Compositions and methods for treating cancer

Combining Vδ1+γδ T cell therapy with immune checkpoint inhibitors and upregulating NKG2D ligands addresses the challenge of tumor microenvironment impact, enhancing cytotoxicity and targeting in solid tumors.

WO2026013616A1PCT designated stage Publication Date: 2026-01-15TAKEDA PHARMA CO LTD
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2025/057007
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-10
Filing Date
2025-07-10
Publication Date
2026-01-15

AI Technical Summary

Technical Problem

The efficacy of T cell therapy, particularly gamma delta (γδ) T cells, against solid tumors remains elusive, and the tumor microenvironment negatively impacts their ability to recognize and kill cancer cells.

Method used

Combining Vδ1+γδ T cell therapy with immune checkpoint inhibitors, such as PD-1 and TIGIT blockers, and upregulating NKG2D ligands on cancer cells or Vδ1+γδ T cells to enhance targeting and cytotoxicity.

Benefits of technology

Enhances the immunotherapeutic efficacy of Vδ1+γδ T cells by increasing their cytotoxicity and targeting to cancer cells, effectively controlling tumor growth in solid cancers like colorectal cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IB2025057007_15012026_PF_FP_ABST
    Figure IB2025057007_15012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides combination therapy using gamma delta (γδ) T cells (e.g., Vδ1+) for treating solid cancers. In particular, the present invention provides several strategies to enhance efficacy of gamma delta (γδ) T cells against cancer cells. The synergistical strategies include combination therapy of gamma delta (γδ) T cell therapy and immune checkpoint blockade immunotherapy and / or upregulation of NKG2D reaction to increase gamma delta (γδ) T cells targeting cancer tissues.
Need to check novelty before this filing date? Find Prior Art

Description

ATTORNEY DOCKET NO.: MIL-049WO1 COMPOSITIONS AND METHODS FOR TREATING CANCER CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to, and the benefit of, U.S. Provisional Application No.63 / 669,544, filed on July 10, 2024; the entire contents of which is hereby incorporated by reference in its entirety. BACKGROUND

[0002] T cells based adoptive cell therapy (e.g., chimeric antigen receptor (CAR) T cells) have been approved for use in patients for hematological malignancies (e.g., B cell malignancies or relapsed and / or refractory multiple myeloma. In addition of “conventional” Alpha beta (αβ) T cells, Gamma delta (γδ) T cells, ‘unconventional’ T cells, have also been translated to the clinic for hematological malignancies (e.g., acute myeloid leukemia). The efficacy of T cell therapy against most solid tumors remains elusive.

[0003] Human γδ T cells exhibit an inherent ability to lyse cancerous cells, and as such, have great potential in the treatment of cancers, including targeting of solid tumors. γδ T cells have the ability to induce cytolysis as a function of producing large amounts of proinflammatory cytokines (e.g., IFN-γ and TNF-α) and have been indicated to be able to kill many different types of tumor cell lines and tumor in vitro, including leukemia, neuroblastoma, and various carcinomas.

[0004] γδ T cells are found in various cancer tissues including lung, breast carcinomas and melanomas, as major tumor infiltrating T cells. γδ T cells have also been found to be associated with good prognosis, indicating that the extent of γδ T cell infiltration, but not of CD8+T cells or NK cells, positively correlates with the overall survival of patients having a solid cancer, e.g., MSS subtype of CRC (Yu et al., Int. J Cancer, 2023, 153, 1684-1697). Recent studies also demonstrate that the majority of γδ T cells infiltrating cancer tissues is Vδ1+T cells. These observations suggest great potential of Vδ1+T cells as effectors for next- generation immunotherapies. Though their potent cytotoxic functions in in vitro and in vivo pre-clinical studies, Vδ1+γδ T cell-based strategy for treating solid cancers is still to be tested in the clinic.

[0005] The present disclosure investigated, for the first time, the therapeutic potential of γδ T cells, particularly Vδ1+γδ T cells, against solid cancers using colorectal cancer (CRC)ATTORNEY DOCKET NO.: MIL-049WO1 as models. The present disclosure further developed combinational strategies to enhance anti- cancer efficacy of Vδ1+γδ T cells. The present disclosure accordingly provides, in certain aspects, Vδ1+γδ T cells compositions and combination therapy for treating solid cancers. SUMMARY

[0006] In certain aspects, the present invention relates to combination therapy and methods for enhancing immunotherapeutic efficacy of T cells, for example, gamma delta T cells (e.g., Vδ1+γδ T cells) for treating cancers (e.g., solid cancers). In at least one aspect, the combination strategies provided herein are believed to synergistically increase targeting of Vδ1+γδ T cells to cancer cells and anti-cancer function of Vδ1+γδ T cells that infiltrate tumor tissues. In accordance, the present invention provides, among other things, combination therapy and methods for treating solid cancers in a subject in need thereof, wherein the combination therapy combines Vδ1+γδ T cell therapy and a second therapy.

[0007] In one aspect, the present invention provides for treating a solid tumor comprising administering gamma delta T cells (e.g., Vδ1+ γδ T cells) to a subject in need thereof and at least one immune checkpoint inhibitor (i.e., immune checkpoint blockade (ICB)).

[0008] In some embodiments, the present invention contemplates administering blood- derived gamma delta T cells (e.g., Vδ1+ γδ T cells) to a subject in need thereof and at least one immune checkpoint inhibitor (i.e., immune checkpoint blockade (ICB)).

[0009] In some embodiments, the Vδ1+ γδ T cells and said at least one immune checkpoint inhibitor are administered to the subject concurrently, or sequentially.

[0010] In some embodiments, the immune checkpoint inhibitor increases cytotoxicity of Vδ1+ γδ T cells that filtrate tumor tissues.

[0011] In some embodiments, the immune checkpoint inhibitor (immune checkpoint blockade (ICB)) targets to PD-1 and / or TIGIT.

[0012] In some embodiments, the immune checkpoint inhibitor is a PD-1 checkpoint inhibitor. The PD-1 checkpoint inhibitor is a PD-1 blocking antibody, a PD-L1 bocking antibody, a PD-L2 blocking antibody, or a small molecule inhibitor targeting the PD-1 / PD-L1 signaling pathway.

