Method for producing a polyhydroxyalkanoates
By growing a genetically modified E. coli strain with the phaCAB operon in dairy wastewater with a high lactose-to-protein ratio, the method addresses the scalability and cost issues of existing PHA production methods, achieving high yields suitable for industrial applications.
Patent Information
- Application Number
- PCT/IB2025/056800
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-08
- Filing Date
- 2025-07-04
- Publication Date
- 2026-01-15
AI Technical Summary
Existing methods for producing polyhydroxyalkanoates (PHAs) using plasmid-engineered strains are expensive and difficult to scale up due to high costs and limited yields, particularly when using lactose-rich substrates.
A method for producing PHAs in a bacterial strain containing the phaCAB operon, grown in dairy wastewater with a high lactose-to-protein ratio, preferably above 50:1, using a genetically modified E. coli strain with a vector like pGEX, which enhances PHB production.
The method achieves high yields of PHB comparable to laboratory conditions, reducing production costs and enabling scalability to industrial levels.
Smart Images

Figure IMGF000015_0001 
Figure IMGF000016_0001 
Figure IMGF000016_0002
Abstract
Description
[0001] “METHOD FOR PRODUCING A POLYHYDROXYALKANOATES”
[0002] OBJECT OF THE INVENTION
[0003] The present invention relates to a method for producing polyhydroxyalkanoates (PHAs) in a bacterial strain containing the phaCAB operon and in the presence of low-protein, low- lactose dairy wastewater.
[0004] The method of the present invention can be used in a medium- to large-scale industrial process for the production of PHAs, preferably PHB.
[0005] STATE OF THE ART
[0006] It is now impossible to ignore the growing demand for replacing plastics originating from non-renewable fossil and petrochemical sources with new innovative materials within the plastic consumer goods supply chain.
[0007] Plastics, which are used daily for numerous applications, in addition to being produced from unsustainable and progressively deteriorating raw materials, become increasingly difficult and complex to manage at the end of their useful life. Consider, for example, consumer goods used daily, such as food packaging, disposable plastic utensils such as forks, plates, and cups, or even plastic bags or film for packaging goods. All of the examples mentioned above fulfill their intended functions perfectly and yet are immediately discarded once their use is complete. This vicious cycle of "mass production - single-use - waste" has become an automatic feature of modem society. While undoubtedly offering short-term benefits and conveniences, it has disastrous environmental side-effects due to the long degradation times of conventional plastic, sometimes exceeding 1,000 years.
[0008] Over the past 60 years, global plastic production has grown from about 0.5 million tons in 1950 to more than 260 million tons today, and continues to steadily increase each year.
[0009] The family of bioplastics known as polyhydroxyalkanoates (PHAs), a group of polymers with properties similar to fossil-based plastics, appears to be an excellent and viable choice for a sustainable future with reduced CO2 emissions. Within this class of polymers is polyhydroxybutyrate (PHB), a natural biodegradable thermoplastic polyester considered as being a potential and valid substitute for synthetic polymers in many applications due to some of its excellent qualities.
[0010] PHB is naturally produced as a reserve energy material within microorganisms and bacteria and accumulates as intracellular granules that function both as a carbon reserve and an energy source. It is then extracted, processed, and manufactured, typically in the form of pellets or granules. This type of production makes it a biological and biodegradable plastic, thus perfectly capable of meeting new market demands.
[0011] PHB is produced in nature by the strain Hl 6 of Cupriavidus necator (formerly Ralstonia eutropha) (DSM428) (Pohlman et al. Nature Biotechnology, 2007 and Little et al. Microbiology Vol. 8, no. 37, pp. 1-2, 2019) and is accumulated as intracellular granules. The genetic information required for the production of the PHB polymer consists of three genes organized in an operon (phaCAB) that encodes three genes: PHA synthase (phaC), 3 -ketothiolase (phaA), and acetoacetyl-CoA reductase (phaB). The phaCAB operon has been described in the model organism C. necator H16, whose complete genome sequence is available.
[0012] PHA-producing bacteria can utilize a wide variety of organic molecules as substrates, mainly sugars, alcohols, and organic acids. Selecting specific substrates or adding co-substrates (precursors) is the primary strategy for improving process productivity and enabling the production of copolymers and / or increasing the fraction of the second monomer within a copolymer.
[0013] In particular, bacterial strains engineered with the phaCAB operon are capable of producing numerous types of PHA polymers, predominantly shortchain PHAs such as Poly-3 -hydroxypropionate (P3HP), Poly-3 -hydroxy valerate (PHV), Poly-3 -hydroxybutyrate (PHB), Poly-4-hydroxybutyrate (P4HB) and their copolymers, when grown in the presence of substrates supplemented with specific monomer precursors that can be simple compounds, such as organic acids, alcohols, hydrocarbons, amino acids, salts or salts of fatty acids, or substrates containing said compounds, such as substrates deriving from agricultural crops, such as sugarcane, sugar beet, corn, cassava, rice straw or rice bran; woody substrates containing lignocellulose; substrates deriving from the food industry such as dairy productions, fruit juices, candy and sugar; vegetable oils (palm oil, coconut oil, etc.), used cooking oils, animal fats, organic waste, washing water and waste water from agricultural productions, drinking water, urban waste water or by-products of other productions such as glycerol.
