Method for determining the presence of retroviral-like particles

The ddPCR method addresses the limitations of TEM by precisely and accurately detecting RVLPs through RNA-focused ddPCR, enhancing sensitivity and reproducibility, and reducing analysis time and variability, ensuring safer biologic materials for medicaments.

WO2026008609A1PCT designated stage Publication Date: 2026-01-08ARES TRADING SA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/068652
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-01
Filing Date
2025-07-01
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

Current methods for detecting and quantifying RetroViral Like Particles (RVLPs) in biologic materials used in medicaments, such as the TEM method, suffer from variability, low sensitivity, and lack of reproducibility, posing safety and regulatory concerns due to potential hamster-to-human transmission risks and interference with other adventitious agents.

Method used

A droplet digital PCR (ddPCR) method is developed to detect RVLPs by treating samples with DNase and RNase to remove genomic DNA and RNA, followed by ddPCR using two different amplification mixes to quantify RNA copies, allowing for precise and accurate detection of RVLPs through statistical analysis of fluorescence signals.

Benefits of technology

The ddPCR method provides enhanced sensitivity, reproducibility, and reduced variability, achieving a better detection limit of 1.4 x 104 RVLPs/ml, requiring only 1 ml of sample, and significantly reducing analysis time from 80 days to 14 days, while ensuring accurate RVLP quantification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000007_0001
    Figure IMGF000007_0001
  • Figure IMGF000010_0001
    Figure IMGF000010_0001
  • Figure IMGF000010_0002
    Figure IMGF000010_0002
Patent Text Reader

Abstract

Provided herein is a method for determining RetroViral Like Particles (RVLPs) using ddPCR (digital droplet PCR). The method enables screening of samples from a manufacturing process for biologic materials to be used as medicaments. As such the method can be used in batch release processes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHOD FOR DETERMINING THE PRESENCE OF RETROVIRAL-LIKE PARTICLES

[0002] Field of the Invention

[0003] The present invention is in the field of diagnostics in the manufacturing process for biologic materials. Such biologic materials may be used in medicaments for the treatment of mammalians, including medicaments for the treatment of humans. Provided herein is a method for determining RetroViral Like Particles (RVLPs) using ddPCR (digital droplet PCR). The method enables screening of samples from a manufacturing process for biologic materials to be used as medicaments. As such the method can be used in batch release processes.

[0004] Background

[0005] In the manufacturing of medicaments, particularly those that use biologic methods such in the production of biologic material for human (or mammalian) medicaments, screening for the presence or absence of RetroViral Like Particles (RLVPs) is an important aspect for determining the suitable for use as a medicament. The current method uses "Virus Particle Detection and Quantification by Ultracentrifugation and Thin Section Electron Microscopy" method (hereinafter "TEM method"). The TEM method remains the reference method for commercial products or products under clinical trials.

[0006] The Chinese Hamster Ovary (CHO) cells used to produce biopharmaceutical proteins are known to contain type-C endogenous retrovirus (ERV) sequences in their genome and to release retroviral-like particles (RVLP). Although RVLPs are shown to be non-infectious and not associated with any diseases in humans, their presence raises safety and regulatory concerns. For instance, there is a risk that these RVLPs lead to a possible hamster to human transmission. Moreover, these RVLPs can also interfere with the detection of other adventitious agents.

[0007] The quantitative estimation of RVLPs in unprocessed bulk harvest material is therefore important to assess the adequacy of virus removal / inactivation determined by the viral clearance studies for the entire manufacturing process. The entire purification process should be able to eliminate substantially more virus than is estimated to be present in a single-dose equivalent of unprocessed bulk.

[0008] Currently, the analytical method applied for the RVLPs detection in unprocessed bulk harvest samples is the TEM method "Virus Particle Detection and Quantification by Ultracentrifugation and Thin Section Electron Microscopy". The main principles of this method are summarized as follows: After clarification and ultra-centrifugation, the resultant pellet is re-suspended and mixed with agar. The sample / agar matrix is then fixed, stained, dehydrated, infiltrated to resin and polymerized. Ultrathin sections are cut with an ultra-microtome and mounted on electron microscope grids. After staining, the sections are examined by TEM (Transmission Electron Microscopy) in such a way that no grid square is scored more than once.