[0013] Exemplary PD-1 blocking antibodies include but are not limited to, Nivolumab, Pembrolizumab, Cemiplimab, Dostarlimab, Retifanlimab, Toripalimab, Pidilizumab, CT011, Camrelizumab (SHR-1210), Vopratelimab (JTX-4014), Spartalizumab (PDR001), Sintilimab (IBI308), Tislelizumab (BGB-A317), INCMGA00012 (MGA012), AMP-514 (MEDI0680), and Acrixolimab (YBL-006).ATTORNEY DOCKET NO.: MIL-049WO1

[0014] In some embodiments, the PD-L1 blocking antibody is Atezolizumab, Avelumab, or Durvalumab. In other embodiments, the PD-1 checkpoint inhibitor is AMP224.

[0015] In some embodiments, the immune checkpoint inhibitor is a TIGIT checkpoint inhibitor. The TIGIT inhibitor is a TIGIT blocking antibody, or a compound directed against TIGIT.

[0016] Exemplary anti-TIGIT blocking antibodies include but are not limited to, Vibostolimab, Etigilimab, Tiragolumab, Domvanalimab, Ociperlimab, M6223, EOS-448, BMS-986207, BAT6021, PM1021, ASP8374, COM902, IBI939, JS006, SEA-TGT, and AB308.

[0017] In some embodiments, the checkpoint inhibitor is a bispecific antibody against PD-1 and TIGIT. A anti-PD-1 / anti-TIGIT bispecific antibody simultaneously targets, binds to and inhibits PD-1 and TIGIT activities. Exemplary anti-PD-1 / anti-TIGIT bispecific antibodies include but are not limited to IBI321, AZD2936, HLX301, and HB0036.

[0018] In some embodiments, the method comprises combining Vδ1+ γδ T cell therapy with a PD-1 checkpoint inhibitor. In some embodiments, the method comprises combining Vδ1+ γδ T cell therapy with a TIGIT checkpoint inhibitor. In some embodiments, the method comprises combining Vδ1+ γδ T cell therapy with a PD-1 checkpoint inhibitor and a TIGIT checkpoint inhibitor.

[0019] In some embodiments, the Vδ1+ γδ T cells described herein are primary Vδ1+ γδ T cells (e.g., blood derived Vδ1+ γδ T).

[0020] In some embodiments, the Vδ1+ γδ T cells described herein are human Vδ1+ γδ T cells.

[0021] In some embodiments, the Vδ1+ γδ T cells described herein are expanded and differentiated in vitro. In some examples, the Vδ1+ γδ T cells (e.g., blood-derived Vδ1+ γδ T cells) are obtained from a sample by a method comprising culturing the sample in a medium comprising a T cell mitogen and a growth factor having interleukin-4-like activity, in the absence of a growth factor having interleukin-15-like activity. In other examples, the Vδ1+ γδ T cells are obtained from a sample by a method comprising culturing the sample in a medium comprising a T cell mitogen and a growth factor having interleukin-15-like activity, in the absence of a growth factor having interleukin-4-like activity. In yet other examples, the Vδ1+ γδ T cells are obtained from a sample by a method comprising: (1) culturing cells in the sample in a first culture medium comprising a T cell mitogen and a growth factor having interleukin-4-like activity; in the absence of a growth factor having interleukin-15-like activity; and (2) culturing the cells obtained in stepATTORNEY DOCKET NO.: MIL-049WO1 (1) in a second culture medium comprising a T cell mitogen and a growth factor having interleukin-15-like activity, in the absence of a growth factor having interleukin-4-like activity.

[0022] In some embodiments, the Vδ1+ γδ T cells are engineered to express a chimeric antigen receptor (CAR) or a new TCR. The CAR comprises an antigen binding domain, a hinge region, a transmembrane and at least one intracellular signaling domain. The antigen binding domain is an antibody that recognizes and binds to an antigen (e.g., a tumor associated antigen (TAA)), or a functional variant thereof. In some embodiments, the CAR is an attenuated CAR.

[0023] In some embodiments, the Vδ1+ γδ T cells express NKG2D and / or DNAM- 1 / CD226. In some examples, the Vδ1+ γδ T cells are treated to increase the expression of NKG2D. For example, the Vδ1+ γδ T cells are treated with butyrate or a salt thereof (e.g., sodium butyrate), or a butyrate prodrug to increase NKG2D expression.

[0024] In some embodiments, the Vδ1+ γδ T cells is administered by intravenous injection or infusion.

[0025] In some embodiments, the solid tumor is a colon cancer (e.g., colorectal cancer), a lung cancer, a skin cancer, a brain cancer, a breast cancer, a prostate cancer, a neuroblastoma, osteosarcoma, sarcoma, a germ cell tumor, carcinoma, retinoblastoma, a carcinoid tumor, a kidney tumor, a liver tumor, rhabdomyosarcoma, a bone tumor, thyroid carcinoma, a benign tumor, glioma, a bladder cancer, a stomach cancer, a pancreatic cancer, or a precancerous condition. In one embodiment, the solid tumor is colon rectal cancer (CRC).

[0026] In some embodiments, the combination therapy described herein is further combined with a treatment of upregulating the expression of a NKG2G ligand in the subject to be treated. In certain aspects, the subject receives butyrate or a salt thereof (e.g., sodium butyrate), or a butyrate prodrug, for upregulating the NKG2D ligand expression before receiving the combination therapy and / or during the course of the combination therapy.

[0027] In some embodiments, the combination therapy described herein is further combined with another anti-cancer therapy.

[0028] In another aspect, the present invention provides a method for conditioning a subject who receives T cell therapy; the method comprises upregulating expression of a NKG2D ligand on the tumor of a subject before administering to the subject the T cell therapy.

[0029] In yet another aspect, the present invention provides a method for treating a cancer in a subject in need thereof; the method comprises i) upregulating expression of a NKG2D ligand on a tumor in the subject, and ii) administering to the subject a T cell therapy.ATTORNEY DOCKET NO.: MIL-049WO1

[0030] In some embodiments, the subject is conditioned at least one day before administration of the T cell therapy. In other embodiments, the subject is conditioned for one day, 2 days, 3 days, 4 days, 5 days, 6 days, a week, two weeks, three weeks, a month or more before administration of the T cell therapy.

[0031] In some embodiments, the subject is treated with butyrate or a salt thereof, or a butyrate prodrug, for upregulating expression of a NKG2D ligand on the tumor.

