Pharmaceutical composition containing her2-binding lipid nanoparticles loaded with mRNA encoding p53 protein

Abstract

The present invention relates to a pharmaceutical composition containing HER2-binding lipid nanoparticles loaded with mRNA encoding p53 protein. The so-called "p53 mRNA-loaded HER-binding lipid nanoparticles" developed in the present invention were verified to deliver p53 mRNA, a tumor inhibitor, which targets highly expressed HER2 in a "human epidermal growth factor receptor 2 (HER2)-positive cancer cell" model, and thus can induce cancer cell death without systemic toxicity.

Description

Pharmaceutical composition comprising HER2-binding lipid nanoparticles loaded with mRNA encoding p53 protein

[0001] The present invention relates to a pharmaceutical composition containing a HER2-binding lipid nanoparticle loaded with mRNA encoding a p53 protein, and more specifically, to a pharmaceutical composition for treating or preventing 'HER2-positive cancer' containing 'a HER2-binding lipid nanoparticle loaded with mRNA encoding a p53 protein' as an active ingredient.

[0002]

[0003] Recent advances in messenger RNA (mRNA) synthesis have enabled therapeutic modification of gene expression in vivo, particularly in cancer treatment. These mRNAs are being utilized in a variety of applications, including personalized mRNA cancer vaccines, expression of immune modulators, and upregulation of tumor suppressor genes. However, to fully utilize the therapeutic potential of in vivo mRNA, a protective carrier capable of protecting it from enzymatic degradation under biological conditions is essential.

[0004] Lipid nanoparticles (LNPs) have emerged as powerful carriers for mRNA delivery, protecting against ribonuclease (RNase) degradation and promoting enhanced cellular uptake. The recent success of LNP-based mRNA vaccine delivery against coronavirus disease highlights their potential application in cancer therapy.

[0005] However, despite the increasing utility of LNPs as mRNA carriers, their mRNA delivery efficiency in tumor tissues remains insufficient, and unintended long-term accumulation can compromise therapeutic outcomes and potentially cause off-target side effects, particularly LNP-associated liver toxicity.

[0006] However, functionalizing LNPs by conjugating target-specific ligands can improve mRNA delivery efficiency at the target site while minimizing toxicity in normal tissues. Antibodies, in particular, are attracting attention as versatile candidates for targeting ligands due to their high specificity and binding affinity. They possess a Y-shaped arm that recognizes the target receptor (Fab) and a tail region that can be conjugated to LNPs.

[0007] However, to bind antibodies to LNPs, the antibody must be bound to the LNP while maintaining the correct orientation to ensure structural integrity and unhindered binding to the target receptor. However, existing methods for immobilizing antibodies to LNPs require complex chemical processes, such as introducing hydrophobic functional groups (e.g., DBCO, BCN, N3) to both the LNP and the antibody.

[0008] This process inevitably leads to the formation of byproducts, damages the antibody structure, and risks unpredictable orientation changes. Furthermore, this could potentially lead to a decrease in the antibody's binding affinity.

[0009]

[0010] The present invention is to load mRNA encoding p53 protein, which has recently been in the spotlight as an anticancer agent, onto the "antibody-conjugated lipid nanoparticle comprising an antibody bound to a membrane scaffold protein" developed by the inventor of the present invention and published after a patent application was filed, and to use an antibody capable of binding to human epidermal growth factor receptor 2 (HER2) as the antibody to confirm whether p53 can be expressed in the cancer cell tissue and play a role as an anticancer agent.

[0011]

[0012] The present invention provides a pharmaceutical composition for treating or preventing 'HER2-positive cancer', which contains as an active ingredient a 'HER2-binding lipid nanoparticle' in which an 'antibody or antibody fragment thereof capable of binding to human epidermal growth factor receptor 2 (HER2)' bound to a membrane scaffold protein is bound to a hydrophobic portion of a lipid forming a lipid nanoparticle through a hydrophobic bond via a membrane scaffold protein, and in which an mRNA encoding a p53 protein is loaded inside the lipid nanoparticle.

[0013] In the pharmaceutical composition of the present invention, the 'HER2 positive cancer' may preferably be 'cancer in which HER2 is overexpressed compared to normal cells'.

[0014] In the pharmaceutical composition of the present invention, the HER2-positive cancer may be, for example, breast cancer or ovarian cancer.

[0015] In the pharmaceutical composition of the present invention, the 'HER-binding lipid nanoparticle' may be preferably administered into a living body through blood.

[0016]

[0017] The present invention has confirmed that the so-called 'p53 mRNA-loaded HER-binding lipid nanoparticle' developed in the present invention can induce cancer cell death without systemic toxicity by delivering p53 mRNA, a tumor suppressor, to highly expressed HER2 in a "human epidermal growth factor receptor 2 (HER2) positive cancer cell" model.

[0018]

[0019] Figures 1a–1k show the construction and characterization results of the GrAb platform. Figure 1a, schematic diagram of the graber antibody (GrAb). Figure 1b, schematic diagram of IgH and IgL used for the production of GrAb. Figure 1c, SDS-PAGE analysis of purified GrAb stained with Coomassie blue. ApoA1 and ApoE3 lanes were excised from another gel. Figure 1d, composition of GrAb-LNPs. Figure 1e, Z-average size and zeta potential plots of GrAb-LNPs with various LP ratios measured by DLS. Figure 1f, mRNA encapsulation efficiency of GrAb-LNPs with various LP ratios assessed by RiboGreen analysis. Figure 1g, Z-average sizes of LNPs and GrAb-LNPs measured at various time points after storage at 4°C. Figure 1h, SDS-PAGE analysis of proteins assembled into LNPs after purification by size exclusion chromatography using a Superdex 200 Increase 10 / 300 GL column. Figure 1i, Quantification of the ratio of antibody and GrAb incorporated into LNPs by measuring the Cy5 fluorescence remaining in the proteins after Amicon filtering to remove unbound proteins (the left bar graph in the graph is regular Ab, and the right bar graph is GrAb). Figure 1j, Quantification of GrAb assembled onto the surface of a single LNP using NTA analysis. Figure 1k, Representative images of GrAb-LNPs at a LNP to LP ratio of 10,000:1 (scale bar: 100 nm). All data in Figure 1 are means ± SD; n = 3. Significance (****P<0.0001) was determined by Tukey-Kramer post hoc test.

[0020] Figures 2a-2i show the results of evaluating receptor-mediated cell-to-GrAb-LNP binding and uptake. Figure 2a, schematic representation of the interaction of HerLNPs with HER2-positive cells, compared to no binding with the IsoLNPs control. Figure 2b, graphs of DiD and DiD MFI of Con, Iso, and HerLNPs bound to HER2-positive cancer cells. Figure 2c, pretreatment of SK-OV-3 cells with HER2 antibody. Figure 2d, measurement of changes in binding affinity of LNPs when preincubated with mouse serum. Figure 2e, fluorescence images of SK-OV-3 cells treated with ConLNP, IsoLNP, and HerLNP encapsulating cy5-Fluc mRNA (white). Figure 2f, pretreatment with HER2 antibody. Figure 2g, Quantification of luminescence of cancer cells treated with Fluc mRNA encapsulating Con, Iso, and HerLNP. Figure 2h, Western blot images of SK-OV-3 cells treated with p53 encapsulating Con, Iso, and HerLNP. Figure 2i, Cell viability analysis for p53 mRNA-mediated apoptosis effect (CCK cell viability was assessed after treating cells with various concentrations of p53 mRNA encapsulating Con, Iso, and HerLNP). All data in Figure 2 are means ± SD; n = 3. Significance ( n.s. P>0.05, *P<0.05, **P<0.01, ****P<0.0001) determined by Tukey-Kramer post-hoc test)

