Gadr2 regulatory gene promoter region and use thereof for overproduction of gamma-aminobutyric acid
The PgadR2 promoter region in lactic acid bacteria induces gadR2 overexpression, enhancing GABA production by 14- to 21-fold and activating the gadCB promoter by a factor of 268, addressing the inefficiencies in existing GABA production methods.
Patent Information
- Application Number
- PCT/EP2025/069626
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-10
- Filing Date
- 2025-07-09
- Publication Date
- 2026-01-15
AI Technical Summary
Lactic acid bacteria exhibit varying and often low levels of gamma-aminobutyric acid (GABA) production, necessitating a more efficient method to induce overexpression of the gadR2 regulatory gene and its operon to enhance GABA production.
The use of a specific promoter region of the gadR2 gene (PgadR2) that includes a SNP and insertion, capable of inducing overexpression of the gadR2 regulatory gene, leading to overexpression of the gadCB operon and subsequent GABA overproduction.
The PgadR2 promoter region achieves a 14- to 21-fold increase in GABA production compared to control strains, activating the gadCB promoter by a factor of 268 and gadC/gadB genes by a factor of 3, resulting in significant GABA overproduction.
Smart Images

Figure IMGF000006_0001 
Figure IMGF000011_0001 
Figure IMGF000017_0001
Abstract
Description
[0001] Title: Promoter region of the gadR2 regulatory gene and its use for gamma-aminobutyric acid overproduction
[0002] The present invention relates to a promoter region of the gadR2 regulatory gene capable of inducing gadR2 overexpression, a gadR2 regulatory cassette comprising a gadR2 regulatory gene and its promoter region, and the use of said cassette to induce upregulation of the gadCB promoter. The invention also relates to a plasmid comprising the gadR2 regulatory cassette and a transformed lactic acid bacterium comprising the plasmid, the plasmid, and the bacterium, which can be used to induce gamma-aminobutyric acid (GABA) overproduction. The invention further relates to a method for producing GABA comprising culturing a transformed lactic acid bacterium according to the invention and a method for producing a genetically modified GABA-producing lactic acid bacterium comprising introducing a plasmid according to the invention into said lactic acid bacterium.
[0003] Lactic acid bacteria are widely used in the food industry (cheese, buttermilk, cream, yogurt) for their acidifying (conversion of sugars to lactic acid), texturizing (production of exopolysaccharides), and protective properties against pathogenic bacteria (production of bacteriocins). They also contribute to the flavor of dairy products, and interest in their potential use as cellular factories for the chemical industry (biofuels, solvents, bio-based plastics) has grown in recent years. Another attractive characteristic of lactic acid bacteria is their ability to produce a range of molecules with applications in the health field, such as bioactive peptides, vitamins, hyaluronic acid, and GABA.
[0004] GABA, a neurotransmitter widely distributed in the sympathetic nervous system, has been the subject of particular research for several years due to its numerous health benefits. GABA plays a crucial role in lowering blood pressure, reduces the risk of lung adenocarcinoma, and possesses antidiabetic, neuroprotective, antidepressant, anti-inflammatory, and visceral antinociceptive properties.
[0005] Lactic acid bacteria are capable of producing large quantities of GABA. However, this GABA production varies greatly between species and even between strains within the same species.
[0006] The organization of genes involved in GABA production can vary among lactic acid bacteria species, but in Lactococcus lactis strains have a gadCB operon: gadC encoding the glutamate and GABA transporter and gadB encoding glutamate decarboxylase. These two genes depend on the same gadCB promoter (PgadCB). Upstream of this promoter is a gene, called gadR2 (or gadR), a positive regulator of the gadCB promoter (PgadCB), which has its own promoter.
[0007] The inventors of the present invention have now surprisingly discovered that the promoter region of the gadR2 gene (PgadR2) can induce overexpression of the gadR2 regulatory gene, leading to overexpression of the genes of the gadCB operon and overproduction of GABA.
[0008] Summary of the invention
[0009] Thus, the present invention relates to a promoter region of the gadR2 regulatory gene capable of inducing the overexpression of gadR2, said region comprising or consisting of:
[0010] (a) The polynucleotide sequence comprising or consisting of SEQ ID No. 1;
[0011] (b) A polynucleotide sequence at least 80% identical to SEQ ID No. 1 and which allows overexpression of the gadR2 regulatory gene; or
[0012] (c) A complementary sequence to the polynucleotide sequences (a) or (b), in which the complementary sequence and the polynucleotide sequence have the same number of nucleotides and are 100% complementary.
[0013] The present invention also relates to a gadR2 regulatory cassette comprising a gadR2 regulatory gene and its promoter region PgadR2 according to the invention.
[0014] The present invention also relates to the use of a regulatory cassette according to the invention, to induce positive regulation of the gadCB promoter.
[0015] The present invention also relates to a method for inducing positive regulation of the gadCB promoter, said method comprising a step implementing a gadR2 regulatory cassette comprising a gadR2 regulatory gene and its PgadR2 promoter region according to the invention.
[0016] It also relates to a plasmid comprising a gadR2 regulatory cassette according to the invention.
[0017] The present invention also relates to a transformed lactic acid bacterium comprising the plasmid according to the invention.
[0018] It also relates to the use of a plasmid according to the invention or a transformed lactic acid bacterium according to the invention, to induce an overproduction of gamma-aminobutyric acid (GABA). It also relates to a method for inducing an overproduction of gamma-aminobutyric acid (GABA), said method comprising a step implementing a plasmid according to the invention or a transformed lactic acid bacterium according to the invention.
[0019] The present invention also relates to a method for producing GABA comprising the culture of a lactic acid bacterium transformed according to the invention.
[0020] The present invention also relates to a method for producing a genetically modified GABA-producing lactic acid bacterium comprising the introduction into said lactic acid bacterium of a plasmid according to the invention.
[0021] Detailed description
[0022] Promoter region of the qadR2 regulatory gene (PgadR2)
[0023] The invention relates to a promoter region of the gadR2 regulatory gene (PgadR2) capable of inducing overexpression of the gadR2 regulatory gene, said promoter region comprising or consisting of:
[0024] (a) The polynucleotide sequence comprising or consisting of SEQ ID No. 1;
[0025] (b) A polynucleotide sequence at least 80% identical to SEQ ID No. 1 and which allows overexpression of the gadR2 regulatory gene; or
[0026] (c) A complementary sequence to the polynucleotide sequences (a) or (b), in which the complementary sequence and the polynucleotide sequence have the same number of nucleotides and are 100% complementary.
