Musculoskeletal conditions
Inhibiting microRNA-544a targets Wnt activation to halt OA progression, offering a less-invasive and cost-effective treatment for OA and rheumatoid arthritis by reducing cartilage degradation and pain.
Patent Information
- Application Number
- PCT/GB2025/051522
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-10
- Filing Date
- 2025-07-10
- Publication Date
- 2026-01-15
AI Technical Summary
Current treatments for osteoarthritis (OA) and rheumatoid arthritis are invasive, costly, and lack effective non-invasive or less-invasive strategies to halt cartilage degeneration and reduce pain, with existing pharmacological therapies providing mixed results and significant health-care burdens.
Inhibition of microRNA-544a (miR-544a) using an inhibitor to target Wnt activation, which is overactive in OA, to halt disease progression and maintain homeostasis in cartilage, potentially combined with other therapies.
The inhibition of miR-544a addresses cartilage degeneration by restoring Wnt pathway homeostasis, reducing cartilage degradation, and providing a less-invasive, cost-effective treatment option with reduced side effects.
Smart Images

Figure GB2025051522_15012026_PF_FP_ABST
Abstract
Description
[0001] Musculoskeletal Conditions
[0002] The present invention relates to therapies for musculoskeletal conditions, and particularly although not exclusively, to therapies for treating conditions that affect the joints, such as osteoarthritis (OA) and rheumatoid arthritis.
[0003] The articular cartilage (AC) is the tissue covering the edges of the bones in the joint. Its role is to support and distribute loads during joint motion and to allow smooth movements. OA is a chronic and degenerative musculoskeletal condition affecting 30% of the population over the age of 60. Progressive degradation of the AC is the hallmark of OA.
[0004] During the early stages of the disease, patients are recommended to adjust their lifestyle, for example by doing therapeutic exercise to improve muscle strengthening and / or by losing weight. Currently, no pharmacological therapy is available to patients except from pain relief, managed with topical or oral administration of non-steroidal anti-inflammatory drugs which can be complemented with steroid injections when other treatments fail.
[0005] Hence, patients whose mobility is severely compromised undergo invasive surgical joint replacement, which is not devoid of post-operative complications, such as infections, joint dislocations, and risk of requiring revision surgeries, especially in the most elderly patients. Additionally, while joint replacement procedures allow regaining of joint mobility, they are nonetheless not effective in reducing pain in ~20% of cases. Furthermore, wait times for joint replacement can vary between six months to a year, depending on health care efficiency and capability in different regions of the UK. Treating OA and rheumatoid arthritis cost £10.2 billion to the UK healthcare system back in 2017, and is expected to reach an estimated £118.6 billion in the next decade.
[0006] Some interventional approaches aimed to halt cartilage degeneration and / or promote its regeneration while also decreasing pain perception, currently under investigation / clinical trial are limited. Cell based therapies, relying on the injection of autologous / heterologous adipose tissue or bone-marrow derived mesenchymal stem cells in the joint, have so far provided mixed results due to difficulties in large-scale production, control of differentiation and inter-donor variability of response. The small molecule market sees only one drug in Phase III clinical trial: Lorecivivint® (BioSplice), a Cdc-like Kinase 2 and Dual-Specificity Tyrosine Phosphorylation- regulated Kinase 1 inhibitor and a modulator of the Wnt-0-catenin pathway. While preliminary data from the Phase III clinical trial, did not meet primary or secondary endpoints, a positive trend in a subgroup of patients with moderate rather than severe OA was noted. LNA043 (Novartis) is a derivative of Angiopoietin-like 3 and was shown to have anabolic and pro-regenerative potential both in vitro and in vivo, although in vitro responses were evident only at supramicromolar concentrations. A phase II clinical trial designed to test efficacy in OA patients is currently ongoing, and results are expected in 2027. LRX712 (Novartis) and TPX-100 supposedly induce chondroprogenitor cell differentiation, although information on their mechanism of action is limited and related to bone rather than cartilage remodelling. Phase II clinical trials are ongoing, but no results on their efficacy in humans have been published to date. QUC398 is an anti-ADAMTS5 nanobody (Merck / Novartis) in Phase II clinical trial to test its efficacy in slowing down cartilage degradation and reducing pain. A few molecules aimed to tackle OA pain have also just entered Phase II clinical trial (RTX- GRT7039, OLP-002, DFV890, GSK3858279). Some molecules, approved or originally tested for their anti-inflammatory activity in other diseases, are also currently under assessment for their potential use in patients affected by OA. Among them we can list the anti-inflammatory molecule DFV890, targeting the inflammasome pathway, originally tested against COVID-19; Iguratimod, a drug approved for patients affected by rheumatoid arthritis, to reduce pain and inflammation, and Metformin, the treatment of choice for patients affected by diabetes, and currently in clinical trial for patients affected by hand OA.
[0007] While studies are ongoing, we still do not have an effective treatment against OA. Finding new, non- or less-invasive, cost-effective, and more efficient strategies to treat OA is therefore an absolute priority to improve the quality of life of millions of people as well as decrease costs and health-care related inequalities.
[0008] Furthermore, there is increasing emphasis and pressure on the scientific community on working towards a better patients' stratification strategy and in personalised medicine: as OA is a multi-factorial disease it is unlikely a "one-size-fit-all" approach will not work for the vast population of patients, and different therapeutic approaches will be required.
[0009] Accordingly, the inventors set out to identify the role of Wnt molecules in cartilage degradation in OA, and surprisingly discovered that microRNA-544a (miR-544a) enhances Wnt activation in cells isolated from the AC (chondrocytes). Based on such discoveries, the inventors further set out to test whether inhibition of miR-544a could be used to halt disease progression in musculoskeletal conditions. Accordingly, in a first aspect of the invention, there is provided an inhibitor of microRNA-544a (miR-544a), for use in treating, preventing or ameliorating a musculoskeletal condition.
[0010] In a second aspect of the invention, there is provided a method of treating, preventing or ameliorating a musculoskeletal condition in a subject, the method comprising, administering, or having administered, to a subject in need of such treatment, a therapeutically effective amount of an inhibitor of microRNA-544a (miR-544a).
[0011] As described in the examples, the inventors have surprisingly identified that miR-544a enhances Wnt activation in chondrocytes. Overactivation of the Wnt signalling has been associated with cartilage degeneration in animal models of OA and in tissues of patients affected by OA. The inventors also discovered that miR-544a is more abundant in damaged areas of the cartilage isolated from patients affected by OA. Additionally, the inventors surprisingly found that stimulation of chondrocytes in vitro with miR-544a, promoted mechanisms of cartilage degeneration. Co-stimulation with miR-544a and a miR-544a antagomir resulted in the rescue of the catabolic activity induced by mIR-544a in articular chondrocytes. Based on these surprising discoveries, the inventors set out to test whether inhibition of miR-544a could be used to halt disease progression and could be developed into a future therapy for patients.
[0012] Targeting miR-544a has two key advantages over the strategies currently on trial: (i) miR-544a is expressed at a very low level in preserved areas of the AC; and (ii) inhibition of basal levels of expression does not compromise cell homeostasis. This suggests that the inhibitor used according to the invention would exert its effect only in compromised areas of the cartilage / synovium, decreasing the risk of potential off target / side effects. Furthermore, miR-544a enhances the activation of both the Wnt / 0- catenin pathway and of the Wnt / CaMKII pathway. Therefore, its targeting would allow the re-establishment of homeostatic levels of activation of the entire network, rather than focusing on a specific branch. Its inhibition could therefore halt disease progression while maintaining the important pro-regenerative and pro-homeostatic function of Wnt signalling in the joint.