[0014] Bontip (Bontip et al. Frontiers in Bioengineering and Biotechnology, Vol. 9, pp. 1-18; 2021) describes the exploitation of the production of the phaCAB operon of C. necator H16 for constructing a strain of Escherichia coli engineered for high-efficiency PHB production using a cold-shock-inducible promoter (cSPA promoter). This system is easily used on a laboratory scale, but difficult to apply on a medium or large industrial scale due to the costs associated with the use of cooling systems.
[0015] In line with the circular economy production and consumption model (Di Bartolo et al., Polymers 13, p.1-26; 2021), various studies have been published aimed at the efficient and low-cost production of PHB using appropriately engineered bacteria (e.g. E. coli). In particular, genetic information encoding PHB from C. necator H16 or Alcaligenes latus (Azoidromonas lata) strain Hl (DSM1123) was inserted into the engineered strains grown in the presence of low-cost biomass (e.g. whey, starch, wastewater, etc.) as a substrate for the metabolism of the recombinant strains. In the study published by Ahn and colleagues (Ahn et al. Applied and Environmental Microbiology, Vol. 66, nr. 8, pages 3624-3627; 2020) the E. coli lac+ strain CGSC4401 (also referred to as DSM9037 in the DSM collection) engineered with a plasmid containing the phaCAB operon of Alcaligenes latus, was tested for the efficiency of PHB production in a high-lactose whey solution (280 g / liter), by a fed-batch fermentation process.
[0016] Similarly, Lee et al. in 1997 (Biotechnology Letters, Vol. 19 nr.l, pages 1033-1035; 1997) published a study regarding the production of PHB in nine recombinant E.coli strains (including CGSC4401) containing the phaCAB operon of Alcaligenes eutrophus and using solutions containing bovine milk powder at different concentrations (from 10 to 70 g / liter) as a substrate for the metabolism.
[0017] Colombo B. et al. (Waste Management. Vol.- 95, pages 22-31, 2019) describes the production of biohydrogen, volatile organic acids, and PHAs using a two-step process and dark fermentation. Biohydrogen and volatile organic acids are produced in the first step starting from deproteinized whey containing hydrolyzed lactose, whereas the production of PHA takes place in the second step and is effected using a mixed microbial culture with an organic acid-rich substrate deriving from dark fermentation after the production of biohydrogen. It is known in literature that this substrate is used by bacteria with a metabolic pathway different from that which uses substrates deriving directly from deproteinized dairy residues or from sugar fermentation. Zhou Wen et al. Journal of Environmental Management. Vol. 341, 2023 describes the different modes of PHA production using different types of bacteria, various carbon sources and metabolic pathways, such as the use of the phaCAB operon, which is described as an operon of the biosynthetic pathway of class I PHA.
[0018] The main disadvantages of using plasmid-engineered strains that utilize inducible operons and lactose-rich substrates are high costs and the limited ability to industrialize the process on a large scale.
[0019] In particular, the methods used to date are particularly expensive and produce polymeric products with low yields or with elasticity and ductility characteristics that are not optimal for industrial use.
[0020] There is therefore a clear need for developing new recombinant strains capable of producing PHAs at high concentrations and high yields when grown on dairy substrates in small-, medium-, and large-scale industrial processes.
[0021] DETAILED DESCRIPTION OF THE INVENTION
[0022] The inventors have surprisingly observed that by growing an E. coli strain containing the phaCAB operon of Cupriavidus necator in a growth substrate deriving from dairy wastewater with a low protein and lactose content, it is possible to obtain a greater accumulation of PHB in the engineered strain and therefore a greater production of PHB, compared to strains grown on raw and non-deproteinized dairy substrates. This result was observed in particular using wastewater with a low protein content and a specific protein-to-lactose ratio.
[0023] The inventors have in fact observed an increase in the yield of PHB obtained by growing the engineered bacterial strain in a mixture coming from dairy waste characterized by a lactose to protein ratio higher than 50:1, compared to the yield obtained using, as a substrate, a raw pasteurized liquid matrix, which is a residue from the production of dairy products (for example the scotta obtained from the residue of the production of pasteurized ricotta or scotta concentrate).
[0024] This production is similar to the yield obtained by growing the engineered strains under optimal growth conditions, using a glucose-containing, protein-free substrate (such as in an LB, Luria-Bertani medium or other commercial laboratory media). These conditions are unsuitable for the production of PHB on an industrial scale as they are too expensive.
[0025] The present invention therefore provides a method for producing a polyhydroxyalkanoate (PHA) in a bacterial strain genetically modified with a vector containing the phaCAB operon and grown in the presence of dairy wastewater with a lactose:protein ratio higher than 50: 1.
[0026] The lactose:protein ratio is preferably higher than 100: 1, more preferably, it is higher than 120: 1, and is even more preferably higher than 150:1.
[0027] In a further preferred aspect, the lactose:protein ratio ranges from 120: 1 to 420: 1.
