or eliminate expression, include:

[0093] ABHD2, ADCY7 AKAP13, ARHGEF11, ARRB1, ATG7, ATP1A1, ATP2B1, BAIAP2, BIRC6, BMP1, CBL, CCDC90B, CFAP46, CFLAR, CHRM2, CLASP1, C0L7A1, C0L8A1, CREB3L2, CREBBP, CSF3, CUL4B, CXCL8, DAPP1, DGKI, DNM2, DUSP22, DVL2, EGFR, ELM03, EPB41L5, ERBB2, EVC, F2R, FKBP5, F0XP1, GALT, GATA2, GFRA3, GMDS, GNB5, GRHL2, HECW2, HERC2, HERC4, HINFP, HM0X1, HTR2B, HUWE1, IL7R, INPP4B, IRF2, ITGA2, ITGA4, JDP2, JUN, KCNK1, KDM5A, LAMA1, MAFG, MANSC1, MCUR1, MDFI, MEGF8, MFSD2A, MICU2, MMP14, MMP17, MRPS10, MTMR3, NCSTN, NEK7, NFKB1, NUMA1, NUMBL, 0V0L2, OXAIL, OXTR, PARD3, PARP12, PDE4B, PIEZO1, PIF1, PIK3C2A, PLCD3, PLCG1, PLXND1, PPL, PPP2R5C, PRG4, PRKAA, RCSD1, RECQL5, RGS9, RNF20, RTF1, SAMHD1, SEMA3A, SHC1, SLC18A2, SLC8B1, SMPD1, SNAI2, SOD2, SPINT2, SSTR1, TEK, TFDP1, TRIP12, UBE3C, VDR, WNK1, XRCC5, and ZBTB1 (herein, “INV-GOI”) or a combination thereof.

[0094] One of ordinary skill in the art readily appreciates that a functional nucleic acid can be designed to specifically recognize / be complimentary to a coding sequence or regulatory domain of the one or more INV-GOI, to elicit reduced or no expression of the INV-COI so targeted.

[0095] In an embodiment, the one or more INV-GOI include: SSTR1, ABHD2, F2R, ATP1A1, ATP2B 1, CREB3L2, JDP2, NR2F6, VDR, AKAP13, ADCY7, CHRM2, PDE4B, PLCD3, ARRB 1 , ARHGEF11 , or a combination thereof.

[0096] In an embodiment, the one or more INV-GOI include SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, VDR, or a combination thereof.

[0097] In an embodiment, the GOI is SSTR1. In an embodiment, the GOI gene is AKAP13ABHD2. In an embodiment, the GOI gene is ADCY7ATP1A1. In an embodiment, the GOI is CHRM2ATP2B1. In an embodiment, the GOI is PDE4BCREB3L2. In an embodiment, the GOI is PLCD3F2R. In an embodiment, the GOI is ARRB1JDP2. In an embodiment, the GOI is NR2F6. In an embodiment, the GOI is VDR. In an embodiment, the one or more modulated / engineered genes include at least one nucleotide truncated, or removed, or changed in comparison to the amino acid sequence of their natural counterpart.

[0098] In an embodiment, the gene is engineered such that at least one portion of the gene is truncated, or removed, or changed such that the gene product is not formed, or is dysfunctional, and the expression of the gene is reduced or eliminated.

[0099] In certain embodiments, the one or more modulated / engineered genes are silenced.

[0100] In an embodiment, the one or more genes that are modulated has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the amino acid sequence of their natural counterpart.

[0101] In an embodiment, the one or more modulated / engineered genes are engineered with guide RNA.

[0102] In some forms, the composition includes one or more functional nucleic acids that inhibit the GOI.

[0103] In some forms the composition is a gene editing composition targeting the GOI. The gene editing composition can be one that induces a single or double strand break at a genetic locus in the GOI and reduces expression thereof. In an embodiment, gene editing or modulation is performed using a CRISPR / Cas system or method. In an embodiment, the gene editing or modulation is performed using siRNA, RNAi, CRISPR / Cas9, Casl2a, Casl3, Casl4, dCas9, Cas3, CasX and guide RNA (gRNA), or a combination thereof. As used herein, the term “CRISPR / Cas system” refers collectively to transcripts and other elements involved in the expression of and / or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, Cas protein, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or an active partial tracrRNA), a cr (CRISPR) sequence (e.g., crRNA or an active partial crRNA), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, type III or type IV CRISPR system. Any element of any suitable CRISPR / Cas gene editing system known in the art can be employed in the systems and methods described herein.

[0104] 1. Functional Nucleic acid inhibitors

[0105] The inhibitor can be a functional nucleic acid. Protein expression and / or activity of a desired protein can be inhibited using a functional nucleic acid (herein, inhibiting NA), or vector encoding the same, which reduces expression of the desired protein. Functional nucleic acids (FNAs) refer to those nucleic acids whose functions are beyond the conventional genetic roles of nucleic acids. As discussed in more detail below, functional nucleic acid molecules can be divided into the following non-limiting categories: antisense molecules, siRNA, miRNA, aptamers, ribozymes, triplex forming molecules, RNAi, external guide sequences, and other gene editing compositions. The functional nucleic acid molecules can act as effectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.

[0106] Functional nucleic acid molecules can interact with any macromolecule, such as DNA, RNA, polypeptides, or carbohydrate chains. Thus, functional nucleic acids can interact with the mRNA or the genomic DNA of a target polypeptide or they can interact with the polypeptide itself. Often functional nucleic acids are designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule. In other situations, the specific recognition between the functional nucleic acid molecule and the target molecule is not based on sequence homology between the functional nucleic acid molecule and the target molecule, but rather is based on the formation of tertiary structure that allows specific recognition to take place. Therefore the cells can include one or more functional nucleic acids designed to reduce expression of the GOI or a gene product thereof. For example, the functional nucleic acid or polypeptide can be designed to target and reduce or inhibit expression or translation of target molecule’s mRNA; or to reduce or inhibit expression, reduce activity, or increase degradation of target molecule protein. In some forms, the composition includes a vector suitable for expression of the functional nucleic acid. i. RNA Interference

[0107] In some embodiments, the functional nucleic acids induce gene silencing through RNA interference. Gene expression can also be effectively silenced in a highly specific manner through RNA interference (RNAi). This silencing was originally observed with the addition of double stranded RNA (dsRNA). Once dsRNA enters a cell, it is cleaved by an RNase III -like enzyme, Dicer, into double stranded small interfering RNAs (siRNA) 21-23 nucleotides in length that contains 2 nucleotide overhangs on the 3’ ends. In an ATP dependent step, the siRNAs become integrated into a multi-subunit protein complex, commonly known as the RNAi induced silencing complex (RISC), which guides the siRNAs to the target RNA sequence. At some point the siRNA duplex unwinds, and it appears that the antisense strand remains bound to RISC and directs degradation of the complementary mRNA sequence by a combination of endo and exonucleases. However, the effect of iRNA or siRNA or their use is not limited to any type of mechanism.

[0108] Short Interfering RNA (siRNA) is a double-stranded RNA that can induce sequencespecific post-transcriptional gene silencing, thereby decreasing or even inhibiting gene expression. In one example, a siRNA triggers the specific degradation of homologous RNA molecules, such as mRNAs, within the region of sequence identity between both the siRNA and the target RNA. For example, WO 02 / 44321 discloses siRNAs capable of sequence-specific degradation of target mRNAs when base-paired with 3' overhanging ends, herein incorporated by reference for the method of making these siRNAs.

[0109] Sequence specific gene silencing can be achieved in mammalian cells using synthetic, short double-stranded RNAs that mimic the siRNAs produced by the enzyme dicer. siRNA can be chemically or in vztro-synthesized or can be the result of short double-stranded hairpin-like RNAs (shRNAs) that are processed into siRNAs inside the cell. Synthetic siRNAs are generally designed using algorithms and a conventional DNA / RNA synthesizer. Suppliers include Ambion (Austin, Texas), ChemGenes (Ashland, Massachusetts), Dharmacon (Lafayette, Colorado), Glen Research (Sterling, Virginia), MWB Biotech (Esbersberg, Germany), Proligo (Boulder, Colorado), and Qiagen (Vento, The Netherlands). siRNA can also be synthesized in vitro using kits such as Ambion’s SILENCER® siRNA Construction Kit.

[0110] The production of siRNA from a vector is more commonly done through the transcription of a short hairpin RNAse (shRNAs). Kits for the production of vectors having shRNA are available, such as, for example, Imgenex’s GENESUPPRESSOR™ Construction Kits and Invitrogen’s BLOCK-TT™ inducible RNAi plasmid and lentivirus vectors.

[0111] In some embodiment, the functional nucleic acid is siRNA, shRNA, miRNA. In some embodiments, the composition includes a vector expressing the functional nucleic acid. Methods of making and using vectors for in vivo expression of functional nucleic acids such as antisense oligonucleotides, siRNA, shRNA, miRNA, EGSs, ribozymes, and aptamers are known in the art. ii. Antisense

[0112] The GOI expression can be reduced using can be antisense molecules. Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNAse H mediated RNA-DNA hybrid degradation. Alternatively, the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. There are numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule. Exemplary methods include in vitro selection experiments and DNA modification studies using DMS and DEPC. It is preferred that antisense molecules bind the target molecule with a dissociation constant (Kd) less than or equal to about IO’6, IO’8, IO10, or IO12.

[0113] An “antisense” nucleic acid sequence (antisense oligonucleotide) can include a nucleotide sequence that is complementary to a “sense” nucleic acid encoding a protein, e.g. , complementary to the TRF2. Antisense nucleic acid sequences and delivery methods are well known in the art. The antisense nucleic acid can be complementary to an entire coding strand of a target sequence, or to only a portion thereof. An antisense oligonucleotide can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more nucleotides in length.

[0114] An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. The antisense nucleic acid also can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).