[0013] In one embodiment, the nucleotide sequence of miR-544a may be represented by Genbank ID No: NC_030257.1, which is provided herein as SEQ ID No: 1, as follows:
[0014] ATTTTCATCACCTAGGGATCTTGTTAAAAAGCAGATTCTGATTCAGGGACCAAGATTCTGCATTTTTAGC AAGTTCTCAAGTGATGCTAAT
[0015] [SEQ ID No: 1] Accordingly, in one embodiment, miR-544a comprises or consists of a nucleotide sequence substantially as set out in SEQ ID No: 1, or a fragment or variant thereof.
[0016] In one embodiment, therefore, the inhibitor binds to a nucleotide sequence substantially as set out in SEQ ID No: 1, or a fragment or variant thereof. miRNA primary transcripts are processed and exported to the cytoplasm where double-stranded duplexes are generated through the action of Dicer in the RNA- induced silencing complex (RISC). Subsequently, one of the strands, designated as miRNA or the guide strand, is preferentially selected for maturation; the complementary miRNA* strand, or the passenger strand, is destined to be degraded. However, recent reports have indicated that both the miRNA and miRNA* species often co-exist and both are functional. As such, the inhibitor of the invention may bind to the complementary sequence of SEQ ID No: 1.
[0017] Accordingly, in one embodiment, the inhibitor binds to a nucleotide sequence that is complementary to the nucleotide sequence substantially as set out in SEQ ID No: 1, or a fragment or variant thereof.
[0018] In one embodiment, the nucleotide sequence complementary to SEQ ID No: 1, is provided herein as SEQ ID No: 51, as follows:
[0019] TAAAAGTAGTGGATCCCTAGAACAATTTTTCGTCTAAGACTAAGTCCCTGGTTCTAAGACGTAAAAATCGTTC AAGAGTTCACTACGATTA
[0020] [SEQ ID No: 51]
[0021] In one embodiment, therefore, the inhibitor binds to a nucleotide sequence substantially as set out in SEQ ID No: 51, or a fragment or variant thereof.
[0022] In some embodiments, the inhibitor may bind to a region from nucleotide positions 55 to 76 of SEQ ID No: 1 or 51.
[0023] The sequence from nucleic acid positions 55 to 76 of SEQ ID No: 1, is provided herein as SEQ ID No: 2, as follows:
[0024] ATTCTGCATTTTTAGCAAGTTC
[0025] [SEQ ID No: 2] In one embodiment, therefore, the inhibitor binds to a nucleotide sequence substantially as set out in SEQ ID No: 2, or a fragment or variant thereof.
[0026] The sequence from nucleic acid positions 55 to 76 of SEQ ID No: 51, is provided herein as SEQ ID No: 52, as follows:
[0027] TAAGAC GTAAAAAT C GT T CAAG
[0028] [SEQ ID No: 52]
[0029] In one embodiment, therefore, the inhibitor binds to a nucleotide sequence substantially as set out in SEQ ID No: 52, or a fragment or variant thereof.
[0030] It will be appreciated by the skilled person that in microRNAs, thymine (T) is substituted with uracil (U). Accordingly, it will be appreciated that the thymines in SEQ ID Nos: 1, 2, 51 and 52, may be substituted with uracils.
[0031] In one embodiment, the inhibitor targets and / or binds the 3p form of microRNA-544a (miR-544a), i.e. miR-544a-3p. In another embodiment, the inhibitor targets and / or binds the 5p form of microRNA-544a (miR-544a), i.e. miR-544a-5p.
[0032] In one embodiment, the inhibitor may be a biological agent, a small molecule drug, a protein, a nucleic acid, or a pharmaceutical agent.
[0033] In another embodiment, the inhibitor may be an interfering nucleic acid molecule. The interfering nucleic acid molecule is configured to bind to and / or inhibit miR-544a.
[0034] The interfering nucleic acid molecule may be an antisense oligonucleotide (e.g. antagomirs), siRNA, or dsRNA, which specifically targets miR-544a. A functional interfering nucleic acid molecule, including antisense oligonucleotides, siRNA molecules, or dsRNA molecules, is capable of specifically downregulating a target gene, optionally one or more exon thereof.
[0035] In one embodiment, the inhibitor is an antagomir (i.e. an anti-miR). It is well known to the skilled person that antagomirs are chemically engineered oligonucleotides designed to silence microRNAs. Antagomirs are a type of antisense oligonucleotide, as their sequence is complementary to their specific miRNA target.
[0036] The antagomir may comprise a nucleotide sequence of SEQ ID No: 3, which is provided herein as follows: AUUCUGCAUUUUUAGCAAGUUC
[0037] [SEQ ID No: 3]
[0038] Accordingly, in one embodiment, the inhibitor comprises a nucleotide sequence substantially as set out in SEQ ID No: 3, or a fragment or variant thereof.
[0039] In one embodiment, the antagomir comprises at least one locked nucleic acid (LNA). LNAs are a class of high-affinity RNA analogs in which the ribose ring is connected by a methylene bridge between the 2'-0 and 4'-C atoms, "locking" the ribose ring in the ideal conformation for Watson-Crick binding. Advantageously, LNA oligonucleotides exhibit improved thermal stability when hybridised to a complementary DNA or RNA strand. In one embodiment, all of the nucleic acids in the antagomir are locked nucleic acids (LNAs). In one embodiment, all of the ribose rings in the nucleic acids of the antagomir are locked.
[0040] The musculoskeletal condition may be any condition that affects joints (e.g. OA, rheumatoid arthritis, psoriatic arthritis, gout, or spondyloarthritis), bones (e.g. osteoporosis, osteopenia and associated fragility fractures, or traumatic fractures), muscles (e.g. sarcopenia) or multiple body areas or systems, such as regional (e.g. back and neck pain) and widespread (e.g. fibromyalgia) pain conditions, inflammatory diseases such as connective tissue diseases and vasculitis that have musculoskeletal manifestations (e.g. systemic lupus erythematosus), or amputation as a result of disease or trauma. The musculoskeletal condition may be any condition that involves damage to cartilage tissue or cartilage degradation.
[0041] In one embodiment, the musculoskeletal condition may be selected from a group consisting of: OA, rheumatoid arthritis, psoriatic arthritis, gout, spondyloarthritis, juvenile idiopathic arthritis, osteoporosis, osteopenia and associated fragility fractures, traumatic fractures, sarcopenia, back pain, neck pain, fibromyalgia, inflammatory diseases, connective tissue diseases, vasculitis, gout, systemic lupus, erythematosus, and seronegative.
[0042] In one embodiment, the musculoskeletal condition is OA. In another embodiment, the musculoskeletal condition is rheumatoid arthritis.
[0043] In some embodiments, the inhibitor reduces or halts cartilage degradation. In some embodiments, the inhibitor increases the proteoglycan content of chondrocytes. In some embodiments, the inhibitor downregulates the expression of pro-inflammatory markers.