[0032] In some embodiments, the subject continues to receive butyrate in the course of the T cell therapy. In some embodiments, the amount of butyrate that is administered to a subject in need thereof is between 25nm – 150mM, (e.g., between 30 – 150 nM), (e.g., between 1mM – 150 mM), (e.g., about 100mM). In some embodiments a subject in need thereof receives a dose of about: 25nM, 30nM, 35nM, 40nM, 45nM, 50nM, 55nM, 60nM, 65nM, 70nM, 75nM, 80nM, 85nM, 90nM, 95nM, 100nM, 105nM, 110nM, 115nM, 120nM, 125nM, 130nM, 135nM, 140nM, 145nM, or 150nM of butyrate. In some embodiments a subject in need thereof receives a dose of about: 1mM, 5mM, 10mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM, 55mM, 60mM, 65mM, 70mM, 75mM, 80mM, 85mM, 90mM, 95mM, 100mM, 105mM, 110mM, 115mM, 120mM, 125mM, 130mM, 135mM, 140mM, 145mM, or 150mM of butyrate.

[0033] In some embodiments, the T cell therapy is a gamma delta T cell (e.g., a Vδ1+ γδ T) cell therapy.

[0034] In some embodiment, the T cell therapy is a combination therapy combining a Vδ1+ γδ T cell therapy and at least one immune checkpoint inhibitor. The immune checkpoints are PD-1 and / or TIGIT.

[0035] In some embodiment, the cancer is a solid cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The drawings herein are for illustrative purposes and should not be limiting.

[0037] FIG.1A-FIG.1C show the phenotype of the exemplary DOT cells. FIG.1A are density plots that represent an example of the purity of γδ T cells and Vδ1+T cells after DOT cell expansion / differentiation from PBMCs from healthy volunteers. FIG.1B show representative percentages of expressed NKG2D, DNAM-1 and NKp30 receptors, gated on exemplary Vδ1+T cells. FIG.1C shows striking degranulation (CD107a), Granzyme B and Perforin production and cytokine expression after 3h PMA / Ionomycin stimulation in the presence of protein translocator inhibitors in an exemplary representative DOT donor.ATTORNEY DOCKET NO.: MIL-049WO1

[0038] FIG.2A-FIG.2B demonstrates that exemplary DOT cells establish robust immunological synapses with both MSI and MSS CRC cell lines. FIG.2A shows representative images of image flow cytometry data of immunological synapses formed between exemplary DOT cells and different CRC cell lines. FIG.2B shows the quantification of filamentous actin (F-actin) signal within the area of interaction between the exemplary DOT cell and the tumor cell. Data were analyzed with Kruskal-Wallis with Dunn’s multiple comparisons test.

[0039] FIG.3A-FIG.3G shows that the exemplary DOT cells can target CRC in vitro and control tumor growth in vivo. FIG.3A is a schematic representation and tumor cell death quantification by annexin V in 3-hour killing assays of DOT cells against different MSI and MSS CRC cell lines. Colors depict individual DOT donors. Paired t-test for normal distributions or Wilcoxon matched-pairs ranked test for non-normal distributions. Pooled 16 assays. FIG.3B a schematic representation and exemplary DOT-cell killing of CD45- depleted primary CRC tumor specimens, measured by Caspase 3 / 7 staining. Lines connect specimens from the same patient. Paired t-test. Pooled 5 assays. FIG.3C is an experimental layout of in vivo intravenously infused exemplary DOT-cell treatment in an orthotopic (intercaecal injection of SW620 cells) CRC model. FIG.3D are representative images and kinetics of in vivo tumor growth, quantified as luciferase signal by exemplary IVIS lumina (n= 8). Analyzed by repeated-measures two-way ANOVA with Sidak’s multiple comparison test. One representative out of more than three independent experiments. FIG.3E shows the kinetics of exemplary tumor-infiltrating DOT cell numbers, per milligram of SW620 tumor tissue, assessed by human CD45 expression by flow cytometry at different time points after one infusion with 10 million cells (n= 6-11). Analyzed by one-way ANOVA with Tukey’s post hoc test. FIG.3F shows representative flow cytometry density plots with percentages inbox after gating on alive cells (upper panel) and quantification of percentages (of human CD45+within alive cells) and numbers of exemplary DOT cells in tumor and different organs (lower panel). Colors represent individual mice. Data representative from two independent experiments. FIG.3G is the chemotaxis index of exemplary DOT cells towards SW620 cells and patient-derived CRC specimens, quantified as number of cells crossing a 5 μm microporous membrane versus control (medium without tumor cells) for 6 hours (n= 5). Data pooled from three independent assays. Data represented as means ± SEM. *P< 0.05, **P< 0.01, ***P< 0.001, ****P< 0.001.ATTORNEY DOCKET NO.: MIL-049WO1

[0040] FIG.4A-FIG.4D demonstrates that the exemplary DOT cells exhibit compromised cytotoxicity within CRC tumors. FIG.4A is a schematic representation of the experimental approach to assess exemplary DOT-cell phenotype upon their intravenous (i / v) inoculation in intercaecal SW620 tumor-bearing mice. FIG.4B is the quantification of expression of immunomodulatory / checkpoint receptors on exemplary DOT cells before infusion to mice and in blood and tumor, represented as percentage of alive human CD45+CD3+Vδ1+cells and assessed by flow cytometry. FIG.4C is the quantification of expression of activation and cytotoxic receptors on exemplary DOT cells before infusion to mice and in blood and tumor, represented as percentage of alive human CD45+CD3+Vδ1+cells and assessed by flow cytometry. FIG.4D is the quantification and expression of CD107a and intracellular markers after 3h PMA / Ionomycin stimulation (in the presence of protein translocation inhibitors), on DOT cells before infusion to mice and in blood and tumor, represented as percentage of alive human CD45+CD3+Vδ1+cells and assessed by flow cytometry. Circles represent individual mice. Data analyzed by one-way ANOVA with Tukey’s post hoc test. Representative of three independent experiments. Data represented as means ± SEM. *P< 0.05, **P< 0.01, ***P< 0.001, ****P< 0.001.

[0041] FIG.5A-FIG.5B assesses the in vivo expression of inhibitory, activation, and cytotoxicity receptors in exemplary DOT cells. Flow cytometry density plots show representative percentages of DOT cells before infusion and in the tumor and in the blood 14 days after infusion into intercaecal SW620-bearing mice, after gating on alive human CD45+CD3+Vδ1+cells (FIG.5A) Surface markers were stained in fresh PBS . (FIG.5B) CD107a and intracellular staining were stained after 3h of PMA / Ionomycin stimulation in the presence of Brefeldin A and Monensin.

