Engineered cell exosome for specifically targeting liver as well as construction and application of engineered cell exosome
By constructing umbilical cord mesenchymal stromal cell exosomes overexpressing integrin αvβ5, the problem of target deficiency of exosomes in the treatment of liver fibrosis was solved, and efficient delivery of exosomes to the liver and improved efficacy were achieved.
Patent Information
- Application Number
- CN202511698139.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-19
- Publication Date
- 2026-02-24
AI Technical Summary
Existing umbilical cord mesenchymal stem cell exosomes lack targeting capabilities when treating liver fibrosis, making it difficult for exosomes to efficiently accumulate in the liver lesion area, especially Kupffer cells, thus affecting the treatment effect.
We constructed umbilical cord mesenchymal stromal cells overexpressing integrin αvβ5 using lentiviral transfection technology, and prepared engineered exosomes that specifically target the liver. We then used their high expression of integrin αvβ5 to enhance the uptake rate of liver Kupffer cells.
This study achieved efficient delivery of exosomes to the liver, significantly improved the efficacy of anti-liver fibrosis treatment, and solved the problem of exosome production, demonstrating promising application prospects.
Smart Images

Figure CN121555431A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to an engineered exosome that specifically targets the liver, its construction, and its application. Background Technology
[0002] Liver fibrosis is a cascade reaction caused by chronic liver injury such as alcohol abuse, chronic hepatitis, non-alcoholic steatohepatitis, or metal overload. When viruses, alcohol, or metabolic factors attack the liver parenchyma, abnormal activation of Kupffer cells releases key mediators such as TGF-β1, driving the activation of hepatic stellate cells and their transformation into myofibroblasts. This leads to uncontrolled deposition of extracellular matrix, ultimately resulting in portal hypertension, cirrhosis, and liver cancer, a leading cause of morbidity and mortality worldwide. Current clinical treatments, such as traditional anti-fibrotic drugs, face a dual contradiction between efficacy and toxicity. Etiological treatments, such as interferon and nucleoside analogs, are unable to reverse the mature fibrotic process, and liver transplantation is difficult to popularize due to donor shortages and various complications.
[0003] In recent years, umbilical cord mesenchymal stem cell exosomes (UC-MSC-exo) have shown breakthrough potential due to their natural biological characteristics: their nanoscale structures (30-150 nm in diameter) encapsulated by a phospholipid bilayer can cross the sinusoidal barrier, and their low immunogenicity endows them with long-lasting circulation capabilities; more importantly, the exosome lumen is filled with various biologically active substances: proteins, nucleic acids, mRNA, regulatory microRNAs (miRNAs, miRs) and DNA, as well as soluble factors (including cytokines and chemokines, enzymes and cofactors). After being released into the extracellular environment, these substances can be taken up by target cells in the microenvironment or carried to distant tissues or organs via body fluids. Current research has shown that exosomes derived from mesenchymal stem cells (MSCs) improve the degree of liver fibrosis in mice through various mechanisms, such as blocking TGF-β / Smad signaling, inhibiting the TGF-β1 / Smad signaling pathway, and inhibiting the epithelial-mesenchymal transition of hepatocytes. However, this therapy faces fundamental clinical efficacy limitations: after intravenous injection, exosomes exhibit severe non-specific organ retention, with a significantly insufficient percentage actually localizing to the liver lesion area, and an especially low proportion capable of actively recognizing target cells (such as Kupffer cells). This lack of targeting makes it difficult for exosomes to efficiently accumulate in the lesion, thus necessitating the development of an effective solution. Summary of the Invention
[0004] The purpose of this invention is to provide an engineered exosome that specifically targets the liver, its construction, and its application, aiming to offer a solution for the clinical treatment of liver fibrosis by achieving efficient delivery of exosomes to the fibrotic area of the liver, thereby improving clinical efficacy. According to existing literature, the differential expression of integrins in exosomes determines the target organ, with exosomes highly expressing αvβ5 exhibiting liver-oriented distribution. Through testing, the inventors discovered that umbilical cord mesenchymal stromal cells and their exosomes highly express integrin αv but not integrin β5 protein. Therefore, an umbilical cord mesenchymal stromal cell line overexpressing ITGβ5 was constructed using lentiviral transfection technology, and exosomes from these overexpressing ITGβ5 umbilical cord mesenchymal stromal cells were further extracted for use in the treatment of liver fibrosis.
[0005] Therefore, the present invention provides the following technical solution.
[0006] The first aspect of the present invention provides an engineered exosome that specifically targets the liver, the exosome being derived from mesenchymal stromal cells that overexpress integrin subunit β5, the mesenchymal stromal cells overexpressing integrin subunit β5 being prepared by lentiviral infection.