[0044] In some embodiments, the inhibitor rescues the catabolic effect of miR-544a on human articular chondrocytes (HACs). In some embodiments, the inhibitor rescues the catabolic effect of miR-544a on the expression of MMP13, HMOX-1, TIMP-3 and / or Lubricin.
[0045] It will be appreciated that the inhibitor according to the invention may be used in a medicament, which may be used as a monotherapy (i.e. use of the inhibitor alone), for treating, preventing or ameliorating a musculoskeletal condition. Alternatively, the inhibitor according to the invention may be used as an adjunct to, or in combination with, known therapies for treating, preventing or ameliorating a musculoskeletal condition. For example, the subject may be additionally treated with steroids / anti- inflammatory drugs, hyaluronic acids, or other substances aimed to increase joint lubrication, or in combination with cell-based therapies (in conjunction with stem cells or autologous chondrocytes, either articular or nasal) and / or experimental drugs / compounds / bioactive molecules currently in clinical trial.
[0046] The inhibitor according to the invention may be combined in compositions having a number of different forms depending, in particular, on the manner in which the composition is to be used. Thus, for example, the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micellar solution, transdermal patch, liposome suspension or any other suitable form that may be administered to a person or animal in need of treatment. It will be appreciated that the vehicle of medicaments according to the invention should be one which is well-tolerated by the subject to whom it is given.
[0047] Medicaments comprising the inhibitor according to the invention may be used in a number of ways. For instance, oral administration may be required, in which case the inhibitor may be contained within a composition that may, for example, be ingested orally in the form of a tablet, capsule or liquid.
[0048] The inhibitor according to the invention may be incorporated within a slow- or delayed-release device. Such devices may, for example, be inserted on or under the skin, and the medicament may be released over weeks or even months. The device may be located adjacent the treatment site, which may be at least adjacent to, or on, the joint being treated. Such devices may be particularly advantageous when long- term treatment with inhibitors used according to the invention is required and which would normally require frequent administration (e.g. daily injection).
[0049] In one embodiment, medicaments according to the invention may be administered to a subject by injection into the blood stream or directly into a site requiring treatment. Injections may be intraarticular (bolus or infusion), intravenous (bolus or infusion), intramuscular (bolus or infusion), subcutaneous (bolus or infusion), or intradermal (bolus or infusion). In one embodiment, the injection is intraarticular.
[0050] It will be appreciated that the amount of the inhibitor that is required is determined by its biological activity and bioavailability, which in turn depends on the mode of administration, the physiochemical properties of the inhibitor and whether it is being used as a monotherapy or in a combined therapy. The frequency of administration will also be influenced by the half-life of the inhibitor within or on the subject being treated. Optimal dosages to be administered may be determined by those skilled in the art, and will vary with the particular inhibitor in use, the strength of the pharmaceutical composition, and the mode of administration. Additional factors depending on the particular subject being treated will result in a need to adjust dosages, including subject age, weight, gender, diet, and time of administration.
[0051] Optimal dosages may be determined depending on the severity of the musculoskeletal condition. The inhibitor may be administered once or twice a day. Alternatively, subjects may require less frequent administration of the inhibitor, such as once or twice a week. Alternatively, the inhibitor may be administered even less frequently when being used as a prophylactic treatment. For example, weekly or monthly administration of the inhibitor may be required. Alternatively, the inhibitor may be administered every month, 3-months, or 6-months.
[0052] Generally, a daily dose of between O.OOlpg / kg of body weight and lOmg / kg of body weight, or between 0.01)ig / kg of body weight and Img / kg of body weight, of the inhibitor according to the invention may be used for treating, preventing or ameliorating a musculoskeletal condition.
[0053] The inhibitor may be administered before, during or after onset of symptoms associated with a musculoskeletal condition. Daily doses may be given as a single administration (e.g. a single daily application). Alternatively, the inhibitor may require administration twice or more times during a day. As an example, the inhibitor may be administered as two (or more) daily doses of between 0.07 jig and 700 mg (i.e. assuming a body weight of 70 kg). A patient receiving treatment may take a first dose upon waking and then a second dose in the evening (if on a two dose regime) or at 3- or 4-hourly intervals thereafter. Alternatively, a slow release device may be used to provide optimal doses of the inhibitor according to the invention to a patient without the need to administer repeated doses.
[0054] Known procedures, such as those conventionally employed by the pharmaceutical industry (e.g. in vivo experimentation, clinical trials, etc.), may be used to form specific formulations of the inhibitor according to the invention and precise therapeutic regimes (such as daily doses of the agents and the frequency of administration).
[0055] The inventor believes that they are the first to suggest a musculoskeletal condition treatment composition, based on the use of the inhibitor of the invention.
[0056] Hence, in a third aspect of the invention, there is provided a musculoskeletal condition prevention, treatment or amelioration pharmaceutical composition comprising a therapeutically effective amount of an inhibitor of microRNA-544a (miR-544a), and a pharmaceutically acceptable vehicle.
[0057] The invention also provides in a fourth aspect, a process for making the composition according to the third aspect, the process comprising combining a therapeutically effective amount of the inhibitor of microRNA-544a (miR-544a), with a pharmaceutically acceptable vehicle.
[0058] The musculoskeletal condition and / or the inhibitor may be as described above for the first and second aspects.
[0059] A "subject" may be a vertebrate, mammal, or domestic animal. Hence, medicaments according to the invention may be used to treat any mammal, for example livestock (e.g. a horse), pets, or may be used in other veterinary applications. In one embodiment, however, the subject is a human being.
[0060] A "therapeutically effective amount" of inhibitor is any amount which, when administered to a subject, is the amount of active agent that is needed to treat, ameliorate, or prevent a musculoskeletal condition, or produce the desired effect. The inhibitor may be used as an adjuvant for the prevention or treatment of a musculoskeletal condition. This means that lower doses of other prophylactic or therapeutic treatments would be required. For example, the therapeutically effective amount of inhibitor used may be from about 0.001 mg to about 800 mg, and optionally from about 0.01 mg to about 500 mg.
[0061] A "pharmaceutically acceptable vehicle" as referred to herein, is any known compound or combination of known compounds that are known to those skilled in the art to be useful in formulating pharmaceutical compositions.
[0062] In one embodiment, the pharmaceutically acceptable vehicle may be a solid, and the composition may be in the form of a powder or tablet. A solid pharmaceutically acceptable vehicle may include one or more substances which may also act as flavouring agents, lubricants, solubilisers, suspending agents, dyes, fillers, glidants, compression aids, inert binders, sweeteners, preservatives, coatings, or tabletdisintegrating agents. The vehicle may also be an encapsulating material. In powders, the vehicle is a finely divided solid that is in admixture with the finely divided active agents according to the invention. In tablets, the active agent (i.e. the inhibitor) may be mixed with a vehicle having the necessary compression properties in suitable proportions and compacted in the shape and size desired. Suitable solid vehicles include, for example calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, low melting waxes and ion exchange resins. In another embodiment, the pharmaceutical vehicle may be a gel and the composition may be in the form of a cream or the like.