[0021] Figures 3a–3h show the results of in vivo mRNA delivery evaluation of GrAb-LNPs targeting HER2-expressing tumors. Figure 3a, Non-invasive NIRF images of SK-OV-3 tumor-bearing mice treated with ConLNP, IsoLNP, or HerLNP (5 mg / kg based on mRNA content). Figure 3b, Quantitative analysis of the radiance efficiency of tumor tissues at various time points using Living Image software. Figure 3c, Ex vivo fluorescence and luminescence images of tumors collected 24 hours after injection. Figure 3d, Quantitative analysis of the average radiance efficiency and luminescence intensity of the harvested tumors. Figure 3e, Histological fluorescence images of tumor tissues. Figure 3f, Ex vivo fluorescence images of harvested organs. Figure 3g, Quantification of the average radiance efficiency in each organ. Figure 3h, Quantification of DiD and Fluc intensities of tumors normalized to the liver. All data in Figure 3 are means ± SD; n = 3. Significance ( n.s. P>0.05, **P<0.01, ***P<0.001, ****P<0.0001) were determined by Tukey-Kramer post hoc test.

[0022] Figures 4a–4g show the therapeutic effect of HER2-targeted LNPs via p53 mRNA delivery. Figure 4a, Experimental plan to evaluate the in vivo antitumor effect of p53@HerLNPs. Figure 4b, Tumor growth curves for 21 days after injection of SK-OV-3 in each group (PBS, Fluc@HerLNPs, p53@ConLNPs, p53@HerLNPs). Figure 4c, Photograph of tumors extracted on day 21. Figure 4d, Measurement of the weight of tumor tissues extracted on day 21. Figure 4e, Western blot analysis and quantification graph showing the level of p53 protein expressed in tumor tissues. Figure 4f, Representative fluorescent image of p53 protein (white) in tumor tissues. Figure 4g, Tumor tissues stained with TUNEL and H&E to confirm apoptosis and tissue damage. All data in Figure 4 are means ± SD; n = 5. Significance ( n.s.P>0.05, *P<0.05, **P<0.01, ****P<0.0001) were determined by Tukey-Kramer post hoc test.

[0023] Figures 5a–5e show the results of in vivo safety testing of GrAb-LNPs. Figure 5a shows relative body weight changes during 21 days of treatment compared to the first day of treatment according to the schedule. Figure 5b shows liver toxicity markers including AST, ALT, and ALP. Figure 5c shows other systemic toxicity markers using blood chemistry analysis isolated from the serum of LNP-treated mice. Figure 5d shows whole blood analysis including red blood cell (RBC), hemoglobin (HGB), hematocrit (HCT), mean body hemoglobin concentration (MCHC), white blood cell (WBC), neutrophil (NEU), lymphocyte (LYM), and monocyte (MONO) counts. Figure 5e shows representative H&E histological images of livers isolated from the ConLNP and HerLNP treatment groups on day 21. All data in Figure 5 are means ± SD, n = 5. Significance (***P<0.001, ****P<0.0001) was determined by Tukey-Kramer post hoc test.

[0024]

[0025] In the present invention, we aimed to develop a cancer treatment without side effects by targeting HER2, which is overexpressed on the cell surface of cancer cells, and delivering the p53 protein specifically to the target.

[0026] In the present invention, the inventors of the present invention attempted to use "antibody-conjugated lipid nanoparticles containing antibodies bound to membrane scaffold proteins (so-called 'GrAb-LNP')" previously developed as a p53 delivery vehicle.

[0027] However, in order for GrAb-LNP to be used as a drug delivery system for delivering anticancer drugs, technically, ① mRNA encoding p53 protein must be well captured by the so-called GrAb-LNP of the present invention, ② must be well transported to the target site after capture, ③ p53 encoding mRNA must be well released from target cancer cells, ④ must not have hepatotoxicity, which is a representative side effect of LNP, and ⑤ must not cause aggregation reaction with proteins in blood when administered into blood.

[0028] However, in the case of the experiment of the present invention below, it was confirmed through the experiment that the so-called 'HER2 target GrAb-LNP' of the present invention can load p53 encoding RNA with a high yield, deliver it specifically to the target HER2, and also show a significant effect as an anticancer agent by well releasing and expressing p53 in HER2-positive cancer. In particular, unlike conventional general LNPs, it was confirmed that the present invention can be administered into a living body through blood because no aggregation reaction occurs with proteins existing in the blood. The GrAb-LNP of the present invention can prevent proteins existing in the blood from sticking when administered into a living body because the lipids on the LNP surface are protected (shielded) by the membrane structural protein constituting GrAb.

[0029] Conventional "anticancer agent-loaded LNPs" required direct injection into cancer cells due to aggregation issues with blood proteins. However, this approach presented practical difficulties in completely killing cancer cells. However, the GrAb-LNP of the present invention has the advantage of not causing aggregation with blood proteins, allowing for in vivo administration via the bloodstream.

[0030] In addition, conventional LNPs had a problem of causing severe liver toxicity due to nonspecific reactions, but the GrAB-LNP of the present invention can be specifically delivered to cancer cells using bound antibodies, and it was confirmed through the following experiments that liver toxicity is greatly suppressed.

[0031] Accordingly, the present invention provides a pharmaceutical composition for treating or preventing 'HER2-positive cancer' containing a HER2-binding lipid nanoparticle in which an 'antibody or antibody fragment thereof capable of binding to human epidermal growth factor receptor 2 (HER2)' bound to a membrane scaffold protein is bound to a hydrophobic portion of a lipid forming a lipid nanoparticle form through a hydrophobic bond via a membrane scaffold protein, and an mRNA encoding a p53 protein is loaded inside the lipid nanoparticle.

[0032] The p53 protein, the target protein of the present invention, is known to play a crucial role in regulating responses such as cell cycle changes, apoptosis, DNA damage repair, and cellular senescence caused by various stresses, such as DNA damage, hypoxia, and abnormal expression of oncogenes. Recently, it has been attracting attention as an alternative anticancer agent. The p53 protein is a well-known substance, and its sequence and the gene encoding it are already widely known. Therefore, a detailed description thereof will be omitted.

[0033] Furthermore, HER2, the target of the present invention, is a protein present on the cell surface. Approximately 15 to 20% of all breast cancers are known to have overexpressed HER2 protein on their cell surfaces. The sequence and characteristics of the HER2 protein are widely known, and numerous antibodies that bind to it have been reported. Once the target to be bound has been determined, antibodies capable of binding to it can be readily developed using genetic engineering knowledge in the art. Therefore, a description of methods for obtaining antibodies or fragments thereof capable of binding to HER2 will be omitted.

[0034] Meanwhile, the present invention can be widely applied to "HER2-positive cancer," which refers to cancers in which HER2 is expressed on the surface of cancer cells compared to normal cells. Examples include breast cancer, ovarian cancer, bladder cancer, pancreatic cancer, and stomach cancer. Recently, various anticancer agents have been developed targeting "HER2-positive cancer."