[0007] In a preferred embodiment of the present invention, the mesenchymal stromal cells include umbilical cord mesenchymal stromal cells, bone marrow mesenchymal stromal cells, adipose mesenchymal stromal cells, dental pulp mesenchymal stromal cells, placental mesenchymal stromal cells, amniotic membrane mesenchymal stromal cells, synovial mesenchymal stromal cells, and thymic mesenchymal stromal cells.
[0008] In a preferred embodiment of the present invention, the mesenchymal stromal cells are umbilical cord mesenchymal stromal cells.
[0009] In a preferred embodiment of the present invention, the mesenchymal stromal cells are derived from, but are not limited to, mice, rats, rabbits, dogs, pigs, and primates.
[0010] In a preferred embodiment of the present invention, the lentivirus is a lentivirus LV-ITGB5-3FLAG-CBh-gcGFP-IRES-puromycin that overexpresses integrin subunit β5.
[0011] A second aspect of the present invention provides a method for preparing engineered exosomes specifically targeting the liver as described above, the method comprising the following steps: S1: Mesenchymal stromal cells to be treated are transfected with a lentivirus that overexpresses integrin subunit β5, so that the mesenchymal stromal cells overexpress integrin subunit β5. S2: Mesenchymal stromal cells containing integrin subunit β5 were cultured. S3: Centrifuge to collect the cell supernatant after the culture treatment; S4: The cell supernatant is centrifuged multiple times to obtain mesenchymal matrix cell exosomes overexpressing integrin subunit β5.
[0012] In a preferred embodiment of the present invention, in step S1, the mesenchymal matrix cells to be treated are mesenchymal matrix cells cultured to the 3rd-5th generation.
[0013] In a preferred embodiment of the present invention, in step S1, the transfection concentration of the lentivirus is 1×10⁻⁶. 7 TU / mL.
[0014] In a preferred embodiment of the present invention, in step S1, the transfection time is 16 hours.
[0015] In a preferred embodiment of the present invention, in step S2, the culture conditions are: culture medium: serum-free basal culture medium, temperature: 37°C, time: 48h.
[0016] In a preferred embodiment of the present invention, in step S3, the centrifugation conditions are: temperature of 4°C, rotation speed of 2000×g, and time of 10min.
[0017] In a preferred embodiment of the present invention, step S4, the multiple centrifugations include the following steps: (i) Centrifuge the cell supernatant at 4°C and 10000×g for 10 min, and collect the supernatant to obtain the first centrifugation supernatant; (ii) Centrifuge the first centrifugal supernatant at 4°C and 100,000 × g for 70 min, and take the supernatant to obtain the second centrifugal supernatant; (iii) Centrifuge the second centrifugation supernatant at 4°C and 100,000×g for 70 min, take the precipitate, wash with PBS buffer and resuspend to obtain cell exosomes.
[0018] In a preferred embodiment of the present invention, the cell exosomes are spherical vesicles with a particle size between 30-150 nm.
[0019] A third aspect of the present invention provides a product for treating liver diseases, the product comprising engineered exosomes specifically targeting the liver as described above.
[0020] In a preferred embodiment of the present invention, the liver disease includes autoimmune liver disease, non-alcoholic fatty liver disease, acute liver injury, liver fibrosis, cirrhosis, and liver ischemia-reperfusion injury.
[0021] In a preferred embodiment of the present invention, the exosomes target liver-resident Kupffer cells.
[0022] A third aspect of the invention provides the use of engineered exosomes or products that specifically target the liver as described above in the preparation of medicaments for treating liver diseases.
[0023] In a preferred embodiment of the present invention, the liver disease includes autoimmune liver disease, non-alcoholic fatty liver disease, acute liver injury, liver fibrosis, cirrhosis, and liver ischemia-reperfusion injury.
[0024] In a preferred embodiment of the invention, the cell exosomes or product target liver-resident Kupffer cells.
[0025] In a preferred embodiment of the invention, the medicament may further include a pharmaceutically acceptable carrier or excipient.
[0026] In a preferred embodiment of the present invention, the drug is administered via nasal administration, oral administration, or intravenous injection.