[0009] The grid squares are examined for the presence of viruses, virus-like particles and other extraneous agents. A minimum of ten grid squares are examined and a count performed. In the event no viruses or virus-like particles are observed, the number of grid squares required to achieve a theoretical detection limit of l.OxlO5VLPs / ml of sample are examined.

[0010] It has been observed that there can be a marked variability in the results, even for the same samples. Accordingly, there is a need for an alternative reliable and accurate method for determining the presence or absence of RLVPs.

[0011] Summary of the Invention

[0012] The method of the present invention is a method based on droplet digital PCR, "Retro-Virus Like Particles by droplet digital PCR (ddPCR) in Unprocessed Bulk Harvest Sample" for RVLP detection and has a better robustness, higher sensitivity and higher reproducibility.

[0013] The method of the present invention can be performed as follows:

[0014] The sample is treated with DNase and RNase to eliminate most of the genomic DNA and RNA of circulating RVLP. This step allows to quantify only the RNA extracted from intact RVLP particles, each containing two copies of RNA. The RNA from intact RVLPs is then extracted (in 3 different replicates) using an automatic extraction system, amplified, and quantified using ddPCR system.

[0015] The droplet digital PCR (ddPCR) technology allows to determine the presence of target nucleic acids in biological samples and performs an absolute quantification. The absolute quantification of the nucleic acid molecules is possible thanks to a system distributing the sample into small droplets of water-oil emulsion one nanoliter in size.

[0016] After the sample is randomly distributed in the individual droplets in each of these, a PCR or RT-PCR reaction is performed with a fluorescent probe. Following the PCR reaction, the droplets are analyzed individually by measuring the fluorescence signal emitted by the probe. Based on the number of droplets that are positive or negative, and using the subsequent statistical calculations based on the Poisson distribution, the absolute quantity of nucleic acids present in the sample is obtained. The method for determining RVLPs of the present invention as performed in accordance with the above, includes that the sample is analyzed in single by ddPCR using two different amplification Mixes: one to amplify both RNA and DNA, which contains the Retro Transcription enzyme, and the other to amplify DNA only, which does not contain the Retro transcription enzyme.

[0017] Sample amplification with the two different Master Mixes allows the quantification of RVLP particles considering only the number of extracted RNA copies, thus excluding the number of copies derived from the genomic DNA still present in the extract. To calculate the Retrovirus-Like Particles in the sample, the value of copies' number obtained in each replicate of the sample, amplified with the RT-ddPCR Master Mix, is subtracted from the value of copies' number in each replicate of the sample amplified with the NO-RTddPCR Master Mix.

[0018] The final value of the number of RVLP particles present in the sample is given as the average of the RVLP / mL obtained in each replicate tested.

[0019] In one embodiment of the present invention for the method for determining RVLPs provides a method for determining RetroViral-Like Particles (RVLPs) in a sample, the method comprising a. Obtaining a biologic sample from a manufacturing process for the production of a biologic composition, b. Treating the biologic sample with both DNase and RNase to remove host cell genome and circulating RNA, c. Extracting nucleic acid material from the treated biologic sample of step b), d. Preparing two reaction mixtures, a first reaction mixture (RT Mix) for both DNA and RNA amplification and a second reaction mixture (NO-RT Mix) for DNA amplification, e. Adding an amount of the extracted nucleic acid materials from step c) to each of the two reaction mixtures of step d), f. Applying PCR amplification to each of the reaction mixtures of step e), and g. Determine the presence or absence of retrovirus materials by subtracting the results of the first and second part of the amplification of the extracted nucleic acid materials.

[0020] In a further embodiment of the method of the present invention, the first reaction mixture (RT- Mix) comprises reverse transcriptase and the second reaction mixture (No-RT Mix) does not comprise reverse transcriptase. Detailed Description

[0021] The method of the present invention provides a robust, predictable and highly accurate method for the determination of RVLPs in a sample from a manufacturing process to prepare a biologic material that can be used for the use in a medicament for the treatment of humans / mammalians.

[0022] In one embodiment of the present invention for the method for determining RVLPs provides a method for determining RetroViral-Like Particles (RVLPs) in a sample, the method comprising a. Obtaining a biologic sample from a manufacturing process for the production of a biologic composition, b. Treating the biologic sample with both DNase and RNase to remove host cell genome and circulating RNA, c. Extracting nucleic acid material from the treated biologic sample of step b), d. Preparing two reaction mixtures, a first reaction mixture (RT Mix) for both DNA and RNA amplification and a second reaction mixture (NO-RT Mix) for DNA amplification, e. Adding an amount of the extracted nucleic acid materials from step c) to each of the two reaction mixtures of step d), f. Applying PCR amplification to each of the reaction mixtures of step e), and g. Determine the presence or absence of retrovirus materials by subtracting the results of the first and second part of the amplification of the extracted nucleic acid materials.