[0027] The identification of this specific promoter region allows for overexpression of the gadR2 regulatory gene, and therefore of the genes of the gadCB operon, as well as an overproduction of GABA.
[0028] By "overexpression of the gadR2 regulatory gene," we mean, in particular, an expression higher than that obtained with a control promoter region of the gadR2 regulatory gene, for example, the promoter region of the gadR2 regulatory gene of the model strain Lactococcus lactis ssp. lactis NCDO2118, also known as strain NCDO2118. More specifically, the promoter region according to the invention allows for an expression of the gadR2 regulatory gene at least 14 times greater than the expression obtained with a control promoter region of strain NCDO2118.
[0029] By "overexpression of the genes of the gadCB operon", we mean in particular a higher expression of the gadC and gadB genes compared to that obtained with a control promoter region, for example the promoter region of the gadCB operon of the model strain NCDO2118. More specifically, the promoter region with the gadR2 regulator according to the invention makes it possible to activate the basal level of the PgadCB promoter responsible for the expression of the gadC and gadB genes by a factor of 268 compared to the basal level, and to increase by a factor of 3 compared to the expression obtained with a control promoter region and its gadR2 regulator of the model strain NCDO2118.
[0030] The basal level corresponds to the expression of the promoter gadCB without the regulator gadR2.
[0031] By "GABA overproduction" is meant a production of GABA greater than that obtained with a control promoter region, for example the promoter region with the gadR2 regulator of the control strain NCDO2118, or the promoter region with the gadR2 regulator of the non-producing strain Lactococcus lactis ssp. lactis IL1403, also called strain IL1403. More specifically, the promoter region according to the invention makes it possible to obtain a production of GABA 18 times greater than the production obtained with a control promoter region of the strain NCDO2118 and 21 times greater than the production obtained with the promoter region of the low-producing strain IL1403 (values obtained by culturing the strains transformed with a plasmid carrying or not the promoter and the regulator in a bioreactor).
[0032] GABA, also known as gamma-aminobutyric acid, is the main inhibitory neurotransmitter of the central nervous system (CNS) and has the following structure:
[0033] [Chem 1]
[0034] GABA is produced by neurons in the central nervous system and by lactic acid bacteria in the digestive system, such as Lactococcus and Lactobacillus. It is also found in many fermented foods, as lactic acid bacteria, such as Lactococcus, produce it. These bacteria produce GABA through the action of a glutamic acid decarboxylase (GAD) system, which includes a GAD enzyme encoded by the gadA or gadB genes and a glutamate / GABA antiporter encoded by the gadC gene.
[0035] SEQ ID No. 1 corresponds to the following sequence: 5'-
[0036] CTAATAGAGCAGATGATGAGCCCAGTATAAGCTTTCACACTGTTTTTATTAATAGCCT AAGAGAAATATAAAGTAATATAAATGTTTTTTATTATAAATTATGTAAGATATACTTTTT GTATGAACTGGTATAAATTTGACGATTAAGTCCTAAATATGTTATAATCTCAATTGCGT AATTTCTTAAATCCAGAAATAACAGCTACATTGACATACTGATTAAAGAGTATAGCCAA TGAACTGTTATAAATCTTGAAAAACAATAAAAATAATAGTTTGGGGGATGTTGAGA-3' This sequence includes all the nucleotides upstream of the coding sequence of the gadR2 gene including the -10, -35 boxes and the 5'UTR region with the RBS (Ribosome Binding Site).
[0037] Said promoter region includes a SNP (single nucleotide polymorphism) consisting of the inversion of an A to T upstream of box -10, and the insertion of an A between box -10 and the RBS, relative to the promoter region of the gadR2 regulator of the model strain NCDO2118 which is taken as control (in bold in Seq ID No. 1).
[0038] In particular, PgadR2 is derived from the Lactococcus lactis EIP3I strain (CNCM I-5388). The Lactococcus lactis EIP3I strain was deposited at the CNCM (National Collection of Microorganism Cultures, 25 rue du Docteur Roux, Paris) on December 13, 2018 under number I-5388.
[0039] Such polynucleotides can be readily obtained by those skilled in the art. The polynucleotides according to the invention can, for example, be obtained by in vitro DNA synthesis. The polynucleotide can then be cloned into a plasmid.
[0040] The term "promoter region" here refers to DNA, including complementary strand DNA, genomic DNA, and synthetic DNA. Polynucleotides can have any three-dimensional structure. A polynucleotide can be double-stranded. Polynucleotides isolated according to the invention can be purified or recombined.
[0041] The promoter region according to the invention may, for example, consist of a minimum of 160 nucleotides.
[0042] This promoter region according to the invention is an isolated sequence.
[0043] The term "isolated" in reference to a biological component refers to a biological component that has been substantially separated or purified from other biological components of the organism's cell, or of the organism itself, in which the component is naturally present, such as other chromosomal and extrachromosomal DNA, proteins, cells, and organelles. "Isolated promoter regions" include nucleic acid molecules purified by standard purification methods. This term also encompasses nucleic acids prepared by amplification and / or cloning, as well as chemically synthesized nucleic acids.
[0044] By "polynucleotide sequence identical to at least 80% of SEQ ID No. 1 and which allows overexpression of the gadR2 regulatory gene," we mean in particular a polynucleotide sequence identical to 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of SEQ ID No. 1 and which allows overexpression of the gadR2 regulatory gene. For example, a polynucleotide sequence "95% identical" means that the polynucleotide sequence is identical to SEQ ID No. 1 and allows overexpression of the gadR2 regulatory gene, except that the sequence may include up to five nucleotide alterations per 100 nucleotides. SEQ ID No. 1. In other words, to obtain a polynucleotide whose sequence is at least 95% identical to SEQ ID No. 1, up to 5% (5 out of 100) of the nucleotides in the sequence can be inserted, deleted or replaced by another nucleotide.In other words, the sequences must be compared over their entire length (i.e., by preparing a global alignment). For example, a first polynucleotide of 100 nt (nucleotides) contained within a second polynucleotide of 200 nt is 50% identical to that second polynucleotide.