[0115] Other examples of useful antisense oligonucleotides (AONs / ASOs) include an alpha- anomeric nucleic acid. An alpha- anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual beta-units, the strands run parallel to each other. The antisense nucleic acid molecule can also comprise a 2’-o- methylribonucleotide or a chimeric RNA-DNA analogue (. iii. Triplex forming molecules

[0116] GOI expression can be reduced using triplex forming molecules. Triplex forming functional nucleic acid molecules are molecules that can interact with either double-stranded or single-stranded nucleic acid. When triplex molecules interact with a target region, a structure called a triplex is formed in which there are three strands of DNA forming a complex dependent on both Watson-Crick and Hoogsteen base-pairing. Triplex molecules are preferred because they can bind target regions with high affinity and specificity. It is preferred that the triplex forming molecules bind the target molecule with a Kd less than 10-6, 10-8, 10-10, or 10-12. iv. External guide sequences

[0117] GOI expression RNA expression can be reduced using external guide sequences. External guide sequences (EGSs) are molecules that bind a target nucleic acid molecule forming a complex, which is recognized by Rnase P, which then cleaves the target molecule. EGSs can be designed to specifically target a RNA molecule of choice. RNAse P aids in processing transfer RNA (tRNA) within a cell. Bacterial RNAse P can be recruited to cleave virtually any RNA sequence by using an EGS that causes the target RNA:EGS complex to mimic the natural tRNA substrate. Similarly, eukaryotic EGS / RNAse P-directed cleavage of RNA can be utilized to cleave desired targets within eukaryotic cells. Representative examples of how to make and use EGS molecules to facilitate cleavage of a variety of different target molecules are known in the art. v. Aptamers

[0118] The functional nucleic acids can be aptamers. Aptamers are molecules that interact with a target molecule, preferably in a specific way. Typically aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stemloops or G-quartets. Aptamers can bind small molecules, such as ATP and theophiline, as well as large molecules, such as reverse transcriptase and thrombin. Aptamers can bind very tightly with Kd’s from the target molecule of less than about 1012M. It is preferred that the aptamers bind the target molecule with a Kd less than about 10"6, 10’8, 1 O’10, or 1012. Aptamers can bind the target molecule with a very high degree of specificity. For example, aptamers have been isolated that have greater than a 10,000 fold difference in binding affinities between the target molecule and another molecule that differ at only a single position on the molecule. It is preferred that the aptamer have a Kd with the target molecule at least 10, 100, 1000, 10,000, or 100,000 fold lower than the Kd with a background binding molecule. It is preferred when doing the comparison for a molecule such as a polypeptide, that the background molecule be a different polypeptide. vi. Ribozymes

[0119] The functional nucleic acids can be ribozymes. Ribozymes are nucleic acid molecules that are capable of catalyzing a chemical reaction, either intramolecularly or intermolecularly. It is preferred that the ribozymes catalyze intermolecular reactions. There are a number of different types of ribozymes that catalyze nuclease or nucleic acid polymerase type reactions which are based on ribozymes found in natural systems, such as hammerhead ribozymes. There are also a number of ribozymes that are not found in natural systems, but which have been engineered to catalyze specific reactions de novo. Preferred ribozymes cleave RNA or DNA substrates, and more preferably cleave RNA substrates. Ribozymes typically cleave nucleic acid substrates through recognition and binding of the target substrate with subsequent cleavage. This recognition is often based mostly on canonical or non-canonical base pair interactions. This property makes ribozymes particularly good candidates for target specific cleavage of nucleic acids because recognition of the target substrate is based on the target substrates sequence. vii. Other Gene Editing Compositions

[0120] In some embodiments the functional nucleic acids are gene editing compositions. Gene editing compositions can include nucleic acids that encode an element or elements that induce a single or a double strand break in the target cell’s genome, and optionally a polynucleotide. The compositions can be used, for example, to reduce or otherwise modify expression of the GOI. a. Strand Break Inducing Elements CRISPR / Cas

[0121] In some embodiments, the element that induces a single or a double strand break in the target cell’s genome is a CRISPR / Cas system. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is an acronym for DNA loci that contain multiple, short, direct repetitions of base sequences. The prokaryotic CRISPR / Cas system has been adapted for use as gene editing (silencing, enhancing or changing specific genes) for use in eukaryotes. By transfecting a cell with the required elements including a Cas gene and specifically designed CRISPRs, the organism's genome can be cut and modified at any desired location. Methods of preparing compositions for use in genome editing using the CRISPR / Cas systems are described in detail in WO 2013 / 176772 and WO 2014 / 018423, which are specifically incorporated by reference herein in their entireties.

[0122] In general, “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. One or more tracr mate sequences operably linked to a guide sequence (e.g., direct repeat-spacer-direct repeat) can also be referred to as pre-crRNA (pre-CRISPR RNA) before processing or crRNA after processing by a nuclease.

[0123] In some embodiments, a tracrRNA and crRNA are linked and form a chimeric crRNA- tracrRNA hybrid where a mature crRNA is fused to a partial tracrRNA via a synthetic stem loop to mimic the natural crRNA:tracrRNA duplex. A single fused crRNA-tracrRNA construct can also be referred to as a guide RNA or gRNA (or single-guide RNA (sgRNA)). Within an sgRNA, the crRNA portion can be identified as the ‘target sequence’ and the tracrRNA is often referred to as the ‘scaffold’.

[0124] In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism including an endogenous CRISPR system, such as Streptococcus pyogenes.

[0125] In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence can be any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In the target nucleic acid, each protospacer is associated with a protospacer adjacent motif (PAM) whose recognition is specific to individual CRISPR systems. In the Streptococcus pyogenes CRISPR / Cas system, the PAM is the nucleotide sequence NGG. In the Streptococcus thermophiles CRISPR / Cas system, the PAM is the nucleotide sequence is NNAGAAW. The tracrRNA duplex directs Cas to the DNA target consisting of the protospacer and the requisite PAM via heteroduplex formation between the spacer region of the crRNA and the protospacer DNA.

[0126] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (including a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. All or a portion of the tracr sequence may also form part of a CRISPR complex, such as by hybridization to all or a portion of a tracr mate sequence that is operably linked to the guide sequence.

[0127] There are many resources available for helping practitioners determine suitable target sites once a desired DNA target sequence is identified. For example, numerous public resources, including a bioinformatically generated list of about 190,000 potential sgRNAs, targeting more than 40% of human exons, are available to aid practitioners in selecting target sites and designing the associate sgRNA to affect a nick or double strand break at the site. See also, crispr.u-psud.fr / , a tool designed to help scientists find CRISPR targeting sites in a wide range of species and generate the appropriate crRNA sequences.

[0128] In some embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a target cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5' with respect to (“upstream” of) or 3' with respect to (“downstream” of) a second element. The coding sequence of one element can be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter.

[0129] In some embodiments, a vector includes one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a “cloning site”). In some embodiments, one or more insertion sites (e.g., about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) are located upstream and / or downstream of one or more sequence elements of one or more vectors. In some embodiments, a vector includes an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell. In some embodiments, a vector includes two or more insertion sites, each insertion site being located between two tracr mate sequences so as to allow insertion of a guide sequence at each site. In such an arrangement, the two or more guide sequences can include two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these. When multiple different guide sequences are used, a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell. For example, a single vector can include about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 guide sequences. In some embodiments, about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, such guide-sequence-containing vectors may be provided, and optionally delivered to a cell.

[0130] In some embodiments, a vector includes a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein.

[0131] Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologues thereof, or modified versions thereof. In some embodiments, the unmodified CRISPR enzyme has DNA cleavage activity, such as Cas9. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.

[0132] In some embodiments, a vector encodes a CRISPR enzyme that is mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10 A) in the RuvC I catalytic domain of Cas9 from S'. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). Other examples of mutations that render Cas9 a nickase include, without limitation, H840A, N854A, and N863A. As a further example, two or more catalytic domains of Cas9 (RuvC I, RuvC II, and RuvC III) can be mutated to produce a mutated Cas9 substantially lacking all DNA cleavage activity. In some embodiments, a D10A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity. In some embodiments, a CRISPR enzyme is considered to substantially lack all DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%>, 1%>, 0.1 %>, 0.01%, or lower with respect to its non-mutated form.

[0133] In some embodiments, an enzyme coding sequence encoding a CRISPR enzyme is codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells can be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules.

[0134] The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database”, and these tables can be adapted in a number of ways. See Nakamura, et al., Nucl. Acids Res., 28:292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell, for example Gene Forge (Aptagen; Jacobus, PA), are also available. In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.

[0135] In some embodiments, a vector encodes a CRISPR enzyme including one or more nuclear localization sequences (NLSs). When more than one NLS is present, each may be selected independently of the others, such that a single NLS may be present in more than one copy and / or in combination with one or more other NLSs present in one or more copies. In some embodiments, an NLS is considered near the N- or C-terminus when the nearest amino acid of the NLS is within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, or more amino acids along the polypeptide chain from the N-or C-terminus.

[0136] In general, the one or more NLSs are of sufficient strength to drive accumulation of the CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell. In general, strength of nuclear localization activity may derive from the number of NLSs in the CRISPR enzyme, the particular NLS(s) used, or a combination of these factors.

[0137] Detection of accumulation in the nucleus may be performed by any suitable technique. For example, a detectable marker may be fused to the CRISPR enzyme, such that location within a cell may be visualized, such as in combination with a means for detecting the location of the nucleus (e.g., a stain specific for the nucleus such as DAPI). Cell nuclei may also be isolated from cells, the contents of which may then be analyzed by any suitable process for detecting protein, such as immunohistochemistry, Western blot, or enzyme activity assay. Accumulation in the nucleus may also be determined indirectly, such as by an assay for the effect of CRISPR complex formation (e.g., assay for DNA cleavage or mutation at the target sequence, or assay for altered gene expression activity affected by CRISPR complex formation and / or CRISPR enzyme activity), as compared to a control no exposed to the CRISPR enzyme or complex, or exposed to a CRISPR enzyme lacking the one or more NLSs.

[0138] In some embodiments, one or more of the elements of CRISPR system are under the control of an inducible promoter, which can include inducible Cas, such as Cas9.