[0023] This method of the present invention better detects the presence of RVLPs than the current TEM methods. The method provides an increased accuracy in respect to TEM method due to the ability of the ddPCR method to discriminate RVLP from the empty particles with the detection of RNA component of RVLP. Moreover, the present invention provides a method with increased reproducibility in respect to TEM method observing a reduced result variability when the same batch of the same product is tested (lower than 25%). In addition, only a low sample volume is needed for testing (1 ml) (instead of 20 ml needed for TEM analysis). Also the method of the present invention provides decreased timelines for results availability (lead time of 14 days, instead of up to 80 days needed for TEM), thus better fitting with the new DS development timelines. Finally, the method of the present invention provides a better detection limit (1.4 x 104RVLPs / ml, instead of 1.0 x 105RVLPs / ml for TEM). Therefore, the method of the present invention satisfies a need for having a faster method providing a better accuracy and sensitivity. In some embodiments of the method of the present invention, the biologic sample is a bulk harvest sample, e.g. a unprocessed bulk harvest sample.

[0024] In some embodiments of the method of the present invention, the PCR amplification is a droplet digital PCR (ddPCR) amplification.

[0025] In some embodiments of the method of the present invention, the method further comprises treating the material from step b) with DNase only before step c).

[0026] In some embodiments of the method of the present invention, the host cell is a Chinese Hamster Ovary (CHO) cell.

[0027] In some embodiments of the method of the present invention for PCR amplification a primer and probe set is used with a RVLP Forward Primer with the sequence CCTCCTCCAGACTCTTG (SEQ ID No.l), a RVLP Reverse Primer with the sequence ATACGGGCTTCCGTTAG (SEQ ID No.2) and a RVLP Probe with the sequence CCAAGAAGGCCCAGATATGTCA (SEQ ID No.3).

[0028] In some embodiments of the method of the present invention, the first reaction mixture (RT- Mix) comprises reverse transcriptase and the second reaction mixture (No-RT Mix) does not comprise reverse transcriptase. In some of these embodiments, the preparation of the two mixtures from step d) is performed with for the first reaction mixture (RT Mix): 5 pl / well of SuperMix, 2 pl / well of Reverse Transcriptase, 1 pl / well of 300 mM DTT, 0.225 pl / well of RVLP Forward Primer 80 pM (sequence CCTCCTCCAGACTCTTG) (SEQ ID No.l), 0.225 pl / well of RVLP Reverse Primer 80 pM (sequence ATACGGGCTTCCGTTAG) (SEQ ID No.2), 0.5 pl / well of RVLP Probe 10 pM (sequence CCAAGAAGGCCCAGATATGTCA) (SEQ ID No.3), and 8.1 pl / well of Water for Molecular Biology; and for the second reaction mixture (NO-RT Mix): 5 pl / well of SuperMix, 1 pl / well of 300 mM DTT, 0.225 pl / well of RVLP Forward Primer 80 pM (sequence CCTCCTCCAGACTCTTG) (SEQ ID No.l), 0.225 pl / well of RVLP Reverse Primer 80 pM (sequence ATACGGGCTTCCGTTAG) (SEQ ID No.2), 0.5 pl / well of RVLP Probe 10 pM (sequence CCAAGAAGGCCCAGATATGTCA) (SEQ ID No.3), and 11.5 pl / well of Water for Molecular Biology.

[0029] In some embodiments, PCR amplification (e.g. a PCR or RT-PCR reaction) is performed with a fluorescent probe. In some embodiments where droplet digital PCR (ddPCR) amplification is used, after the sample is randomly distributed in the individual droplets in each of these, a PCR or RT-PCR reaction is performed with a fluorescent probe. In such embodiments, following the PCR reaction, the droplets can be analyzed individually by measuring the fluorescence signal emitted by the probe. Based on the number of droplets that are positive or negative, and using the subsequent statistical calculations based on the Poisson distribution, the absolute quantity of nucleic acids present in the sample can be obtained.