[0028] According to a preferred aspect, the bacterial strain is selected from: Acidovorax, Acinetobacter, Actinobacillus, Actinomiceti, Aeromonas, Alcaligenes, Allochromatium, Anabaena, Aphanothece, Aquaspirillum, Asticcaulus, Axobacter, Azomonas, Aureobasidium, Azoidromonas,
[0029] Azospirillum, Azotobacter, Bacillo, Beggiatoa, Beijerinckia, Beneckea,
[0030] Brachymonas, Bradyrhizobium, Burkholderia, Caryophanon, Caulobacter,
[0031] Chloroflexus, Chlorogloea, Chromatium, Chromobacterium, Clostridium,
[0032] Defluviicoccus, Comamonas, Corynebacterium, Cupriavidus, Cyanobacterium, Derxia, Delftia, Ectothiorhodospira, Erwinia, Escherichia coli, Ferrobacillus, Gamphospheria, Gloeocapsa, Gloeothece, Haemophilus, Halobacterium, Haloarcula, Haloferax, Halomonas, Haloquadratum, Haloterrigena, Hydrogenophaga, Hyphomicrobium, Klebsiella (ricombinante), Lamprocystis, Lampropedia, Leptothrix, Legionella, Methanomonas, Methylobacterium, Methylomonas, Methylosinus, Methylocystis, Methyl ovibrio, Micrococcus, Microcoleus, Microcystis, Microlunatus, Microvoleus, Moraxella, Mycoplana, Nitrobacter, Nitrococcus, Nocardia, Nostoc, Oceanospirillum, Oscillatoria, Paracoccus, Pauci spirillum, Pedomicrobium, Photobacterium, Protomonas, Pseudomonas, Ralstonia, Rhizobium, Rhodobacter, Rhodococcus, Rhodopseudomonas, Rhodospirillum, Rubrivivax, Saccharophagus, Shinorhizobium, Sphaerotilus, Spirillum, Spirulina, Stafilococco, Stella, Streptomyces, Synechococcus, Syntrophomonas, Thiobacillus, Thiocapse, Thiococcus, Thiocystis, Thiodictyon, Thiopedia, Thiosphaera, Variovorax, Vibrio, Wautersia (currently Cupriavidus), Xanthobacter and Zoogloea.
[0033] The bacterial strain is preferably a strain of Escherichia coli (E. coli).
[0034] According to a further preferred embodiment, the vector is a pGEX plasmid (Novagene), pUC18, pGEM-T Vector (Promega), pHSG298 (Takara), pHSG396 (Takara), pCold (Takara), or any vector with a Lac+ promoter.
[0035] In particular, the pGEX expression vector allows transcription of the nucleotide sequence cloned downstream of the Lac promoter, using the inducer IPTG (isopropyl-P-D-1 -thiogalactopyranoside), a non-metabolizable analogue of allolactose.
[0036] Said dairy wastewater preferably has a protein content ranging from 0.7 g / L to 0.05 g / L, preferably from 0.35 g / L to 0.1 g / L, more preferably approximately 0.25 g / L.
[0037] Said dairy wastewater preferably has a lactose content of less than 50 g / L, preferably less than 40 g / L.
[0038] According to a further preferred embodiment, said dairy wastewater has a lactose content ranging from 5 g / L to 50 g / L, preferably from 25 g / L to 45 g / L.
[0039] Said dairy wastewater is preferably wastewater from the industrial processing of milk for the production of butter, cheese, and dairy products. Said dairy wastewater is more preferably subjected to pasteurization or sterilization.
[0040] According to a further preferred aspect, said polyhydroxyalkanoate is selected from PHB, or polymers obtained from at least one monomer selected from the group consisting of 2-hydroxybutyrate, lactic acid, 3 -hydroxybutyrate (3HB), 3 -hydroxypropionate (3HP), 3 -hydroxy valerate (3HV), 3- hydroxyhexanoate (3HH), 3-hydroxyheptanoate (3HHep), 3 -hydroxy octanoate (3 HO), 3-hydroxynonanoate (3HN), 3 -hydroxy decanoate (3 HD), 3- hydroxyundecanoate (HUD), 3 -hydroxy dodecanoate (3HDd), 4-hydroxybutyrate (4HB), 4-hydroxy valerate (4HV), 5 -hydroxy valerate (5HV) and 6- hydroxyhexanoate (6HH) and combinations thereof, said polyhydroxyalkanoate is preferably PHB and its copolymers, and is more preferably PHB.
[0041] According to a further preferred embodiment, said polyhydroxyalkanoate is a short-chain polyhydroxyalkanoate selected from Poly-3 -hydroxypropionate (P3HP), Poly-3 -hydroxy valerate (PHV), Poly-3 -hydroxybutyrate (PHB), Poly-4- hydroxybutyrate (P4HB) and their copolymers.
[0042] According to a preferred embodiment, said polymers are produced by the method of the present invention using, in addition to the dairy substrate, monomeric precursors selected from organic acids such as acrylic acid, propionic acid, butyric acid, valeric acid, levulinic acid, acetic acid, lauric acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, oleic acid, myristic acid, undecanoic acid, dodecanoic acid, or tetradecanoic acid; alcohols, selected from methanol and pentanol, methane; amino acids, selected from valine, cysteine, cystine, methionine, isoleucine, leucine, tyrosine, tryptophan, phenylalanine, arginine, lysine, proline, and histidine; and salts, selected from sodium gluconate, sodium butyrate, sodium hexanoate, and fatty acid salts.