[0035] Meanwhile, the formulation of the pharmaceutical composition of the present invention can be prepared in a desirable form depending on the method of use, and in particular, it is preferable to formulate it by adopting a method known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. Examples of specific dosage forms include granules, lotions, liniments, lemonades, aromatic waters, powders, syrups, liquids and solutions, aerosols, extracts, elixirs, ointments, fluidextracts, emulsions, suspensions, decoctions, infusions, ophthalmic solutions, tablets, suppositories, injections, spirits, cataplasmas, capsules, It may be any one of creams, troches, tinctures, pastes, pills, soft or hard gelatin capsules.

[0036] In addition, the dosage of the pharmaceutical composition of the present invention should preferably be determined by considering the administration method, the age, sex, and body weight of the recipient, and the severity of the disease. For example, based on the active ingredient, it can be administered at least once a day at 0.001 to 1,000 mg / kg (body weight). However, the above dosage is merely an example and may vary depending on the recipient's condition and the doctor's prescription.

[0037] In addition, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier, diluent, or excipient in addition to the active ingredient. Examples of usable carriers, excipients, or diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil, and one or more of these may be used. In addition, when the preventive or therapeutic agent is a drug, a filler, an anticoagulant, a lubricant, a wetting agent, a fragrance, an emulsifier, or a preservative may be additionally included.

[0038]

[0039] Hereinafter, the present invention will be described in more detail through the following examples and experimental examples. However, the scope of the present invention is not limited to the following examples and experimental examples, but includes modifications of technical concepts equivalent thereto.

[0040]

[0041] [Example 1: Construction of the 'GrAb-LNP Loaded with mRNA Encoding an Anticancer Protein' of the Present Invention and Verification of Its Efficacy as an Anticancer Agent]

[0042]

[0043] I. Purpose of the experiment

[0044] In this example, the effect of the present invention was verified by manufacturing a HER2-binding GrAb-LNP loaded with an mRNA encoding the p53 protein as an 'mRNA encoding an anticancer protein' and confirming its anti-efficacy against HER2-overexpressing cancer.

[0045]

[0046] Ⅱ. Experimental Materials and Methods

[0047] 1. Gene synthesis and replication

[0048] Nucleotide sequences are processed using GeneOptimizer to minimize rare codons. ® Optimization was performed using software (Thermo Scientific) and further evaluated using GenScript (Piscataway). The optimized nucleotide sequence was synthesized as a gBlocks gene fragment by IDT. All cloning experiments were performed using a sequence- and linkage-independent cloning method. Insert or vector nucleotides were amplified using KOD Plus Neo DNA polymerase (TOKOD-401, TOYOBO) and digested with DpnI (R017L, NEB). Insert and vector nucleotides were assembled using T4 DNA polymerase (M0203S, NEB). The resulting plasmids were used to transform Escherichia coli TOP10 host cells and then sequenced.

[0049]

[0050] 2. Construction and production of GrAb

[0051] We engineered GrAb constructs for HER2 targeting and control applications using a dual-vector system. The first vector, IgL, contains the coding sequences for a signal peptide, variable light (VL), and constant light (CL) domains. The second vector, IgH, consists of a signal peptide, constant weight 1 (CH1), hinge, constant weight 2 (CH2), and constant weight 3 (CH3) domains, a Gly4Ser linker, and an apolipoprotein fusion segment. The signal peptide sequence used in both vectors is MGWSCIILFLVATATGAHS, which ensures efficient protein secretion. The GrAb backbone was based on human IgG1 to leverage its well-documented biological function and structural properties. For the specific targeting of HER2, the variable regions (VL and VH) of trastuzumab were used, while the isotype control GrAb used the VH and VL domains of the NI-0401 (Foralumab) clone. Apolipoprotein fusions used mature forms of ApoA1 (amino acids 25-267) and ApoE3 (amino acids 19-219).

[0052] Table 1 below shows the genetic information used in this example.

[0053] DNA 서열5'->3'비고신호펩타이드(Signal peptide)ATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGCGCGCATCC서열번호 1IgLGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGATAGGGTCACCATCACCTGCCGTGCCAGTCAGGATGTGAATACTGCTGTAGCCTGGTATCAACAGAAACCAGGAAAAGCTCCGAAGCTACTGATTTACTCGGCATCCTTCCTCTACTCTGGAGTCCCTTCTCGTTTCTCTGGATCGAGATCTGGGACGGATTTCACTCTGACCATCAGCAGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAACATTATACTACTCCTCCCACGTTCGGACAGGGTACCAAGGTGGAGATCAAACGTACGGTGGCCGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGTTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGC서열번호 2VL oftrastuzumabGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGATAGGGTCACCATCACCTGCCGTGCCAGTCAGGATGTGAATACTGCTGTAGCCTGGTATCAACAGAAACCAGGAAAAGCTCCGAAGCTACTGATTTACTCGGCATCCTTCCTCTACTCTGGAGTCCCTTCTCGTTTCTCTGGATCGAGATCTGGGACGGATTTCACTCTGACCATCAGCAGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAACATTATACTACTCCTCCCACGTTCGGACAGGGTACCAAGGTGGAGATCAAACGT서열번호 3CLACGGTGGCCGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGTTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGC서열번호4IgHAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGAAGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAA서열번호 5VH of trastuzumabGAGGTGCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCAGGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACATTAAAGACACCTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCAAGGATTTATCCTACGAATGGTTATACTAGATATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTGCAGATGAACAGCCTGCGTGCTGAGGACACTGCCGTCTATTATTGTTCTAGATGGGGAGGGGACGGCTTCTATGCTATGGACTACTGGGGTCAAGGAACCCTGGTCACCGTCTCCTCG서열번호6CH1GCTAGCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCCTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTT서열번호 7HingeGAGCCCAAATCTTGTGACAAAACTCACACATGCCCA서열번호 8CH2CCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAA서열번호9CH3GGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGAAGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAA서열번호 10Gly4 Ser linkerGGAGGCGGAGGCAGC서열번호 11ApoA1søkjømdeh 12ApoE3sökõmboldeh 13VL of NI-0401(Foralumab)GAAATCGTGCTGACACAGAGCCCCGCCACACTGTCACTTTCTCCAGGCGAAAGAGCCACACTGAGCTGCAGAGCCAGCCAGAGCGTGTCCTCTTACCTGGCCTGGTATCAGCAGAAGCCAGGACAGGCTCCCCGGCTGCTGATCTACGATGCCAGCAATAGAGCCACAGGCATCCCCGCCAGATTTTCTGGCTCTGGAAGCGGCACCGACTTCACCCTGACCATAAGCAGCCTGGAACCTGAGGACTTTGCCGTGTATTACTGCCAGCAGCGGAGCAACTGGCCTCCTCTGACATTTGGCGGAGGCACCAAGGTGGAAATCAAG서열번호 14VH of NI-0401 (Foralumab)CAGGTGCAGCTGGTTGAATCTGGTGGCGGAGTTGTGCAGCCTGGCAGAAGCCTGAGACTGTCTTGTGCCGCCAGCGGCTTCAAGTTTAGCGGCTATGGCATGCACTGGGTCCGACAGGCACCTGGCAAAGGCCTTGAATGGGTCGCCGTGATTTGGTACGACGGCAGCAAAAAGTACTACGTGGACAGCGTGAAGGGCAGATTCACCATCAGCCGGGACAACAGCAAGAACACCCTGTACCTGCAGATGAACAGCCTGAGAGCCGAGGACACCGCCGTGTACTATTGCGCCAGACAGATGGGCTACTGGCACTTCGATCTGTGGGGCAGAGGCACCCTGGTCACAGTTTCTAGC서열번호 15FireflyluciferaseGCCTGACCGAGACCACCAGCGCCATCCTGATCACCCCCGAGGGCGACGACAAGCCCGGCGCCGTGGGCAAGGTGGTGCCCTTCTTCGAGGCCAAGGTGGTGGACCTGGACACCGGCAAGACCCTGGGCGTGAACCAGCGGGGCGAGCTGTGCGTGCGGGGCCCCATGATCATGAGCGGCTACGTGAACAACCCCGAGGCCACCAACGCCCTGATCGACAAGGACGGCTGGCTGCACAGCGGCGACATCGCCTACTGGGACGAGGACGAGCACTTCTTCATCGTGGACCGGCTGAAGAGCCTGATCAAGTACAAGGGCTACCAGGTGGCCCCCGCCGAGCTGGAGAGCATCCTGCTGCAGCACCCCAACATCTTCGACGCCGGCGTGGCCGGCCTGCCCGACGACGACGCCGGCGAGCTGCCCGCCGCCGTGGTGGTGCTGGAGCACGGCAAGACCATGACCGAGAAGGAGATCGTGGACTACGTGGCCAGCCAGGTGACCACCGCCAAGAAGCTGCGGGGCGGCGTGGTGTTCGTGGACGAGGTGCCCAAGGGCCTGACCGGCAAGCTGGACGCCCGGAAGATCCGGGAGATCCTGATCAAGGCCAAGAAGGGCGGCAAGATCGCCGTG서열번호16EGFPGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG서열번호 17p53TCAGAGAGCTGAACGAGGCCCTGGAGCTGAAGGACGCCCAGGCCGGCAAGGAGCCCGGCGGCAGCAGAGCCCACAGCAGCCACCTGAAGAGCAAGAAGGGCCAGAGCACCAGCAGACACAAGAAGCTGATGTTCAAGACAGAGGGCCCCGACAGCGAC서열번호 18