[0045] The Needle program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970, A general method applicable to the search for similarities in the amino acid sequence of two proteins, J. Mol. Biol. 48:443-453) to find the optimal alignment (including gaps) of two sequences, taking into account their total length, can be used, for example. Preferably, the percentage of identity according to the invention is calculated using the Needle program with a "Gap open" parameter of 10.0, a "Gap Extend" parameter of 0.5, and a Blosum 62 matrix. The Needle program is available, for example, on the website ebi.ac.uk.
[0046] A "complementary sequence" as used here refers to a sequence that specifically hybridizes in solution, for example, according to Watson-Crick base-matching rules.
[0047] In particular, the gadR2 regulatory gene according to the invention comprises or consists of the polynucleotide sequence comprising or consisting of a sequence at least 80% identical to SEQ ID No. 2.
[0048] SEQ ID No. 2 corresponds to the following sequence: 5'-
[0049] ATGTATAAAAAATATGGAGATTGTTTTAAAAAGTTACGAAACCAAAAGAATTTAGGATT ATCATACTTTAGTAAATTAGGAATAGACCGTTCAAATATATCTAGATTTGAACATGGAA AGTGTATGATGAGTTTTGAGCGCATAGATTTGATGTTAGAAGAAATGCAAGTGCCATT AGCTGAGTACGAATTGATAGTAAATAATTATATGCCGAATTTCCAAGAATTTTTTATAT TAGAATTGGAAAAAGCTGAATTTAGTCAAAATCGAGATAAAATAAAAGAGTTATATTCT GAGGTTAAAGAAACAGGGAATCATTTACTGACGATTACCGTTAAAACGAAGCTTGGG ACTATTAGTCAGACAGAAGTTAAGGAAATTGAAACTTATCTTTGTAATATTGAAGAGTG GGGATATTTTGAACTAACTTTATTCTATTTTGTATCTGATTATCTCAATGTCAATCAATT AGAATTGCTGCTTTTTAACTTTGACAAAAGATGTGAAAATTACTGTAGAGTCTTAAAAT ATAGAAGGAGACTATTGCAAATAGCCTATAAAAGCGTTGCGATATACGCGGCTAATG GAGAAAGAACAAAAGCCGAAAATATTTTAGAAATGACTAAAAAAATATCGGACTGTAGG TGTTGATTTATATTCTGAAGTATTAAGACATCTTGCCAGAGGTATCATTATTTTTAATTT TGAAAATGCAGAAGTGGGAGAAGAAAAAATAAAATTATGCGCTTGAAACTTTGGAAGAA TTTGGAGGAATGAAGATAAAAGAATTCTATCAGAAAAAAATGGAAAAGTATTTGAAAA AGTCAATTTAG-3'.
[0050] By "polynucleotide sequence identical to at least 80% to SEQ ID No. 2, we mean in particular a polynucleotide sequence identical to 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% to SEQ ID No. 2. For example, a polynucleotide sequence "identical" to 95%" means that the polynucleotide sequence is identical to the SEQ ID No. 2 sequence, except that the sequence may include up to five nucleotide alterations per 100 nucleotides of SEQ ID No. 2. In other words, to obtain a polynucleotide whose sequence is at least 95% identical to SEQ ID No. 2, up to 5% (5 out of 100) of the nucleotides in the sequence can be inserted, deleted, or replaced by another nucleotide. In other words, the sequences must be compared along their entire length (i.e., by preparing a global alignment).For example, a first polynucleotide of 100 nt (nucleotides) contained in a second polynucleotide of 200 nt is 50% identical to this second polynucleotide.
[0051] The Needle program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970, A general method applicable to the search for similarities in the amino acid sequence of two proteins, J. Mol. Biol. 48:443-453) to find the optimal alignment (including gaps) of two sequences, taking into account their total length, can be used, for example. Preferably, the percentage of identity according to the invention is calculated using the Needle program with a "Gap open" parameter of 10.0, a "Gap Extend" parameter of 0.5, and a Blosum 62 matrix. The Needle program is available, for example, on the website ebi.ac.uk.
[0052] gadR2 regulator cassette
[0053] The present invention also relates to a gadR2 regulatory cassette comprising a gadR2 regulatory gene according to the invention and its PgadR2 promoter region according to the invention.
[0054] A regulatory cassette according to the invention is a natural DNA fragment or a recombinant construct comprising an artificial combination of nucleic acid fragments, including, but not limited to, regulatory and coding sequences not found together in nature. For example, a recombinant DNA construct may include regulatory and coding sequences from different sources, or regulatory and coding sequences from the same source arranged in a manner different from that found in nature. The expression cassette may include 5' and 3' regulatory sequences operationally linked to the PgadR2 promoter and / or the gadR2 regulatory gene according to the invention. "Operationally linked" means a functional link between two or more elements.Regulatory sequences are nucleotides located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence that can influence the transcription, RNA processing, stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, translation head sequences and polyadenylation recognition sequences.
[0055] The present invention also relates to the use of a regulatory cassette according to the invention, to induce positive regulation of the gadCB promoter.
[0056] It also relates to a method for inducing positive regulation of the gadCB promoter, said method comprising a step implementing a gadR2 regulatory cassette comprising a gadR2 regulatory gene and its PgadR2 promoter region according to the invention.
[0057] The gadCB operon includes the gadC gene which encodes the glutamate and GABA transporter and gadB which encodes glutamate decarboxylase, these two genes depending on the same gadCB promoter (PgadCB).
[0058] By "positive regulation" we mean that the regulatory cassette according to the invention will induce an activation of PgadCB, in particular an overactivation of PgadCB.
[0059] This positive regulation of the gadCB promoter allows for overexpression of the gadC and gadB genes, which leads to an overproduction of GABA.
[0060] By "overexpression of the gadC and gadB genes" and "overproduction of GABA", we mean the same definition as that given in the paragraph relating to the PgadR2 promoter region.