[0042] FIG.6A-FIG.6G exemplifies how NKG2D mediates CRC targeting by exemplary DOT cells. FIG.6A depicts flow cytometry histograms of NKR ligand expression in different CRC cell lines. FIG.6B shows the Correlation of geometric mean of NKR ligand(s) expression on different CRC lines and targeting by exemplary DOT cells, assessed by the increase in the percentage of Annexin V+ tumor cells upon incubation with exemplary DOT cells. Spearman’s correlation coefficient (r) and p-value are shown. FIG.6C describes the analysis of NKG2D ligand expression, assessed by FPKM, in normal colon (N= 41), primary colon cancer (N= 453) and AML (N= 151) obtained from the TGCA repository. Data were analyzed by Kruskal-Wallis with Dunn’s multiple comparisons test. FIG.6D is the quantification by flow cytometry of CD69, CD107a and TNFα expression on exemplary DOT cells after 48h incubation with plate-bound MICA-Fc chimera. Points depict individualATTORNEY DOCKET NO.: MIL-049WO1 replicates from the same DOT donor. Data analyzed by unpaired t-test. One representative out of three experiments. FIG.6E shows SW620 tumor cell death assessed by flow cytometry over a 3h-killing assay, performed with freshly thawed exemplary DOT cells and DOT cells pre-stimulated with plate-bound MICA-Fc chimera for 48h. Each point corresponds to individual replicates from the same DOT donor. Data analyzed by one-way ANOVA with Tukey’s post-hoc test. One representative out of three experiments. FIG.6F shows SW620 tumor cell death assessed by flow cytometry over a 3h-killing assay performed with exemplary DOT cells in the presence of αNKG2D / αDNAM-1 blocking antibodies or its isotype control. Lines connect individual DOT donors (pool of 8 assays). Repeated-measures one-way ANOVA with Tukey’s post-hoc test. Data analyzed by repeated-measures one-way ANOVA with Tukey’s post-hoc test. FIG.6G shows SW620 tumor cell death assessed by flow cytometry over a 3h-killing assay performed with exemplary control or NKG2D knockout DOT cells Each point corresponds to individual replicates from the same donor. Data represented as means ± SEM. *P< 0.05, **P< 0.01, ***P< 0.001, ****P< 0.001.

[0043] FIG.7A-FIG.7D demonstrates that NKG2D is important for CRC targeting by exemplary DOT cells. FIG.7A shows the expression of exemplary NKG2D ligands in colon cancers (n= 453) versus healthy colon tissue (n= 41). Mann-Whitney U-test. FIG.7B shows the mean fluorescence intensity (MFI) and percentage of NKG2D+cells in exemplary DOT cells after incubation with plate-bound MICA Fc-chimera for 48h. Each point represents individual replicates from the same DOT donor. Unpaired t-test. One representative out of two independent experiments. FIG.7C describes a 3h-Killing assay of SW620 cells incubated with exemplary DOT cells in the presence of either αNKp30 or αTCRVδ1 blocking antibody or their isotype control, quantified by flow cytometry Annexin V staining. Data points represent individual replicates from two DOT donors. One-way ANOVA with Tukey’s post-hoc test. Pool of three independent experiments. Data represented as means ± SEM.*P< 0.05, **P< 0.01, ***P< 0.001, 0.001. FIG.7D depicts the phenotype of exemplary NKG2D- / -DOT cells and CRISPR-Cas9 controls. Representative percentage of CD3+Vδ1+cells after gating on alive cells is shown. Histograms represent expression of different receptors after gating on Vδ1+cells.

[0044] FIG.8A- FIG.8K describes how butyrate upregulates NKG2D ligand expression and increases CRC targeting by exemplary DOT cells. FIG.8A shows heatmaps representing exemplary NKR ligand upregulation, assessed by flow cytometry in CRC upon 24h exposure to different molecules. Fold change (FC) of expression over control condition with only medium is represented. FIG.8B describes exemplary 3h-killing assays against CRC cell linesATTORNEY DOCKET NO.: MIL-049WO1 with or without treating cell lines with butyrate for 24h. Individual points represent different DOT donors. One-way ANOVA with Tukey’s post-hoc test. Pool of three independent experiments. FIG.8C shows exemplary NKG2D ligand upregulation, assessed by flow cytometry, in primary tumor specimens from CRC patients upon butyrate exposure for 24h, represented as fold change of control. FIG.8D depicts an exemplary 24h-killing assay against primary CRC specimens with or without treating tumor cells with butyrate for 24h. Lines connect values from the same patients. Pool of four independent assays. FIG.8E shows the viability, assessed by flow cytometry, of exemplary DOT cells upon exposure to different concentrations of butyrate for 3h. FIG.8F shows the expression of NKG2D, DNAM-1 and TNFα, assessed by flow cytometry, upon exposure to different concentrations of butyrate for 3h. Lines connect values from the same DOT donors (n= 3). One representative out of two independent experiments. Data in FIG.8D-FIG.8F were analyzed by repeated-measures one-way ANOVA with Tukey’s post-hoc test. FIG.8G shows an exemplary 3h-killing assay of SW620 with or without butyrate pre-treatment and / or αNKG2D blocking antibodies. Individual points depict different DOT donors. One-way ANOVA with Tukey’s post-hoc test. One representative out of three independent experiments. FIG.8H a schematic representation of the exemplary in vivo administration of 100 mM sodium butyrate in drinking water of intercaecal SW620 tumor-bearing mice and DOT-cell intravenous (i / v) treatment. FIG.8I depicts exemplary flow cytometry density plots which show representative in vivo NKG2D ligand expression in the tumor (gated on alive human Epcam+tumor cells) of control or butyrate-treated mice on day 28 post tumor- inoculation, with percentages depicted inbox. FIG.8J shows CD69 expression, assessed by flow cytometry, on exemplary tumor-infiltrating DOT cells in butyrate-treated and control mice. Each point depicts individual mice. Unpaired t-test. One representative out of two independent experiments. FIG.8K describes the exemplary kinetics of intercaecal SW620 tumor growth measured by luciferase signal using in vivo imaging of mice treated as depicted in H (n= 6). Repeated-measures two-way ANOVA with Sidak’s multiple comparisons test. Pool of two independent experiments. Data represented as means ± SEM. *P< 0.05, **P< 0.01, ***P< 0.001, ****P< 0.001.