[0027] By employing the above technical solution, the present invention has at least the following advantages: This invention utilizes genetic engineering techniques to construct an engineered umbilical cord mesenchymal stromal cell exosome that specifically targets the liver, derived from mesenchymal stromal cells (preferably human umbilical cord mesenchymal stromal cells). This exosome is constructed by infecting human umbilical cord mesenchymal stromal cells with recombinant lentivirus and stably overexpresses the integrin subunit beta 5 (ITGβ5). Compared to natural exosomes, the exosomes of this invention, due to overexpression of the β5 subunit of the fibronectin-targeting receptor integrin αvβ5 on the surface of liver Kupffer cells, exhibit significantly enhanced uptake by liver Kupffer cells, achieving targeted enrichment of the exosomes in the liver after intravenous injection. Furthermore, the in vivo anti-liver fibrosis efficacy is further improved, providing a novel therapy for treating liver diseases such as liver fibrosis.
[0028] Animal experiments have shown that the liver-targeted engineered umbilical cord mesenchymal matrix cell exosomes used in this invention can achieve significant enrichment in liver tissue after intravenous infusion, improving the in vivo anti-fibrotic efficacy. Furthermore, the cell source of the engineered exosomes of this invention is easy to obtain, solving the problem of exosome yield and showing good application prospects.
[0029] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described in detail below. Attached Figure Description
[0030] Figure 1This is a typical phenotypic diagram of human umbilical cord mesenchymal stromal cells from Example 1; Figure 2 The image shows the lentiviral vector LV-ITGB5-3FLAG-CBh-gcGFP-IRES-puromycin overexpressing ITGβ5 according to the present invention. Figure 3 This is a comparative graph showing the effect of ITGβ5 gene overexpression on ITGβ5 protein expression in human umbilical cord mesenchymal stromal cells; where A is the expression of integrin αv, β5 and CD90 proteins detected by Western blot, with GAPDH as an internal control; B is the detection of ITGβ5 transfected positive cells by FCM; and C is a statistical analysis graph of ITGβ5 transfected positive cells. Figure 4 Morphological characterization of engineered exosomes specifically targeting the liver and stably overexpressing ITGβ5; where A is a transmission electron microscope image of the exosomes; B is a particle size analysis image of the exosomes; Figure 5 Integrin αv, β5, and exosome marker proteins were detected in engineered exosomes that specifically target the liver and stably overexpress ITGβ5. Figure 6 Immunofluorescence assay of engineered exosomes specifically targeting the liver and overexpressing ITGβ5 for stable uptake by liver Kupffer cells; Figure 7 To detect the in vivo antifibrotic effect of engineered exosomes that specifically target the liver and stably overexpress ITGβ5. Detailed Implementation
[0031] To make the technical means, creative features, achieved objectives, and effects of this invention readily understandable, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0032] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.
[0033] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0034] In this document, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this invention, but do not exclude other aspects.
[0035] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.
[0036] In this article, the term "transmission electron microscope (TEM)" is a high-resolution microscope that uses an electron beam instead of a light beam. It can provide higher magnification and resolution than traditional optical microscopes and is typically used to observe nanoscale samples such as viruses, organelles, and macromolecular complexes.
[0037] In this paper, the term "Nanoparticle Tracking Analysis (NTA)" is a biophysical method used to analyze and characterize the size and concentration of nanoparticles.
[0038] In this embodiment of the invention, transmission electron microscopy and nanoparticle tracking analysis techniques are used to characterize the morphology, particle concentration, and size of exosomes, respectively.
[0039] In this paper, the term "exosomes" (hereinafter referred to as "EXO") refers to a class of extracellular vesicles with a diameter of approximately 30–150 nm, which can be secreted by almost all types of cells (including cells in the central nervous system) under physiological or pathological conditions. Exosomes can directly act on recipient cells, playing physiological roles such as intercellular substance transport and signal transduction. The differences in substances contained in exosomes from different cells mainly depend on the parent cell; therefore, exosomes from different sources have different functions. Transmission electron microscopy can provide information on the morphology, size, and structure of exosomes, which is crucial for studying the physical properties of exosomes and assessing their potential as drug carriers. Nanoparticle tracking analysis can accurately measure the hydrodynamic diameter of exosomes, helping to understand the size distribution and uniformity of exosomes; it can also quantitatively analyze the particle concentration of exosomes, providing fundamental data for studying their biological functions and potential applications.
[0040] In this invention, the term "pharmaceutical acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with other components of the formulation and / or the mammals to which it is treated. Preferably, "pharmaceutical acceptable" as used herein means approved by federal regulatory agencies or national governments or listed in the United States Pharmacopeia or other generally recognized pharmacopoeias for use in animals, particularly in humans.
[0041] In this invention, the term "pharmaceutically acceptable carrier" includes any solvent, pharmaceutical stabilizer, or combination thereof, all of which are known to those skilled in the art. It covers the use of any conventional carrier in therapeutic or pharmaceutical compositions, except in cases where any conventional carrier is incompatible with the active ingredient.