[0061] By "PgadCB overactivation," we mean, in particular, a greater activation of PgadCB compared to that obtained with a control promoter region, for example, the promoter region of the gadCB operon of the NCDO2118 model strain. More specifically, the promoter region according to the invention enables the basal level of the PgadCB promoter responsible for the expression of the gadC and gadB genes to be activated by a factor of 268 compared to the basal level, and to increase expression by a factor of 3 compared to that obtained with a control promoter region and its regulator gadR2 of the NCDO2118 model strain (values obtained by fusion of the promoter to a reporter gene). "Basal level" has the same definition as that given in the paragraph relating to the PgadR2 promoter region. Plasmid
[0062] The present invention also relates to a plasmid comprising a gadR2 regulatory cassette according to the invention. "Plasmid" herein means a circular, double-stranded DNA molecule. The plasmid may include a marker gene for selecting cells containing said plasmid, an origin of replication to enable the cell to replicate the plasmid, and / or a multiple cloning site for inserting a DNA fragment, in particular the cassette according to the invention. In particular, said plasmid is selected from those described in Table 1.
[0063] [Table 1]
[0064] The present invention also relates to the use of a plasmid according to the invention to induce GABA overproduction. It further relates to a method for inducing gamma-aminobutyric acid (GABA) overproduction, said method comprising a step implementing a plasmid according to the invention. The definition of "GABA overproduction" has already been explained in the section concerning the PgadR2 promoter region.
[0065] Within the framework of the present invention, the use of the plasmid according to the invention will make it possible in particular to transform a lactic acid bacterium in order to obtain a strain that overproduces GABA.
[0066] Transformed lactic acid bacteria
[0067] The present invention therefore also relates to a transformed lactic acid bacterium comprising the plasmid according to the invention.
[0068] The present invention also relates to the use of a lactic acid bacterium transformed according to the invention, to induce an overproduction of GABA.
[0069] It also relates to a method for inducing an overproduction of gamma-aminobutyric acid (GABA), said method comprising a step using a lactic acid bacterium transformed according to the invention.
[0070] Lactic acid bacteria are well known to those skilled in the art, who can carry out the transformation based on their general knowledge.
[0071] Lactic acid bacteria according to the invention will in particular be selected from Lactococcus lactis ssp. lactis IL1403, as described in Chopin A, Chopin MC, Moillo-Batt A, Langella P (1984) Two plasmid determined restriction and modification systems in Streptococcus lactis. Plasmid 11:260-263, and Lactococcus lactis ssp. lactis NCDO2118, as described in Oliveira LC, Saraiva TDL, Soares SC, Ramos RTJ, Sà PHCG, Carneiro AR, et al. Genome Sequence of Lactococcus lactis subsp. lactis NCDO 2118, a GABA-Producing Strain. Genome Announc. 2014;2:e00980-14., and Lactococcus lactis EIP3I (CNCM I-5388) as described in Gomes P et al., 2023, FASEB J., https: / / doi.org / 10.1096 / fj.202301588R.
[0072] The overproduction of GABA is as defined above and will result from the presence of the plasmid according to the invention, itself comprising a regulatory cassette according to the invention, said cassette comprising the promoter region according to the invention capable of in the end inducing the overproduction of GABA.
[0073] GABA production process
[0074] The present invention also relates to a method for producing GABA comprising the culture of a lactic acid bacterium transformed according to the invention.
[0075] As already mentioned, lactic acid bacteria are well known to those skilled in the art, who can carry out the transformation based on their general knowledge. The preparation of culture media and the definition of culture conditions enabling the growth and production of GABA in the lactic acid bacteria strains of the present invention are well known to those skilled in the art; these culture media can be adapted to each specific strain of Lactococcus lactis.
[0076] Furthermore, the culture of transformed lactic acid bacteria can be carried out between 25 and 42°C. In some cases, the culture of transformed lactic acid bacteria can be performed under aerobic or anaerobic conditions. Temperature conditions can be regulated using a thermostatic bath, a heating jacket, a jacket, etc. The term "anaerobic conditions" used here refers to an environment with low oxygen levels or no oxygen in which lactic acid bacteria can proliferate. For example, in such an environment, anaerobic conditions can be achieved by using an anaerobic chamber, an anaerobic box, an airtight container or bag containing a deoxidizer, or other similar product, or simply by sealing a culture container tightly. Culture formats may include static culture, stirred culture, and tank culture.Furthermore, the culture duration can range from 3 to 96 hours. In some cases, the pH of the medium can be maintained between 4.5 and 7.0 at the start of the culture.
[0077] For example, the culture medium and culture conditions used in a bioreactor may be as follows: 5 g / L of glutamic acid, 50 g / L of glucose and 5 pg / mL of erythromycin in a base medium with yeast extract at 10 g / L, pH regulation at 6.6 for 7 h then a decrease in pH to 4.6.
[0078] Such lactic acid bacteria will be specifically chosen from Lactococcus lactis ssp. lactis IL1403, as described in Chopin A, Chopin MC, Moillo-Batt A, Langella P (1984) Two plasmid determined restriction and modification systems in Streptococcus lactis. Plasmid 11:260-263., and Lactococcus lactis ssp. lactis NCDO2118, as described in Oliveira LC, Saraiva TDL, Soares SC, Ramos RTJ, Sà PHCG, Carneiro AR, et al. Genome Sequence of Lactococcus lactis subsp. lactis NCDO 2118, a GABA-Producing Strain. Genome Announc. 2014;2:e00980-14., Lactococcus lactis EIP3I (CNCM I-5388) as described in Gomes P et al., 2023, FASEB J., https: / / doi.org / 10.1096 / fj.202301588R.
[0079] Here again, the overproduction of GABA is as defined previously and will result from the presence of the plasmid according to the invention, itself comprising a regulatory cassette according to the invention, said cassette comprising the promoter region according to the invention capable of ultimately inducing the overproduction of GABA.
[0080] In particular, the culture obtained from transformed GABA-producing lactic acid bacteria can be used directly. In some cases, the culture of transformed lactic acid bacteria may be subjected to further treatments, including sterilization, crude purification by centrifugation, and / or solid-liquid separation by filtration, as required. Furthermore, the transformed lactic acid bacteria according to the invention may be in the form of viable bacterial cells and / or in the form of moist bacterial cells or dried bacterial cells. The transformed lactic acid bacteria according to the invention may also be dead bacteria, said bacteria having retained their intact cell morphology as well as GAD activity. In one embodiment, these dead bacteria have been inactivated with ethanol.