[0063] However, the pharmaceutical vehicle may be a liquid, and the pharmaceutical composition is in the form of a solution. Liquid vehicles are used in preparing solutions, suspensions, emulsions, syrups, elixirs and pressurized compositions. The active agent according to the invention (i.e. the inhibitor) may be dissolved or suspended in a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats. The liquid vehicle can contain other suitable pharmaceutical additives such as solubilisers, emulsifiers, buffers, preservatives, sweeteners, flavouring agents, suspending agents, thickening agents, colours, viscosity regulators, stabilizers or osmoregulators. Suitable examples of liquid vehicles for oral and parenteral administration include water (partially containing additives as above, e.g. cellulose derivatives, optionally sodium carboxymethyl cellulose solution), alcohols (including monohydric alcohols and polyhydric alcohols, e.g. glycols) and their derivatives, and oils (e.g. fractionated coconut oil and arachis oil). For parenteral administration, the vehicle can also be an oily ester such as ethyl oleate and isopropyl myristate. Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration. The liquid vehicle for pressurized compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.
[0064] Liquid pharmaceutical compositions, which are sterile solutions or suspensions, can be utilized by, for example, intramuscular, intrathecal, epidural, intraperitoneal, intravenous and particularly subcutaneous injection. The inhibitor may be prepared as a sterile solid composition that may be dissolved or suspended at the time of administration using sterile water, saline, or other appropriate sterile injectable medium.
[0065] The inhibitor and compositions of the invention may be administered orally in the form of a sterile solution or suspension containing other solutes or suspending agents (for example, enough saline or glucose to make the solution isotonic), bile salts, acacia, gelatin, sorbitan monoleate, polysorbate 80 (oleate esters of sorbitol and its anhydrides copolymerized with ethylene oxide) and the like. The inhibitor used according to the invention can also be administered orally either in liquid or solid composition form. Compositions suitable for oral administration include solid forms, such as pills, capsules, granules, tablets, and powders, and liquid forms, such as solutions, syrups, elixirs, and suspensions. In an embodiment, orally administrable formulations do not dissolve in the stomach, but preferentially dissolve in the duodenum. Orally administrable formulations may be enterically-coated, for example enteric-coated tablets or capsules. Forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.
[0066] It will be appreciated that the invention extends to any nucleic acid or peptide or variant, derivative or analogue thereof, which comprises substantially the amino acid or nucleic acid sequences of any of the sequences referred to herein, including functional variants or functional fragments thereof. The terms "substantially the amino acid / nucleotide / peptide sequence", "functional variant" and "functional fragment", can be a sequence that has at least 40% sequence identity with the amino acid / nucleotide / peptide sequences of any one of the sequences referred to herein, for example 40% identity with the sequence identified as SEQ ID Nos: 1-52, and so on.
[0067] Amino acid / polynucleotide / polypeptide sequences with a sequence identity which is greater than 65%, greater than 70%, greater than 75%, or greater than 80% sequence identity to any of the sequences referred to are also envisaged. In some embodiments, the amino acid / polynucleotide / polypeptide sequence has at least 85% identity with any of the sequences referred to, at least 90% identity, at least 92% identity, at least 95% identity, at least 97% identity, at least 98% identity , or at least 99% identity with any of the sequences referred to herein.
[0068] The skilled technician will appreciate how to calculate the percentage identity between two amino acid / polynucleotide / polypeptide sequences. In order to calculate the percentage identity between two amino acid / polynucleotide / polypeptide sequences, an alignment of the two sequences must first be prepared, followed by calculation of the sequence identity value. The percentage identity for two sequences may take different values depending on:- (i) the method used to align the sequences, for example, ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example, local vs global alignment, the pair-score matrix used (e.g. BLOSUM62, PAM250, Gonnet etc.), and gap-penalty, e.g. functional form and constants.
[0069] Having made the alignment, there are many different ways of calculating percentage identity between the two sequences. For example, one may divide the number of identities by: (i) the length of shortest sequence; (ii) the length of alignment; (iii) the mean length of sequence; (iv) the number of non-gap positions; or (iv) the number of equivalenced positions excluding overhangs. Furthermore, it will be appreciated that percentage identity is also strongly length dependent. Therefore, the shorter a pair of sequences is, the higher the sequence identity one may expect to occur by chance.
[0070] Hence, it will be appreciated that the accurate alignment of protein or DNA sequences is a complex process. The popular multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et al., 1997, Nucleic Acids Research, 24, 4876-4882) is a preferred way for generating multiple alignments of proteins or DNA in accordance with the invention. Suitable parameters for ClustalW may be as follows: For DNA alignments: Gap Open Penalty = 15.0, Gap Extension Penalty = 6.66, and Matrix = Identity. For protein alignments: Gap Open Penalty = 10.0, Gap Extension Penalty = 0.2, and Matrix = Gonnet. For DNA and Protein alignments: ENDGAP = -1, and GAPDIST = 4. Those skilled in the art will be aware that it may be necessary to vary these and other parameters for optimal sequence alignment.
[0071] In some embodiments, calculation of percentage identities between two amino acid / polynucleotide / polypeptide sequences may then be calculated from such an alignment as (N / T)*100, where N is the number of positions at which the sequences share an identical residue, and T is the total number of positions compared including gaps and either including or excluding overhangs. In some embodiments, overhangs are included in the calculation. Hence, a most preferred method for calculating percentage identity between two sequences comprises (i) preparing a sequence alignment using the ClustalW program using a suitable set of parameters, for example, as set out above; and (ii) inserting the values of N and T into the following formula:- Sequence Identity = (N / T)*100.
[0072] Alternative methods for identifying similar sequences will be known to those skilled in the art. For example, a substantially similar nucleotide sequence will be encoded by a sequence, which hybridizes to DNA sequences or their complements under stringent conditions. By stringent conditions, we mean the nucleotide hybridises to filter-bound DNA or RNA in 3x sodium chloride / sodium citrate (SSC) at approximately 45°C followed by at least one wash in 0.2x SSC / 0.1% SDS at approximately 20-65°C. Alternatively, a substantially similar peptide may differ by at least 1, 2, 3, 4 or 5 amino acids from the sequences shown in SEQ ID Nos: 1-52.
[0073] Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence described herein could be varied or changed without substantially affecting the sequence of the protein encoded thereby, to provide a functional variant thereof. Suitable nucleotide variants are those having a sequence altered by the substitution of different codons that encode the same amino acid within the sequence, thus producing a silent change. Other suitable variants are those having homologous nucleotide sequences but comprising all, or portions of, sequence, which are altered by the substitution of different codons that encode an amino acid with a side chain of similar biophysical properties to the amino acid it substitutes, to produce a conservative change. For example small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large non-polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine. The polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine. The positively charged (basic) amino acids include lysine, arginine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be appreciated which amino acids may be replaced with an amino acid having similar biophysical properties, and the skilled technician will know the nucleotide sequences encoding these amino acids. All of the features described herein (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined with any of the above aspects in any combination, except combinations where at least some of such features and / or steps are mutually exclusive.
[0074] For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:-
[0075] Figure 1 shows the Wnt-signalling network. miR-544a is an enhancer of Wnt- signalling, which can target multiple molecules involved in its activation. In particular, miR-544a enhances the activation of both the Wnt / p-catenin pathway and of the Wnt / CaMKII pathway.