[0043] In preferred embodiments, the culture conditions include aerobic or substantially aerobic growth or maintenance conditions. Exemplary aerobic conditions for fermentation processes are described herein in the examples but should not be considered as limiting the present invention. Each of these conditions can be used with microbial organisms not present in nature as also with other aerobic conditions well known in the art.
[0044] Cultivation conditions can comprise, for example, liquid culture procedures as well as fermentation, batch or feed-batch, continuous, and other small-, medium-, and large-scale cultivation processes.
[0045] According to a preferred embodiment, the method according to the present invention is characterized by the following steps: a) inoculation of the bacterial strain in a percentage ranging from 30 to 1% v / v; b) incubation for at least 10 hours at a temperature within the range of 27-40°C, with shaking at 50-1500 rpm; aeration by diffusion in a flask, within the range of 0.5-3 1 / 1 / min (vvm) in a bioreactor; c) maintaining the pH of the culture at a value of 5-8; d) recovery of the cellular biomass by extraction and purification of the polyhydroxyalkanoate granules.
[0046] The method according to the present invention is preferably characterized by the following steps: a) inoculation of the bacterial strain in a percentage ranging from 15 to 2% v / v, preferably a percentage of 4%; b) incubation for at least 24 hours at a temperature within the range of 30-37°C, more preferably 37°C, with shaking at 100-500 rpm; aeration by diffusion in a flask, within the range of 1-2 1 / 1 / min (vvm) in a bioreactor; c) maintaining the pH of the culture at a value of 6-7; d) extraction and purification of the polyhydroxyalkanoate granules.
[0047] DEFINITIONS "Scotta" is the liquid matrix that remains from cheesemaking whey (e.g., from the production of ricotta) following the acid-thermal precipitation of whey proteins. It mainly contains lactose, proteins, and mineral salts in aqueous solution.
[0048] "Scotta concentrate" is one of the fractions obtained through a separation process based on a membrane filtration system, aimed at recovering different fractions for use in different valorization pathways.
[0049] As used herein, a "vector" is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment can be inserted to induce replication of the inserted segment. Vectors can be expression vectors.
[0050] As used herein, an "expression vector" is a vector that comprises one or more expression control sequences.
[0051] According to the present invention, the term "vvm" has the following meaning: the first "v" stands for air volume (e.g., liter); the second "v" stands for unit of culture liquid expressed in volume (e.g., liter); and "m" stands for unit of time (e.g., minute). For example, 1 vvm (1 / 1 / m) means that in 1 minute, 1 liter of air passes through 1 liter of liquid.
[0052] The phaCAB operon is a cluster of three genes (phaC, phaA, and phaB) that are responsible for the 3-step biosynthesis of polyhydroxyalkanoates (PHAs). These genes respectively encode the polyhydroxyalkanoate (PHA) synthase, 3- ketothiolase, and acetoacetyl-Coenzyme A reductase enzymes, EXAMPLES
[0053] Example 1. Production of the engineered strain EP001
[0054] Verification of the amplificabilitv of the phaCAB operon
[0055] A strain of Cupriavidus necator Hl 6, a PHA producer, was purchased. This is a model organism for PHA producers whose complete genome sequence is published (Garet T. Little, Microbiol Resour Announce. 2019. 12; 8 (37)). Specific oligonucleotides for the amplification of the phaCAB operon (genomic sequence with Accession Number AM260479.1, https: / / www.ncbi.nlm.nih.gOv / nuccore / A 260479. l / ).
[0056] More specifically, the CNF1 (forward primer) and CNR1 (reverse primer) oligonucleotides are nucleotide sequences complementary to the genomic regions upstream of the putative phaCAB promoter and downstream of the same operon, respectively. The CNF2 (forward primer) oligonucleotide includes the nucleotide sequence of the region immediately downstream of the putative phaCAB operon promoter. PCR reactions with the CNF1 / CNR1 and CNF2 / CNR1 oligonucleotide pairs yielded amplification products of the same size as expected.
[0057] In particular, the nucleotide amplification reactions using the oligonucleotide pairs CNF1 / CNR1 and CNF2 / CNR1 produced amplicons of 4906 bp and 4361 bp, respectively, consistent with the sizes expected from the nucleotide sequence deposited under accession number AM260479.1. The oligonucleotides used for amplifyng the phaCAB operon of Cupriavidus necator Hl 6 are the following:
[0058] - Primer CNF1: AAGTACCTTGCCGACATCTATGCG (SEQ ID NR. 1)
[0059] - Primer CNR1 : CCC AACAAGGCACTAAGAAAAGCG (SEQ ID NR. 2)
[0060] - Primer CNF2: CTGACGATTCCCAGGTTTCTCCGG (SEQ ID NR. 3)
[0061] The nucleotide sequences of the oligonucleotides used for the amplification of the phaCAB operon (from the start codon ATG of the phaC gene to the stop codon TGA of the phaB gene) and the subsequent cloning of the amplified product into the pGEX vector (using the restriction sites BamHI and Xhol) are the following::
[0062] - pGEX-FWl: GGCCCCTGGGHTCCCCGGAAATGGCGACCGGCAA (SEQ ID NR. 4); - pGEX-RVl: GCACTCGAC7UGHGTCAGCCCATATGCAGG (SEQ ID NR. 5)
[0063] Cloning of the phaCAB amplicon into the pGEX-6P-l expression vector
[0064] For cloning the phaCAB amplicon, pGEX-6P-l (Novagen Sigma) was selected as the expression vector, which contains the inducible Lac+ promoter.