[0081] In particular, a sterilized product can be prepared by a sterilization process using transformed lactic acid bacteria. Sterilization processes may include filtration sterilization, radiation disinfection, overheating disinfection, and pressure disinfection.
[0082] In some embodiments, a heated product can be prepared by heat treatment of transformed lactic acid bacteria. The heat treatment may include high-temperature treatment (e.g., 80°C to 150°C) of the transformed lactic acid bacteria for a certain time (e.g., from 10 minutes to 1 hour, or from 10 to 20 minutes).
[0083] In some embodiments, a destructured product or cell-free extract can be prepared by destructuring, fracturing, reducing in size, crushing, pulverizing, disintegrating, or grinding the transformed lactic acid bacteria. For example, physical destructuring (e.g., agitation or filtration), enzymatic lysis treatment, chemical treatment, and / or autolysis induction treatment can be performed.
[0084] In some embodiments, an extract can be obtained by extraction of the transformed lactic acid bacteria using a suitable aqueous or organic solvent. For example, the transformed lactic acid bacteria can be immersed in an aqueous or organic solvent (e.g., water, methanol, or ethanol), or can be agitated or refluxed in the solvent.
[0085] In some embodiments, the transformed lactic acid bacteria can be converted into a powder or granular product by drying. Drying methods include spray drying, drum drying, vacuum drying, and freeze-drying, which can be used alone or in combination.
[0086] In some embodiments, GABA can be purified from transformed lactic acid bacteria by a known separation / purification method. Examples of such separation / purification methods include: a method involving the precipitation of salts or organic solvents based on degrees of solubility; a method involving dialysis, ultrafiltration, or gel filtration based on molecular weight differences; a method involving ion-exchange chromatography based on charge differences; a method involving affinity chromatography based on degrees of specific binding; and a method involving hydrophobic chromatography or reversed-phase chromatography based on degrees of hydrophobicity, or a combination thereof.
[0087] Method for producing a genetically modified GABA-producing lactic acid bacterium
[0088] The present invention also relates to a method for producing a genetically modified GABA-producing lactic acid bacterium comprising the introduction into said lactic acid bacterium of a plasmid according to the invention.
[0089] As already mentioned, lactic acid bacteria are well known to those skilled in the art who can genetically modify the lactic acid bacteria based on their general knowledge.
[0090] Such lactic acid bacteria will be specifically chosen from Lactococcus lactis ssp. lactis IL1403, as described in Chopin A, Chopin MC, Moillo-Batt A, Langella P (1984) Two plasmid determined restriction and modification systems in Streptococcus lactis. Plasmid 11:260-263, and Lactococcus lactis ssp. lactis NCDO2118, as described in Oliveira LC, Saraiva TDL, Soares SC, Ramos RTJ, Sà PHCG, Carneiro AR, et al. Genome Sequence of Lactococcus lactis subsp. lactis NCDO2118, a GABA-Producing Strain. Genome Announc. 2014;2:e00980-14, Lactococcus lactis EIP3I (CNCM I-5388) as described in Gomes P et al., 2023, FASEB J., https: / / doi.org / 10.1096 / fj.202301588R.
[0091] Genetically modified lactic acid bacteria, as described here, can be propagated under conditions and in media known to those skilled in the art.
[0092] In some embodiments, genetically modified lactic acid bacteria can be prepared by culture under suitable conditions using a medium conventionally used for culturing lactic acid bacteria. A natural or synthetic medium can be used as the culture medium provided it contains a carbon source, a nitrogen source, a mineral salt, a genetic construct selection agent (e.g., erythromycin), and other components, and that it allows the efficient culture of genetically modified lactic acid bacteria. To produce GABA, the medium must contain free glutamate, as this is the precursor of GABA. A person skilled in the art can adequately select a known medium suitable for a particular bacterial strain. Examples of carbon sources that can be used include lactose, glucose, sucrose, fructose, galactose, and blackstrap molasses.Examples of nitrogen sources that can be used include nitrogen-containing organic substances such as casein hydrolysate, whey protein hydrolysate, and soy protein hydrolysate. Examples of mineral salts that can be used include phosphate, sodium, potassium, and magnesium. Examples of suitable media for culturing lactic acid bacteria include MRS liquid medium, GAM medium, BL medium, Briggs liver broth, animal milk, skim milk, and milk-derived whey. Tomato juice, carrot juice, other vegetable juices, apple juice, pineapple juice, and grape juice are examples of natural media that can be used.
[0093] The genetically modified lactic acid bacteria obtained by the process according to the invention can be used and processed according to the methods described in the paragraph relating to the GABA production process.
[0094] As mentioned above, GABA can be used to address intestinal pain, mood disorders, stress management, and more broadly, human and animal health and nutrition. It is also used as a bitterness blocker and / or food flavoring agent.
[0095] Thus, the lactic acid bacteria according to the invention can be used in human and animal health and / or nutrition.
[0096] The invention is now illustrated by the following figures and examples.
[0097] Figures
[0098] [Fig 1]: Construction strategy of the different plasmids used
[0099] [Fig 2]: Endpoint fluorescence measurement protocol
[0100] [Fig 3]: Alignment of the PgadR2 promoter sequences of L. lactis strains EIP3I and NCDO2118
[0101] [Fig 4]: Measurement of PgadCB promoter activation with or without regulator in EIP3I and NCDO2118 strains
[0102] [Fig 5]: Measurement of PgadR2 promoter activation in L. lactis EIP3I and NCDO2118 strains
[0103] Examples
[0104] Study of gad gene expression in different L. lactis strains
[0105] The expression levels of different gad genes from two L. lactis strains (EIP3I (CNCM I-5388) as described in Gomes P et al., 2023, FASEB J., https: / / doi.org / 10.1096 / fj.202301588R) and NCDO2118 (Oliveira LC, Saraiva TDL, Soares SC, Ramos RTJ, Sà PHCG, Carneiro AR, et al. Genome Sequence of Lactococcus lactis subsp. lactis NCDO2118, a GABA-Producing Strain. Genome Announc. 2014;2:e00980-14) were measured by fusing gadR2 promoters, gadR2 genes, and gadCB promoters with eGFP (enhanced form of green fluorescent protein GFP) in a pTRKH3-eGFP plasmid and the plasmid was introduced into the reference strain L. lactis IL1403.