[0042] In this invention, the term "pharmaceuticalally acceptable excipient" may include any solvent suitable for a particular target dosage form. The use of any conventional excipients, except those incompatible with the exosomes disclosed herein, for example, for any adverse biological effects or harmful interactions with any other component of a pharmaceutically acceptable composition, is also within the scope of this invention.
[0043] In this invention, the terms "treatment" and "relief" both refer to the attainment of desired pharmacological and / or physiological effects. These effects may be preventative in terms of complete or partial prevention of disease or its symptoms, and / or therapeutic in terms of partial or complete cure of disease and / or adverse effects caused by disease. As used herein, "treatment" encompasses diseases in mammals, particularly humans, including: (a) prevention of disease or the onset of disease in individuals susceptible to disease but not yet diagnosed with it; (b) inhibition of disease, such as blocking disease progression; or (c) relief of disease, such as reducing disease-related symptoms. As used herein, "treatment" encompasses any administration of a drug or compound to an individual to treat, cure, relieve, improve, reduce, or inhibit the individual's disease, including but not limited to administration of a drug containing a compound described herein to an individual in need.
[0044] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.
[0045] Example 1: Isolation, culture and identification of human umbilical cord mesenchymal stromal cells (UCMSCs) Under aseptic conditions, harvest approximately 10–20 cm of the umbilical cord from the proximal end near the fetus. Cut off 2 cm from each end and immerse the cord in DPBS (Durbeco phosphate-buffered saline) containing 2% penicillin and streptomycin for no more than 24 hours. Then, cut the cord into small segments of approximately 2 cm and wash with DPBS containing 2% penicillin and streptomycin until no blood remains. Remove the three blood vessels from the cord: two arteries and one vein. Finally, use ophthalmic scissors to cut the cord into pieces approximately 1 mm in size. 3Small tissue fragments were collected. After the tissue was minced, it was directly placed into a T75 culture flask and inverted for 4 hours. Then, the flask was upright, and 10 mL of human mesenchymal stem cell complete culture medium was added. The formulation of the human mesenchymal stem cell complete culture medium used was: 10% MSC-grade fetal bovine serum (Gibco, catalog number 10099141C) + DMEM low-glucose medium (Gibco, catalog number 10567014). After about 14 days of culture, the cells crawled out and formed colonies (CFU-F). The culture flask was gently tapped to detach the tissue fragments, which were then discarded. The cell surface was gently washed with PBS, and 10 mL of fresh human mesenchymal stem cell complete culture medium was added. The flask was then placed in an incubator for further culture. When the primary cells reached 40%–50% confluence, they were passaged. That is, the old culture medium was discarded first, and the cells were washed once with DPBS at room temperature, and the DPBS was aspirated. Then, an appropriate amount of Tryple was added, and the cells were incubated at 37 °C for 3 min for digestion. Gently pipette the cells to collect the cell suspension into a centrifuge tube. Centrifuge at 1200 r / min for 5 min at room temperature and discard the supernatant. Resuspend the cells in human mesenchymal stem cell complete culture medium, gently pipette to mix evenly, and seed at a density of approximately 1.5 × 10⁶ cells / mL. 4 / cm 2 The cells were then incubated at 37°C in a 5% CO2 incubator until 80-90% confluence. Following this, a new round of Tryple digestion and passage culture was performed to obtain human umbilical cord mesenchymal stromal cells (UCMSCs). Flow cytometry was used to detect the typical phenotypic characteristics of the obtained UCMSCs; the results are shown below. Figure 1 .
[0046] like Figure 1 As shown, flow cytometry results indicated that the obtained human umbilical cord mesenchymal stromal cells highly expressed MSC surface molecules CD73 (99.9%), CD90 (98.9%), and CD105 (99.2%), while negatively expressing the mesenchymal stromal cell marker CD19+45+11+34+HLA-DR (0.93%). These results demonstrate that the UCMSCs isolated and prepared in this example possess typical MSC characteristics and have high purity.
[0047] Example 2: Construction of engineered umbilical cord mesenchymal stromal cells that stably overexpress integrin β5 (ITGβ5) and specifically target the liver ITGβ5 overexpression / knockout lentivirus was constructed by Shanghai Jikai Gene Medical Technology Co., Ltd. The cloning vector used was GV492, and the lentivirus packaging vector was LV-ITGB5-3FLAG-CBh-gcGFP-IRES-puromycin. Its plasmid map is shown below. Figure 2 As shown.
[0048] The nucleotide sequence of the ITGβ5 gene is shown in SEQ ID NO. 1.