[0139] A CRISPR system utilized in the methods disclosed herein can be encoded within a vector system which can include one or more vectors which can include a first regulatory element operably linked to a CRISPR / Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence includes (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell, (b) a tracr mate sequence, and (c) a tracr sequence; and a second regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme which can optionally include at least one or more nuclear localization sequences. Elements (a), (b) and (c) can arranged in a 5' to 3 orientation, wherein components I and II are located on the same or different vectors of the system, wherein when transcribed, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of a CRISPR complex to the target sequence, and wherein the CRISPR complex can include the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence, wherein the enzyme coding sequence encoding the CRISPR enzyme further encodes a heterologous functional domain. In some embodiment, one or more of the vectors encodes also encodes a suitable Cas enzyme, for example, Cas9. The different genetic elements can be under the control of the same or different promoters.

[0140] While the specifics can be varied in different engineered CRISPR systems, the overall methodology is similar. A practitioner interested in using CRISPR technology to target a DNA sequence (such as Brd9, Ankibl, Cacngl, and Gt 13 (Cfap20)) can insert a short DNA fragment containing the target sequence into a guide RNA expression plasmid. The sgRNA expression plasmid contains the target sequence (about 20 nucleotides), a form of the tracrRNA sequence (the scaffold) as well as a suitable promoter and necessary elements for proper processing in eukaryotic cells. Such vectors are commercially available (see, for example, Addgene). Many of the systems rely on custom, complementary oligos that are annealed to form a double stranded DNA and then cloned into the sgRNA expression plasmid. Co-expression of the sgRNA and the appropriate Cas enzyme from the same or separate plasmids in transfected cells results in a single or double strand break (depending of the activity of the Cas enzyme) at the desired target site.

[0141] The nuclease activity of the genome editing systems described herein cleave target DNA to produce single or double strand breaks in the target DNA. Double strand breaks can be repaired by the cell in one of two ways: non-homologous end joining, and homology- directed repair. In non-homologous end joining (NHEJ), the double-strand breaks are repaired by direct ligation of the break ends to one another. As such, no new nucleic acid material is inserted into the site, although some nucleic acid material may be lost, resulting in a deletion. In homology-directed repair, a donor polynucleotide with homology to the cleaved target DNA sequence is used as a template for repair of the cleaved target DNA sequence, resulting in the transfer of genetic information from a donor polynucleotide to the target DNA. As such, new nucleic acid material can be inserted / copied into the site. Therefore, in some embodiments, the genome editing composition optionally includes a donor polynucleotide. The modifications of the target DNA due to NHEJ and / or homology- directed repair can be used to induce gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, gene mutation, etc.

[0142] Accordingly, cleavage of DNA by the genome editing composition can be used to delete nucleic acid material from a target DNA sequence by cleaving the target DNA sequence and allowing the cell to repair the sequence in the absence of an exogenously provided donor polynucleotide. Thus, the subject methods can be used to knock out a gene (resulting in complete lack of transcription or altered transcription) or to knock in genetic material into a locus of choice in the target DNA.

[0143] Alternatively, if the genome editing composition includes a donor polynucleotide sequence that includes at least a segment with homology to the target DNA sequence, the methods can be used to add, i.e., insert or replace, nucleic acid material to a target DNA sequence (e.g., to “knock in” a nucleic acid that encodes for a protein, an siRNA, an miRNA, etc.), to add a tag (e.g., 6xHis, a fluorescent protein (e.g., a green fluorescent protein; a yellow fluorescent protein, etc.), hemagglutinin (HA), FLAG, etc.), to add a regulatory sequence to a gene (e.g., promoter, polyadenylation signal, internal ribosome entry sequence (IRES), 2A peptide, start codon, stop codon, splice signal, localization signal, etc.), to modify a nucleic acid sequence (e.g., introduce a mutation), and the like. As such, the compositions can be used to modify DNA in a site- specific, i.e., “targeted”, way, for example gene knock-out, gene knock- in, gene editing, gene tagging, etc. as used in, for example, gene therapy.

[0144] In applications in which it is desirable to insert a polynucleotide sequence into a target DNA sequence, a polynucleotide including a donor sequence to be inserted is also provided to the cell. By a “donor sequence” or “donor polynucleotide” or “donor oligonucleotide” it is meant a nucleic acid sequence to be inserted at the cleavage site. The donor polynucleotide typically contains sufficient homology to a genomic sequence at the cleavage site, e.g., 70%, 80%, 85%, 90%, 95%, or 100% homology with the nucleotide sequences flanking the cleavage site, e.g., within about 50 bases or less of the cleavage site, e.g., within about 30 bases, within about 15 bases, within about 10 bases, within about 5 bases, or immediately flanking the cleavage site, to support homology-directed repair between it and the genomic sequence to which it bears homology. The donor sequence is typically not identical to the genomic sequence that it replaces. Rather, the donor sequence may contain at least one or more single base changes, insertions, deletions, inversions or rearrangements with respect to the genomic sequence, so long as sufficient homology is present to support homology-directed repair. In some embodiments, the donor sequence includes a non-homologous sequence flanked by two regions of homology, such that homology-directed repair between the target DNA region and the two flanking sequences results in insertion of the non-homologous sequence at the target region.

[0145] Donor sequences can also include a vector backbone containing sequences that are not homologous to the DNA region of interest and that are not intended for insertion into the DNA region of interest. Generally, the homologous region(s) of a donor sequence will have at least 50% sequence identity to a genomic sequence with which recombination is desired. In certain embodiments, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 99.9% sequence identity is present. Any value between 1% and 100% sequence identity can be present, depending upon the length of the donor polynucleotide.

[0146] The donor sequence can include certain sequence differences as compared to the genomic sequence, e.g., restriction sites, nucleotide polymorphisms, selectable markers (e.g., drug resistance genes, fluorescent proteins, enzymes etc.), etc., which can be used to assess for successful insertion of the donor sequence at the cleavage site or in some cases may be used for other purposes (e.g., to signify expression at the targeted genomic locus). In some cases, if located in a coding region, such nucleotide sequence differences will not change the amino acid sequence, or will make silent amino acid changes (i.e., changes which do not affect the structure or function of the protein). Alternatively, these sequences differences may include flanking recombination sequences such as FLPs, loxP sequences, or the like, that can be activated at a later time for removal of the marker sequence.

[0147] The donor sequence can be a single- stranded DNA, single- stranded RNA, doublestranded DNA, or double-stranded RNA. It can be introduced into a cell in linear or circular form. If introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonucleolytic degradation) by methods known to those of skill in the art. For example, one or more dideoxynucleotide residues are added to the 3' terminus of a linear molecule and / or self- complementary oligonucleotides are ligated to one or both ends. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphor amidates, and O-methyl ribose or deoxyribose residues.

[0148] As an alternative to protecting the termini of a linear donor sequence, additional lengths of sequence can be included outside of the regions of homology that can be degraded without impacting recombination. A donor sequence can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance. b. Zinc Finger Nucleases

[0149] In some embodiments, the element that induces a single or a double strand break in the target cell’s genome is a nucleic acid construct or constructs encoding a zinc finger nucleases (ZFNs). ZFNs are typically fusion proteins that include a DNA-binding domain derived from a zinc-finger protein linked to a cleavage domain.

[0150] The most common cleavage domain is the Type ITS enzyme Fokl. Fokl catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, U.S. Pat. Nos. 5,356,802; 5,436, 150 and 5,487,994). One or more of these enzymes (or enzymatically functional fragments thereof) can be used as a source of cleavage domains.

[0151] The DNA-binding domain, which can, in principle, be designed to target any genomic location of interest, can be a tandem array of CyszHisz zinc fingers, each of which generally recognizes three to four nucleotides in the target DNA sequence. The CysjHisi domain has a general structure: Phe (sometimes Tyr)-Cys-(2 to 4 amino acids)-Cys-(3 amino acids)- Phe(sometimes Tyr)-(5 amino acids)-Leu-(2 amino acids)-His-(3 amino acids)-His. By linking together multiple fingers (the number varies: three to six fingers have been used per monomer in published studies), ZFN pairs can be designed to bind to genomic sequences 18-36 nucleotides long.

[0152] Engineering methods include, but are not limited to, rational design and various types of empirical selection methods. Rational design includes, for example, using databases including triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, U.S. Pat. Nos. 6, 140,081; 6,453,242; 6,534,261; 6,610,512; 6,746,838; 6,866,997; 7,067,617; U.S. Published Application Nos. 2002 / 0165356; 2004 / 0197892; 2007 / 0154989; 2007 / 0213269; and International Patent Application Publication Nos. WO 98 / 53059 and WO 2003 / 016496. c. Transcription Activator-Like Effector Nucleases

[0153] In some embodiments, the element that induces a single or a double strand break in the target cell’s genome is a nucleic acid construct or constructs encoding a transcription activatorlike effector nuclease (TALEN). TALENs have an overall architecture similar to that of ZFNs, with the main difference that the DNA-binding domain comes from TAL effector proteins, transcription factors from plant pathogenic bacteria. The DNA-binding domain of a TALEN is a tandem array of amino acid repeats, each about 34 residues long. The repeats are very similar to each other; typically they differ principally at two positions (amino acids 12 and 13, called the repeat variable diresidue, or RVD). Each RVD specifies preferential binding to one of the four possible nucleotides, meaning that each TALEN repeat binds to a single base pair, though the NN RVD is known to bind adenines in addition to guanine. TAL effector DNA binding is mechanistically less well understood than that of zinc-finger proteins, but their seemingly simpler code could prove very beneficial for engineered-nuclease design. TALENs also cleave as dimers, have relatively long target sequences (the shortest reported so far binds 13 nucleotides per monomer) and appear to have less stringent requirements than ZFNs for the length of the spacer between binding sites. Monomeric and dimeric TALENs can include more than 10, more than 14, more than 20, or more than 24 repeats.

[0154] Methods of engineering TAL to bind to specific nucleic acids are described in Cermak, et al, Nucl. Acids Res. 1-11 (2011). US Published Application No. 2011 / 0145940, which discloses TAL effectors and methods of using them to modify DNA. Miller et al. Nature Biotechnol 29: 143 (2011) reported making TALENs for site-specific nuclease architecture by linking TAL truncation variants to the catalytic domain of Fokl nuclease. The resulting TALENs were shown to induce gene modification in immortalized human cells. General design principles for TALE binding domains can be found in, for example, WO 2011 / 072246.