[0076] Figure 2 shows that miR-544a is a transcriptional target of Wnt3a in articular chondrocytes (a) Human Articular Chondrocytes (HACs) were stimulated for 24h with lOOng / ml of human recombinant Wnt3a or with vehicle control (PBS). RIMA was extracted, p-catenin dependent transcriptional targets of Wnt3a measured by microarray analysis (Nalesso et al., Sci Rep., 2021); (b) Expression levels of the mlR- 544a precursor (pri-miR-544a) and Axin-2 in human articular chondrocytes (HACs) stimulated with Wnt3a (lOOng / mL) for 24 hours, assessed by qPCR (n=6); (c) Expression levels of the mature form of miR-544a in HACs stimulated with Wnt3a for 24 hours, assessed by qPCR (n=6). qPCR results for Axin-2 were normalised to the housekeeping gene p-actin and expressed as fold change in comparison to culture media or vehicle. qPCR results for miR-544a were normalised for the housekeeping gene RNU6B and expressed as fold change in comparison to vehicle. The fold change was calculated with the comparative 2'AACtmethod. Data are shown as mean ± SEM. Statistical analysis was performed by unpaired two-tailed t-test.
[0077] Figure 3 shows that miR-544a modulates the activation of Wnt signalling pathways in articular chondrocytes, (a) Putative target genes of miR-544a associated with the activation of the Wnt pathway identified through Target Scan interrogation; b) Schematic representation of putative target genes related to the p-catenin-dependent Wnt pathway; c) to further validate some of the putative miR-544a targets, 3'UTR- seed sequences of Axin-2, Cadherin 1 (CDH1), catenin p interacting protein 1 (CTNNBP1) and glycogen synthase kinase 3 beta (GSK3b) or mutated sequences as a control were cloned in pmirGLO vectors upstream of the luciferase gene. Confirming binding of the microRNA to these genes, reduced luminescence was recorded in C28 / I2 cells transfected with miR-544a mimic (100 nM) and the vectors expressing the seed sequences 48h after transfection. No reduction in luminescence was reported in cells transfected with vectors expressing the mutated forms of the seed sequences. Results are expressed as mean ± SEM of Relative Luminescence units of Firefly luciferase normalized to Renilla luciferase (n=3); (d) mRNA expression levels of Axin- 2, CDH1, CTNNBIP1 and GSK-3P in Human Articular Chondrocytes (HACs) s transfected with miR-544a mimic (50nM) or negative control (NC, 50nM) for 3 hours, assessed by qPCR after 24 hours (n=6). qPCR results were normalised to the housekeeping gene p-actin and expressed relative gene expression (%) in comparison to NC; (e) Immunofluorescence analysis shows upregulation of p-catenin at protein level in HACs transfected with miR-544a mimic (50nM) in comparison to NC mimic (50nM). Fluorescence intensity of immunoreactive areas was quantified in the whole cell and nucleus after 24 hours of transfection. (n=4). MiR-544a (50nM) enhanced the ability of Wnt3a (lOOng / ml) to activate the SUPER8XTOPFIash reporter assay in (f) HEK293FT cells and (g) C28 / I2 cells (n=3). (h) Immunofluorescence analysis showing upregulation of phospho-CamKII (pCamKII) expression in HACs response to transfection with miR-544a mimic in comparison to NC (both 50nM). Fluorescence intensity of immunoreactive areas was quantified in the whole cell and nucleus after 24 hours of transfection. (n=4). DAPI - positive staining for nuclei. Original magnification - x40, scale bar - 50 pm. Data are shown as mean ± SEM. Statistical analysis was performed by one-way ANOVA or unpaired two-tailed t-test.
[0078] Figure 4 shows that miR-544a is upregulated in OA and promotes catabolism in the AC. (a) Expression level of miR-544a in HACs isolated from conserved and damaged areas of the articular cartilage assessed by qPCR (n=4). (b) Expression level of miR- 544a in HACs stimulated with IL- ip (20ng / mL), TGF-p (20ng / mL) or IL-6 (20ng / mL) for 8 hours or 24 hours, assessed by qPCR (n=4). qPCR results for miR-544a were normalised for the housekeeping gene RNU6B and expressed as fold change in comparison to vehicle. The fold change was calculated with the comparative 2'AACtmethod, (c) miR-544a modulates the expression of phenotypic genes and catabolic markers on HACs. HACs were transfected with miR544a mimic (50 nM) or NC (50 nM) in presence or absence of Wnt3a (100 ng / mL) for 24 hours and gene expression was assessed by qPCR (n=6). Individual gene expression levels were normalised by the expression levels of the house-keeping gene p-actin and expressed as relative gene expression (% to NC). (d) MMP-13 and (e) Aggrecan neoepitope protein expressions were upregulated in HACs transfected with miR-544a mimic for 24 hours. Fluorescence intensity of immunoreactive areas was quantified in the whole cell and nucleus. (n = 5). DAPI - positive staining for nuclei. Original magnification - x40, scale bar - 50 pM. (f,g) miR-544a (50 nM), alone or co-stimulated with Wnt3a (100 ng / mL), reduced the accumulation of highly sulphated GAGs in chondrocyte micromasses, as assessed by Alcian Blue staining (n=4). GAG content was normalised by protein content measured through bicinchoninic acid (BOA) assay. Data are shown as mean ± SEM. Statistical analysis was performed by one-way ANOVA or unpaired two-tailed t-test.
[0079] Figure 5 shows that miR-544a promotes catabolism through activation of both p- catenin and CaMKII. (a) Schematic representation of miR-544a modulation on the Wnt signalling pathway. (b,c) Immunofluorescence assay aimed to detect the expression of MMP-13 or MMP-cut aggrecan neoepitope in human articular chondrocytes (HACs) transfected with miR-544a mimic (50 nM) or NO (50 nM) in presence or absence of the 0-catenin inhibitor Xav-939 (10 pM) or of the CaMKII inhibitor KN93 (10 pM) for 24 hours. Fluorescence intensity of immunoreactive areas was quantified on the whole cell (n=3). DAPI - positive staining for nuclei. Original magnification - x40, scale bar - 50 pM. Data are shown as mean ± SEM. Statistical analysis was performed by oneway ANOVA or unpaired two-tailed t-test.
[0080] Figure 6 shows that the inhibitor of miR-544a rescues the catabolic effect of miR- 544a on HACs. HACs were transfected with miR-544a mimic or (50nM) or NC (50nM) in presence or absence of the miR-544a antagomir (lOpM) for 24h. The modulation of MMP13, HMOX-1, TIMP-3 and Lubricin induced by mIR-544a was brought back to levels comparable to control in presence of the antagomir. Data are shown as mean ± SEM. Statistical analysis was performed by one-way ANOVA or unpaired two-tailed t- test.
[0081] The inventors surprisingly discovered that microRNA-544a (miR-544) enhances Wnt activation in cells isolated from the AC (chondrocytes). This abnormal activation of Wnt molecules results in cartilage degeneration in OA. The inventors also discovered that miR-544a is more abundant in damaged areas of the cartilage isolated from patients affected by OA and of mice in which OA is artificially induced by surgery. Additionally, the inventors surprisingly found that stimulation of chondrocytes in vitro with miR-544a, promoted mechanisms of cartilage degeneration. Based on these surprising discoveries, the inventors set out to test whether inhibition of miR-544a could be used to halt disease progression and could be developed into a future therapy for patients.