[0049] SEQ ID NO. 1: atgcc gcgggccccg gcgccgctgt acgcctgcct cctggggctc tgcgcgctcctgccccggct cgcaggtctc aacatatgca ctagtggaag tgccacctca tgtgaagaat gtctgctaatccacccaaaa tgtgcctggt gctccaaaga ggacttcgga agcccacggt ccatcacctc tcggtgtgatctgagggcaa accttgtcaa aaatggctgt ggaggtgaga tagagagccc agccagcagc ttccatgtcctgaggagcct gcccctcagc agcaagggtt cgggctctgc aggctgggac gtcattcaga tgacaccacaggagatgcc gtgaacctcc ggcccggtga caagaccacc ttccagctac aggttcgcca ggtggagactatcctgtgg acctgtacta cctgatggac ctctccctgt ccatgaagga tgacttggac aatatccggagcctgggcac caaactcgcg gaggatga ggaagctcac cagcaacttc cggttgggat ttgggtcttttgttgataag gacatctctc ctttctccta cacggcaccg aggtaccaga ccaatccgtg cattggttacaagttgtttc caaattgcgt cccctccttt gggttccgcc atctgctgcc tctcacagac agagtggacagcttcaatga ggaagttcgg aaacagaggg tgtcccggaa ccgagatgcc cctgagggg gctttgatgcagtactccag gcagccgtct gcaaggagaa gattggctgg cgaaaggatg cactgcattt gctggtgttcacaacagatg atgtgcccca catcgcattg gatggaaaat tgggaggcct ggtgcagcca cacgatggccagtgccacct gaacgaggccaacgagtaca ctgcatccaa ccagatggac tatccatccc ttgccttgcttggagagaaa ttggcagaga acaacatcaa cctcatcttt gcagtgacaa aaaaccatta tatgctgtacaagaatttta cagccctgat acctggaaca acggtggaga ttttagatgg agactccaaa aatattattcaactgattat taatgcatac aatagtatcc ggtctaaagt ggagttgtca gtctgggatc agcctgaggatcttaatctc ttctttactg ctacctgcca agatggggta tcctatcctg gtcagaggaa gtgtgagggtctgaagattg gggacacggc atcttttgaa gtatcattgg aggcccgaag ctgtcccagc agacacacggagcatgtgtt tgccctgcgg ccggtgggat tccgggacag cctggaggtg ggggtcacct acaactgcacgtgcggctgc agcgtggggc tggaacccaa cagcgccagg tgcaacggga gcgggaccta tgtctgcggcctgtgtgagt gcagccccgg ctacctgggc accaggtgcg agtgccagga tggggagaac cagagcgtgtaccagaacct gtgccgggag gcagagggca agccactgtg cagcgggcgt ggggactgca gctgcaaccagtgctcctgc ttcgagagcg agtttggcaa gatctatggg cctttctgtg agtgcgacaa cttctcctgtgccaggaaca agggagtcct ctgctcaggc catggcgagt gtcactgcgg ggaatgcaag tgccatgcaggttacatcgg ggacaactgt aactgctcga cagacatcag cacatgccgg ggcagagatg gccagatctgcagcgagcgt gggcactgtc tctgtgggcagtgccaatgc acggagccgg gggcctttgg ggagatgtgtgagaagtgcc ccacctgccc ggatgcatgc agcaccaaga gagattgcgt cgagtgcctg ctgctccactctgggaaacc tgacaaccag acctgccaca gcctatgcag ggatgaggtg atcacatggg tggacaccatcgtgaaagat gaccaggagg ctgtgctatg tttctacaaa accgccaagg actgcgtcat gatgttcacctatgtggagc tccccagtgg gaagtccaac ctgaccgtcc tcagggagcc agagtgtgga aacacccccaacgccatgac catcctcctg gctgtggtcg gtagcatcct ccttgttggg cttgcactcc tggctatctggaagctgctt gtcaccatcc acgaccggag ggagtttgca aagtttcaga gcgagcgatc cagggcccgctatgaaatgg cttcaaatcc attatacaga aagcctatct ccacgcacac tgtggacttc accttcaacaagttcaacaa atcctacaat ggcactgtgg actga The P3 (generation 3) UCMSCs prepared in Example 1 were resuspended in human mesenchymal stem cell complete culture medium to a density of 1.5 × 10⁻⁶. 4 Cells were cultured at a concentration of 100 cells / mL and then seeded into 6-well plates, 2 mL of cell suspension per well. The plates were incubated at 37°C for 24 h until cell confluence reached 30%. Then, ITGβ5 overexpressing virus solution was added; the lentivirus transfection concentration was 1 × 10⁻⁶. 7 TU / mL, cultured at 37℃ for 16 h. Then, the medium was changed to selection medium (puronomycin concentration 1 μg / mL + complete human mesenchymal stromal cell culture medium), and cultured for another day, then the medium was changed back to complete human mesenchymal stromal cell culture medium. Cultured to the 5th generation, resulting in engineered umbilical cord mesenchymal stromal cells stably overexpressing ITGβ5 and specifically targeting the liver, abbreviated as ITGβ5-UCMSCs; the control group consisted of UCMSCs without ITGβ5 virus solution. Finally, the viral transfection efficiency was detected by Western blot and flow cytometry, and the results are shown below. Figure 3 .