[0155] 2. Expression Vectors

[0156] Nucleic acid inhibitors can be inserted into vectors for expression in cells. Methods for delivering nucleic acid payloads are known in the art (reviewed in Paunovska, et al. Nat. Rev. Gen, 23:265-280 (2022).

[0157] As used herein, a “vector” is a replicon, such as a plasmid, phage, virus or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Vectors can be expression vectors. In eukaryotes the term “expression vector” refers to a vector that includes one or more expression control sequences regardless of the origin of the sequence (prokaryote or eukaryote). Nucleic acids in vectors can be operably linked to one or more expression control sequences. The term “expression control sequence” refers to a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence. Control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, a ribosome binding site, and the like. For example, the control sequence can be incorporated into a genetic construct so that expression control sequences effectively control expression of a coding sequence of interest.

[0158] Suitable expression vectors include, without limitation, plasmids and viral vectors derived from, for example, bacteriophage, baculoviruses, tobacco mosaic virus, herpes viruses, cytomegalo virus, retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen Life Technologies (Carlsbad, CA). Recent transfection studies have investigated minicircle DNA (mcDNA), nucleic acids that are derived from pDNA by recombination that removes bacterial sequences. The recombinant nucleic acids can be introduced into host cells using mcDNA using methods known in the art (Mun et al. Biomaterials, 2016;101:310-320).

[0159] Nonviral vectors for oligonucleotide delivery include inorganic material-based delivery systems, lipid based nanocarriers, polymeric vectors, for example, poly(lactide-co-glycolide) (PLGA) is a copolymer of poly lactic acid (PLA) and poly glycolic ac 3D scaffold-based delivery systems, chitosan, dendrimer based vectors, cell derived membrane vesicles and 3D scaffold-based delivery systems (reviewed in Fu, et al., ExRNA 1, 24 (2019). https : / / doi.org / 10.1186 / s41544-019-0024-y).

[0160] The expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., U.S. Pat. No. 6,326,193). Exemplary viral vectors include but are not limited to lentiviral vector, an Adeno-associated virus (AAV) vector, or an adenovirus vector, or a Herpes Simplex virus (HSV) vector, or a vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV), or a chimeric vector containing a combination of any two or more of an Adeno-associated virus (AAV) vector, Herpes Simplex virus (HSV) vector, vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV).

[0161] Adenovirus expression vectors are based on adenoviruses, which have a low capacity for integration into genomic DNA but are highly efficient for transfecting host cells. Adenovirus expression vectors contain adenovirus sequences sufficient to: (a) support packaging of the expression vector and (b) to ultimately express the recombinant nucleic acids in the host cell. In some embodiments, the adenovirus genome is a 36 kb, linear, double stranded DNA, where a foreign DNA sequence (e.g., a nucleic acid for generating the expression system) may be inserted to substitute large pieces of adenoviral DNA in order to make the expression vector (see, e.g., Danthinne and Imperiale, Gene Therapy (2000) 7(20): 1707-1714). Another expression vector is based on an adeno associated virus, which takes advantage of the adenovirus coupled systems. This AAV expression vector has a high frequency of integration into the host genome. It can infect non-dividing cells, thus making it useful for delivery of genes into mammalian cells, for example, in tissue cultures or in vivo. The AAV vector has a broad host range for infectivity. Details concerning the generation and use of AAV vectors are described in U.S. Pat. Nos. 5,139,941 and 4,797,368, which are incorporated herein in their entireties.

[0162] Retrovirus expression vectors are capable of integrating into the host genome, delivering a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and being packaged in special cell lines. The retrovirus vector is constructed by inserting a nucleic acid (e.g., the recombinant nucleic acids for generating the expression system) into the viral genome at certain locations to produce a virus that is replication defective. Though the retrovirus vectors are able to infect a broad variety of cell types, integration and stable expression of the recombinant nucleic acids, requires the division of host cells.

[0163] Lentivirus vectors are derived from lentiviruses, which are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function (see, e.g., U.S. Pat. Nos. 6,013,516 and 5,994,136). Some examples of lentiviruses include the Human Immunodeficiency Viruses (HIV-1, HIV-2) and the Simian Immunodeficiency Virus (SIV). Lentivirus vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef are deleted making the vector biologically safe. Lentivirus vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression, e.g., of the recombinant nucleic acids (see, e.g., U.S. Pat. No. 5,994,136).

[0164] An expression vector can include a selectable marker, an origin of replication, and other features that provide for replication and / or maintenance of the vector. Large numbers of suitable vectors and promoters are known to those of skill in the art; many are commercially available for generating a recombinant construct. Exemplary vectors include but are not limited pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden), pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene) pSVK3, pBPV, pMSG and pSVL (Pharmacia). Physical transduction techniques can also be used, such as liposome delivery and receptor-mediated and other endocytosis mechanisms. For example in some embodiments, the functional nucleic acid inhibitor is delivered via a liposome. Commercially available liposome preparations such as LIPOFECTIN, LIPOFECT AMINE (GIBCO-BRL, Inc., Gaithersburg, Md.), SUPERFECT (Qiagen, Inc. Hilden, Germany) TRANSFECTAM (Promega Biotec, Inc., Madison, Wis.), CELLFECTIN®, DMRIE-C, DMRIE, DOTAP, DOSPA, and DOSPER, and dendrimer compositions, particularly G5-G10 dendrimers, including dense star dendrimers, PAMAM dendrimers, grafted dendrimers, and dendrimers known as dendrigrafts and SUPERFECT®. as well as other liposomes developed according to procedures standard in the art are well known. In addition, the disclosed nucleic acid or vector can be delivered by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, Calif.) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Tucson, Ariz.). This disclosed compositions and methods can be used in conjunction with any of these or other commonly used gene transfer methods.

[0165] B. Methods of Using

[0166] In an aspect, disclosed is a method for treating cancer in a subject, the method including administering to a subject in need thereof, an effective amount of a functional nucleic acid to reduce or eliminate expression of one or more INV-GOI. In an embodiment, the subject is administered a functional nucleic acid specific for one or more INV-GOI: SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, VDR, AKAP13, ADCY7, CHRM2, PDE4B, PLCD3, ARRB1, ARHGEF11, or a combination thereof. In an embodiment, the subject is administered a functional nucleic acid specific for or more INV-GOI: SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, VDR.

[0167] In an aspect, disclosed is a method for treating cancer in a subject, the method including: transplanting genetically modified stromal cells as disclosed herein to a tumor site, with or without a carrier, in an effective amount to reduce cancer metastasis or reduce the progression of cancer in the subject.

[0168] Effective amounts may vary depending upon the biological effect desired in the individual, condition to be treated, and / or the specific characteristics of the composition according to the present invention and the individual. In this respect, any suitable dose of the composition can be administered to the patient (e.g., human), according to the type of disease to be treated. Various general considerations taken into account in determining the “effective amount” are known to those of skill in the art and are described, e.g., in Gilman et al., eds., Goodman And Gilman’s: The Pharmacological Bases of Therapeutics, 8th ed., Pergamon Press, 1990; and Remington’s Pharmaceutical Sciences, 17th Ed., Mack Publishing Co., Easton, Pa., 1990, each of which is herein incorporated by reference.

[0169] In an embodiment, the subject or patient is a human subject or a human patient, such as a human being treated or assessed for a disease, disorder or condition, a human at risk for a disease, disorder or condition, a human having a disease, disorder or condition, and / or human being treated for a disease, disorder or condition as described herein. In one embodiment, the subject is about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years of age. In another embodiment, the subject is about 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, 90-95, 95-100 years of age. Values and ranges intermediate to the above recited ranges are also intended to be part of this invention. In addition, ranges of values using a combination of any of the above-recited values as upper and / or lower limits are intended to be included. As used herein, a subject is “in need of treatment” if such subject would benefit biologically, medically, or in quality of life from such treatment. A subject in need of treatment does not necessarily present symptoms, particular in the case of preventative or prophylaxis treatments. The terms “subject” and “patient” are used interchangeably herein. The term “subject” also refers to an organism, tissue, cell, or collection of cells from a subject.

[0170] In some forms, the method includes a targeted gene-editing methodology, enhancing the resilience of subject’s own stromal fibroblasts to enable them to confine cancer from dissemination, and prevent or limit metastasis.

[0171] The population of genetically engineered stromal cells such as fibroblasts described herein can be administered to the microenvironment of a cancerous tumor (e.g., a cancerous tumor in a human or animal subject) using any suitable administration techniques, including but are not limited to intratumoral, image-guided catheter, ultrasound guided delivery system, tattoo machine, subdermal cell delivery patch, delivery by slow digestion of biomaterials, surgical filling of hydrogel containing cells, oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration. The composition preferably is suitable for parenteral administration. The term “parenteral,” as used herein, includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. Preferably, the composition is administered using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection. In certain embodiments, the administration or delivery of compositions and / or population of fibroblasts is achieved by electroporation, adenoviral particles (AAVs), zinc finger-based editing, TALEN, ARK bridge, or a combination thereof. In certain embodiments, the administration or delivery of compositions and / or population of fibroblasts is achieved by electroporation, adenoviral particles (AAVs), TALEN, ARK bridge, or zinc finger-based editing.

[0172] In certain embodiments, the compositions or populations of fibroblasts described herein may be targeted to specific tumor sites or tumor cell populations. Tumor-specific drug targeting methods are known in the art and may be used in connection with the present disclosure. Such targeting methods include, for example, (i) passive targeting based on the specific features of tumor vasculature, (ii) active targeting with specific binding of an antitumor agent (e.g., the compositions or engineered fibroblasts described herein) with its molecular target, and (iii) cell- mediated tumor targeting. It will be appreciated that passive targeting is associated with the structural features of the tumor vasculature, while active targeting typically involves covalent or non-covalent binding of an antitumor agent (e.g., the compositions or engineered fibroblasts described herein) to a molecule which is capable of selective interaction with specific molecules on the surface of target cells. Cell-mediated tumor targeting involves drug delivery by cells which possess preferential tropism to a tumor type.

[0173] In some forms, cells genetically engineered cells as disclosed herein, are transplanted at the site of primary tumor creating a barrier against cancer dissemination.