[0065] The phaCAB operon amplicon was cloned into pGEX-6P-l in the 5'- phaCAB-3' direction, using the BamHI and Xhol sites respectively present in the specifically designed pGEX-FWl and pGEX-REVl oligonucleotides described above. Two plasmid constructs (pBA134 and pBA135) were obtained, each initially propagated in the laboratory strain E. coli JM83 and subsequently in a lac+ E. coli strain as the final recipient strain to test the production of PHB and its use for the valorization of dairy industrial waste (rich in lactose) and the production of bioplastics.
[0066] The engineered strain obtained (EP001) was tested in expression assays for the production of PHB in different dairy substrates.
[0067] Expression assays of phaCAB in EP001
[0068] In order to verify the production of PHB in the EP001 strain, on a laboratory scale and in small volumes (25ml), two staining systems with fluorescent dyes were used, as indicated in literature.
[0069] 1) Vital staining with Nile Red on a solid medium (Spickermann P. et al. Arch. Microbiol. (1999) 171 : 73-80) thanks to which it is possible to grow the bacteria (37°C) on a solid nutrient medium with the addition of Nile Red (Cf 0.5ug / ml) and distinguish the PHA-producing bacteria from the non-producing ones by means of the different colouring of the colonies. The PHB-producing bacteria form red colonies when exposed to UV. 2) fluorescence microscopy after staining the cells with Nile Blue A (Legat A. et al. Appl. Microbiol. Biotechnol (2010) 87: 1119-1127)) thanks to which it is possible to have an indirect indication of the intracellular accumulation of PHA through fluorescent signals observable under a fluorescence microscope. The method involves the preparation of a slide on which a sample (about 20 pl) of a saturated bacterial culture grown in a rich medium (Luria Bertani medium was used without and with the addition of the IPTG expression inducer Cf 0.5mM was added) and subsequently fixed with heat and stained with 0.1% Nile Blue A. The production of PHB in the EP001 strain was verified through fluorescence microscopy.
[0070] The accumulation of PHB was also confirmed in the EP001 strain. For this purpose, saturated bacterial cultures were set up in flasks containing 25 ml of Nutrient Broth (OXOID) and grown at 37°C for 24 hours and 48 hours. It was observed that the 48 hour culture showed a significantly reduced number of fluorescent signals compared to the 24 hour culture, suggesting probable consumption of the reserve polymer previously accumulated in the cytoplasm..
[0071] The results obtained confirm that the phaCAB operon in the pGEX construct is expressed in the EP001 strain engineered in our laboratories.
[0072] Example 2. Evaluation of PHB production by the strain EP001 in deproteinated and non-deproteinated dairy substrates.
[0073] The engineered strain for the production of PHB (EP001) was used in a series of fermentation tests on different types of dairy wastewater in order to verify the potential production of bioplastic (PHB).
[0074] Materials and methods
[0075] 2.1 Substrates
[0076] The substrates used are scotta and scotta “concentrate” deriving from the wastewater collected from several Apulian dairies.
[0077] Scotta is the liquid matrix that remains from the production of ricotta following the acid-thermal precipitation of whey proteins. It mainly contains lactose, proteins, and mineral salts in an aqueous solution.
[0078] Scotta “concentrate” is one of the fractions obtained through a separation process based on a membrane filtration system, aimed at recovering various fractions for use in differentiated valorization processes.
[0079] 2.1.1 Heat-treated substrates
[0080] Pasteurized substrates. An initial set of experimental tests involved inoculating the starter and evaluating the biomass and PHB accumulation in scotta (S) and scotta concentrate (C) heat-treated at 60°C for 30 minutes (SP and CP). The starter was also inoculated into pasteurized substrates supplemented (SP+ and CDP+) with Trace Solution (TS) and Mineral Medium (MM), whose compositions are shown in Tables 1 and 2, respectively.
[0081] Table 1. Composition and concentrations of Trace Solution (TS) components (Wang, F. and Lee, S.Y. (1997) Applied and Environmental Microbiology, 63(9), pages 3703-3706. doi.org / 10.1128 / aem.63.9.3703-3706.1997. Zafar, Mohd. et al. (2012) ‘Optimization of polyhydroxybutyrate (PHB) production by Azohydromonas lata MTCC 2311 by using genetic algorithm based on artificial neural network and response surface methodology’, Biocatalysis and Agricultural Biotechnology, 1(1), pages 70-79.)
[0082] Table 1. Composition and component concentrations Mineral Medium (MM) ( Sharma, V., Misra, S. and Kumar Srivastava, A. (2017) ‘Developing a green and sustainable process for enhanced PHB production by Azohydromonas australica ’, Biocatalysis and Agricultural Biotechnology, 10, pages 122-129. doi.org / 10.1016 / j.bcab.2017.02.014). Table 2.