[0050] like Figure 3 As shown, compared with the UCMSCs group that does not express ITGβ5 protein, the ITGβ5-UCMSCs group showed a significant increase in ITGβ5 protein expression level in the resulting ITGβ5-UCMSCs after transfection with ITGβ5-overexpressing lentivirus, thus demonstrating the good effect of lentivirus infection.
[0051] Example 3: Preparation and detection of engineered umbilical cord mesenchymal stromal cell exosomes that stably overexpress ITGβ5 and specifically target the liver The fifth-generation engineered umbilical cord mesenchymal stromal cells specifically targeting the liver, prepared in Example 2, were cultured until 85% confluence. The culture medium was then replaced with low-glucose DMEM serum-free medium (Gibco, catalog number 10567014), and cultured for another 48 hours. The resulting cell culture medium was collected. The collected cell culture medium was centrifuged at 2000×g, 4°C for 10 min to remove live and dead cells, and the cell supernatant was collected. The obtained cell supernatant was centrifuged at 10000×g, 4°C for 10 min to remove cell debris, and the supernatant was collected to obtain the first centrifugation supernatant. The first centrifugation supernatant was added to an ultracentrifuge tube and centrifuged at 100000×g, 4°C for 70 min. The supernatant was collected, and apoptotic bodies and microvesicles were removed to obtain the second centrifugation supernatant. The second centrifugation supernatant was added to an ultracentrifuge tube and centrifuged at 100000×g, 4°C for 70 min. The liquid in the tube was discarded, and the precipitate was collected. PBS was repeatedly pipetted and resuspended in the tubes to obtain engineered umbilical cord mesenchymal stromal cell exosomes stably overexpressing ITGβ5 and specifically targeting the liver, abbreviated as ITGβ5-UCMSCs-Exo, which were stored at -80℃ for later use. The control group consisted of umbilical cord mesenchymal stromal cell exosomes not expressing ITGβ5, abbreviated as UCMSCs-Exo. Morphological characterization and property analysis of the obtained ITGβ5-UCMSCs-Exo were performed, and the results are shown below. Figure 4 and Figure 5 .
[0052] Transmission electron microscopy identification of exosome morphology: results are as follows Figure 4 As shown in Figure A, both UCMSCs-Exo and ITGβ5-UCMSCs-Exo appeared as round vesicles under transmission electron microscopy, with UCMSCs-Exo being umbilical cord mesenchymal stromal cell exosomes.
[0053] NTA particle size determination: The extracted exosome stock solution was diluted 1000 times and then subjected to NTA for particle size determination. The results are as follows: Figure 4 As shown in Figure B, the particle size of the obtained ITGβ5-UCMSCs-Exo is between 30-150 nm.
[0054] Western blot analysis was performed on the expression levels of exosomal ITGβ5, the exosomal negative marker Calnexin, the positive marker TSG101, and the MSC marker CD90. The results are as follows: Figure 5 As shown, the expression level of ITGβ5 protein in ITGβ5-UCMSCs-Exo was significantly increased compared with that in UCMSCs-Exo.
[0055] The above results show that, compared with natural exosomes (UCMSCs-Exo), the ITGβ5-UCMSCs-Exo prepared in this invention also appear as round vesicles under transmission electron microscopy, and their particle size is between 30-150 nm; and the expression level of ITGβ5 protein is significantly improved while maintaining the normal expression of exosome markers.