[0082] Materials and Methods Human AC samples and chondrocytes isolation
[0083] Preserved (Mankin Score <4) human AC was collected from patients (male and female, age range 50-90) who had undergone total hip or knee replacement because of OA, following collection of informed consent. Surgeries were performed at the South-West London Elective Orthopaedic Centre. All procedures were approved by the London South-East Research Ethics Committee (19 / LO / 0742). Chondrocytes were isolated as previously described (Nalesso et al., 2011;2021).
[0084] Primary cells, cell lines, cell transfection and stimulation
[0085] Human articular chondrocytes (HACs) and C28 / I2 human chondrocyte cell line were cultured with complete media (CM; DMEM / F-12 - ThermoFisher Scientific, Waltham, MA, USA), supplemented with 10 % Fetal bovine serum (FBS; Gibco Invitrogen, Carlsbad, CA, USA) and 1 % antibiotic and antimycotic solution (Sigma-Aldrich, St. Louis, MO, USA)) AT 37°C in a 5 % CO2 incubator (Binder, Tuttlingen, Germany). HACs were used at passages 0 to 2.
[0086] HEK293FT human embryonal kidney cell line was cultured with DMEM High Glucose (ThermoFisher Scientific), supplemented with 2% FBS and 1% antibiotic and antimycotic solution and experiments were conducted when cells reached 80% confluence.
[0087] If not differently indicated, cells were stimulated in CM or culture media supplemented with 2% FBS and 1% antibiotic antimycotic solution supplemented with human recombinant Wnt3a (100 ng / ml; R8<.D), recombinant human Interleukin-ip (ILip), -IL6 and Transforming growth factor pi (TGF- ) (all used at 20 ng / ml; all purchased from BioLegend), KN93 or its inactive control KN92 (10 pM; EMD Millipore), XAV-939 (10 pM; ThermoFisher) or respective vehicles as indicated.
[0088] Cell transfection
[0089] HACs or C28 / I2 were transfected with hsa-miR-544a miRCURY LNA miRNA mimic (50nM; Qiagen) or negative control (NC) miRCURY LNA miRNA mimic (50nM; Qiagen) with or without hsa-miR-544a miRCURY LNA miRNA inhibitor (10 pM; Qiagen) by using Lipofectamine 2000 (ThermoFisher Scientific) following manufacturer instructions for 4 hours at 37°C. After transfection, the cells were washed and incubated in CM with or without specific stimuli. The sequence of NC has no homology to any known miRNA or mRNA sequences in murine or human. The miRNA inhibitor consists of antisense oligonucleotides with perfect sequence complementary to its target. The sequences of miR544a mimic, miR544a NC mimic and miR544a inhibitor are presented in Table 1.
[0090] Table 1 : miR544a mimic, miR544a NC mimic and miR544a inhibitor sequences
[0091] Dual Luciferase reporter assay
[0092] Potential targets of miR-544a were predicted by using TargetScan release 7.2. Selection of targets genes was then performed through pathway analysis done with ConsensusPath database (http: / / cpdb.molgen.mpg.de / ). Predicted pairing positions between miR-544a and 3'UTR of the selected genes were obtained using Target Scan and Microrna.org. 3'UTR regions of the transcripts for all the selected genes were downloaded in FASTA format from the Ensemble Genome Browser. Primers were specifically designed by using open-source Primer3Plus software to amplify a 0.5-1 kb region of 3'UTR containing the miR-544a binding sites. Extensions of 15 bases comprising the restriction site of the Sad restriction enzyme (5'GAGCTC3'; SEQ ID No: 16) were added to the 5' end of the primer to obtain PCR amplicons homologous to 15 bases at each end of the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA). Primer sequences are listed in Table 2. Genomic DNA extracted from human chondrosarcoma SW1353 cells was used for the amplification of 3'UTR regions of the genes of interest, followed by the construction of the insertion in the vector and cell transformation.
[0093] Table 2: Primers for 3'UTR sequence amplification After the validation of the selected putative targets of miR544, C28 / I2 cells were cotransfected with miR-544a mimic (100 nM) or miR NC (100 nM) with the constructed pmirGLO Dual-Luciferase miRNA Target Expression Vectors (500 ng; Promega). After 48 hours of transfection, the media was discarded, and the reporter assay was performed by using the Dual Luciferase Reporter Assay System kit (Promega). Luminescence at 560 nm was measured with the CLARIOstar microplate reader (BMG LABTECH) and the results are expressed as mean ± SEM of Relative Luminescence units of Firefly luciferase normalized to Renilla luciferase of three independent experiments.
[0094] TOPFIash reporter assay
[0095] C28 / I2 and HEK293FT cells were co-transfected with SUPER8XTOP / FOPFIash TCF / LEF- firefly luciferase reporter vector (450 ng / well) and with the control vector expressing Renilla luciferase (50 ng / well) using Lipofectamine 2000 (ThermoFisher, Waltham, MA, USA), following manufacturer instructions. After transfection, the media was replaced, and cells were stimulated with recombinant Wnt3a (100 ng / mL; R&D Systems) or vehicle control for 48 hours. Luciferase activity was quantified using the Dual Luciferase Reporter assay system (Promega). Firefly luciferase activity was normalized by the Renilla luciferase activity. Results are expressed as fold increase of relative luminescence units in comparison to NC of three independent experiments.
[0096] Micromass cultures and Alcian Blue staining
[0097] Human articular chondrocytes were transfected with the mIR-544a mimic or NC (both 50nM) as described above. Micromass (MM) cultures (25 x 104cells / well) were then prepared with the transfected cells as previously described (Nalesso et al., JCB 2011). The MM were stimulated with recombinant human Wnt3a (100 ng / mL; R8<.D) for 48h. The MM were fixed and stained overnight with Alcian blue 8GS (Carl Roth, Karlsruhe, Germany) as previously described (De Bari et al., 2001. Proteoglycans were extracted with 6M guanidine hydrochloride overnight (Sigma-Aldrich, St. Louis, MO, USA) and absorbance read at 630 nm with a CLARIOstar spectrophotomer (BMG LABTECH, Offenburg, Germany). Absorbance values were normalized to protein content, determined by the bicinchoninic acid (BCA) assay, according to manufacturer instructions (ThermoFisher Scientific, Waltham, MA, USA). Images of the micromasses were acquired at room temperature with a stereomicroscope (SZTL 350 Stereo Binocular Microscope, VWR®, Radnor, PA, USA).
[0098] Gene expression analysis
[0099] To analyse mIR-544a expression levels, samples were reverse transcribed using the cDNA miScript PCR Reverse Transcription Kit (Qiagen). The expression levels of precursor and mature miR-544a were evaluated by qPCR using miScript SYBR Green PCR Kit (Qiagen) and normalized for the housekeeping gene U6B small nuclear RNA (RNU6B). The primers were purchased from Qiagen (Catalogue number: YP00204646 for miR544a; Catalogue number: YP02119464 for RNU6B, Catalogue number: MP00002828 for the precursor of the miR-544a) and the qPCR reactions were performed in the CFX96TM PCR machine (BioRad).
[0100] Total RNA (350 ng / sample) was extracted from HACs using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to manufacturer's instructions. Samples were reverse transcribed to cDNA using a High-Capacity cDNA Reverse transcription kit (Applied Biosystems, Waltham, MA, USA). Quantitative PCR was performed using hot-start DNA polymerase (Qiagen, Hilden, Germany). The complete list of primers is presented at the Table 3 (all primers were purchased from Sigma-Aldrich, St. Louis, MO, USA). Results were normalised for p-actin values. All reactions were performed in the CFX384TM Optics Module PCR machine (BioRad, Hercules, CA, USA).