[0174] In an embodiment the method includes modulating the extracellular matrix (ECM) remodeling in the microenvironment of a cancerous tumor, which includes administering the disclosed composition into the stromal microenvironment of cancer, thereby inhibiting ECM remodeling in the microenvironment of the cancerous tumor. Thus, the disclosure also provides a method of inhibiting progression of a cancerous tumor, which includes administering an effective amount of the disclosed compositions the microenvironment of a cancerous tumor. The term “extracellular matrix (ECM),” as used herein, refers to the non-cellular component present within all tissues and organs, which provides not only essential physical scaffolding for the cellular constituents but also initiates biochemical and biomechanical cues that are required for tissue morphogenesis, differentiation, and homeostasis. The ECM includes a three-dimensional network of extracellular macromolecules, such as collagen, enzymes, and glycoproteins. ECM remodeling in the tumor microenvironment (TME) by different solid cancers, including but not limited to colorectal cancer (CRC), breast cancer, pancreatic, lung, and melanoma is known to be associated with tumor progression, and CAFs have been shown to remodel the tumor microenvironment to promote efficient metastasis.

[0175] The term “tumor,” as used herein, refers to an abnormal mass of tissue that results when cells divide more than they should or do not die when they should. In the context of the present disclosure, the term tumor may refer to tumor cells and tumor-associated stromal cells or tissue (i.e., the tumor “microenvironment”). Tumors may be benign and non-cancerous if they do not invade nearby tissue or spread to other parts of the organism. In contrast, the terms “cancerous tumor,” “malignant tumor,” “cancer,” and “cancer cells” may be used interchangeably herein to refer to a tumor comprising cells that divide uncontrollably and can invade nearby tissues. Cancer cells also can spread or “metastasize” to other parts of the body through the blood and lymph systems. The cancerous tumor may be a carcinoma (cancer arising from epithelial cells), a sarcoma (cancer arising from bone and soft tissues), a lymphoma (cancer arising from lymphocytes), a blood cancer (e.g., myeloma or leukemia), a melanoma, or brain and spinal cord tumors. The cancerous tumor can be located in the oral cavity (e.g., the tongue and tissues of the mouth) and pharynx, the digestive system, the respiratory system, bones and joints (e.g., bony metastases), soft tissue, the skin (e.g., melanoma), breast, the genital system, the urinary system, the eye and orbit, the brain and nervous system (e.g., glioma), or the endocrine system (e.g., thyroid) and is not necessarily the primary tumor. More particularly, cancers of the digestive system can affect the esophagus, stomach, small intestine, colon, rectum, anus, liver, gall bladder, and pancreas. Cancers of the respiratory system can affect the larynx, lung, and bronchus and include, for example, non-small cell lung carcinoma. Cancers of the reproductive system can affect the uterine cervix, uterine corpus, ovaries, vulva, vagina, prostate, testis, and penis. Cancers of the urinary system can affect the urinary bladder, kidney, renal pelvis, and ureter. Cancer cells also can be associated with lymphoma (e.g., Hodgkin's disease and NonHodgkin's lymphoma), multiple myeloma, or leukemia (e.g., acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and the like). In one embodiment, the cancerous tumor is a colorectal cancer or carcinoma (CRC), a breast cancer, or a melanoma.

[0176] When a population of stromal cells such as fibroblasts, or a composition comprising fibroblasts, is administered to a subject (e.g., a human), the cells can be allogeneic or autologous to the subject. In “autologous” administration methods, cells (e.g., fibroblasts) are removed from a subject, stored (and optionally modified), and returned back to the same subject. In “allogeneic” administration methods, a subject receives cells (e.g., fibroblasts) from a genetically similar, but not identical, donor. Preferably, the cells are autologous to the subject.

[0177] As used herein, the terms “treatment” and “treating” can include reversing, alleviating, inhibiting the progression of, preventing or reducing the likelihood of cancer malignancy, or one or more symptoms or manifestations of a cancer metastatic spread. Accordingly, the disclosed compositions can be administered prophylactically to prevent or reduce the incidence or recurrence of a cancer. In some embodiments, the disclosed compositions, and methods promote inhibition of tumor cell dissemination, increase the sensitivity of chemotherapy, prevention of cancer cells to spread into stroma, or to metastasize to proximal or distal lymph nodes, or vasculature, such that chance of recurrent metastasis is reduced in mammals (e.g. a human, horse, or dog, or cat). “Treatment of cancer” means alleviation of cancer in whole or in part. In an embodiment, the disclosed methods and compositions reduce the size of a cancerous tumor by at least about 20% (e.g„ at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%). In an embodiment, the disclosed methods and compositions contained the spread of cancer to other organs more than 90% (e.g. at least about 95%, 100%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%).

[0178] The efficacy of the genetically engineered fibroblasts can be tested in a mouse model of pancreatic cancer, colorectal cancer, breast cancer, or melanoma, lung cancer, or any other solid cancer, by examining the primary cancerous tumor size, number of metastatic nodes, proximal lymph metastasis, margin of dissemination, tumor microenvironment’s extracellular matrix (ECM) remodeling, CAF induction, and disease progression metrics.

[0179] In an aspect, disclosed is a method of determining or predicting at least one gene for modulation to improve stromal resistance to cancer spread in a subject, the method including: 1) isolating fibroblasts from a biopsy (For example from skin or any other tissue); 2) sequencing the fibroblasts for RNA, and testing for their potential to resist cancer; and 3) selecting genes based on a prediction model developed by using evolutionary principles, and trajectory of gene change across mammalian stroma.

[0180] In an aspect, disclosed is an in vitro method for functionally predicting the potential of patient’s fibroblasts, native and after genetic modification to cancer spheroid spread and dissemination in vivo in a mouse model with hydrogel plug with embedded un-modified, or modified fibroblasts. The method involves creating an orthogonal scratch to the underlying nanopattemed scaffold by a movable pin covered with soft silicone material, manually or motor- controlled after a monolayer of either invasive, or stromal cells is already achieved. Cells removed by scratch are washed off, and the stromal, or invasive cells respectively are seeded to create another monolayer such that the interface of the two cell types is orthogonal to the direction of the underlying nano / micro patterns. One of the cell types is labeled fluorescently, and time-stamped pictures are taken. Morphometric analysis of the interface is quantified to assess the native / natural resistance of a species / patient’s fibroblasts to resist invasion, as well as the effect of a gene therapy.

[0181] In an aspect, disclosed is a method for in vivo functional prediction and assessment of patient fibroblasts, native or gene modified, resistance to cancer invasion. The method involves embedding patient’s fibroblasts, native or gene modified, in a hydrogel plug (including but not limited to Matrigel), with fluorescently labeled spheroids of cancer or other invasive cells mixed in, which is injected and polymerized subcutaneously in the mouse. The plug is removed about 3, 4, 5, 6, 7, 8, 9, or 10 days after injection and immediate polymerization, and imaged for morphometric analysis of the spheroids using a microscope. In one embodiment the plug is removed 4 days after grafting, and immediately imaged afterwards to establish differences in the gene modified stromal response to trophoblast spread (Fig. 3).

[0182] In an aspect, disclosed is a method to combine in vitro, in vivo assessment of stromal resistance with transcriptomic data to predict native stromal resistance, and the potential efficacy of gene therapy. The movement of individual fibroblast cells and the invasive cells are tracked in an in-vitro assay platform. Measures such as direction, persistence, distributional of cell velocities of individual cells, and the joint distribution of such measures from neighboring cells are calculated. The overall extent of invasion of cancer cell lines, and the number and distribution of individual escaped and leader cells, and number of invasive forks into the fibroblast cell population are measured. Genome wide gene expression profiling, mutations in the genomic sequence, and / or epigenetic profiling of the fibroblast cells are conducted. The gene expression, mutation, and epigenetic states of individual genes, and the combined scores for phenotypic groups of genes and signaling pathways are calculated. A machine learning model, such as linear or logistic regression, deep neural network, decision trees, etc., or ensemble method combining many such models, i.e., random forest, boosting and bagging models can be used to predict the invasive potential from morphometric measures and sequencing data described above.

[0183] Combination Therapy

[0184] An aspect of the disclosed method is to reduce CAF (cancer associated fibroblast) induced resistance to chemotherapy drug response in a subject, or sensitize the subject to administered cancer chemotherapeutic agent. In some forms, the disclosed cell therapy methods are administered as a combination therapy with an additional therapeutic agent, preferably, a chemotherapeutic agent. As used herein, “combination” or “combined” refer to either concomitant, simultaneous, or sequential administration of the therapeutics.

[0185] In some forms, the pharmaceutical compositions and other therapeutic agents are administered separately through the same route of administration. In other forms, the pharmaceutical compositions and other therapeutic agents are administered separately through different routes of administration. The combinations can be administered either concomitantly (e.g., as an admixture), separately but simultaneously (e.g., via separate routes of delivery into the same subject; for example, one agent is given orally while the other agent is given by injection, etc.,), or sequentially (e.g., one agent is given first followed by the second). Exemplary chemotherapeutic agents include, but are not limited to cytotoxic drugs such as doxorubicin, cyclosporine, mitomycin C, cisplatin and carboplatin, BCNU, 5FU, methotrexate, adriamycin, camptothecin, epothilones A-F, and taxol. Examples of preferred additional therapeutic agents include other conventional therapies known in the art for treating the desired disease, disorder or condition. In some forms, the therapeutic agent is one or more other targeted therapies (e.g., a targeted cancer therapy).

[0186] In some forms, the additional therapeutic agent is a chemotherapeutic or antineoplastic drug. The majority of chemotherapeutic drugs can be divided into alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, monoclonal antibodies, and other anti-tumor agents.

[0187] The following terms are used to describe the methods disclosed herein. In instances where a term is not specifically defined herein, that term is given an art-recognized meaning by those of ordinary skill applying that term in context to its use in describing the present disclosure.