[0083] The objective of the pasteurization is to destroy the contaminating microbiota to allow the inoculated starter to thrive. At the end of the heat treatment, before inoculation, the substrates were centrifuged (Hermle LaborTechnik Z 327 K centrifuge) at 4°C, 12,000 rpm for 15 minutes. The pellet (mainly consisting of denatured proteins) was discarded, whereas the supernatant was used to set up the tests. The protein content of the supernatant obtained from the pasteurized scotta is about 0.33 g / L. Sterilized substrates. The biomass and PHB accumulation were subsequently evaluated in scotta and scotta concentrate heat-treated at 121 °C for 15 minutes. The sterilized substrates were used as such (SS and CDS) and supplemented (SS+ and CDS+) with TS and MM.
[0084] The objective of the sterilization is to destroy the contaminating microbiota and allow the significant precipitation of the residual proteins present in the substrates (determined using the Bradford method before and after treatment, as well as for the pasteurization). At the end of the heat treatment, before inoculation, the substrates were centrifuged (Hermle LaborTechnik Z 327 K centrifuge) at 4°C, 12,000 rpm for 15 minutes. The pellet was discarded, whereas the supernatant was used for testing. The supernatant from the sterilized pellet had a protein content of approximately 0.012 g / L and a lactose content of approximately 36 g / L.
[0085] 2.1.2 Effect of the concentration in organic nitrogen
[0086] In order to verify the growth of the microorganism (biomass) and the accumulation of PHB in the presence of variable concentrations of nitrogenous organic substances in the substrate, substrates with intermediate concentrations were obtained compared to the pasteurized scotta (0.33 g / L of proteins) and the sterilized scotta (0.012 g / L of proteins). In particular, the substrates with intermediate concentrations were obtained by mixing pasteurized and sterilized scotta as indicated in Table 3.
[0087] Table 3. Composition and protein concentration of substrates obtained by mixing pasteurized and sterilized scotta.
[0088] 2.2 Propagation of the microorganism
[0089] The culture of the engineered strain EP001 as described above was revitalized by resuspension and subsequent incubation for 24 hours at 37°C in Luria Bertani (LB) medium pH 7.0, having the following composition (g / L): Tryptone 10, Yeast extract 5, NaCl 10, supplemented with ampicillin (100 ug / ml) and glucose (20 g / L). The medium was sterilized at 121 °C for 15 minutes before use. The inoculation (both in the routine propagation phases in the medium and for the experimental tests on the substrates) was carried out at 4% v / v upon reaching the exponential phase (16-18 hours of incubation). In order to ensure the aerobic conditions necessary for the growth of the microorganism, the media and substrates were kept under constant shaking (200 rpm).
[0090] 2.3 Test conditions
[0091] The experimental program included the development of a series of fermentation setups aimed at monitoring and optimizing the production process of PHB in scotta and scotta concentrate by E. coli EPOOL
[0092] It should be noted that a preliminary series of tests led to the definition of the following common conditions: a) batch of 200 ml per thesis, placed in 500 ml Pyrex glass Erlenmeyer flasks; b) 4% inoculations (v / v); c) fermentation time equal to 72 hours, at a temperature of 37°C;
[0093] 5 d) pH correction to 7.00, effected every 3 hours with NaOH 3M.
[0094] Each test was set up inside 500 ml Pyrex glass Erlenmeyer flasks. The bacterial culture was inoculated at 4% v / v. The fermentations were conducted in an orbital shaking incubator (Argo Lab model, SKI4) at 200 rpm, at a constant temperature of 37°C. For each condition, the addition of an antibiotic
[0095] 10 (cycloheximide 0.10 g / L) was programmed to inhibit the growth of contaminating yeasts (Table 4).
[0096] Table 4. List of tested conditions and fermentation parameters.
[0097] Table 5. Lactose: protein ratio of the different substrates
[0098] 2.4 Recovery and determination of the dry weight
[0099] At the end of the fermentation, the bacterial cells were recovered from the liquid substrate by centrifugation at 12,000 rpm for 15 minutes at 4°C. The cell pellet was resuspended and washed twice with a 0.9% NaCl solution to remove any residual impurities. Washing removes substances present in the culture liquid (salts, nutrients, etc.) that could alter the final dry weight or dissolve in the extraction solvent, reducing the purity of the polymer. After washing, a new centrifuge was effected at 12,000 rpm for 15 minutes at 4°C.
[0100] The cellular biomass recovered was then oven-dried at 60°C for at least 24 hours. This operating temperature, in addition to ensuring the evaporation of any moisture present, protects the polymer from microbial or enzymatic degradation. The drying process allows for the correct measurement of the dry weight. The dried cell pellet was weighed using a precision analytical balance (Sartorius). Determining the dry weight provides a quantitative measurement of the cellular biomass obtained from the fermentation process. This parameter is of fundamental importance for evaluating the performance of bacterial growth under different experimental conditions.
[0101] 2.5 Extraction and purification of the bioplastic
[0102] The extraction of PHB granules contained in bacterial cells first of all involves cell lysis, followed by the separation of the biopolymer from the rest of the cellular components. In particular, the protocol indicated in Wang et al. (Bioprocess and Biosystems Engineering 35 (9), pages 1591-1607) was used for the extraction and purification of PHB from the dry biomass of E. coli.