[0045] FIG.9A-FIG.9F demonstrate how butyrate enhances exemplary NKG2D- mediated targeting of CRC cells. FIG.9A shows the expression of NKG2D ligands in SW620 cells, assessed by flow cytometry, with or without exposure to butyrate for 24h and with (right) or without (left) additional 3h-exposure to butyrate. (n= 3). One representative out of three independent experiments. FIG.9B shows different exemplary CRC cell linesATTORNEY DOCKET NO.: MIL-049WO1 were pre-treated with butyrate (for 24h) and then a 3h-killing assay was performed in the absence of butyrate. Each point represents individual DOT donors. One-way ANOVA with Tukey’s post-hoc test. One representative out of three independent experiments. FIG.9C describes the exemplary DOT-cell receptor repertoire in the presence or absence of butyrate for 3h. Individual DOT cell donors are connected with lines (n= 3-5). Analyzed by repeated- measures one-way ANOVA with Tukey’s post-hoc test. FIG.9D shows exemplary NKG2D+DOT cells, assessed by flow cytometry, in contact with SW620 cells that were or were not pre-incubated for 24h with butyrate. Individual points depict different DOT donors. One-way ANOVA with Tukey’s post-hoc test. FIG.9E shows the percentage of exemplary DOT cells, assessed by human CD45 expression by flow cytometry, in the blood and tumor of butyrate- treated mice and controls at day 28 post intercaecal SW620-inoculation (n= 4-5). One representative out of two independent experiments. FIG.9F depicts the number of exemplary DOT-cells per mg of tumor at day 28 post intercaecal SW620 -inoculation (n= 4-5). Data represented as means ± SEM. *P< 0.05, **P< 0.01, ***P< 0.001,0.001.

[0046] FIG.10A-FIG.10J describes how blockade of TIGIT and PD-1 receptors enhances exemplary DOT-cell cytotoxicity against CRC. FIG.10A describes the differential expression, assessed by flow cytometry, of exemplary checkpoint receptors on DOT cells infiltrating the intercaecal SW620 tumors and before infusion, represented as fold change of positive cells in the tumor versus pre-injection. FIG.10B is the PD-L1 expression on SW620 cells upon 24h incubation with either exemplary recombinant IFNγ, DOT cells or DOT cells and neutralizing αIFNγ antibody, measured by flow cytometry. Individual technical replicates are depicted. Data representative of two independent experiments. One-way ANOVA with Tukey’s post-hoc test. FIG.10C describes the geometric mean fluorescence intensity of PVR levels in exemplary PD-L1-negative (neg) and positive SW620 cells upon IFNγ or DOT cell exposure. Measured by flow cytometry and analyzed by paired t-test. FIG.10D describes the percentage of exemplary Granzyme B-expressing DOT cells after 24h incubation with plate- bound PVR and / or PD-L1 in the presence or not of αDNAM-1 / αCD96 blocking antibodies. One representative out of two independent experiments, analyzed by one-way ANOVA with Tukey’s post-hoc test. FIG.10E shows the increase in the percentage of SW620 tumor cell death, assessed by Annexin V flow cytometry staining, upon 3h in vitro incubation with exemplary DOT cells in the presence of blocking antibodies against different checkpoints in comparison with isotype controls. Each point represents a different DOT donor. One-sample t-test against hypothetical value =1. Pool of 11 different assays. FIG.10F depicts the increase in the percentage of primary tumor cell death (obtained from CD45-depleted CRCATTORNEY DOCKET NO.: MIL-049WO1 primary specimens), assessed by caspase 3 / 7 flow cytometry staining, upon 24h in vitro incubation with exemplary DOT cells in the presence of blocking antibodies against different checkpoints in comparison with isotype controls. Different symbols represent different patient-derived specimens. One-sample t-test against hypothetical value =1. Data pooled from three assays. FIG.10G is an exemplary schematic representation of the in vivo (intraperitoneal) administration of immune checkpoint blocking (or isotype control) antibodies concomitant with DOT-cell infusions (at days 7, 14 and 21 post tumor- inoculation) in the intercaecal SW620 model. FIG.10H depicts representative flow cytometry density plots of PD-1 and TIGIT expression in blood and exemplary tumor- infiltrating DOT cells (left) and quantification of TIGIT and PD-1 expression on tumor- infiltrating Vδ1+cells, at day 28 after tumor injection (right) upon in vivo checkpoint blockade (gated on alive human CD45+CD3+TCRVδ1+cells). FIG.10I is the exemplary flow cytometry quantification of CD107a, Granzyme B and TNFα in tumor-infiltrating DOT cells after checkpoint blockade therapy in vivo. FIG.10J shows intercaecal SW620 tumor growth upon exemplary DOT-cell treatment and checkpoint blockade, measured by luciferase signal using in vivo imaging (n=8-12). Data pooled from two independent experiments and analyzed by repeated measures two-way ANOVA with Tukey’s multiple comparisons test. Differences between the different groups on day 28 are indicated with asterisks. Data represented as means ± SEM. *P< 0.05, **P< 0.01, ***P< 0.001, ****P< 0.001.

[0047] FIG.11A-FIG.11B describes how IFNγ exposure upregulates exemplary PD-L1 and PVR levels on SW620 cells and PD-L1 and PVR inhibit DOT-cell cytotoxicity. FIG. 11A is an exemplary heatmap that shows the surface expression of different ligands with or without exposure to IFNγ for 24h. Columns correspond to replicated plate wells. The color scale represents the Z-score of the geometric mean of fluorescence intensity. One representative out of two independent experiments. FIG.11B shows exemplary Perforin and NKG2D levels after 24h incubation with plate-bound PVR and or PD-L1 in the presence or not of αDNAM-1 / αCD96 blocking antibodies. One representative out of two independent experiments, analyzed by one-way with Tukey’s post-hoc test. Data represented asmeans ± SEM. *P< 0.05, **P< 0.01, ****P< 0.001.

[0048] FIG.12A-FIG.12D describes how exemplary endogenous Vδ1+T cells exhibit a dysregulation of checkpoint and cytotoxic receptors in CRC tumors. FIG.12A is an exemplary t-SNE plot of Vδ1+cells isolated from blood and tumors from CRC patients and blood samples from healthy donors, considering the expression levels of NKR / NCR andATTORNEY DOCKET NO.: MIL-049WO1 inhibitory receptors measured by spectral flow cytometry. A stochastic pool of six samples per group was used. On the left, colors represent the nine clusters automatically identified after considering the parameters evaluated. The distribution of cells throughout the clusters according to their origin is depicted on the right. FIG.12B are the frequencies of the different clusters of Vδ1+cells among each group, each cluster is depicted with the same scheme as in FIG.12A. FIG.12C depict exemplary violin plots that show the normalized expression of each marker along the different clusters. FIG.12D is the exemplary quantification of expression and representative density plots of PD-1 / TIGIT and NKG2D / DNAM-1, represented as percentage of positive cells among alive Vδ1+cells. Data analyzed by one-way ANOVA with Tukey’s post hoc test. Representative of three independent experiments. Data represented as means ± SEM. *P< 0.05, **P< 0.01,0.001.