[0056] Example 4: In vitro colocalization detection of exosomes from liver Kupffer cells and engineered umbilical cord mesenchymal matrix cells Kupffer cells isolated from mouse (wild-type C57BL / 6 mice) livers were resuspended in complete culture medium to a density of 5 × 10⁻⁶. 5 Cell suspension was prepared at 2 × 10⁶ cells / mL using a complete culture medium consisting of high-glucose DMEM (Gibco, catalog number 10564011) + 10% FBS + 1% PS. Cells were then cultured at 2 × 10⁶ cells / well. 5 Cells were seeded in 12-well plates containing poly-L-lysine-coated climbing sheets, with 1 mL of cell suspension per well. After 12 hours of incubation to allow cell adhesion, the culture medium was replaced with a medium containing 3 × 10⁻⁶ cells / well. 6 Complete culture medium containing CMDil-labeled exosomes at a density of 1 / mL (invitrogen, catalog number C7001) (low-glucose DMEM (Gibco, catalog number 10567014) + 10% FBS (Gibco, catalog number 10099141C) + 1% PS (Gibco, catalog number 15140122)) was used to culture exosomes in two groups: UCMSCs-Exo group (CMDil-labeled UCMSCs-Exo) and ITGβ5-UCMSCs-Exo group (CMDil-labeled ITGβ5-UCMSCs-Exo). Cells were cultured at 37°C for 24 h. After culture, cells from each group were mounted and immunofluorescence assayed. The specific procedure was as follows: ① Fixation: After washing the cells on the slide three times with PBS, fix them with 4% paraformaldehyde at room temperature for 30 minutes, and then wash them three times with PBS.
[0057] ② Permeability: Treat the slides with 0.25% Triton X-100 at room temperature for 20 minutes, and wash three times with PBS.
[0058] ③ Sealing: Use 5% FBS to seal at room temperature for 1 hour.
[0059] ④ Primary antibody incubation: Kupffer cells were labeled with F4 / 80 antibody (ab300421, abcam) and blocked overnight at 4°C.
[0060] ⑤ Washing: Wash three times with PBS, 8 minutes each time.
[0061] ⑥ Secondary antibody incubation: Incubate with 568-labeled secondary antibody (Alexa Fluor 568, Invitrogen) at room temperature for 1 hour.
[0062] ⑦ Washing: Wash three times with PBS, 8 minutes each time.
[0063] ⑧ Mounting: Use mounting medium containing DAPI for mounting. After the mounting medium dries, store at 4°C protected from light.
[0064] ⑨ Fluorescence imaging: The slides were photographed using a confocal microscope. The results are shown in […]. Figure 6 .
[0065] like Figure 6 The results showed that, compared with the control group (UCMSCs-Exo), the number of ITGβ5-UCMSCs-Exo cells overexpressing ITGβ5 was significantly increased in the ITGβ5-UCMSCs-Exo group.
[0066] Example 5: In vivo antifibrotic efficacy assay of liver-targeted engineered umbilical cord mesenchymal matrix cell exosomes Construction of a mouse model of liver fibrosis: Healthy male C57BL / 6J mice were acclimatized for one week. The fibrosis model group was intraperitoneally injected with 25% CCl4-corn oil solution at a dose of 0.15 mL / kg, twice a week for eight weeks. The control group was injected with the same volume of corn oil. On days 15, 29, 43, and 57 after modeling, orbital blood was collected from mice to detect changes in alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. Liver tissue was also collected for hematoxylin-eosin staining (HE) and Masson staining. Criteria for successful establishment of a liver fibrosis model: Compared with the control group, mice in the model group showed lethargy, rough and messy fur, and significantly elevated levels of liver function ALT and AST. As the modeling time increased, the severity of liver lesions in mice progressively worsened. At 4 weeks, hepatocytes were damaged, with localized hepatocyte degeneration, swelling, and localized necrosis foci. Fibrosis or small nodular changes appeared in the portal area, consistent with the pathological diagnosis of early liver fibrosis. At 6 weeks, there was a tendency for pseudolobule formation. At 8 weeks, the surface of the liver of mice had a granular appearance, and under the microscope, the fibrosis in the portal area extended into the lobules, indicating moderate liver fibrosis.
[0067] The model mice were then randomly divided into three groups: a liver fibrosis model group, a liver fibrosis UCMSCs-Exo treatment group, and a liver fibrosis ITGβ5-UCMSCs-Exo treatment group. A healthy control group was also included. Each group consisted of 10 mice. The mice were then treated as follows: all groups received intervention once a week for a total of 4 weeks.
[0068] Normal control group: Healthy mice were treated with 200 μL PBS via tail vein injection; Liver fibrosis model group (Control): Liver fibrosis model mice were treated with 200 μL PBS via tail vein injection; Liver fibrosis UCMSCs-Exo treatment group (UCMSCs-Exo): In mice with a liver fibrosis model, treatment with 1×10 9 One UCMSCs-Exo (resuspended in 200 μL PBS) was administered via tail vein injection; The liver fibrosis ITGβ5-UCMSCs-Exo group (ITGβ5-UCMSCs-Exo): This group was used in liver fibrosis model mice at a dose of 1×10⁻⁶. 9 One ITGβ5-UCMSCs-Exo (resuspended in 200 μL PBS) was administered via tail vein injection.