[0054]

[0055] Through the above process, the recombinant 'Recombinant IgH for GrAb' and 'Recombinant IgL for GrAb' (Fig. 1b) were introduced into each pMAZ plasmid, and then ExpiCHO-S (A29127, Gibco) cells (expression host) were transformed with these two recombinant plasmids to produce the GrAb of the present invention.

[0056] The cells are 6.0 × 10 6 Cells were seeded at a density of 10 cells / mL. The following day, the heavy and light chains of the GrAb plasmid were co-transfected using the ExpiFectamine CHO transfection kit (A14524, Invitrogen) as a transfection reagent. The plasmids encoding the heavy and light chains were injected at a 1:1 ratio, totaling 1 μg of DNA per mL of culture medium, to infect the cells. The infected cells were cultured in an incubator shaking at 120 rpm with 8% CO2 at 37°C. After 13 days, the supernatant (SPNT) was collected at 4°C, 7,000 × g, and 30 min and filtered using a 0.22 μm PES membrane filter. GrAb was purified using a protein A purification system and dialyzed against a 1 kDa MWCO dialysis membrane.

[0057]

[0058] 3. In vitro transcription of mRNA

[0059] For in vitro transcription, the template was linearized with HindIII-HF restriction enzyme (R3104L, NEB). mRNA was generated using the Takara IVTpro® T7 mRNA Synthesis Kit (6144, Takara) with CleanCap Reagent AG (3' OMe) (N-7413, Trilink) according to the manufacturer's protocol. Uridine in the mRNA was replaced with N1-methyl-puduridine (HY-112582A, MCE). mRNA was purified using the Monarch RNA Cleanup Kit (T2040L, NEB), eluted with RNase-free DW (1 μg / μL), and stored at -80°C until use.

[0060]

[0061] 4. Formulation of LNP and integration of GrAb

[0062] An ethanol solution with a lipid concentration of 6.25 mM was prepared, containing the following components for Con LNPs: SM-102 (CAY10779, Cayman), cholesterol (C8667, Sigma), DSPC (850365C, Avanti), and DMG-PEG2000 (880151P, Avanti) were mixed at a molar ratio of 50:38.5:10:1.5. For fluorescent labeling, 1,1'-dioctadecyl-3,3,3',3'-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt (DiD, D7757, Invitrogen) was added to the ethanol phase at a 1 mol% ratio based on the total lipids. The aqueous phase containing mRNA was prepared using a 10 mM sodium citrate buffer at pH 3. The ionizable lipid: mRNA amine / phosphate (N / P) ratio was fixed at 6. The volume ratio between the ethanol and aqueous phases was adjusted to 1:3. LNPs were diluted 4-fold with PBS (pH 7.4).

[0063] For the GrAb-LNP formulation, the LNP mixture and GrAb protein were mixed at a lipid:protein molar ratio (LP ratio) of 10,000:1 and incubated at 37°C for 30 min. Subsequently, the mixture was dialyzed twice against PBS (pH 7.4) using a 1 Mda MWCO centrifugal filter at 12,000 g for 10 min and stored at 4°C.

[0064]

[0065] 5. Size distribution of LNPs

[0066] The hydrodynamic diameter and PDI were measured by dynamic light scattering (DLS) using a Litesizer DLS 500 (Anton Paar). mRNA / LNPs (2.5 μg mRNA) were diluted in 1 mL of PBS, pH 7.4, and transferred to a cuvette for size distribution analysis. For stability testing, LNPs were incubated at 4°C for 7 days and monitored by DLS. To assess stability in mouse serum, equal amounts of mRNA / LNPs were incubated in 50% normal mouse serum (10410, Invitrogen) and stored at room temperature.

[0067] Size exclusion chromatography (SEC) was performed using AKTA Pure (GE Healthcare Life Sciences) to analyze GrAb incorporation into LNPs. LNPs were prepared as previously described. GrAb, LNPs, and GrAb-LNPs were analyzed using a Superdex 200 Increase 10 / 300 GL column (28990944, Cytiva). Samples were injected into the column using a 1 mL sample loop at a flow rate of 0.75 mL / min. Fractions 1–10 were collected, concentrated using a 10 kDa MWCO centrifugal filter, and then subjected to SDS-PAGE analysis.

[0068]

[0069] 6. Analysis of surface-integrated GrAb per single LNP

[0070] The size and particle number of these LNPs were measured using a nanoparticle tracking analyzer (NTA, Nanosight NS300, Malvern). In addition, a Pierce BCA protein assay kit (23225, Thermo Scientific) was used to measure the particle size and particle number of 1.0 × 10 10 The number of GrAb molecules contained in the LNP was measured. To calculate the number of GrAb molecules per single LNP, the amount of GrAb was multiplied by Avogadro's constant (6.022 × 10 23 ) and then multiply the total number of particles (1.0 × 10 10 ) and converted into the number of molecules.

[0071]

[0072] 7. Analysis of the integration efficiency of GrAb into LNPs

[0073] To determine the antibody binding ratio on the LNP surface in the presence or absence of ApoA1, antibodies and GrAb were labeled with cyanine 5-NHS ester (13020, Lumiprobe) according to the manufacturer's protocol. LNPs were then incubated with antibodies or GrAb at a LP ratio of 10,000:1 at 37°C for 30 min, after which unbound antibodies were removed through a 1 MDa MWCO centrifugal filter. The labeled proteins were centrifugally filtered through a 10 kDa MWCO centrifugal filter, and the fluorescence of the total protein was measured. The percentage of antibody incorporated into the LNPs was calculated by subtracting the value obtained from the 1 MDa (integrated protein) centrifugal filter from the value obtained from the 10 kDa centrifugal filter (total protein). Incorporation (%) was calculated using the following equation:

[0074] [Mathematical Formula 1]

[0075]

[0076]

[0077] 8. Morphological analysis of GrAb-LNPs

[0078] The morphology of HerLNPs was observed using cryogenic transmission electron microscopy (cryo-TEM) (Tecnai F20 G2). HerLNPs were deposited on a thin carbon film covered with a copper grid and then vitrified using a Vitrobot (FEI). The vitrified sample was stored in liquid nitrogen until imaging.