[0101] Table 3: Primer sequences used for quantitative gene expression analysis Immunocytochemistry
[0102] HACs (4 x 104cells / well) were seeded on 8-well chamber slides (Lab-Tek) and transfected with hsa-mIR-544a mimic or NC (lOpM) as described above and then stimulated for 24h with recombinant Wnt3a (100 ng / mL), KN92 (10 pM; EMD), KN93 (10 pM; EMD), or XAV-939 (10 |jM), alone or in combination as described in the individual experiments. After being washed in PBS, the cells were fixed in 4% buffered PFA. Autofluorescence was quenched by washing the slides in 50 mM NH4CI and then blocked for 1 hour in blocking buffer (goat serum diluted 1:50 in PBS / 0.5% BSA). After blocking, samples were incubated overnight at 4°C with the following antibodies: anti- phospho-CaMKII rabbit polyclonal IgG antibody (Cell Signalling Technology), anti-beta- catenin (Cell Signalling), anti-MMP-13 mouse monoclonal antibody (Santa Cruz Biotechnology) or anti-Aggrecan Neoepitope polyclonal antibody (Invitrogen), all diluted 1 : 100 in blocking buffer. Upon washing, samples were incubated with a secondary Alexa Fluor 647-conjugated goat anti-mouse antibody (1:200; Invitrogen) for 1 hour at RT and washed in PBS. Finally, the slides were stained with DAPI. The slides were then mounted in Mowiol (EMD) and images were acquired with a confocal fluorescence microscope (Nikon), using a 40X objective lens.
[0103] Statistical analysis
[0104] Statistical significance comparing two groups with parametric data was assessed by Student's t tests. For multiple comparisons, statistical analysis was performed by one analysis of variance (ANOVA), including the appropriate post-test. A value of P < 0.05 was considered statistically significant for all comparison tests. All the data in the graphs are expressed as mean ± SEM.
[0105] Results of miR-544a in human articular
[0106] The inventors' previous work showed that Wnt3a, a Wnt ligand whose expression is modulated in OA (Nalesso et al 2011) can simultaneously activate both p-catenin dependent and independent signalling branches of the Wnt signalling system (Nalesso et al., 2011) in articular chondrocytes. To understand the specific transcriptional targets downstream from the activation of the individual pathways, the inventors performed a microarray analysis on human chondrocytes stimulated with Wnt3a with or without the CaMKII inhibitor KN93 (Nalesso et al., 2021). Analysis showed that the gene mostly upregulated by Wnt3a in a CaMKII independent manner was Axin2, a very well characterised modulator of the Wnt-B-catenin dependent pathway, while the most downregulated gene was the precursor of micro-RNA-544a (miR-544a), a microRNA which had been shown to activate the Wnt-B catenin pathway in other biological systems (Figure 2a), but whose role had not been previously characterised in the AC. Data were validated by qPCR (Figure 2b). The inventors then tested whether Wnt3a stimulation of human articular chondrocytes could affect the expression of the mature form of the microRNA (Figure 2c). Wnt3a stimulation promoted the upregulation of the mature form of miR-544a, suggesting the establishment of a negative feedback loop downregulating the expression of the precursor of miR-544a in response to the upregulation of its mature form.
[0107] 2 - miR-544a modulates the activation of both B-catenin and CaMKII- dependent branches of the Wnt-siqnallinq network miR-544a has been reported to be an activator of the Wnt- -catenin pathway in several biological contexts, mostly associated with cancer development. The inventors performed a target scan analysis to understand putative target genes of miR-544a. Upon cross-referencing with previous literature, the inventors focused their attention on the 3p arm of miR-544a, as previous studies suggested this as the active form of this micro-RNA. The target scan analysis returned over 5154 putative target genes for miR-544a-3p. The inventors then performed an over-representation analysis with ConsensusPath database software to understand the KEGG-annotated pathways potentially modulated by miR-544a. The analysis returned 69 pathways. Confirming previous literature, the Wnt pathway was among the pathways modulated by miR- 544a. Putative targets of the pathway are listed in Figure 3a. Both components of the Wnt-B-catenin dependent and CaMKII-dependent branches of the Wnt signalling are included within this list.
[0108] To validate the modulation of some of the components of the Wnt-B-catenin pathway in articular chondrocytes (Figure 3B), the inventors cloned the 3'-UTR of Axin2, Cadherin 1, B-catenin and GSK-3B, or a scrambly rearranged sequence of their nucleotides as a control upstream the luciferase expressing gene in pMirGlo-vectors and transfected in the chondrocytic cell line C28 / I2 (Figure 3C). Stimulation of the cells with miR-544a mimic significantly decreased the relative luminescence emitted by the cells transfected with the original 3'-UTR sequences but not the one emitted by cells transfected with the mutated forms (Figure 3C). Modulation of the target genes was confirmed at mRNA level in human primary chondrocytes (Figure 3D). Interestingly, while the transcription of GSK3 seems to be downregulated by miR-544a in the reporter assay, the actual mRNA expression was upregulated by the microRNA in primary cells. This suggests the presence of additional molecular mechanisms controlling the expression of this key component of the Wnt-signalling in articular chondrocytes at a transcriptional level.
[0109] To confirm modulation of the Wnt-0-catenin pathway in response to miR-544a, the inventors measured the expression of 0-catenin in human articular chondrocytes stimulated with the miR-544a mimic. 0-catenin expression was indeed upregulated by miR-544a and its transmigration to the nucleus enhanced in comparison to cells stimulated with the negative control (Figure 3e). Furthermore, miR-544a enhanced the activation of a TCF / LEF reporter assay induced by recombinant Wnt3a, both in bovine primary chondrocytes and in HEK293 cells.
[0110] Finally, as some isoforms of CaMKII were also among the putative target genes for miR-544a, the inventors tested whether stimulation of primary cells with miR-544a mimic could affect activation of CaMKII (Figure 3h). Phosphorylation of CaMKII was increased by stimulation of primary chondrocytes with miR-544a, suggesting a role for miR-544a in the simultaneous modulation of separate branches of the Wnt-signalling.
[0111] Example 3 - miR-544a expression is unregulated in damaged cartilage and promotes catabolism
[0112] To investigate the biological role of miR-544a on cartilage homeostasis, the inventors measured its expression levels in chondrocytes removed from preserved (Mankin score <4) and damaged (Mankin score >4) areas of AC from patients who had undergone total hip or knee replacement because of OA. miR-544a expression was significantly higher in cells isolated from damaged areas of the cartilage (Figure 4A) and was also upregulated in primary cells stimulated with pro-inflammatory and pro- fibrotic cytokines and growth factors known to promote degeneration of joint tissues in the AC during the development of OA (Figure 4B).