[0106] Materials and methods
[0107] in silico analysis
[0108] The sequences of the promoter regions (PgadCB and PgadR2) and the gadR2 genes of the EIP3I and NCDO2118 strains were aligned using the CLUSTALW algorithm (default parameters used) available in the MEGA11 (Molecular Evolutionary Genetics Analysis) software.
[0109] The BENCHLING software was used for the in silico construction of plasmids as well as for the design of oligonucleotides.
[0110] Construction of the different plasmids used in the study
[0111] Figure 1 illustrates the strategies used to construct the different plasmids. Table 1 describes the cloning method used for each plasmid (GIBSON cloning or blunt-end ligation cloning). Table 2 describes the sequence of oligonucleotides (or primers) used to perform the different cloning methods.
[0112] [Table 2]
[0113] Oligonucleotides used (Floating tail in bold) The oligonucleotides were synthesized by EUROFINS GENOMICS. All cloning was carried out in the E. coli DH5a strain.
[0114] Specifically, the pTRKH3-Perm-eGFP plasmid (Ref Plasmid #27169) was purchased from Addgene (Addgene Europe, Teddington, UK). This plasmid contains two origins of replication (or / p15A allowing its replication in E. coli, and o pAMpi allowing its replication in L. lactis), an erythromycin resistance gene allowing selection in E. coli (ery 150 pg / mL) or L. lactis (ery 5 pg / mL), as well as eGFP under the control of the promoter of the erythromycin resistance gene (Perm).
[0115] ■ A1 - The pTRKH3-eGFP (T-) plasmid was obtained by deletion of the Perm promoter after PCR amplification of 10 pg of pTRKH3-Perm-eGFP template DNA with oligonucleotides A1 and A2 (0.5 pM final concentration for each). Amplification was performed using the CloneAmp HiFi PCR Premix (cat. No. 639298) from TaKaRa (TaKaRa Bio Europe SAS) in a final volume of 25 pL, according to the manufacturer's recommendations. The PCR conditions were as follows:
[0116] 1- Denaturation 2 min at 98°C;
[0117] 2- Denaturation 10 sec at 98°C;
[0118] 3- Hybridization 10 sec at 58°C;
[0119] 4- Elongation 1 min 30 at 72°C;
[0120] 5-30 PCR cycles are performed (steps 2 to 4);
[0121] 6- Elongation 2 min at 72°C.
[0122] (The hybridization temperature was determined using the Tm calculator software (https: / / tmcalculator.neb.eom / #l / main), the elongation time is 5 sec / kb).
[0123] ■ A2- After amplification, 5 pL of the PCR mix are passed on gel to check the size of the amplified fragment (7600 bp), and the remaining 20 pL are purified with the QIAquick PCR kit from QIAGEN (Ref 28104) according to the manufacturer's protocol.
[0124] ■ A3- The purified DNA (100 ng) is then phosphorylated with T4 polynucleotide kinase (Ref M0201S from New England Biolabs) and ligated using T4 DNA ligase (M0202S from New England Biolabs) according to the supplier's recommendations.
[0125] ■ A4- 5 pL of ligated DNA (= blunt-end cloning) are used to transform chemocompetent E. coli NEB 5a cells (derived from the E. coli DH5a strain) (C2987H from New England Biolabs). Selection is performed on LB + ery (150 pg / mL).
[0126] ■ A5 - A colony is then cultured, and plasmid DNA is extracted using the Monarch Plasmid Miniprep kit (Ref T1010L from New England Biolabs) according to the supplier's recommendations. The DNA sequence is verified by Sanger sequencing (EUROFINS). ■ B1 - The pTRKH3-pCB plasmids E iP3reGFP and pTRKH3-pCB2ii8-eGFP were built by replacing Perm with pCB E | P3 | or pCB2n8 respectively. More specifically, the pTRKH3-Perm-eGFP vector DNA was amplified by PCR with primers A1 and A2 as described above. The pCB insert DNAs E | P3 | or pCB 2118350 bp cells each were amplified by PCR using genomic DNA (1 ng) from strains EIP3I and NCDO2118, respectively, as a template. Amplification was performed with the Q5-HF DNA polymerase (M0491 from New England Biolabs) in a final volume of 50 pL with primers A4 and A5, according to the manufacturer's recommendations. The PCR conditions were as follows:
[0127] 1- Denaturation 2 min at 98°C;
[0128] 2- Denaturation 10 sec at 98°C;
[0129] 3- Hybridization 30 sec at 58°C;
[0130] 4- 30 sec at 72°C;
[0131] 5-30 PCR cycles are performed (steps 2 to 4);
[0132] 6- Elongation 2 min at 72°C.
[0133] ■ (The hybridization temperature was determined using the Tm calculator software (https: / / tmcalculator.neb.eom / #l / main), the elongation time is 20 sec / kb).
[0134] ■ B2- After amplification of the insert fragments, the DNA is passed on gel and purified on a QIAGEN column as previously described in A2.
[0135] ■ B3 - Primers A4 and A5 have floating tails (nucleotides in bold) that allow hybridization to the pTRKH3-Perm-eGFP vector DNA, which has been previously amplified with A1 and A2. This enables Gibson-type assembly. Therefore, 50 ng of pTRKH3-Perm-eGFP vector DNA amplified with A1 and A2 will be mixed with EIP3I or NCDO2118 insert DNA amplified with A4 and A5 in molar ratios of 1 mole of vector to 3 moles of insert. Gibson cloning will be performed using the NEBuilder® HiFi DNA Assembly Master Mix kit (E2621 from New England Biolabs).
[0136] ■ B4- 4 pL of the GIBSON product are then used to transform chemocompetent E. coli NEB 5a cells (C2987H from New England Biolabs). Selection is performed on LB + ery (150 pg / mL).