[0079]

[0080] 9. Analysis of mRNA encapsulation efficacy

[0081] mRNA encapsulation efficiency was assessed using the QuantIT RiboGreen RNA Assay Kit (R11490, Invitrogen). Briefly, LNPs were incubated with 1X TE or 1X TE + 1% Triton X-100 for 20 min. After incubation, RiboGreen reagent was added to each sample, and fluorescence intensity was measured at excitation / emission wavelengths of 485 / 520 nm using a GloMax plate reader (Promega). The amount of RNA loaded into LNPs (internal RNA) was calculated by subtracting the value obtained for 1X TE (free mRNA) from the value obtained for 1X TE + 1% Triton X-100 (total mRNA). Encapsulation (%) was calculated using the following equation:

[0082] [Equation 2]

[0083]

[0084]

[0085] 10. In vitro cell binding and uptake assay

[0086] MDA-MB-231 HER2 - Cells and SK-OV-3, MDA-MB-453, SK-BR-3, BT-474 HER2 + Cells (1 × 10 per sample) 6 Cells) were incubated in PBS with Con, Iso, and HerLNP (400 ng mRNA / mL) at 37°C for 30 min.

[0087] SK-OV-3 is a HER2-overexpressing ovarian cancer cell line, MDA-MB-453, SK-BR-3, and BT-474 cells are HER2-overexpressing breast cancer cell lines, and MDA-MB-231 is a HER2-nonexpressing breast cancer cell line.

[0088] Cells were washed three times with 1 mL of PBS and analyzed using a CytoFLEX flow cytometer (Beckman Coulter). To investigate the specific role of the HER2 receptor in cellular uptake, SK-OV-3 cells were pre-incubated with trastuzumab at 37°C for 1 h prior to treatment with nanoparticles, a receptor blocking procedure. The treated cells were then subjected to the same washing steps and flow cytometry as in the initial assay to assess the effect of receptor blockade on nanoparticle uptake.

[0089] To monitor the cellular uptake of NPs, Cy5-labeled Fluc-mRNA-conjugated Con, Iso, and HerLNPs were prepared. SK-OV-3 cells were seeded at 5 × 10 per well. 5 Cells were seeded at a density of 100 cells per 35 mm confocal dish (SPL) and cultured at 37°C in 5% CO2 for 24 h. The cells were then incubated with LNPs at different time intervals. Cells were washed with PBS, counterstained with Hoechst 33342 (H3570, Thermo Scientific), and analyzed using a confocal laser scanning microscope.

[0090]

[0091] 11. In vitro cell infection

[0092] For firefly luciferase (Fluc) infection, MDA-MB-231 HER2 cells were cultured in 48-well plates. - Cells and SK-OV-3, MDA-MB-453, SK-BR-3, BT-474 HER2 +Cells were seeded. After 24 h, cells were treated with Fluc-loaded Con, Iso, and HerLNPs (50 ng of mRNA per well). After 2 h of incubation, cells were washed with PBS (pH 7.4) and cultured in fresh medium for an additional 24 h. Then, 45 μL of Cell Culture Lysis 5X Reagent (CCLR, E1531, Promega) was added and transferred to a white 96-well plate. 100 μL of luciferase assay substrate (E1501, Promega) was added to each well, and the resulting luminescence was measured using a GloMax plate reader.

[0093] For EGFP infection, SK-OV-3 cells were seeded at 5 × 10 per well. 5 Cells were seeded in 6-well plates at a density of 100 cells / well and cultured at 37°C in 5% CO2 for 24 h, after which the cells were visualized using an EVOS M5000 fluorescence microscope (Invitrogen).

[0094]

[0095] 12. In vitro cell growth inhibition assay

[0096] SK-OV-3 cells were seeded at 1 × 10 per well. 4 Cells were seeded in 48-well plates at a density of 10 μg / mL. After 24 h of cell attachment, the cells were treated with PBS, Fluc@HerLNP, p53@ConLNP, p53@IsoLNP, and p53@HerLNP at various mRNA concentrations (0.125, 0.250, 0.500, 1.000, and 2.000 μg / mL). After 24 h of incubation, the cells were washed with PBS buffer (pH 7.4) and cultured in fresh medium for an additional 24 h. The in vitro cell growth inhibitory efficacy of p53@LNP was confirmed using Cell Counting Kit-8 (CCK-8, CK-04, Dojindo).

[0097]

[0098] 13. Evaluation of p53 protein expression levels

[0099] Protein extracts from cells or resected tumors in each group were prepared using RIPA buffer (89900, Thermo Scientific), supplemented with a protease inhibitor cocktail (X), and boiled at 100°C for 10 min. Equal amounts of protein were measured using a Pierce BCA protein assay kit. After gel electrophoresis and protein denaturation, the membrane was blocked in TBST (150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 0.1% Tween 20) with 5% nonfat dry milk for 1 h at room temperature with gentle shaking. The membrane was then incubated overnight at 4°C with p53 (sc-126, Santa Cruz Biotechnology) or GAPDH (MAB5718, R&D) antibodies. After washing with TBST, the membrane was incubated with secondary antibody (GTX213111-01, GeneTex) for 1 h at 37°C. Immunoreactive bands were visualized using a SuperSignal West Femto Maximum Sensitivity Substrate (34094, Thermo Scientific) and captured and analyzed with an iBrightTM CL750 Imaging System (Invitrogen).

[0100]

[0101] 14. Xenograft mouse model

[0102] Seven-week-old female BALB / c nu / nu mice were bred under pathogen-free conditions at the Korea Institute of Science and Technology (KIST). All experiments involving live animals were conducted in compliance with relevant laws and the institutional guidelines of the KIST Institutional Animal Care and Use Committee (IACUC). To prepare xenograft mouse models, 2 × 10 cells were cultured in a mixture of DMEM (50 μL) and Matrigel (50 μL, 354230, Corning). 6 SK-OV-3 cells were inoculated subcutaneously into the left flank of mice.

[0103]

[0104] 15. Biological distribution of GrAb-LNPs

[0105] When the average SK-OV-3 tumor volume reached 200 mm , DiD-labeled LNPs containing Fluc mRNA (0.5 mg / kg based on mRNA) were intravenously injected into mice. Noninvasive near-infrared fluorescence (NIRF) imaging was performed at designated time points using an IVIS Lumina Series III system (PerkinElmer). Tumor tissues and major organs (liver, lung, spleen, kidney, and heart) were harvested 24 hours after injection for ex vivo fluorescence imaging. For luminescence imaging, organs were immersed in a d-luciferin solution in phosphate-buffered saline (PBS) (4 mM d-luciferin, 2 mM ATP) for 5 minutes. After a 5-minute incubation, bioluminescence imaging was performed. The fluorescence and luminescence intensities of the tumors and each organ were quantified using Living Image software (PerkinElmer). Finally, tumor tissues were harvested, immersed in OCT compound for cryosectioning, and counterstained with DAPI. Fluorescence images of sectioned tissues were observed using a confocal microscope (Leica).