[0113] Stimulation of primary human chondrocytes with a miR-544a mimic induced modulation of chondrocyte phenotypic markers, namely downregulation of the joint lubricant lubricin and of the metalloproteinase inhibitor Tissue Inhibitor of Metalloproteinase 3 (TIMP3) and upregulation of the hypertrophic marker Matrix Metalloprotease 13 (MMP13). miR-544a overexpression also promoted upregulation of Heme-Oxygenase l(HMOX-l), a marker of cell oxidative stress, which the inventors have previously shown to be a specific marker of the activation of the Wnt / CaMKII axis (Nalesso et al., Sci Rep 2021). The inventors confirmed upregulation of MMP13 at protein level by immunofluorescence (Figure 4d). Supporting a pro-catabolic role of miR-544a in the AC, the inventors also showed that its overexpression can promote upregulation of Aggrecan neoepitope generated by Aggrecanase-mediated proteolytic cut (Figure 4e) and downregulation of proteoglycan content, as shown by reduced alcian blue staining in chondrocyte micromasses stimulated with the miR-544a mimic (Figure 4f). miR-544a could also enhance the catabolic activity promoted by Wnt3a.
[0114] Example 4 - miR-544a promotes catabolism through the activation of both the B- catenin and the CAMKII mediated branches of the Wnt signalling
[0115] As miR-544a could promote both the activation of the Wnt / -catenin and of the Wnt / CaMKII mediated pathways, the inventors investigated whether its catabolic activity was specifically mediated by one of the two. To this end, the inventors stimulated primary human chondrocytes with the miR-544a mimic alone or in combination with inhibitors of the activation of CaMKII (KN93) or B-catenin (XAV939). Co-stimulation with both inhibitors rescued the upregulation of MMP13 expression as well as the expression of Aggrecanase-cut aggrecan (Figure 5b, 5c). This seems to confirm an important modulatory role for miR-544a in the maintenance of the homeostatic balance between different branches of the Wnt signalling and that overactivation of both branches can lead to increased catabolism and pro- degenerative effects in the AC.
[0116] Example 5 - Chondrocvte homeostasis is rescued after miR544a inhibition
[0117] Since the inventors showed that expression of miR544a is increased in human and mouse OA cartilage compared with preserved / control cartilage and that miR544a activity was able to affect chondrocytes homeostasis, they next tested the effects of the inhibition of miR544a by co-transfecting the chondrocytes with a miR544a inhibitor, which presents a seguence complementary to its target.
[0118] The inventors' data demonstrates that the inhibitor successfully rescues the catabolic effect of miR-544a on the expression of MMP13, HMOX-1, TIMP-3 and Lubricin (Figure 6).
[0119] Conclusions
[0120] The inventors have demonstrated for the first time the importance of miR-544a in the maintenance of cartilage homeostasis. They discovered that the expression of this microRNA is surprisingly upregulated in damaged areas of the AC in patients affected by OA. Overexpression of miR-544a in isolated chondrocytes leads to upregulation of the catabolic enzyme MMP13 and of an aggrecan neo-epitope generated because of increased proteolytic activity. It also reduces overall proteoglycan content. Furthermore, overexpression of miR-544a promotes downregulation of Lubricin, a proteoglycan responsible for joint lubrication and TIMP3, an inhibitor of meta I loprotease activity, which further corroborates the pro-degenerative activity of this micro-RNA in the AC. Upregulation of miR-544a also results in upregulation of pro-inflammatory markers, as well as increased expression of Heme-Oxygenase 1, suggesting an additional role for this microRNA in modulating pro-inflammatory and pro-oxidative mechanisms.
[0121] Based on these surprising discoveries, the inventors demonstrated that inhibition of miR-544a can be used to halt disease progression in OA and can be developed into a therapy for patients. Advantageously, targeting miR-544a has two key advantages over the strategies currently on trial: (i) miR-544a is expressed at a very low level in preserved areas of the AC; and (ii) inhibition of basal levels of expression does not compromise cell homeostasis. As such, the inhibitor according to the invention would exert its effect only in compromised areas of the cartilage / synovium, decreasing the risk of potential off target / side effects. Furthermore, miR-544a enhances the activation of both the Wnt / 0-catenin pathway and of the Wnt / CaMKII pathway. Therefore, its targeting would allow the re-establishment of homeostatic levels of activation of the entire network, rather than focusing on a specific branch. Its inhibition would therefore halt disease progression while maintaining the important pro-regenerative and pro-homeostatic function of Wnt signalling in the joint.
Claims
Claims1. An inhibitor of microRNA-544a (miR-544a), for use in treating, preventing or ameliorating a musculoskeletal condition.
2. The inhibitor for use according to claim 1, wherein the inhibitor binds to a nucleotide sequence substantially as set out in SEQ ID No: 1 or 51, or a fragment or variant thereof.
3. The inhibitor for use according to claim 1 or claim 2, wherein the inhibitor binds to a region from nucleotide positions 55 to 76 of SEQ ID No: 1 or 51.
4. The inhibitor for use according to any one of the preceding claims, wherein the inhibitor binds to a nucleotide sequence substantially as set out in SEQ ID No: 2 or 52, or a fragment or variant thereof.
5. The inhibitor for use according to any one of the preceding claims, wherein the inhibitor is a biological agent, a small molecule drug, a protein, a nucleic acid, or a pharmaceutical agent.
6. The inhibitor for use according to any one of the preceding claims, wherein the inhibitor is an interfering nucleic acid molecule, optionally wherein the interfering nucleic acid molecule is configured to bind to and / or inhibit miR-544a.
7. The inhibitor for use according to claim 6, wherein the interfering nucleic acid molecule is an antisense oligonucleotide, siRNA, or dsRNA.
8. The inhibitor for use according to any one of the preceding claims, wherein the inhibitor is an antagomir.
9. The inhibitor for use according to any one of the preceding claims, wherein the inhibitor comprises a nucleotide sequence substantially as set out in SEQ ID No: 3, or a fragment or variant thereof.
10. The inhibitor for use according to claim 8 or claim 9, wherein the antagomir comprises at least one locked nucleic acid (LNA).
11. The inhibitor for use according to any one of the preceding claims, wherein the musculoskeletal condition is selected from a group consisting of: a condition that affects joints, bones, muscles or multiple body areas or systems; widespread pain conditions; inflammatory diseases; amputation as a result of disease or trauma; and a condition that involves damage to cartilage tissue or cartilage degradation.
12. The inhibitor for use according to any one of the preceding claims, wherein the musculoskeletal condition is selected from a group consisting of: osteoarthritis, rheumatoid arthritis, psoriatic arthritis, gout, spondyloarthritis, juvenile idiopathic arthritis, osteoporosis, osteopenia and associated fragility fractures, traumatic fractures, sarcopenia, back pain, neck pain, fibromyalgia, inflammatory diseases, connective tissue diseases, vasculitis, gout, systemic lupus, erythematosus, and seronegative.
13. The inhibitor for use according to any one of the preceding claims, wherein the musculoskeletal condition is osteoarthritis.
14. The inhibitor for use according to any one of the preceding claims, wherein the musculoskeletal condition is rheumatoid arthritis.
15. A musculoskeletal condition prevention, treatment or amelioration pharmaceutical composition comprising a therapeutically effective amount of an inhibitor of microRNA-544a (miR-544a), and a pharmaceutically acceptable vehicle.
16. The composition according to claim 15, wherein the inhibitor is as defined in any one of claims 1-14.
17. A process for making the composition according to claim 15 or claim 16, the process comprising combining a therapeutically effective amount of the inhibitor of microRNA-544a (miR-544a), with a pharmaceutically acceptable vehicle.