[0137] ■ B5- A colony is then cultured, and plasmid DNA is extracted using the Monarch Plasmid Miniprep kit (Ref T1010L from New England Biolabs) according to the supplier's recommendations. The DNA sequence is verified by Sanger sequencing (EUROFINS).
[0138] ■ C1- The pTRKH3-R2 plasmids E | P 3.pCB E | P3r eGFP and pTRKH3-R2 2118 -pCB 2118 - eGFPs were built by cloning upstream pCBs E | P3 | and pCB 2118 gadR2 regulatory genes EiP3i and gadR22H8 under the control of their own promoters (R2 E IP3I and R2 2118 ). The vectors pTRKH3-pCB E iR3i-eGFP and pTRKH3-pCB2n8-eGFP were amplified by PCR with primers A1 and A6 and inserts R2 E IP3I and R2 2118 were amplified from genomic DNA with primers A7 and A8 and a GIBSON cloning was performed as described previously in Part B.
[0139] ■ D1- The pTRKH3-pR2 plasmids E iP3i-eGFP and pTRKH3-pR2 2118 -eGFP were obtained by deleting the fragments [gadR2 H p 3r pCB E | P3 |] and [gadR2 2 8 -pCB 2118 pTRKH3-R2 plasmids E ip3.pCB E ip3|-eGFP and pTRKH3-R2 2118 -pCB 2118 -eGFP respectively. These were amplified by PCR with primers A2 and A11 and recircularized according to the protocol described in part A (blunt end ligation).
[0140] • E1- The pTRKH3-R2 plasmid E iP3i was obtained by deleting the cassette [pCB E | P3 |- eGFP] of the pTRKH3-R2 plasmid E | P3 .pCB E | P3 |-eGFP. For this, it was amplified by PCR with primers A3 and A16 and recircularized according to the protocol described in part A (blunt end ligation).
[0141] Electro-transformation of the Lactococcus lactis IL1403 strain
[0142] The preparation of electrocompetent cells was carried out following the protocol of Le Bourgeois P et al., 2000 (Electrotransformation of bacteria, Chapter 6, Springer Lab Manual, N. Eynard, J. Tessié (eds) Springer-Verlag Berlin Heidelberg 2000) with the following adjustments: the cells were pre-adapted to glycine during a first preculture of 5 mL in M17 + 5 g / L glucose + 0.5 M sucrose + 1% glycine for 24 h at 30°C without shaking. Then a second preculture was carried out by inoculating 50 pL of the first preculture into the same culture medium except for the addition of 2% glycine. Finally, the final culture was carried out in the same medium as the second preculture, at 30°C without shaking until an OD between 0.5 and 0.8 was obtained. The rest of the protocol is carried out according to Le Bourgeois P et al., 2000, cited above.
[0143] Competent cells are aliquoted at 75 pL into microtubes, then immediately frozen for 1 min in liquid nitrogen and stored at -80°C. For transformation, one aliquot is thawed on ice. 15 ng of plasmid are added directly to the cells and incubated for 4 min on ice, then transferred to a pre-chilled electroporation tank. The electroporation conditions are: 2.40 kV, 400 ohms, 25 pF. Then, 900 pL of M17 + 5 g / L glucose + 0.5 M sucrose are immediately added, and the cells are transferred to a microtube for phenotypic expression for 3 h at 30°C without agitation. 100 pL of the direct or 10' dilution is then added. 1 are spread on GM 17 plates + Agar + 5 pg / mL erythromycin and incubated for 48 h at 30°C. Fluorescence level measurement
[0144] The protocol is illustrated by [Figure 2],
[0145] Specifically, 1 mL of Yeast Extract (YE) at 10 g / L + Erythromycin (ery) at 5 pg / mL is inoculated with the different IL1403 strains transformed with the plasmids described above from cryotubes. Growth is carried out overnight at 30°C without shaking. Then, 10 pL of this preculture is inoculated into 1 mL of YE + ery 5 pg / mL and cultured at 30°C without shaking. After 8 h of growth, 10 pL of this last preculture is inoculated into 1 mL of the previously described medium and cultured overnight at 30°C without shaking. Four biological replicates are prepared. This culture is then centrifuged at 6000 rpm for 5 min, and the bacterial pellet is resuspended in 1 mL of PBS buffer. This step is repeated. Then, this bacterial suspension is diluted with H₂O ièmeThe sample was placed in PBS buffer and loaded into a flat-bottom microplate (Microtest Plate 96 well, Ref 82.1581001 from Starsted). Eight technical replicates were performed. The emitted fluorescence was read using a fluorometer (BIOTEK, Synergy H1, Microplate Reader) with the following wavelengths: 485 nm (excitation) and 514 nm (emission).
[0146] Results
[0147] In silico analysis of the PgadCB, PgadR2 promoters and the gadR2 regulatory genes of the EIP3I and NCDO2118 strains
[0148] Sequence alignment showed that the PgadCB promoters of the EIP3I and NCDO2118 strains are identical.
[0149] However, the alignment of the PgadR2 promoter sequences of the EIP3I and NCDO2118 strains shows two differences: a single nucleotide polymorphism (SNP) upstream of box -10 (T in the EIP3I sequence instead of A in the NCDO2118 sequence), and the insertion of an A upstream of the RBS for the EIP3I strain sequence. These results are illustrated in [Figure 3].
[0150] Alignment of the gadR2 gene sequences shows that they are identical for the EIP3I and NCDO2118 strains.
[0151] Comparison of the activity of the PgadCB promoters of L. lactis strains EIP3I and NCDO2118 under the control of their respective gadR2 regulator.
[0152] The activity level of the different PgadCB promoters was studied by fusion with the fluorescent marker eGFP. The different constructs carried by replicative plasmids in Lactococcus lactis were introduced by transformation into the IL1403 strain, a low GABA producer and reference strain. The results are shown in [Figure 4].
[0153] The fluorescence measurement showed that
[0154] 1- The gadR2 regulatory gene is required for the activation of the PgadCB promoter (activation of factor 268 for PgadCB) HP3 / and a factor of 70 for PgadCB 2118 )
[0155] 2- Activation of the PgadCB promoter EiP3i under the control of its gadR2 regulator EiP3i is 3 times greater than the activation of the PgadCB promoter 2118 under the control of its gadR2 regulator 2118 .