[0049] FIG.13 describes the exemplary receptor repertoire of endogenous Vδ1+T cells in CRC. Quantification of expression of different inhibitory and cytotoxic receptors in blood from healthy controls and blood and tumors from CRC patients, represented as percentage of positive cells among alive Vδ1+cells. Data analyzed by one-way ANOVA with Tukey’s post hoc test or Kruskal-Wallis with Dunn multiple comparisons test. Representative of three independent experiments. Data represented as means ± SEM. *P< 0.05, **P<0.001. DETAILED DESCRIPTION

[0050] The present disclosure relates to combination therapy and methods for enhancing immunotherapeutic efficacy of T cells, in particular, Vδ1+γδ T cells in the treatment of solid cancers. In accordance with the present disclosure, a number of combination strategies are provided to, in some aspects, synergistically increase anti-cancer function of Vδ1+γδ T cells that infiltrate tumor tissues. These combined therapies modulate tumor microenvironment (TME) that negatively impacts activation of Vδ1+γδ T cells, and / or increase targeting of Vδ1+γδ T cells to cancer cells.

[0051] Gamma delta (γδ) T cells are ‘unconventional’ T cells expressing γδ T cell receptor (TCR). Mature γδ T cells migrate to peripheral blood (PB) and mucosal tissues, including skin and gut mucosa, where they function as primary effectors in the response against infections and cancer, prior to responses of the αβ T cell lineage. One γδ T cell subtype that expresses Vδ1 TCR δ chain (i.e., Vδ1+γδ T cells) is one of the predominant γδ T cells in tissues. Vδ1+ γδ T cells recognize target cells and mediate anti-tumor activity throughATTORNEY DOCKET NO.: MIL-049WO1 the direct lysis of transformed cells. Vδ1+ γδ T cells have also been known to be a prevalent tumor infiltrating lymphocyte (TIL) population in cancer (e.g., colorectal cancer (CRC)).

[0052] Vδ1+γδ T cell based adoptive cell therapy (e.g., a DOT (Delta One T cell) product) is one cell therapy that has been previously described for use in treating hematological malignancies. However, a major hurdle for adoptive cell therapy for treating solid cancers is that tumor microenvironment (TME) can influence tumor-infiltrating lymphocytes (TILs) and negatively impact their ability to recognize and kill cancer cells after they infiltrate tumor tissues.

[0053] In at least one aspect, and without being bound by any theory, the inventors of the present disclosure found that Vδ1+γδ T cells (e.g., an in vitro expanded and differentiated Delta One T (DOT) cells) can target solid tumor cells, for example, colorectal cancer tumor (CRC) cells to control tumor growth. The results of the present disclosure are believed to provide evidence for a strong and broad activity of DOT cells against tested CRC cell lines, as well as multiple patient-derived CRC biopsies. Again, without being bound by any particular theory, the present disclosure further demonstrates that DOT cells targeting to cancer cells (e.g., CRC cells) is largely accounted to a natural killer cell receptor, NKG2D, on DOT cells, which interacts with NKG2D ligands expressed on cancer cells. Without being bound by theory, the inventors further confirmed that increasing NKG2D receptor on Vδ1+γδ T cells, and / or upregulating expression of NKG2D ligands (e.g., ligands ULBP-1,2,3 and 6) on CRC cancer cells, enhanced Vδ1+γδ T cells targeting to CRC cells.

[0054] In addition to discovery of contributions of NKG2D signaling pathway to anti- cancer activities of Vδ1+γδ T cells, the inventors of the present disclosure further found that the infused DOT cells in CRC xenograft model express increased levels of the immune checkpoints PD-1 and TIGIT, as compared to pre-infusion DOT cells. Again, without being bound by any particular theory, it is believed that the inhibitory signals from PD-1 and TIGIT compromise DOT cells’ ability to combat tumor cells. PD-1 and TIGIT blockade, in vitro and in vivo, can significantly increase cytotoxic function of DOT cells infused in tumors.

[0055] Based on those findings, the present disclosure unveils two strategies to maximize immunotherapeutic efficacy of Vδ1+γδ T cells. In one aspect, this strategy includes combining Vδ1+γδ T cells and one or more immune checkpoint inhibitors can significantly enhance cytotoxicity of δ1+γδ T cells. In at least another aspect, this strategy includes upregulating NKG2D ligands on cancer cells and / or NKG2D on Vδ1+γδ T cells increasesATTORNEY DOCKET NO.: MIL-049WO1 tumor cell specific targeting of Vδ1+γδ T cells. Furthermore, in certain aspects, it is contemplated that the two strategies can be used in combination as well.

[0056] In accordance, the present disclosure provides, among other things, combination therapy and methods of treating cancers with solid tumors using gamma delta (γδ) T cells, particularly Vδ1+γδ T cells, in combination with one or more immune checkpoint inhibitors.

[0057] The present disclosure also provides methods for increasing immunotherapeutic efficacy of Vδ1+γδ T cells based adoptive cell therapy. To increase targeting of Vδ1+γδ T cells to cancer cells, the NK-signaling pathway is activated. For example, Vδ1+γδ T cells are pre-treated to increase expression of a NK cell receptor, NKG2D. The patient in need of Vδ1+γδ T cells based adoptive cell therapy is conditioned to increase the expression of a NKG2D ligand on cancer cells. Definitions

[0058] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art.

[0059] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0060] Administer: As used herein, “administering” a composition to a subject means to give, apply or bring the composition into contact with the subject. Administration can be accomplished by any of a number of routes, such as, for example, topical, oral, subcutaneous, intramuscular, intraperitoneal, intravenous, intrathecal, and intradermal.

[0061] Allogeneic cell therapy: As used herein, the term “allogeneic cell therapy” refers to a type of cellular therapy that uses cells from a donor (e.g., a healthy person) to treat a patient. Cells from a single donor can be used to treat one or more patients. Donor cells (e.g., Vδ1+ γδ T cells isolated from a donor’s blood) can undergo extensive expansion and screening before establishing a master cell bank, which is the basis for generating allogeneic cell therapies. Cells from the donor can be modified (e.g., expressing a chimeric antigen receptor) or unmodified. The cells can be derived from multiple potential cell sources, including but not limited to donated tissues, umbilical cord blood, placenta, bone marrow, and induced pluripotent and embryonic stem cells. An advantage of allogeneic strategies, among other things, is “off-the-shelf” supply. For example, in urgent medical situations, allogeneic therapies utilize donor’s cells, allowing storage and immediate availability to treatATTORNEY DOCKET NO.: MIL-049WO1 multiple patients. Exemplary allogeneic cell therapies include chimeric antigen receptor (CAR) T cell therapy. Allogeneic CAR-T cell therapy involves engineering T cells from a donor to express chimeric receptors that target cancer cells which are then infused into patients. In the context of the present disclosure, the Vδ1+ γδ T cells or CAR expressing Vδ1+ γδ T cells described herein are used for allogeneic cell therapy.