[0106]

[0107] 16. In vivo therapeutic effects of GrAb-LNP

[0108] To evaluate the therapeutic efficacy of GrAb-LNP, mice were randomly divided into four groups (n=5) and injected with SK-OV-3 cells 7 days after subcutaneous injection. Then, PBS, Fluc@HerLNP, p53@ConLNP, and p53@HerLNP (0.6 mg / kg based on mRNA) were intravenously administered five times at 3-day intervals. Tumor volume and body weight were measured every other day, and tumor size was measured with a caliper, and tumor volume was calculated as 0.5 × (width) 2 × (length) 2 On the 21st day, the mice were euthanized and tumors, organs, and blood were collected for further experiments.

[0109]

[0110] 17. Histological analysis of tumor tissue

[0111] For histological analysis of the extracted tumor tissue, the tumor was fixed in 4% paraformaldehyde solution. The tumor was then embedded in paraffin and sectioned at 5 μm thickness using a rotary microtome. The sectioned tissue was stained with hematoxylin and eosin (H&E) and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-labeling (TUNEL). To assess p53 protein levels in the tumor tissue, deparaffinized and rehydrated sections were incubated with a p53 antibody for 24 hours. Subsequently, sections were incubated with FITC-conjugated anti-rabbit secondary antibody and DAPI for 1 hour and 10 minutes, respectively, and fluorescence images were observed using a confocal laser scanning microscope.

[0112]

[0113] 18. In vivo toxicity test

[0114] To assess in vivo toxicity, excised organs, including the liver, lungs, spleen, kidney, and heart, were fixed in 4% PFA and embedded in paraffin. Tissues were then sectioned at 5 μm thickness and stained with H&E. For serum biochemical analysis, blood samples were centrifuged at 1,200 rpm for 20 minutes to obtain the supernatant. Comprehensive analyses of whole blood and serum components were performed by DK Korea Co., Ltd.

[0115]

[0116] Ⅲ. Experimental Results

[0117] 1. Construction and characterization of GrAb-LNPs

[0118] (1) Manufacturing of GrAb-LNP

[0119] In this example, we aimed to fabricate GrAb-lipidnanoparticles (GrAb-LNPs) capable of binding to HER2. Our approach involved fabricating a recombinant protein called Grabber Antibody (GrAb), which consists of two functional domains: a targeting antibody domain and an apolipoprotein, and then conjugating it to LNPs.

[0120] Figure 1a is a schematic diagram of the Grabber Antibody (GrAb) prepared in this example. The apolipoprotein of GrAb enhances specificity by promoting the formation of a protein corona around the LNP, similar to "grabbing" the LNP.

[0121] For the production of GrAb, two plasmids, IgH and IgL, encoding the heavy chain and apolipoprotein of the antibody and the light chain of the antibody with similar N-terminal signal sequences were constructed (Fig. 1b).

[0122] Trastuzumab was used as the antibody for the HER2 target model, and ApoA1 and ApoE3 were selected as apolipoproteins. GrAb was expressed and purified using the ExpiCHO system, yielding approximately 190 mg / L for ApoA1 and approximately 35 mg / L for ApoE3 (Fig. 1c).

[0123] Incubation of LNPs with GrAb for 0.5 h at 37°C allowed antibody to be displayed on the LNP surface via apolipoprotein-mediated interaction (Fig. 1d).

[0124]

[0125] (2) Exploration of the optimal mixing ratio of GrAb and LNP

[0126] We aimed to optimize the incubation ratio of GrAb by introducing GrAb into LNPs at various lipid-to-protein ratios (LP ratios of 500 to 100,000:1).

[0127] For ApoA1-mediated assemblies, a slight increase in size from 132 ± 3 nm to 140 ± 3 nm was observed at a LP ratio of 10,000:1, but the change in polydispersity index (PDI) value was minimal. However, ApoE3-mediated assemblies increased in size to 173 ± 6 nm at LP ratios below 10,000:1, except at 100,000:1 (Fig. 1e). Furthermore, we observed a decrease in mRNA encapsulation efficiency with increasing GrAb ratio for both ApoA1 and ApoE3 (Fig. 1f).

[0128] These results are consistent with previous reports that apolipoproteins can remodel the surface of LNPs, potentially leading to mRNA leakage. Nevertheless, for ApoA1, no difference in encapsulation efficiency was observed at LP ratios of 10,000:1 or higher, suggesting minimal mRNA leakage (Fig. 1f).

[0129] To assess the stability of GrAb-LNPs at various LP ratios, they were stored at 4°C for 7 days and size changes were monitored. At the lowest LP ratio (highest protein ratio), 500:1, size increases occurred in both ApoA1- and ApoE3-mediated reactions due to protein-mediated aggregation. At higher LP ratios, ApoA1 remained stable in size even after 1 week, whereas ApoE3-mediated assembly increased in size except at the 100,000:1 ratio (Fig. 1g).

[0130] Meanwhile, to evaluate the serum stability of GrAb-LNPs at a LP ratio of 10,000:1, LNPs and GrAb-LNPs were incubated with 50% mouse serum, and both particles maintained their size even after 72 h of incubation.

[0131]

[0132] (3) Confirmation of whether GrAb is stably bound to LNP

[0133] We aimed to confirm that GrAb is stably incorporated into LNPs through ApoA1-mediated assembly. Analysis of the initial fraction (F1-9) from size exclusion chromatography using SDS-PAGE revealed that GrAb protein was exclusively present in the LNP fraction (Fig. 1h). After incubating LNPs with Cy5-labeled Trastuzumab or Cy5-labeled Trastuzumab-GrAb (this experiment was to compare that Trastuzumab, which is not in the GrAb form and therefore not incorporated into LNPs, and Trastuzumab GrAb is incorporated into LNPs by ApoA1) at a LP ratio of 10,000:1, fractions containing antibody-bound LNPs were pooled and analyzed for the residual Cy5 fluorescence relative to the initial Cy5 fluorescence. This revealed that approximately 92 ± 3% of GrAb was incorporated into the LNPs (Fig. 1i). Subsequently, the number of particles and the amount of GrAb were measured to determine the number of GrAb molecules bound to the LNP surface. The number of particles was assessed using nanoparticle tracking analysis (NTA), and the GrAb molecules in the LNP were quantified using a DC protein assay kit. At a LP ratio of 10,000:1, approximately 69 GrAb molecules were confirmed to be assembled on the LNP surface (Fig. 1j).

[0134] Finally, the size and shape of HerLNP were confirmed by cryo-TEM imaging compared to LNP. Representative cryo-TEM images showed that both LNP and HerLNP had a spherical shape with similar size (Fig. 1k).

[0135] Taken together, these results demonstrate that each Grabber antibody (GrAb) possesses a unique antibody domain, effectively mediating the binding of this domain to LNPs. Consequently, this method demonstrates the potential for direct and efficient attachment of GrAb target antibodies to the LNP surface.

[0136] This capability allows for rapid production of LNPs designed for targeted delivery, demonstrating that the specificity of the antibody domain of GrAb can be leveraged for precise cellular targeting.

[0137]

[0138] 2. GrAb-LNP for receptor-mediated cell targeting

[0139] (1) HER2 positivity of ‘HER2 targeting GrAb-LNP’ Confirming selective binding to cancer cells

[0140] In this example, the 'HER2 target GrAb-LNP (hereinafter referred to as 'HerLNP')' manufactured above is used to target HER2 positive We investigated whether it could selectively bind to cancer cells.