[0156] 3- Like the sequences of the PgadCB promoters EiP3i and PgadCB 2118 are identical, as are the gadR2 genes in these 2 strains; the observed differences must stem from the level of activation of the PgadR2 promoters.
[0157] Comparison of PgadR2 promoter activity in EIP3I and NCDO2118 strains
[0158] The activity level of the different PgadR2 promoters was studied through fusion with the fluorescent marker eGFP.
[0159] The results are shown in [Figure 5],
[0160] The PgadR2 promoter of the EIP3I strain is 14 times stronger than the PgadR2 promoter of the NCDO2118 strain. It therefore seems that the sequence differences between these 2 promoters (inversion of an A to a T upstream of box -10 and / or insertion of an A for the EIP3I strain) allow it to express the regulator more strongly.
[0161] Study of the impact of PgadR2 from the L. lactis strain EIP3I on GABA production in different L. lactis strains
[0162] The study was set up to illustrate the overproduction of GABA in 2 different strains: the IL1403 strain which produces very little GABA and the NCDO2118 strain whose gadCB operon is already fully functional.
[0163] Materials and methods
[0164] Six transformed strains were studied: 1- EIP3I carrying the pTRKH3-R2 plasmid E | P3 2- EIP3I carrying the control plasmid pTRKH3-eGFP, 3- NCDO2118 carrying the plasmid pTRKH3-R2 E | P3 |, 4- NCDO2118 carrying the control plasmid pTRKH3-eGFP, 5- IL1403 carrying the plasmid pTRKH3-R2 E | P3 | and 6- IL1403 carrying the control plasmid pTRKH3-eGFP. They were cultured on M17 medium with 20 g / L glucose and 5 pg / mL erythromycin in static mode at 30°C and harvested during the exponential growth phase (optical density at 580 nm, OD 580~2), to be aliquoted into 2 mL cryotubes in the presence of 20% v / v glycerol and stored at -80°C. These stocks were used for precultures and cultures in bioreactors. Microbial cultures were performed in duplicate in 2 L bioreactors (BiostatB plus, Sartorius, Melsungen, Germany) with M17 medium (Table 3) supplemented with 5 g / L glutamic acid, 50 g / L glucose, and 5 pg / mL erythromycin. Incubation was carried out at 30°C with stirring (250 rpm) under microaerobic conditions (initial aeration of the medium followed by cessation of gas exchange with the medium). The pH was maintained at 6.6 with 10 N KOH for 7 h, then adjusted to 4.6 by the addition of orthophosphoric acid.
[0165] [Table 3]
[0166] Composition of medium M17
[0167] The cultures were inoculated with cells from precultures in Erlenmeyer flasks in a similar medium but without glutamic acid. They were harvested during the exponential phase and concentrated to obtain an initial optical density (OD) at 580 nm of 0.25 in the fermenter.
[0168] Growth was monitored by measuring absorbance at 580 nm (Libra S11, Biochom, one unit of absorbance is equivalent to 0.3 g / L).
[0169] Samples were collected every 30 min for 15 h and then at the 24 h mark. They were stored at -20°C after biomass removal by centrifugation (4 min at 13,000 rpm at 4°C) for subsequent quantification of GABA concentrations by HPLC according to the method described by Laroute V, Yasaro C, Narin W, Mazzoli R, Pessione E, Cocaign-Bousquet M, et al. GABA Production in Lactococcus lactis Is Enhanced by Arginine and Coaddition of Malate. Front Microbiol. 2016;7 doi: 10.3389 / fmicb.2016.01050. Preparation of the pT R KH 3- R2 plasmid F IPSI and control plasmid (pT RKH3-eGFP) see § Construction of the different plasmids used in the study, parts A1 and E1 Results
[0170] The results are shown in [Table 4] below.
[0171] GABA represents the concentration of GABA (mM) measured at 12 hours of culture.
[0172] [Table 4]
[0173] PgadR2 of the EIP3I strain allows overexpression of the EIP3I gadR2 regulatory gene, which increases GABA production in this hyper-producing strain under fermentation conditions.
[0174] Overexpression of the EIP3I gadR2 regulatory gene in the NCDO2118 strain gives it the ability to produce larger quantities of GABA.
[0175] Overexpression of the EIP3I gadR2 regulatory gene in the IL1403 strain gives it the ability to produce larger quantities of GABA.
[0176] (original in electronic form)
[0177] (This sheet is not part of the international application nor does it count as a sheet thereof)
[0178] RESERVED FOR THE RECEIVING OFFICE
[0179] FOR INTERNATIONAL OFFICE USE ONLY
Claims
DEMANDS 1. Promoter region of the gadR2 regulatory gene capable of inducing gadR2 overexpression, said promoter region comprising or consisting of: (a) The polynucleotide sequence comprising or consisting of SEQ ID No. 1; (b) A polynucleotide sequence at least 80% identical to SEQ ID No. 1 and which allows overexpression of the gadR2 regulatory gene; or (c) A complementary sequence to the polynucleotide sequences (a) or (b), in which the complementary sequence and the polynucleotide sequence have the same number of nucleotides and are 100% complementary.
2. Promoter region according to claim 1, wherein the gadR2 regulatory gene comprises or consists of the polynucleotide sequence comprising or consisting of a sequence at least 80% identical to SEQ ID No.
2.
3. gadR2 regulatory cassette comprising a gadR2 regulatory gene as defined in claim 2 and its promoter region as defined in claim 1.
4. Use of a regulatory cassette according to claim 3, to induce positive regulation of the gadCB promoter.
5. Plasmid comprising a gadR2 regulating cassette according to claim 3.
6. Transformed lactic acid bacterium comprising the plasmid as defined in claim 5.
7. Use of a plasmid according to claim 5 or of a transformed lactic acid bacterium according to claim 6, to induce an overproduction of gamma-aminobutyric acid (GABA).
8. A process for the production of GABA comprising the culture of a lactic acid bacterium transformed according to claim 6.
9. A method for producing a genetically modified GABA-producing lactic acid bacterium comprising introducing into said lactic acid bacterium a plasmid according to claim 5.