[0188] As used herein, the terms “amino acid,” “nucleotide,” “polynucleotide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Terms “nucleic acid” or a “nucleic acid sequence” refers to a polymer or oligomer of pyrimidine and / or purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982)). Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein. The present technology contemplates any deoxyribonucleotide, ribonucleotide, or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated, or glycosylated forms of these bases, and the like. The polymers or oligomers may be heterogenous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states. In some embodiments, a nucleic acid or nucleic acid sequence comprises other kinds of nucleic acid structures such as, for instance, a DNA / RNA helix, peptide nucleic acid (PNA), morpholine nucleic acid (see, e.g., Braasch and Corey, Biochemistry, 41(14): 4503-4510 (2002)) and U.S. Pat. No. 5,034,506), locked nucleic acid (LNA; see Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 97: 5633-5638 (2000)), cyclohexenyl nucleic acids (see Wang, J. Am. Chem. Soc., 122: 8595-8602 (2000)), and / or a ribozyme. Hence, the term “nucleic acid” or “nucleic acid sequence” may also encompass a chain comprising non-natural nucleotides, modified nucleotides, and / or non-nucleotide building blocks that can exhibit the same function as natural nucleotides (e.g., “nucleotide analogs”); further, the term “nucleic acid sequence” as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single or double- stranded, and represent the sense or antisense strand. The terms “nucleic acid,” “polynucleotide,” “nucleotide sequence,” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.

[0189] It will be appreciated that expression of a gene is regulated (for example, downregulated) if the expression is reduced by at least about 20% (e.g., 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more) as compared to a reference level or control. Expression of a gene is upregulated if the expression is increased by at least about 20% (e.g., 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more) as compared to a reference level or control.

[0190] The terms “silence” “knock down,” and “silence expression,” as used herein, refer to inhibition of expression of a particular gene. The degree of inhibition may be partially complete (e.g., 10% or more, 25% or more, 50% or more, or 75% or more), substantially complete (e.g., 85% or more, 90% or more, or 95% or more), or fully complete (e.g., 98% or more, or 99% or more). Gene silencing may be accomplished using a variety of methods known in the art. In some embodiments, silencing is performed using gene editing. The terms “gene editing,” “genome editing,” or “genome engineering,” may be used interchangeably herein to refer to a type of genetic engineering in which DNA is inserted, deleted, modified, or replaced in the genome of a living organism. For example, gene editing may be used to disrupt or modify an endogenous genomic region of a host cell, inserting an exogenous gene into a host genome, replacing an endogenous nucleotide sequence with an exogenous nucleotide sequence, or any combination thereof. Systems and methods for gene editing are described in detail in, e.g., National Academies of Sciences, Engineering, and Medicine; National Academy of Medicine; National Academy of Sciences; Committee on Human Gene Editing: Scientific, Medical, and Ethical Considerations. Human Genome Editing: Science, Ethics, and Governance. Washington (DC): National Academies Press (US); 2017 Feb. 14. A, The Basic Science of Genome Editing. A sequence of bases is a succession of bases signified by a series of a set of five different letters that indicate the order of nucleotides forming alleles within a DNA (using GACT) or RNA (GACU) molecule. By convention, sequences are usually presented from the 5’ end to the 3' end. For DNA, the sense strand is used. Because nucleic acids are normally linear (unbranched) polymers, specifying the sequence is equivalent to defining the covalent structure of the entire molecule. Gene expression is the process by which a genes coded information is converted into the structures present and operating in the cell. Expressed genes include those that are transcribed into mRNA and then translated into protein and those that are transcribed into RNA but not translated into protein (for example, transfer and ribosomal RNAs). miRNA is a non-coding region of mRNA that is believed to be important in the either promotion or inhibition of gene expression.

[0191] Below are the names of some micro RNAs and genes known in the art. Nonlimiting examples of the microRNAs include miR-29, miR-33, miR-140, miR-145, miR-143, miR-21, and miR- 1820ther information can be found on the website https: / / www.genecards.org / which is incorporated herein by reference.

[0192] The use of the terms “a” and “an” and “the” and similar referents (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. By way of example, "an element" means one element or more than one element.

[0193] As used herein, the term “substantially” means to a great or significant extent, but not completely.

[0194] It should also be understood that, in certain methods described herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited unless the context indicates otherwise. Furthermore, the terms first, second, etc., as used herein are not meant to denote any particular ordering, but simply for convenience to denote a plurality of, for example, layers.

[0195] The terms “comprising”, “having”, “including”, and “containing” are to be construed as open- ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted.

[0196] The terms “about” or “approximately,” as used herein, is inclusive of the stated value and means within an acceptable range of deviation for the particular value as determined by one of ordinary skill in the art, considering the measurement in question and the error associated with measurement of the particular quantity (i.e., the limitations of the measurement system). For example, “about” can mean within one or more standard deviations, or within ± 10% or 5% of the stated value. Recitation of ranges of values are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1-2.0 includes 0.1, 0.2, 0.3, 0.4 . . . 2.0. All methods described herein can be performed in a suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”), is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any nonclaimed element as essential to the practice of the invention as used herein.

[0197] The phrase "and / or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and / or" should be construed in the same fashion, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and / or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and / or B", when used in conjunction with open-ended language such as "comprising" can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

[0198] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e., "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of."

[0199] As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from anyone or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a nonlimiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and / or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0200] The phrase "one or more," as used herein, means at least one, and thus includes individual components as well as mixtures / combinations of the listed components in any combination. All ranges and amounts given herein are intended to include subranges and amounts using any disclosed point as an end point. Thus, a range of " 1% to 10%, such as 2% to 8%, such as 3% to 5%," is intended to encompass ranges of " 1% to 8%," "1% to 5%," "2% to 10%, " and so on. All numbers, amounts, ranges, etc., are intended to be modified by the term "about," whether or not so expressly stated. Similarly, a range given of "about 1% to 10%" is intended to have the term "about" modifying both the 1% and the 10% endpoints. Further, it is understood that when an amount of a component is given, it is intended to signify the amount of the active material unless otherwise specifically stated.

[0201] As used herein, the term “administering” means the actual physical introduction of a composition into or onto (as appropriate) a subject, a host, or cell. Any and all methods of introducing the composition into the subject, host or cell are contemplated according to the invention; the method is not dependent on any particular means of introduction and is not to be so construed. Means of introduction are well-known to those skilled in the art, and also are exemplified herein. “Providing” means giving, administering, selling, distributing, transferring (for profit or not), manufacturing, compounding, or dispensing.

[0202] As used herein, “optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0203] Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of a federal or state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0204] As used herein, the term “prophylaxis” refers to preventing or reducing the progression of a disorder, either to a statistically significant degree or to a degree detectable by a person of ordinary skill in the art.

[0205] As used herein, the term “dose” or “dosage” denotes any form of an active ingredient formulation or composition, including cells, that contains an amount sufficient to initiate or produce a therapeutic effect with at least one or more administrations. “Formulation” and “composition” are used interchangeably herein. As used herein, the terms “control,” or “reference” are used herein interchangeably. A “reference” or “control” level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. “Control” also refers to control experiments or control cells.

[0206] The term “subject” or “patient” is used herein to refer to an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, and a whale), a bird (e.g., a duck or a goose), and a shark.

[0207] All methods described herein can be performed in a suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”), is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention as used herein. Unless defined otherwise, technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art of this disclosure.

[0208] Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims are introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group.

[0209] A significant change is any detectable change that is statistically significant in a standard parametric test of statistical significance such as Student’s T-test, where p < 0.05.

[0210] The disclosed compositions and methods can be further understood through the following numbered paragraphs.

[0211] 1. A population of stromal cells genetically engineered to reduce or eliminate expression of one or more genes which confer permissivity to cancer invasion (INV-GOI), wherein the INV- GOI is selected from the group consisting of: ADCY7 AKAP13, ARHGEF11, ARRB 1, ATG7, BAIAP2, BIRC6, BMP1, CBL, CCDC90B, CFAP46, CFLAR, CHRM2, CLASP1, COL7A1, COL8A1, CREBBP, CSF3, CUL4B, CXCL8, DAPP1, DGKI, DNM2, DUSP22, DVL2, EGFR, ELMO3, EPB41L5, ERBB2, EVC, F2R, FKBP5, FOXP1, GALT, GATA2, GFRA3, GMDS, GNB5, GRHL2, HECW2, HERC2, HERC4, H1NFP, HM0X1, HTR2B, HUWE1, IL7R, INPP4B, IRF2, ITGA2, ITGA4, JUN, KCNK1, KDM5A, LAMA1, MAFG, MANSC1, MCUR1, MDFI, MEGF8, MFSD2A, MICU2, MMP14, MMP17, MRPS10, MTMR3, NCSTN, NEK7, NFKB1, NUMA1, NUMBL, OVOL2, OXAIL, OXTR, PARD3, PARP12, PDE4B, PIEZO1, PIF1, PIK3C2A, PLCD3, PLCG1, PLXND1, PPL, PPP2R5C, PRG4, PRKAA, RCSD1 , RECQL5, RGS9, RNF20, RTF1 , SAMHD1 , SEMA3A, SHC1 , SLC18A2, SLC8B1 , SMPD1, SNAI2, SOD2, SPINT2, SSTR1, TEK, TFDP1, TRIP12, UBE3C, VDR, WNK1, XRCC5, ZBTB1, and a combination thereof.

[0212] 2. The cells of paragraph 1, wherein the INV-GOI is selected from the group consisting of SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, VDR, AKAP13, ADCY7, CHRM2, PDE4B, PLCD3, ARRB1, and ARHGEF11, or a combination thereof.

[0213] 3. The cells of paragraph 1 or 2, wherein the INV-GOI is selected from the group consisting of SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, and VDR, or a combination thereof.

[0214] 4. The cells of any one of paragraphs 1-3, wherein the at least one or more INV-GOI comprises a frameshift mutation, deletion of an exon, a double stranded break at the gene locus, wherein the gene function is reduced or absent.

[0215] 5. The cells of any one of paragraphs 1-4 comprising one or more inhibitory functional nucleic acids specific for the one or more INV-GOI.

[0216] 6. The cells of paragraph 5, wherein the inhibitory functional nucleic acid is selected from the group consisting of siRNA, shRNA, Antisense oligonucleotides (ASOs), and CRISPER / CAS system comparing a guide sequence specific for the one or more INV-GOI, wherein the guide targets any exon of the gene.