[0103] In order to obtain complete cell lysis, the dried biomass was resuspended in a solution of 12% v / v sodium hypochlorite (NaOCl, Sigma Aldrich) and chloroform (CHCh, VWR Chemicals): 12.5 ml of chloroform and 12.5 ml of 12% sodium hypochlorite per gram of dried cell biomass. To achieve complete solubilization, the mixture was kept in a water bath at 30°C for 90 minutes and vortexed regularly. Lysis of the bacterial cells allows the biopolymer to pass into the organic phase (chloroform).
[0104] The solutions, placed in 50 ml Falcon tubes, were centrifuged (5,000 rpm, 15 minutes 4°C) to obtain three distinct phases: a top layer of hypochlorite, a disk of intermediate cellular material, and a denser bottom layer of chloroform containing the bioplastic (Figure 2). The organic phase containing PHB was recovered with a glass Pasteur pipette, taking care not to remove the cellular material forming the disk at the interface between the phases, and centrifuged again (5,000 rpm, 15 minutes 4°C) to remove any residual impurities.
[0105] The pellet, corresponding to the raw PHB, was recovered with chloroform and subjected to a purification process with ethanol (Sigma Aldrich), added in a quantity equal to 10 times the volume of chloroform used for each individual sample. After centrifugation at 12,000 rpm for 15 minutes at 4°C, the pellet, corresponding to the purified PHA, was recovered and left under a fume hood to volatilize any excess solvent, then weighed (Gibertini balance). The polymer yield (%) was calculated as [PHA (mg / L) / CDM (mg / L)] x 100.
[0106] 3. Results
[0107] Optical density at 600 nm (ODeoo), microscopic observations, and pH were monitored regularly throughout the experiments, whereas the dry weight of the biomass and PHB were measured at the end of the experiment. The pH was maintained at 7.00 ± 0.02 by correction with 3M (or 5M) NaOH.
[0108] Table 6. Data relating to the cell pellet (Dry Cell Weight) of E. coli EP001 and PHB synthesized during incubation at 30°C for 72 hours in pasteurized scotta (SP+) and pasteurized scotta concentrate (CP+), pasteurized scotta concentrate subjected to lactose dilution (CPD+) and in substrates (Mixture I, II and III) having intermediate concentrations of nitrogenous organic substances compared to pasteurized scotta (SP, 0.33 g / L of proteins) and sterilized scotta (SS, 0.12 g / L of proteins).
[0109] Analysis of the data indicated in Table 6 shows that the E. coli EP001 strain is capable of growing and synthesizing PHB in both pasteurized scotta and pasteurized scotta concentrate.
[0110] Comparing the CP+ and CDP+ substrates, it is clear that at reduced lactose and protein concentrations, an increase in the quantity of PHB synthesized is observed, resulting in 0.15 g / L in the diluted substrate with a lactose reduction (CDP+), wherein the lactose concentration was reduced from 124.5 g / L to 25 g / L. The quantity of PHB synthesized in the CDP+ is therefore double that found in the undiluted substrate (CP+). Table 6 also shows that the CDP+ substrate has a higher yield than CP+, as the pasteurized concentrate contains an excess of sugars that promotes bacterial growth (higher DCW biomass) without inducing PHA production, thus lowering the yield.
[0111] In order to verify the growth of the microorganism (biomass) and the accumulation of PHB at varying concentrations of organic nitrogenous substances in the substrate, substrates with intermediate protein concentrations were obtained, mixtures I, II, and III, compared to pasteurized scotta (0.33 g / L of protein) and sterilized scotta (0.12 g / L of protein).
[0112] From an analysis of the results obtained and shown in Table 6, confirmed by multiple replicates, it is clear that an increase in the PHB yield is achieved by decreasing the protein concentration present in the substrate and with a lactose-to- protein ratio higher than 50:1, preferably higher than 100: 1 and 120: 1.
[0113] It can be noted in particular that the highest levels of PHB production are obtained in media such as mixtures I, II, and III, with a specific lactose-to-protein ratio higher than 100: 1.
[0114] It can be observed, in fact, that with the reduction of the protein content in the mixture within a certain value (from mixture I to mixture III), and therefore with a specific lactose:protein ratio ranging from 140: 1 to 400: 1, there is an increase in the synthesis of PHB, with a yield of PHB produced equal to approximately 50% of the biomass, which is close to the yield obtained in a laboratory LB medium (free of proteins and lactose) of 68.9%.
Claims
CLAIMS1. A method for producing a polyhydroxyalkanoate (PHA) in a bacterial strain genetically modified with a vector containing the phaCAB operon and grown in the presence of dairy wastewater having a lactose:protein ratio higher than 50: 1.
2. The method according to claim 1 characterized in that said lactose:protein ratio is higher than 100:1, preferably higher than 120: 1, more preferably higher than 150: 1.
3. The method according to any of claims 1 or 2, characterized in that said lactose:protein ratio ranges from 120: 1 to 420: 1.