[0030] Sample amplification with the two different Master Mixes (e.g. first reaction mixture (RT Mix) and a second reaction mixture (NO-RT Mix)) allows the quantification of RVLP particles considering only the number of extracted RNA copies, thus excluding the number of copies derived from the genomic DNA still present in the extract. In some embodiments where ddPCR is used, to calculate the Retrovirus- Like Particles in the sample, the value of copies' number obtained in the sample (e.g. in each replicate) amplified with the RT-ddPCR Master Mix, is subtracted from the value of copies' number in the sample (e.g. in each replicate) amplified with the NO-RTddPCR Master Mix.

[0031] Table 1: Summary Table of the Benefits & Risks for ddPCR and TEM methods Examples

[0032] Unprocessed Bulk Harvest of CTLA4_aOX (hereinafter reported as COX) and MSLN_CD137 (hereinafter reported as MN7) were tested. In addition, genomic extract from CHO-K1 cells containing type-C endogenous retrovirus (ERV) target sequence was used to test specificity, accuracy and method LOQ as a certified RNA standard was not available.

[0033] A panel of positive and negative controls were used to ensure the validity of the results.

[0034] • Linearity: Linearity was assessed as the ability of the method to quantify RVLP by ddPCR in 5 serial dilutions of Unprocessed bulk harvest samples (COX and MN7). The linearity of each sample was verified by evaluating the average % recovery of RVLP / ml obtained in the three extractions for each dilution in comparison to the first dilution point.

[0035] • Range: the range of the samples was defined as the dilution range in which linearity has been demonstrated.

[0036] • Specificity: the specificity of the method to amplify the endogenous retro-virus (ERV) target region in different types of CHO hosts (CHO-S, CHO-K1 and CHO-DUKX Bll) and not in other host cells tested (NSO-LD hybridoma cells) was verified. In addition, it was also assessed the specificity of the primer and probe set to detect RVLPs and no other virus species (MVM).

[0037] • Accuracy: the accuracy in quantifying the sequence of the target gene for RVLP was verified by analysing three replicates for three different concentrations of genomic CHO-K1 extract and by valuating the recovery percentage of the endogenous retrovirus (ERV) copies / pl obtained in comparison to the expected value of RVLP copies / pl (defined in the specificity test).

[0038] • Precision: Repeatability was extrapolated from the linearity tests. CV% of RVLP / ml values obtained in the three linearity replicates for the initial dilution of the COX bulk harvest sample was calculated. To assess intermediate precision the same analysis was repeated by a second operator. The RVLP / mL values obtained were evaluated together with those obtained by the first operator in the linearity tests and the CV% of RVLP / ml was calculated on the replicates analysed by the two analysts.

[0039] • Limit of Quantification (LOQ): the LOQ of the method was assessed as the number of RVLP copies / ml that the ddPCR method is able to detect and quantify. The LOQ was verified by analysing 5 replicates of five serial dilutions of genomic CHO-K1 extract and by evaluating the CV%. The value of RVLP copies detected in the lowest dilution which showed a CV% < 25% was used to calculate the LOQ using the following formula: RVLP (particles 111L) =x 2 100*1.5!'5 *’ Dilution Factor 2

[0040] Where:

[0041] - x (copies / 20 pL) is the difference between the number of copies 20 pL obtained with the RT-ddPCR Master Mix and the number of copies 20 pL obtained with the NO-RT-ddPCR Master Mix.

[0042] - 2 is the division factor considering that 2 pL of extracted is loaded into the reaction.

[0043] - 100 is the multiplication factor considering the extract volume.

[0044] - 1.5 is the multiplication factor considering that the sample (200 pL) is diluted before extraction up to a volume of 300 pL.

[0045] - 5 is the multiplication factor to report the number of copes in mL, considering that 200 pL sample is extracted.

[0046] - Dilution Factor is the dilution factor of the sample in question.

[0047] - 2 is the division factor considering that each RVLP particle contains two copies of RNA.

[0048] The above formula was also used for the calculation of LOQ. related to the samples COX and MN7, using as a dilution factor the results obtained in the test of the Linearity and Range of the samples.

[0049] • Robustness: the robustness was assessed by verifying the performance of the analytical method when deliberate changes to the values set for the critical steps are applied. Changes were introduced on the duration of DNAse-RNAse, DNAse and inactivation step incubations.

[0050] Table 2: Comparison of Validation Results between Current (TEM) vs ddPCR method for RVLP detection

[0051] In the frame of the development and validation of ddPCR method for RVLPs detection and quantification, Unprocessed Bulk Harvest samples deriving from different manufacturing processes were tested with both TEM and ddPCR methods.