[0141] The specificity of DiD-labeled GrAb-LNPs for HER2 was evaluated in both HER2-negative MDA-MB-231 cells and HER2-positive SK-OV-3, SK-BR-3, MDA-MB-453, and BT-474 cancer cell lines (Fig. 2b, 1) Representative flow histograms of Con, Iso, and HerLNPs bound to HER2-positive SK-BR-3, MDA-MB-453, and BT-474 cancer cells, and 2) their DiD mean fluorescence intensity (MFI) graphs. 3) Representative flow histograms and DiD MFI graphs of Con, Iso, and HerLNPs bound to HER2-negative MDA-MB-231 cancer cells. All data are means ± SD; n = 3. Significance ( n.s.(P>0.05, ****P<0.0001) determined by Tukey-Kramer post hoc test). In addition, isotypic LNPs (IsoLNPs) were included along with a control LNP without GrAb (ConLNP) for comparison. IsoLNPs were designed as an isotypic control of GrAb that does not bind HER2, and differ from HerLNPs only in the variable region targeting the antigen. A significant increase in DiD fluorescence intensity was observed in HER2-positive cancer cell lines treated with HerLNPs, in contrast to the results obtained with ConLNPs and IsoLNPs. However, in the MDA-MB-231 cell line, there was no significant difference in DiD fluorescence intensity between cells treated with ConLNPs, IsoLNPs, or HerLNPs. Pre-blocking the HER2 receptor with antibodies in the SK-OV-3 cell line abolished the differential uptake of HerLNPs, resulting in fluorescence intensities similar to those observed in MDA-MB-231 cells (Fig. 2c). Furthermore, the binding affinity of HerLNPs persisted even after 24 h of incubation with mouse serum, indicating no defect in targeting ability under biological conditions (Fig. 2d).

[0142] Furthermore, we confirmed the cellular uptake of HER2-dependent mRNA by HerLNPs using LNPs loaded with Cy5-labeled firefly luciferase (Fluc) mRNA, visualized by confocal fluorescence microscopy in SK-OV-3 cells (Fig. 2e). HerLNPs exhibited faster cellular mRNA uptake than ConLNPs and IsoLNPs. However, this cellular uptake was significantly inhibited by preincubating cells with anti-HER2 antibodies to block the receptor (Fig. 2f).

[0143]

[0144] (2) Investigation of whether functional mRNA delivery to HER2-positive cancer cells is possible.

[0145] We investigated whether HER2-mediated internalization could lead to functional mRNA delivery to HER2-positive cancer cells (Fig. 2g, 1) Quantitative luminescence plots of HER2-positive SK-BR-3, MDA-MB-453, and BT-474 cells; 2) HER2-negative MDA-MB-231 treated with Fluc mRNA-encapsulated Con, Iso, and HerLNPs; and 3) representative EGFP fluorescence images of HER2-positive SK-OV-3 cells treated with EGFP mRNA-encapsulated Con, Iso, and HerLNPs. All data are mean ± SD; n = 3. Significance (***P<0.001, ****P<0.0001) was determined by Tukey-Kramer post hoc test). In the HER2-positive cell line (SK-OV-3), we observed a significant increase in Fluc intensity after treatment with HerLNPs compared to ConLNPs and IsoLNPs. Conversely, in a HER2-negative cell line (MDA-MB-231), treatment with ConLNP, IsoLNP, or HerLNP did not significantly increase Fluc intensity. Similar results were observed when enhanced green fluorescent protein (EGFP) mRNA was used as an additional reporter, as confirmed by fluorescence microscopy, with SK-OV-3 cells treated with HerLNP exhibiting higher levels of EGFP expression.

[0146] Meanwhile, to specifically confirm the restoration of tumor suppressor p53 and its anticancer efficacy in HER2-positive cell lines, p53 mRNA was encapsulated in HerLNPs and delivered (p53@HerLNPs). At this time, HerLNPs loaded with Fluc mRNA (Fluc@HerLNP), ConLNPs loaded with p53 mRNA (p53@ConLNP), IsoLNPs loaded with p53 mRNA (p53@IsoLNP), and HerLNPs (p53@HerLNP) were also treated and compared for comparison.

[0147] As a result, a higher p53 expression level was observed in SK-OV-3 cells treated with p53@HerLNP compared to other LNPs (Fig. 2h). Furthermore, p53@HerLNP dose-dependently reduced cell viability in SK-OV-3 compared to Fluc@HerLNP, p53@ConLNP, and p53@IsoLNP (Fig. 2i).

[0148] These results demonstrate the distinct HER2 binding ability of HerLNPs, demonstrating their ability to deliver target mRNA to cancer cells expressing HER2 receptors.

[0149]

[0150] 3. In vivo mRNA delivery evaluation of GrAb-LNPs targeting HER2-expressing tumors

[0151] The in vivo efficacy of GrAb-LNPs for mRNA delivery, which actively target tumors by attaching HER2 antibodies, was evaluated in mice harboring HER2-expressing SK-OV-3 (an ovarian cancer cell line). When tumor volumes reached 200 mm, DiD-labeled LNPs containing Fluc mRNA were intravenously injected (0.5 mg / kg based on mRNA). Noninvasive near-infrared fluorescence (NIRF) imaging was performed at various time points (1, 3, 6, 12, and 24 hours). No significant differences in fluorescence signals were observed between groups up to 3 hours after treatment. However, from 6 hours onward, HerLNPs showed increased accumulation in the target tumor tissue (indicated by black circles), whereas ConLNPs and IsoLNPs consistently showed low accumulation rates up to 24 hours (Fig. 3a, b).

[0152] At 24 hours, the strongest fluorescence signal was observed in the tumor area treated with HerLNP, which was a 1.86-fold increase compared to IsoLNP. As expected, NIRF imaging of the extracted tumors also showed a significant increase in DiD radiative efficiency and Fluc signal in HerLNP (Fig. 3c, d). Fig. 3c shows images of tumors extracted from three types of ovarian cancer mice. Fig. 3c (A) shows the DiD fluorescence in cancer tissue measured by IVIS, with the bright region representing the MAX and the dark region representing the MIN. Fig. 3c (B) shows the Fluc fluorescence in cancer tissue measured by IVIS, with the dark region representing the MAX and the bright region representing the MIN. The left side of Fig. 3d is a graph showing the quantification of the DiD signal in Fig. 3c, and the right side is a graph showing the quantification of the Fluc signal in Fig. 3d. These results demonstrate the enhanced Luc protein expression rate due to the enhanced mRNA@LNP delivery via the HER2 targeting moiety. Furthermore, quantitative analysis of homogenized tumor tissues revealed that HerNLPs exhibited a greater increase in DiD (2.14-fold) and Fluc (4.56-fold) intensities compared to IsoLNPs. Furthermore, histological analysis revealed that DiD fluorescence (white) was the strongest signal in HerLNPs in tumor tissues (Fig. 3e).

[0153] Meanwhile, an important phenomenon different from previous reports that LNPs generally cause hepatotoxicity was observed: DiD fluorescence intensity in the liver tissue of HerLNP was significantly reduced compared to other groups, confirming that HER2 antibody-mediated tumor targeting reduces off-target effects, especially in the liver (Fig. 3f, g). This suggests that the GrAb-LNP of the present invention can significantly reduce hepatotoxicity (Do you have any corrections to the underlined interpretation above?). In addition, quantitative analysis results to confirm the tumor-to-liver ratio of delivered mRNA showed that the fluorescence (3.22-fold) and Fluc (3.28-fold) intensities were much higher in HerLNP than in IsoLNP, confirming that mRNA was delivered to the tumor at a much higher rate than in the liver (Fig. 3h).