4. The method according to any of the previous claims, characterized in that said bacterial strain is selected from Acidovorax, Acinetobacter, Actinobacillus, Actinomiceti, Aeromonas, Alcaligenes, Allochromatium, Anabaena, Aphanothece, Aquaspirillum, Asticcaulus, Axobacter, Azomonas, Aureobasidium, Azoidromonas, Azospirillum, Azotobacter, Bacillo, Beggiatoa, Beijerinckia, Beneckea, Brachymonas, Bradyrhizobium, Burkholderia, Caryophanon, Caulobacter, Chloroflexus, Chlorogloea, Chromatium, Chromobacterium, Clostridium, Defluviicoccus, Comamonas, Corynebacterium, Cupriavidus, Cyanobacterium, Derxia, Delftia, Ectothiorhodospira, Erwinia, Escherichia coli, Ferrobacillus, Gamphospheria, Gloeocapsa, Gloeothece, Haemophilus, Halobacterium, Haloarcula, Haloferax, Halomonas, Haloquadratum, Haloterrigena, Hydrogenophaga, Hyphomicrobium, Klebsiella (ricombinante), Lamprocystis, Lampropedia, Leptothrix, Legionella, Methanomonas, Methylobacterium, Methylomonas, Methylosinus, Methylocystis, Methylovibrio, Micrococcus, Microcoleus, Microcystis, Microlunatus, Microvoleus, Moraxella, Mycoplana, Nitrobacter, Nitrococcus, Nocardia, Nostoc, Oceanospirillum, Oscillatoria, Paracoccus, Paucispirillum, Pedomicrobium, Photobacterium, Protomonas, Pseudomonas, Ralstonia, Rhizobium, Rhodobacter, Rhodococcus, Rhodopseudomonas, Rhodospirillum, Rubrivivax, Saccharophagus,Shinorhizobium, Sphaerotilus, Spirillum, Spirulina, Stafilococco, Stella, Streptomyces, Synechococcus, Syntrophomonas, Thiobacillus, Thiocapse, Thiococcus, Thiocystis, Thiodictyon, Thiopedia, Thiosphaera, Variovorax, Vibrio, Wautersia (currently Cupriavidus), Xanthobacter and Zoogloea, said bacterial strain is preferably a strain of E. coli.
5. The method according to any of the previous claims, characterized in that said vector is a plasmid of the type pGEX, pUC18, pGEM-T, pHSG298, pHSG396, pCold or any vector with a Lac+ promoter.
6. The method according to any of the previous claims, characterized in that said dairy wastewater has a protein content ranging from 0.7g / L to 0.05 g / L, preferably from 0.35 g / L to 0.1 g / L, more preferably approximately 0.25 g / L.
7. The method according to any of the previous claims, characterized in that said dairy wastewater has a lactose content lower than 50 g / L, preferably lower than 40 g / L.
8. The method according to any of the previous claims, characterized in that said dairy wastewater has a lactose content ranging from 5 g / L to 50 g / L, preferably from 25 g / L to 45 g / L.
9. The method according to any of the previous claims, characterized in that said dairy wastewater is wastewater coming from the industrial processing of milk for the production of butter, cheese and derivatives, said dairy wastewater is more preferably subjected to pasteurization or sterilization.
10. The method according to any of the previous claims, characterized in that said polyhydroxyalkanoate is selected from PHB or polymers obtained from at least one monomer selected from the group consisting of 2-hydroxybutyrate, lactic acid, 3 -hydroxybutyrate (3HB), 3-hydroxypropionate (3HP), 3 -hydroxy valerate (3HV), 3-hydroxyhexanoate (3HH), 3-hydroxyheptanoate (3HHep), 3- hydroxy octanoate (3 HO), 3 -hydroxynonanoate (3HN), 3 -hydroxy decanoate (3 HD), 3-hydroxyundecanoate (HUD), 3 -hydroxy dodecanoate (3HDd), 4- hydroxybutyrate (4HB), 4-hydroxy valerate (4HV), 5 -hydroxy valerate (5HV) and6-hydroxyhexanoate (6HH) and combinations thereof, preferably said polyhydroxyalkanoate is PHB or polymers thereof, and is more preferably PHB.
11. The method according to claim 10, characterized in that said polyhydroxyalkanoate is a short-chain polyhydroxyalkanoate selected from Poly- 3 -hydroxypropionate (P3HP), Poly-3 -hydroxy valerate (PHV), Poly-3 - hydroxybutyrate (PHB), Poly-4-hydroxybutyrate (P4HB) and their copolymers.
12. The method according to any of the previous claims, characterized in that it comprises the following steps: a) inoculation of the bacterial strain in a percentage ranging from 30 to 1% v / v; b) incubation for at least 10 hours at a temperature within the range of 27-40°C, with shaking at 50-1500 rpm; aeration by diffusion in a flask, within the range of 0.5-3 1 / 1 / m in a bioreactor; c) maintaining the pH of the culture at a value of 5-8; d) recovery of the cellular biomass by extraction and purification of the polyhydroxyalkanoate granules.
13. The method according to any of the previous claims, characterized in that it comprises the following steps: e) inoculation of the bacterial strain in a percentage ranging from 15 to 2% v / v, preferably a percentage of 4%; f) incubation for at least 24 hours at a temperature within the range of 30-37°C, more preferably 37°C, with shaking at 100-500 rpm; aeration by diffusion in a flask, within the range of 1-2 1 / 1 / m in a bioreactor; g) maintaining the pH of the culture at a value of 6-7; h) extraction and purification of the polyhydroxyalkanoate granules.