[0217] 7. The cells of paragraph 6, comprising an expression vector comprising:

[0218] (a) a nucleic acid encoding the guide RNA and

[0219] (b) a nucleic acid encoding a CRISPR-associated (Cas) protein selected from the group consisting of SpCas9, SaCas9, Cas 12a, and functionally equivalent endonucleases.

[0220] 8. The cells of any one of paragraphs 1-7, comprising a gRNA encoding sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO: 16:

[0221] 9. The cells of one of paragraphs 1-9, wherein the stromal cells are fibroblasts.

[0222] 10. A pharmaceutical composition comprising the cells of any one of paragraphs 1-9, in a pharmaceutically acceptable carrier.

[0223] 11. A method of reducing cancer spread and / or inhibiting progression of a cancerous tumor in a subject and / or inhibiting development of stroma induced drug resistance a subject, the method comprising administering, optionally in a delivery vehicle or carrier: (a) the cells of any one of paragraphs 1-9 ; (b) composition of paragraph 10 to the subject, optionally, wherein the cells are fibroblasts; or (c) an inhibitory functional nucleic acid selected from the group consisting of siRNA, shRNA, antisense oligonucleotides (ASOs), and CRISPER / CAS system comparing a guide sequence specific for the one or more INV-GOI, wherein the guide targets any exon of the gene.

[0224] 12. The method of paragraph 11, wherein the cells or composition are administered at a tumor site.

[0225] 13. A method of reducing cancer spread and / or inhibiting progression of a cancerous tumor in a subject and / or inhibiting development of stroma induced drug resistance in cancer, the method comprising: (a) isolating fibroblasts from a biopsy of a healthy tissue, including but not limited to skin, breast, gut, or from the surgically removed cancer itself, (b) genetically engineering the fibroblasts to silence or reduce expression of one or more INV-GOI ; and (c) administering an effective amount of the genetically engineered population of fibroblasts to subject, optionally to the location of the tumor in the subject, to inhibits escape of cancer cells from the cite.

[0226] 14. The method of any one of paragraphs 11-13, wherein the cells are isolated from a subject’s own tissues, surgically isolated cancer mass, mesenchymal stem cells frozen from umbilical cord, fat tissue, or a combination thereof. 15. The method of any one of paragraphs 11-14, wherein the subject is administered a chemotherapy, wherein the composition enhances subject’s sensitivity to chemotherapy.

[0227] 16. The method of paragraph 11, comprising administering an expression vector comprising:

[0228] (a) a nucleic acid encoding the guide RNA and

[0229] (b) a nucleic acid encoding a CRISPR-associated (Cas) protein selected from the group consisting of SpCas9, SaCas9, Cas 12a, and functionally equivalent endonucleases, to the subject.

[0230] 17. The method of paragraph 16, wherein the nucleic acid encoding the guide RNA is selected from the group consisting of SEQ ID NO:1-SEQ ID NO: 16:

[0231] 18. The method of any one of paragraphs 12-17, wherein the subject is administered a chemotherapeutic agent selected from the group consisting of doxorubicin, cyclosporine, mitomycin C, cisplatin and carboplatin, BCNU, 5FU, methotrexate, adriamycin, camptothecin, epothilones A-F, and taxol.

[0232] 19. The method of any one of paragraphs 12-18, wherein the tumor site is selected from the group consisting of colorectal, breast cancer, pancreatic, lung, and melanoma.

[0233] 20. The method of any one of paragraphs 16-19, wherein the vector is a viral vector.

[0234] 21. The method of paragraph 20, wherein the viral vector is selected from the group including a lentiviral vector, an Adeno-associated virus (AAV) vector, or an adenovirus vector, or a Herpes Simplex virus (HSV) vector, or a vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV), or a chimeric vector including a combination of any two or more of a Adeno- associated virus (AAV) vector, Herpes Simplex virus (HSV) vector, vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV).

[0235] 22. The method of claim any one of claims 16-19, wherein the vector is selected from the group including a plasmid, a cosmid, and a replicon.

[0236] This disclosure is illustrated by the following Examples, which are not intended to limit the claims.

[0237] Examples

[0238] Genes were identified by correlating the expression of genes in endometrial stromal fibroblasts, and / or skin fibroblasts from mammalian species with different levels of placental invasion, and filtered with the gene expression changes accompanying decidualization in human endometrium to filter and prioritize genes based on their predictability of conferring stromal resistance when silenced (Figure 1A).

[0239] In an example, various in vitro (Figure 2A), and in vivo (Figure 3A-3C, 4A-4D) are used to demonstrate the efficacy of a gene silencing strategy in conferring stromal resistance. These methods were not only used in discovery, but can be employed in quantitatively assessing a patient’s native stromal resistance to cancer invasion, as well as to test the efficiency of how a gene therapy will improve stromal resistance in a precision manner.

[0240] Figure. 1C-1D and evolved stromal genes contributing to vulnerability to cancer and trophoblast invasion identified by comparative mammalian transcriptomics and phenotyping. (Figure. 1C) ELI-score (change across epitheliochorial to hemochorial mammalian stroma) and fold change between decidualized and undifferentiated endometrial fibroblasts. (Figure. ID) TFs P-values identified by change in copy number of TF binding sites explaining the gene expression variance across species based on copy number of TF binding sites in cis-regulatory regions of a given gene. The genes in FIG. 1C are as follows (in the order from top to bottom): GLI3, GIPR, GRIA1, ADCY7, ATP2B1, CREBBP, CREB1, SSTR1, TGFB1, PPARA, R0CK2, ABHD2, EP300, NFKB1, ATP1A1, NC0A2, GRIA4, F2R, GABBR2, PDE4B, GABBR1, ADCY9, CREB3L2, NFKBIA, AKT3, KCNK2, CHRM2, OXTR.

[0241] The genes encoding transcription factors that regulate INV-GOI gene expression, and are also included as part of INV-GOI set are described in FIG. ID and are listed as follows (from left to right): 0NECUT1, JDP2, MEF2B, P0U3F1, POU2F2, RELA, NFIA, YY1, E2F1, NFATC2, REST, VDR, CRX, NR2F6, RARA, PRDM1, SIX1, NKX2.5, RARA, RXRG, NZF740, IRF1, ZNF384, KLF14, SP3. In vivo methods for rapid assaying of stromal resistance to invasion (Figure 3A-C), and metastatic model of stromal avatar (Figure 4A-4D) are created by inventors to (i) quantify patient’s native / natural resistance to cancer invasion, (ii) change in patient’s native / natural resistance to cancer invasion by lifestyle factors or therapy (e.g. hormone replacement therapy, insulin resistance, menopause, diabetes etc.), as well as (iii) efficiency of genetic manipulation in patient stroma to increase stromal resistance to cancer invasion.

[0242] Skin fibroblasts isolated from a bovine completely prevented metastasis of highly malignant A375 melanoma cells in a mouse model of stromal avatar (Figure 4A), while human skin fibroblasts allowed metastasis to occur. Lung and liver were found to have several metastatic nodes after 4 weeks when the stromal component was human, while bovine fibroblasts prevented metastasis (Figure 4B). In addition, there was little tumor-less weight change in the animals with bovine fibroblasts (Figure 4C), they ambled well, and did not show cancer associated decline in health, and survived (80%), while those with human fibroblasts all lost weight, and succumbed to cancer associated lethality (Figure 4D).

[0243] Fibroblasts or stromal cells are isolated from patient normal tissue, or cancer biopsy and characterized (Figure 5A-B), genetically manipulated based on ELI prediction (Figure 5C-D), and after quality check are transplanted autologously back at the site of primary tumor (Figure 5E) resulting in prevention of residual cancer cells from escape, beyond their primary location.

[0244] In an example, fibroblasts isolated from biopsies of breast cancer were silenced using sgRNA or siRNA for a gene STTR1, which was found to change profoundly in human endometrial fibroblasts vs other mammalian endometrial fibroblasts, particularly nonanthropoids. Identification of the gene was obtained by a regression analysis on many mammalian species stromally expressed mRNA against their capacity to limit invasion of placenta during gestation (Figure 1).

[0245] Figure. 6A-6C show gene silencing / knockout / knockdown of evolved stromal genes increase resistance to many cancer types in stromal fibroblasts. (Figure 6A) Representative example of HCT116 spheroids (brightly labeled with H2B-mCherry) invading into a monolayer of fibroblasts (black region) at 0, and 44 hours for control (scrambled), and a silenced gene (here, ABHD2). (Figure 6B) Extent of invasion of HCT116 colon cancer spheroids into the patient derived primary dermal fibroblasts silenced for genes; (Figure 6C) Extent of invasion of HCT116 colon cancer spheroids into patient derived lung primary fibroblasts silenced for indicated genes. Student-t tests show significance against NCI (scrambled): p-value< 0.05: *; 0.01: **,;.001: ***; 0.0001: **** . Figure 6D shows the effect of gene silencing in patient derived breast fibroblasts in reducing cancer invasion vs control (scrambled). Statistics by student- t-tests; p-value < : 0.05: *; 0.01: **; 0.001: ****; 0.0001: ****

[0246] Gene silenced CAFs for STTR1 completely confined spread of MDA-MB-231 cells, derived from malignant and metastasized triple negative breast cancer. In a mouse xenograft model, MDA-MB-231 cells mixed with gene-perturbed or unmodulated patient fibroblasts (Figure 7A) both encapsulated in a collagen gel did not exhibit any metastasis, while untreated CAFs allowed cells to escape and metastasize to distal organs (Figure 7B). All control animals without exception consistently lost weight (Figure 7C), became weaker, exhibited increased sickness and many died within 2 months (Figure 7D), while animals which had CAFs subjected to ex-vivo gene perturbation remained healthy, did not die, and did not lose weight (Figure 7C- 7D).

[0247] CAFs isolated from breast cancer biopsies were subjected to electroporation based gene silencing for ABHD2, ATP1A1, ATP2B1, CREB3L2, F2R, JDP2, NR2F6, SSTR1, VDR, and other genes, showing a dramatic reduction in cancer dissemination in a mouse model, when these cells were xenografted with MDA-MB-231, or A375 cells.