[0062] Antibody: as used herein, the term “antibody,” refers to an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. The term is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen- binding) antibody fragments, including fragment antigen binding (Fab) fragments, F(ab′)2fragments, Fab′ fragments, Fv fragments, recombinant IgG (rIgG) fragments, single chain antibody fragments, including single chain variable fragments (scFv), diabodies, and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific (e.g., bispecific) antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, tandem tri-scFv. Unless otherwise stated, the term “antibody” should be understood to encompass functional antibody fragments thereof. The term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD.

[0063] Cancer: As used herein, the term “cancer” refers to a disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described herein and include but are not limited to, leukemia, lymphoma, multiple myeloma, ovarian cancer, breast cancer, endometrial cancer, colon cancer (colorectal cancer), rectal cancer, bladder cancer, urothelial cancer, lung cancer (non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung), bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, gastric cancer, hepatocellular carcinoma, gall bladder cancer, bile duct cancer, esophageal cancer, renal cell carcinoma, thyroid cancer, squamous cell carcinoma of the head and neck (head and neck cancer), testicular cancer, cancer of the endocrine gland, cancer of the adrenal gland, cancer of the pituitary gland, cancer of the skin, cancer of soft tissues, cancer of blood vessels, cancer of brain, cancer of nerves, cancer of eyes, cancer of meninges, cancer of oropharynx, cancer of hypopharynx,ATTORNEY DOCKET NO.: MIL-049WO1 cancer of cervix, and cancer of uterus, glioblastoma, meduloblastoma, astrocytoma, glioma, meningioma, gastrinoma, neuroblastoma, melanoma, myelodysplastic syndrome, and a sarcoma and the like.

[0001] Chimeric Antigen Receptor (CAR): As used herein, the term “chimeric antigen receptor” or “CAR” means a protein that when expressed on the surface of a cell allows a CAR expressing cell to recognize its specific protein (antigen), such as on tumor cells, infected cells or cells mediating autoimmune or inflammatory diseases or disorders. Such receptors are also known as chimeric T cell receptors, chimeric immunoreceptors, or artificial T cell receptors. Upon transduction of a cell with a nucleic acid construct encoding a CAR, the cell will recognize the antigen specified by the CAR. A CAR is typically comprised of an ectodomain (extracellular domain) and an endodomain (cytoplasmic domain), separated by a transmembrane domain. The ectodomain, expressed on the surface of the cell, comprises an antigen binding domain or receptor domain, optionally a signal peptide that directs the antigen binding domain into the endoplasmic reticulum for processing, and optionally a spacer (or hinge) region. The antigen binding domain (or receptor domain) comprises peptides that specifically recognize a target antigen. As a non-limiting example, the antigen binding domain can be a single chain antibody, such as an scFv. The spacer region links the antigen binding domain to the transmembrane domain and is designed to be sufficiently flexible to allow the antigen binding domain to orient in a manner that allows antigen recognition. Examples of spacer domains include, but are not limited to, the hinge region from IgG, the CH2CH3region of an immunoglobulin, CD28 hinge, Dap10 hinge, CD8 hinge, and portions of CD3 molecules. The transmembrane domain is a hydrophobic alpha helix, typically, that spans across the lipid bilayer of the cell membrane. The endodomain of the CAR is composed of a signal transmitting peptide that transmits an activation signal intracellularly to the cell cytoplasm, thereby stimulating the cell expressing the CAR. The endodomain may include multiple such signaling domains, as explained, infra. In some embodiments, a CAR comprises at least an extracellular antigen binding domain, a transmembrane domain and a cytoplasmic signaling domain (also referred to herein as “an intracellular signaling domain”) comprising a functional signaling domain derived from a stimulatory molecule and / or costimulatory molecule as defined below. In some aspects, the set of polypeptides encoding the CAR are contiguous with each other. In some embodiments, the set of polypeptides include a dimerization switch that, upon the presence of a dimerization molecule, can couple the polypeptides to one another, e.g., can couple an antigen binding domain to an intracellular signaling domain. In one aspect, the stimulatoryATTORNEY DOCKET NO.: MIL-049WO1 molecule is the zeta chain associated with the T cell receptor complex. In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule as defined below. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a costimulatory molecule and a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising two functional signaling domains derived from one or more costimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. In one aspect the CAR comprises an optional leader sequence at the amino-terminus (N-ter) of the CAR fusion protein. In one aspect, the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen binding domain, wherein the leader sequence is optionally cleaved from the antigen binding domain (e.g., an scFv) during cellular processing and localization of the CAR to the cellular membrane.

[0064] Co-administration: As used herein, the term "co-administration" refers to administration of two or more agents (e.g., a combination described herein and / or another active agent such as an anti-cancer agent). The timing of coadministration depends in part of the combination and compositions administered and can include administration at the same time, just prior to, or just after the administration of one or more additional therapies, for example cancer therapies such as chemotherapy, hormonal therapy, radiotherapy, or immunotherapy. Coadministration is meant to include simultaneous or sequential administration of the composition individually or in combination (more than one composition). Thus, the preparations can also be combined, when desired, with other active substances (e.g., to reduce metabolic degradation). The compositions described herein can be used in combination with one another, with other active agents known to be useful in treating a solid cancer.

[0065] Enhance: As used herein, the term "enhance" refers to an increase or improvement in the function or activity of a cell after administration or contacting with a combination described herein compared to the cell prior to such administration or contact.ATTORNEY DOCKET NO.: MIL-049WO1

[0066] Gamma delta (γδ) T cells: Gamma delta (γδ) T cells refer to a subset of T cells that express their surface a distinct and defining T cell receptor (TCR). This TCR is composed of one gamma chain (γ) and one delta (δ) chain. The heterodimer γδ TCR can recognize antigens. γδ T cells can display a pre-activated and memory phenotype and the high frequency of these cells enables rapid responses without the presence of cognate TCR agonists and / or cellular expansion. γδ T cells are mainly from peripheral blood and non-blood tissues such as the skin with a restricted TCR repertoire. In humans, γδ T cells are classified according to their Vδ gene segment used. Three Vδ genes Vδ1-3; and seven functional Vγ gene segments: Vγ2-5, Vγ8, Vγ9, and Vγ11, exist in human γδ T cells. The γδ TCR repertoire is also associated with the tissue distribution. For example, Vδ1+T cells are abundant in the epithelium in human. In humans and non-human primates, γδ T cells bearing the Vδ2 chain are the main subset present in peripheral blood and this δ chain is generally associated to the Vγ9. Like αβ T lymphocytes, the activation of γδ T cells through the TCR requires the participation of accessory molecules. CD27 and NKG2D have been identified as co-effectors of the TCR activation.