[0154] Considering these comprehensive biodistribution results, it was found that GrAb-LNPs loaded with HER2-targeting antibodies demonstrated enhanced mRNA delivery efficacy in tumor tissues through HER2-dependent active targeting, leading to successful translation into target protein within the tumor site.

[0155]

[0156] 4. Therapeutic effect of GrAb-LNP through p53 mRNA delivery

[0157] The in vivo therapeutic efficacy of HER2-targeted GrAb-LNP (HerLNP) via p53 mRNA delivery was evaluated using the SK-OV-3 xenograft mouse model.

[0158] When the SK-OV-3 tumor volume reached approximately 50–80 mm, each treatment, including PBS, Fluc@HerLNP, p53@ConLNP, and p53@HerLNP, was intravenously administered at a dose of 0.6 mg / kg based on mRNA every 3 days for 21 days (Fig. 4a). As expected, p53@HerLNP showed the least tumor growth rate over 21 days compared to the other groups (Fig. 4b). In fact, the tumor volume on day 21 was significantly higher than that of PBS (474.26 ± 49.66 mm 3 ), Fluc@HerLNP (510.44 ± 55.02 mm 3 ), p53@ConLNP (370.50 ± 117.45 mm 3 ), compared to p53@HerLNP (108.08 ± 16.28 mm 3 ) was much less.

[0159] On day 21, the antitumor efficacy of p53@HerLNPs was also enhanced, with a 4.62-fold reduction in tumor weight compared to the p53@ConLNPs group, as shown in the photographic images and the extracted tumor weights (Fig. 4c, d). To confirm whether the tumor growth inhibition was due to the delivered p53 mRNA, the level of p53 protein expression in tumor tissues was evaluated using Western blot analysis and immunofluorescence staining. Quantification of the band intensities revealed that p53 protein was significantly upregulated in p53@HerLNPs compared to p53@ConLNPs (3.85-fold; Fig. 4e). In addition, the fluorescence signal of p53 (white) was significantly increased in the tumors of mice treated with p53@HerLNPs compared to the other groups (Fig. 4f). Further evaluation of the therapeutic effect using H&E or TUNEL staining of tumor tissues extracted on day 21 revealed significant apoptosis accompanied by structural abnormalities in tumors of p53@HerLNPs-treated mice (Fig. 4g). These results collectively demonstrate that delivery of p53 mRNA using HER2-targeted GrAb LNPs enhances in vivo therapeutic efficacy through specific upregulation of p53 protein in SK-OV-3 tumors, demonstrating the potential efficacy of GrAb LNPs in inducing antitumor responses through targeted mRNA delivery.

[0160]

[0161] 5. In vivo safety testing of GrAb-LNP

[0162] The in vivo safety evaluation of GrAb-LNPs was performed using mice following the same protocol as shown in Fig. 5. Body weight changes were monitored for 21 days, and mice treated with HerLNPs (Fluc@HerLNP and p53@HerLNP) showed no detectable difference compared to the group treated with PBS (Fig. 5a). In contrast, mice treated with p53@ConLNP, which lacks the HER2 targeting moiety, showed significant body weight loss (5.47%) on day 21, indicating off-target toxicity associated with LNP administration. Follow-up blood chemistry analysis on day 21 showed that serum concentrations of aspartate transaminase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP) remained stable, indicating that HerLNPs did not induce hepatotoxicity (Fig. 5b). In contrast, mice treated with p53@ConLNP exhibited severe toxicity, with elevated AST (1.95-fold and 2.38-fold, respectively), ALT (2.48-fold and 2.89-fold), and ALP (1.88-fold and 2.53-fold, respectively) levels compared to PBS and p53@HerLNP, respectively. Interestingly, no significant difference was observed in any other toxicity parameters in serum and whole blood among all groups, including p53@ConLNP (Fig. 5c, d). This liver-specific toxicity correlates with the biodistribution results in Fig. 4 , which demonstrates that LNP accumulation was higher in the liver in the absence of HER2-targeting antibodies. As expected, liver histological analysis revealed severe histopathological abnormalities and tissue necrosis in mice treated with p53@ConLNP (Fig. 5e). In contrast, mice treated with HerLNP showed no structural damage or toxicity in any major organ (lung, spleen, kidney, and heart). These results consistently support the potential of GrAb-LNP as a safe mRNA carrier that not only mitigates liver-specific toxicity, a well-known side effect of LNP, but also avoids systemic toxicity.

[0163]

[0164] Ⅳ. Results and Interpretation

[0165] As described above, the present invention successfully fabricated GrAb-LNPs, a targeted mRNA delivery platform, by incorporating an engineered antibody fused to an apolipoprotein in the Fc region into LNPs. By leveraging the strong absorption properties of apolipoproteins within lipid structures, the antibody could be incorporated into LNPs through a simple and natural process that did not require complex and unstable chemical procedures. Furthermore, unlike conventional chemical reactions, the biomolecule-mediated incorporation method of the present invention does not require the introduction of functional groups for chemical conjugation, which can limit the diversity of lipid components, making it applicable to antibodies in all lipid compositions.

[0166] As an example, the above experiments demonstrated the superior binding and targeting capabilities of GrAb-LNPs in vitro and in vivo in HER2-overexpressing cancers. This improved LNP delivery was also confirmed to reduce off-target toxicity, particularly in the liver. Indeed, hepatotoxicity is known to be a significant obstacle to clinical application of LNPs as therapeutic drug carriers. However, by using a targeting strategy to reduce LNP accumulation in the liver, in vivo safety tests, including histological and blood analyses, confirmed hepatotoxicity and other systemic safety.

[0167] Another advantage of the GrAb-LNP developed in this invention is that the ApoA1 protein incorporated around the LNP can act as a shield against protein corona formation under biological conditions. Typically, when LNPs enter the bloodstream, they interact with various proteins to form a protein corona, resulting in LNP occlusion and rapid immune clearance. However, our system, in which the protein ApoA1 is attached to the LNP, performs a protein corona shield in vivo. This minimizes potential changes in metabolic rate and prevents unwanted immune responses to LNPs in the body.

[0168] The present invention is not limited to targeting HER2, but rather offers the flexibility to target any receptor by modifying the variable region of the antibody. This flexibility opens the way to a wide range of applications beyond ovarian cancer, including lymphoma immunotherapy and influenza vaccine development. Given its superior therapeutic performance, simplicity of the reaction process, and broad applicability, GrAb-LNPs hold the potential to advance LNP-based mRNA delivery technology.

Claims

1. A pharmaceutical composition for treating or preventing 'HER2-positive cancer', comprising as an active ingredient a 'HER2-binding lipid nanoparticle' in which an 'antibody or antibody fragment thereof capable of binding to human epidermal growth factor receptor 2 (HER2)' bound to a membrane scaffold protein is bound to a hydrophobic portion of a lipid forming a lipid nanoparticle form through a hydrophobic bond via a membrane scaffold protein, and in which mRNA encoding p53 protein is loaded inside the lipid nanoparticle.

2. In paragraph 1, The above 'HER2 positive cancer' is, A pharmaceutical composition characterized by being a 'cancer in which HER2 is overexpressed compared to normal cells.' 3. In paragraph 1, The above HER2 positive cancer is, A pharmaceutical composition characterized in that it is breast cancer or ovarian cancer.

4. In paragraph 1, The above 'HER-conjugated lipid nanoparticles' are, A pharmaceutical composition characterized in that it is administered into a living body through blood.

Images