[0052] In particular, Unprocessed bulk harvest samples collected from perfusion bioreactors at different Working Days (WD), from the steady state to the end of the production phase, were tested from MSLN_CD137 (MN7), CTLA4_aOX40L (COX) and Anti-GD2 ADC processes production, at different scales (50 L, 200L or 2000 L).

[0053] The results obtained are detailed in the Tables reported in following paragraph.

[0054] Table 3: Results for MSLN_CD137 (MN7) GMP run 200 L

[0055] Table 4: Results for CTLA4_aOX40L (COX) Fine-tuning run, GLP run and GMP run

[0056] Table 5: Results for Anti-GD2 GLP run As shown in the reported tables, the results obtained with the ddPCR method in terms of RVLP / ml are lower than the ones obtained with TEM analysis. Indeed, as the method is focusing on RNA component of RVLP, the ddPCR method is able to discriminate the RVLPs from the empty particles which are, on the other hand, not distinguishable by TEM, providing a more reliable and representative quantification of RVLP. In addition, the ddPCR method was demonstrated to be more precise and accurate as no overestimation of RVLP content is shown.

[0057] With ddPCR method, the same trend in RVLPs quantification was observed for each molecule and run tested. Indeed, the highest results in terms of RVLP quantification were observed in the last Working Day (WD) (MN7 GMP, COX GLP and Anti-GD2 GLP runs) and second last WD (COX fine-tuning and COX GMP runs) for all the processes tested.

[0058] With TEM method, the same trend in RVLPs quantification was observed for MN7 GMP, COX fine-tuning, COX GLP and Anti-GD2 GLP runs with the highest results in terms of RVLPs in the last WD (MN7 GMP and COX fine-tuning runs) and second last WD (COX GLP and Anti- GD2 GLP runs).

[0059] However, a different trend was observed for COX GMP run as the highest results in terms of RVLPs were observed in the first WDs. These results are not in line with the ones obtained by ddPCR analysis and by TEM method in the other process runs.

[0060] These results are not considered representative for the following reasons:

[0061] - Protein retention observed in the crude harvest by using an Alternative Tangential Flow (ATF) as cell separation system could be used as a potential surrogate for RVLP retention. For COX GMP run, as the protein retention increased significantly along the culture duration (= 0% at WD9 versus =43% at WD22), an increased RVLP retention would be expected at the end of the culture duration, resulting in higher RVLP levels in the lasts WD, as observed for all other runs and molecules tested by ddPCR and TEM (MN7 GMP, COX fine-tuning and GLP, and Anti-GD2 GLP runs)

[0062] - As described, the ddPCR method is more robust, precise, providing a more reliable and accurate quantification of RVLP than the TEM method as no overestimation of RVLP content is shown.

[0063] - The TEM method is highly variable, based on the results obtained from prior knowledge data, a difference in terms of RVLPs retention up to 3 log was observed by analyzing the same batch of the same product, justifying the high variability of the method.

[0064] For all the reasons reported above, results obtained with TEM method for COX GMP run for WD09 and WD16 samples can be considered as outliers. In conclusion, ddPCR is a more appropriate method to quantify RVLP for perfusion processes where the trend of RVLP production and variations along the culture duration can be established with more accuracy and precision.

[0065] The retroviral -I ike particle count in the Unprocessed bulk harvest is needed to assess the potential viral load per dose of drug product, representing the safety margin of the process. The RVLP testing strategy needs to be adapted depending on the type of culture (fed-batch mode versus perfusion mode). For fed-batch processes, the RVLP testing of the Unprocessed bulk harvest is done at the end of the production phase before the clarification step, where the RVLP level in the bioreactor is the highest.

[0066] For perfusion processes, the cell culture duration might be extended with a continuous forward processing of harvested cell culture material. For this reason, the periodicity of the testing and the representativeness of the samples should be justified, due to the potential for unprocessed bulk to be continually harvested from the production reactor during processing and for the potential for the virus like particles to variate along the cell culture span. There is therefore a need to increase the frequency of sampling. It was assessed that a number of 6 samples, sampled at 6 different Working Days (WD) during the production phase (including the last WD of the culture), from the steady state to the end of the culture, would be suitable to get a trend of RVLP production along the perfusion culture.