[0248] CAFs isolated from breast cancer biopsies increase drug resistance in cancer, tested here for doxorubicin in breast cancer (Figure 8). However, ELI gene modulation, here demonstrated for SSTR1 silencing in CAFs, reverses this drug resistance response (Figure 8). Stromal cells are known to enhance drug resistance, therefore ELI gene therapy, shown here for SSTR1 silencing, can prevent development of drug resistance.

[0249] It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

[0250] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. CLAIMSWe claim:

1. A population of stromal cells genetically engineered to reduce or eliminate expression of one or more genes which confer permissivity to cancer invasion (INV-GOI), wherein the INV- GOI is selected from the group consisting of: ABHD2, ADCY7 AKAP13, ARHGEF11, ARRB1 , ATG7, ATP1 Al, ATP2B1 , BAIAP2, BIRC6, BMP1 , CBL, CCDC90B, CFAP46, CFLAR, CHRM2, CLASP1, C0L7A1, C0L8A1, CREB3L2, CREBBP, CSF3, CUL4B, CXCL8, DAPP1, DGKI, DNM2, DUSP22, DVL2, EGFR, ELM03, EPB41L5, ERBB2, EVC, F2R, FKBP5, F0XP1, GALT, GATA2, GFRA3, GMDS, GNB5, GRHL2, HECW2, HERC2, HERC4, HINFP, HM0X1, HTR2B, HUWE1, IL7R, INPP4B, IRF2, ITGA2, ITGA4, JDP2, JUN, KCNK1, KDM5A, LAMA1, MAFG, MANSC1, MCUR1, MDFI, MEGF8, MFSD2A, MICU2, MMP14, MMP17, MRPS10, MTMR3, NCSTN, NEK7, NFKB1, NUMA1, NUMBL, OVOL2, 0XA1L, OXTR, PARD3, PARP12, PDE4B, PIEZO1, PIF1, PIK3C2A, PLCD3, PLCG1, PLXND1, PPL, PPP2R5C, PRG4, PRKAA, RCSD1, RECQL5, RGS9, RNF20, RTF1, SAMHD1, SEMA3A, SHC1, SLC18A2, SLC8B1, SMPD1, SNAI2, SOD2, SPINT2, SSTR1, TEK, TFDP1, TRIP12, UBE3C, VDR, WNK1, XRCC5, and ZBTB1, or a combination thereof.

2. The cells of claim 1, wherein the INV-GOI is selected from the group consisting of SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, VDR, AKAP13, ADCY7, CHRM2, PDE4B, PLCD3, ARRB1, and ARHGEFH, or a combination thereof.

3. The cells of claim 1 or 2, wherein the INV-GOI is selected from the group consisting of SSTR1, ABHD2, F2R, ATP1A1, ATP2B1, CREB3L2, JDP2, NR2F6, and VDR, or a combination thereof.

4. The cells of any of claims 1-3, wherein the at least one or more INV-GOI comprises a frameshift mutation, deletion of an exon, a double stranded break at the gene locus, wherein the gene function is reduced or absent.

5. The cells of any one of claims 1-4 comprising one or more inhibitory functional nucleic acids specific for the one or more INV-GOI.

6. The cells of claim 5, wherein the inhibitory functional nucleic acid is selected from the group consisting of siRNA, shRNA, Antisense oligonucleotides (ASOs), and CRISPER / CAS system comparing a guide sequence specific for the one or more INV-GOI, wherein the guide targets any exon of the gene.

7. The cells of claim 6, comprising an expression vector comprising:(a) a nucleic acid encoding the guide RNA and(b) a nucleic acid encoding a CRISPR-associated (Cas) protein selected from the group consisting of SpCas9, SaCas9, Cas 12a, and functionally equivalent endonucleases.

8. The cells of any one of claims 1 -7, comprising a gRNA encoding sequence selected from the group consisting of: AACTTCCGGTGCCCATAGTT (SEQ ID NO:1); (ABHD2) CTCATCAAACACGGCTGTTT (SEQ ID NO:2); GATAACTCCTCGCTCACGTT (SEQ ID NO:3); (CHRM2) CGGGAACATCCTAGTCAGTT (SEQ ID NO:4);TGCAATAGCCGTACCAAGTT (SEQ ID NO:5); CTGACCCAAGAGTTCTGTTT (SEQ ID NO:6); CTGTATAGAGTTACGGGTTT (SEQ ID NO:7); GCTGGTCAAATATCCGGGTT (SEQ ID NO:8); GCTGGTCAAATATCCGGGTT (SEQ ID NO:9);CACGAACGGCGTGGACAGTT (SEQ ID NO: 10); ATGGCATGATGTTTAGGTTT (SEQ ID NO: 11); ACAGACGAACCACCCCGTTT (SEQ ID NO: 12);AAGGGACCTTGAGCGAGTTT (SEQ ID NO: 13); GATAACTCCTCGCTACGTTT (SEQ ID NO: 14); GCTAAAATGGTACCGAGTTT (SEQ ID NO: 15);GCTTGTGATTCGAAAGTTTT (SEQ ID NO: 16); ATAGCACCACACGCCCGTTT (SEQ ID NO: 17) and TCGAGCGGCAAGCATTAGTT (SEQ ID NO: 18).

9. The cells of one of claims 1-9, wherein the stromal cells are fibroblasts.

10. A pharmaceutical composition comprising the cells of any one of claims 1-9, in a pharmaceutically acceptable carrier.

11. A method of reducing cancer spread and / or inhibiting progression of a cancerous tumor in a subject and / or inhibiting development of stroma induced drug resistance a subject, the method comprising administering, optionally in a delivery vehicle or carrier:(a) the cells of any one of claims 1-9 ; (b) composition of claim 10 to the subject, optionally, wherein the cells are fibroblasts; or(c) an inhibitory functional nucleic acid specific for one or more INV-GOI, wherein the inhibitory nucleic acid is selected from the group consisting of siRNA, shRNA, antisense oligonucleotides (ASOs), and CRISPER / CAS system comparing a guide sequence specific for the one or more INV-GOI, wherein the guide targets any exon of the INV-GOI.

12. The method of wherein the cells or composition are administered at a tumor site.

13. A method of reducing cancer spread and / or inhibiting progression of a cancerous tumor in a subject and / or inhibiting development of stroma induced drug resistance in cancer, the method comprising: (a) isolating fibroblasts from a biopsy of a healthy tissue or surgicallyremoved cancer, optionally, wherein the healthy tissue is selected from the group consisting of skin, breast, and gut, (b) genetically engineering the fibroblasts to silence or reduce expression of one or more INV-GOI, ; and (c) administering an effective amount of the genetically engineered population of fibroblasts to subject, optionally to the location of the tumor in the subject, to inhibits escape of cancer cells from the cite.

14. The method of any one of claims 1 1 -13, wherein the cells are isolated from a subject’s own tissues, surgically isolated cancer mass, mesenchymal stem cells frozen from umbilical cord, fat tissue, or a combination thereof.

15. The method of any one of claims 11-14, wherein the subject is administered a chemotherapy, wherein the composition enhances subject’s sensitivity to chemotherapy.

16. The method of any one of claims 11-15, comprising administering an expression vector comprising:(a) a nucleic acid encoding the guide RNA and(b) a nucleic acid encoding a CRISPR-associated (Cas) protein selected from the group consisting of SpCas9, SaCas9, Cas 12a, and functionally equivalent endonucleases, to the subject or stromal cells.

17. The method of claim 16, wherein the nucleic acid encoding the guide RNA is selected from the group consisting of:AACTTCCGGTGCCCATAGTT (SEQ ID NO: 1); (ABHD2) CTCATCAAACACGGCTGTTT (SEQ ID NO:2); GATAACTCCTCGCTCACGTT (SEQ ID NO:3); (CHRM2) CGGGAACATCCTAGTCAGTT (SEQ ID NON); TGCAATAGCCGTACCAAGTT (SEQ ID N0:5); CTGACCCAAGAGTTCTGTTT (SEQ ID NO:6); CTGTATAGAGTTACGGGTTT (SEQ ID NO:7); GCTGGTCAAATATCCGGGTT (SEQ ID NO:8);GCTGGTCAAATATCCGGGTT (SEQ ID NO:9); CACGAACGGCGTGGACAGTT (SEQ ID NO: 10); ATGGCATGATGTTTAGGTTT (SEQ ID NO: 11);ACAGACGAACCACCCCGTTT (SEQ ID NO: 12); AAGGGACCTTGAGCGAGTTT (SEQ ID NO: 13); GATAACTCCTCGCTACGTTT (SEQ ID NO: 14);GCTAAAATGGTACCGAGTTT (SEQ ID NO: 15); GCTTGTGATTCGAAAGTTTT (SEQ ID NO: 16); ATAGCACCACACGCCCGTTT (SEQ ID NO: 17) and TCGAGCGGCAAGCATTAGTT (SEQ ID NO: 18).

18. The method of any one of claims 12-17, wherein the subject is administered a chemotherapeutic agent selected from the group consisting of doxorubicin, cyclosporine, mitomycin C, cisplatin and carboplatin, BCNU, 5FU, methotrexate, adriamycin, camptothecin, epothilones A-F, and taxol.

19. The method of any one of claims 12-18, wherein the tumor site is selected from the group consisting of colorectal, breast cancer, pancreatic, lung, and melanoma.

20. The method of any one of claims 16-19, wherein the vector is a viral vector.

21. The method of claim 20, wherein the viral vector is selected from the group including a lentiviral vector, an Adeno-associated virus (AAV) vector, or an adenovirus vector, or a Herpes Simplex virus (HSV) vector, or a vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV), or a chimeric vector including a combination of any two or more of a Adeno- associated virus (AAV) vector, Herpes Simplex virus (HSV) vector, vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV).

22. The method of claim any one of claims 16-19, wherein the vector is selected from the group including a plasmid, a cosmid, and a replicon.

Citation Information

Patent Citations

  • Island

    US150A

  • Zinc finger binding domains for nucleotide sequence ANN

    US20020165356A1

  • Composition binding polypeptides

    US20040197892A1

  • Zinc finger domains specifically binding agc

    US20070154989A1

  • Zinc finger binding domains for tnn

    US20070213269A1