[0069] Mice were sacrificed and their tissues collected at week 13 of modeling. Blood ALT / AST levels were measured in each group of mice, and liver tissue samples were collected for pathological staining. Results are shown below. Figure 7 .
[0070] like Figure 7 As shown, compared with the Normal group, the Control group of model mice showed significantly increased fibrosis in gross liver examination, HE staining of pathological sections, and Masson staining of collagen deposition, indicating successful establishment of the liver fibrosis model. Furthermore, the ITGβ5-UCMSCs-Exo treatment group showed significantly lower fibrosis in gross liver examination, HE staining of pathological sections, and Masson staining of collagen deposition compared to the UCMSCs-Exo treatment group, and significantly lower ALT and AST levels in liver function compared to the UCMSCs-Exo treatment group. These results indicate that exosome intervention can alleviate liver damage and fibrosis in liver fibrosis mice, and the ITGβ5-UCMSCs-Exo intervention group is more effective than the UCMSCs-Exo treatment group.
[0071] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the methods and techniques disclosed above without departing from the scope of the present invention to create equivalent embodiments. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. An engineered exosome that specifically targets the liver, characterized in that, The exosomes are derived from mesenchymal stromal cells that overexpress integrin subunit β5, which are prepared by lentiviral infection.
2. The engineered exosomes specifically targeting the liver according to claim 1, characterized in that, The mesenchymal stromal cells include umbilical cord mesenchymal stromal cells, bone marrow mesenchymal stromal cells, adipose mesenchymal stromal cells, dental pulp mesenchymal stromal cells, placental mesenchymal stromal cells, amniotic membrane mesenchymal stromal cells, synovial mesenchymal stromal cells, and thymic mesenchymal stromal cells.
3. The engineered exosomes specifically targeting the liver according to claim 1, characterized in that, The lentivirus is LV-ITGB5-3FLAG-CBh-gcGFP-IRES-puromycin, which overexpresses the integrin subunit β5.
4. The method for preparing engineered exosomes specifically targeting the liver according to any one of claims 1-3, characterized in that, The method includes the following steps: S1: Mesenchymal stromal cells to be treated are transfected with a lentivirus that overexpresses integrin subunit β5, so that the mesenchymal stromal cells overexpress integrin subunit β5. S2: Mesenchymal stromal cells containing integrin subunit β5 were cultured. S3: Centrifuge to collect the cell supernatant after the culture treatment; S4: The cell supernatant is centrifuged multiple times to obtain mesenchymal matrix cell exosomes overexpressing integrin subunit β5.
5. The preparation method according to claim 1, characterized in that, In step S1, the mesenchymal matrix cells to be treated are mesenchymal matrix cells cultured to the 3rd-5th generation.
6. The preparation method according to claim 1, characterized in that, In step S2, the culture conditions are as follows: culture medium: serum-free basal medium, temperature: 37°C, time: 48h.
7. The preparation method according to claim 1, characterized in that, In step S3, the centrifugation conditions are: temperature 4℃, rotation speed 2000×g, and time 10min.
8. The preparation method according to claim 1, characterized in that, In step S4, the multiple centrifugations include the following steps: (i) Centrifuge the cell supernatant at 4°C and 10000×g for 10 min, and collect the supernatant to obtain the first centrifugation supernatant; (ii) Centrifuge the first centrifugal supernatant at 4°C and 100,000 × g for 70 min, and take the supernatant to obtain the second centrifugal supernatant; (iii) Centrifuge the second centrifugation supernatant at 4°C and 100,000×g for 70 min, take the precipitate, wash with PBS buffer and resuspend to obtain cell exosomes.
9. A product for treating liver diseases, characterized in that, The product comprises engineered exosomes that specifically target the liver as described in any one of claims 1-3; The liver diseases mentioned include autoimmune liver disease, non-alcoholic fatty liver disease, acute liver injury, liver fibrosis, cirrhosis, and liver ischemia-reperfusion injury. The exosomes target liver-resident Kupffer cells.
10. The use of engineered exosomes specifically targeting the liver according to any one of claims 1-3 or the product according to claim 9 in the preparation of a medicament for treating liver diseases; The liver diseases mentioned include autoimmune liver disease, non-alcoholic fatty liver disease, acute liver injury, liver fibrosis, cirrhosis, and liver ischemia-reperfusion injury. The exosomes or products target liver-resident Kupffer cells.