[0067] In case of change of the cell separation technology (i.e., ATF) during the culture, a testing needs to be performed the WD before and after the change. Indeed, the potential sieving of RVLP due to the progressive filter fouling would be worst-case in terms of RVLP retention and safety margin estimation.

[0068] Thus, the present invention provides a high sensitivity and accurate droplet digital PCR (ddPCR) method for detecting and quantifying Retrovirus-like particles (RVLPs) in Unprocessed Bulk Harvest samples as alternative to TEM. This method is based on ddPCR technology, allowing an absolute quantification of RVLPs, focusing on RNA component.

[0069] The system was shown to provide highly precise and reproducible quantification of RVLPs starting from a low sample volume (1 ml) and good Limit Of Quantification (1.4 x 104RVLPs / ml).

[0070] A comparability exercise performed on three molecules (COX, MN7 and Anti-GD2) for 5 different runs at different scales (50L, 200L, 2000L, ref. paragraph 7) showed comparable RVLP results quantified by both methods. The same trend in RVLPs quantification was observed along the perfusion processes for each run, with the highest results observed in the lasts WD, except for COX GMP run results obtained by TEM.

Claims

Claims1. A method for determining RetroViral-Like Particles (RVLPs) in a sample, the method comprising a. Obtaining a biologic sample from a manufacturing process for the production of a biologic composition, b. Treating the biologic sample with both DNase and RNase to remove host cell genome and circulating RNA, c. Extracting nucleic acid material from the treated biologic sample of step b), d. Preparing two reaction mixtures, a first reaction mixture (RT Mix) for both DNA and RNA amplification and a second reaction mixture (NO-RT Mix) for DNA amplification, e. Adding an amount of the extracted nucleic acid materials from step c) to each of the two reaction mixtures of step d), f. Applying PCR amplification to each of the reaction mixtures of step e), and g. Determine the presence or absence of retrovirus materials by subtracting the results of the first and second part of the amplification of the extracted nucleic acid materials.

2. The method of claim 1, wherein the PCR amplification is a droplet digital PCR (ddPCR) amplification.

3. The method of any of the preceding claims, further treating the material from step b) with DNase only before step c).

4. The method of any of the preceding claims, wherein the host cell is a Chinese Hamster Ovary (CHO) cell.

5. The method of any of the preceding claims, wherein for PCR amplification a primer and probe set is used with a RVLP Forward Primer with the sequence CCTCCTCCAGACTCTTG (SEQ ID No.1), a RVLP Reverse Primer with the sequence ATACGGGCTTCCGTTAG (SEQ ID No.2) and a RVLP Probe with the sequence CCAAGAAGGCCCAGATATGTCA (SEQ ID No.3).

6. The method of any of the preceding claims, wherein the first reaction mixture (RT-Mix) comprises reverse transcriptase and the second reaction mixture (No-RT Mix) does not comprise reverse transcriptase.

7. The method of claim 6, wherein the preparation of the two mixtures from step d) is performed with: for the first reaction mixture (RT Mix):5 pl / well of SuperMix2 pl / well of Reverse Transcriptase- 1 pl / well of 300 mM DTT- 0.225 pl / well of RVLP Forward Primer 80 pM (sequence CCTCCTCCAGACTCTTG) (SEQ ID No.1)- 0.225 pl / well of RVLP Reverse Primer 80 pM (sequence ATACGGGCTTCCGTTAG) (SEQ ID No.2)- 0.5 pl / well of RVLP Probe 10 pM (sequence CCAAGAAGGCCCAGATATGTCA) (SEQ ID No.3)8.1 pl / well of Water for Molecular Biology and for the second reaction mixture (NO-RT Mix):5 pl / well of SuperMix- 1 pl / well of 300 mM DTT- 0.225 pl / well of RVLP Forward Primer 80 pM (sequence CCTCCTCCAGACTCTTG) (SEQ ID No.1)- 0.225 pl / well of RVLP Reverse Primer 80 pM (sequence ATACGGGCTTCCGTTAG) (SEQ ID No.2)- 0.5 pl / well of RVLP Probe 10 pM (sequence CCAAGAAGGCCCAGATATGTCA) (SEQ ID No.3)11.5 pl / well of Water for Molecular Biology

Citation Information

Patent Citations

  • Modular extracellular sensor architecture for regulating genes

    US20190338262A1

  • Systems and methods for characterizing and treating disease

    US20220081726A1