[0067] Immune checkpoint: As used herein, the term “immune checkpoint” refers to ligand-receptor pairs that exert inhibitory or stimulatory effects on the immune response. Such checkpoint proteins have been described to be expressed on cells of the adaptive immune system, specifically on T cells, and of the innate immune system. These checkpoint molecules are critical for self-tolerance and modulation of the length and magnitude of immune responses of effectors in various tissue types. These proteins have become attractive targets for cancer immunotherapies. Examples of immune checkpoint molecules include, but are not limited to PD-1, B7-H3, B7-H4, CTLA-4, LILRB1, LILRB2, TIM3, CD47, CD137, CD70, and TIGIT.

[0068] Immunotherapy: As used herein, the term “immunotherapy” refers to the prevention or treatment of disease, such as infection or cancer, with substances that stimulate or suppress the immune response. Examples of cancer-specific immunotherapies include, but are not limited to, monoclonal antibodies, checkpoint inhibitors (e.g., pembrolizumab [Keytruda] and ipilimumab [Yervoy]), cytokines (e.g., type I interferons (INF), tumor necrosis factors [TNF], interleukins [IL]), and chimeric antigen receptor (CAR) T cell therapy.

[0069] In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.ATTORNEY DOCKET NO.: MIL-049WO1

[0070] In vivo: As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. In the context of cell- based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).

[0071] Solid tumor: As used herein, a “solid tumor” is any cancer of body tissue other than blood, bone marrow, or the lymphatic system. Solid tumors can be further divided into those of epithelial cell origin and those of non-epithelial cell origin. Examples of epithelial cell solid tumors include tumors of the gastrointestinal tract, colon, breast, prostate, lung, kidney, liver, pancreas, ovary, head and neck, oral cavity, stomach, duodenum, small intestine, large intestine, anus, gall bladder, labium, nasopharynx, skin, uterus, male genital organ, urinary organs, bladder, and skin. Solid tumors of non-epithelial origin include sarcomas, brain tumors, and bone tumors.

[0072] Subject: As used herein, the terms “subject” and “patient” are used interchangeably. A subject refers to an individual suffering from a disease or disorder, for example, cancer, solid tumor, infectious disease or inflammatory disease.

[0073] Treatment: As used herein, the terms “treatment,” “treat,” “therapy” and synonyms thereof refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) a disease, for example cancer. Those in need of such treatment include those already with a disease as well as those prone to getting the disease or those in whom a disease is to be prevented. γδ T cells and Cell Therapy

[0074] In accordance, combination therapy described herein comprises gamma delta (γδ) T cells, for example, Vδ1+ γδ T cells. Vδ1+ Gamma delta (γδ) T cells

[0075] Gamma delta (γδ) T cells are lymphoid cells expressing γδ T cell receptor (TCR). These cells then migrate to peripheral blood (PB) and mucosal tissues, including skin and gut mucosa, where they function as primary effectors in the response against infections and cancer, prior to responses of the αβ T cell lineage. Among the four subtypes of human γδ T cells defined by the TCR δ chain, Vδ1+ γδ T cells is one of the two subtypes that are the most predominant. Vδ1+γδ T cells, for example, recognize target cells and mediate anti-tumor activity through the direct lysis of transformed cells. Vδ1+γδ T cells have been known to be the dominant tumor-infiltrating γδ T cell population in several cancers including colorectalATTORNEY DOCKET NO.: MIL-049WO1 cancer (CRC). Some of tumor-infiltrating γδ T cells comprise activating NK cell receptors (NKR) like NKp46 and NKG2D, as well as cytotoxic (Granzyme B, Perforin) and proliferation (Ki67) markers, indicating that NKR-expressing Vδ1+γδ T cells are important anti-tumor effectors in CRC.

[0076] In some embodiments, the γδ T cells described herein are Vδ1+γδ T cells.

[0077] In some embodiments, the Vδ1+γδ T cells used in the methods described herein are Vδ1+γδ T cells expressing activating NK cell receptors (NKR). In some embodiments, Vδ1+γδ T cells express a high level of NKp46 (NKp46+ Vδ1+γδ T cells). In some embodiments, δ1+γδ T cells express a high level of NKG2D (NKG2D Vδ1+γδ T cells). In some embodiments, Vδ1+γδ T cells express high levels of NKp46 and NKG2D (NKp46+ NKG2D+ Vδ1+γδ T cells).

[0078] In some embodiments, the Vδ1+γδ T cells described here are human Vδ1+γδ T cells.

[0079] In some embodiments, the Vδ1+γδ T cells described here are tissue-resident Vδ1+γδ T cells, for example, skin derived Vδ1+ γδ T cells.

[0080] In some embodiments, the Vδ1+γδ T cells described herein are primary Vδ1+γδ T cells.

[0081] In some embodiments, the Vδ1+γδ T cells described here are derived from blood (e.g., peripheral blood mononuclear cells), for example, blood-derived Vδ1+ γδ T cells.

[0082] In some embodiments, the Vδ1+γδ T cells described herein are a cell preparation from an in vitro expansion and differentiation of γδ T cells.

[0083] In some embodiments, the Vδ1+ γδ T cells described here are further engineered, for example, modified to express a chimeric antigen receptor (CAR). The CAR comprises an extracellular antigen binding domain, a hinge region, a transmembrane, at least one co- stimulatory domain and an intracellular activation domain.

[0084] In some embodiments, the extracellular antigen binding domain recognizes and binds to a tumor associated antigen (TAA). The antigen binding domain is an antibody or antigen binding fragment thereof, a Fab fragment, a F(ab′)2fragment, a Fv fragment, a single chain variable fragment (scFv), a single domain antibody, VHH, a diabody, a nanobody, a bispecific binding agent, or a multiple specific binding agent. In one embodiment, the antigen binding domain is a scFv.

[0085] In some embodiments, the hinge domain comprises a hinge region derived from IgG, CD28, CD8α, CD4, or variant thereof. In some embodiments, the transmembrane regionATTORNEY DOCKET NO.: MIL-049WO1 is derived from a transmembrane region of CD28, CD8α, CD16, CD27, DAP10, DAP12, NKG2D, CD 16, NKp44, NKp46, NKp30, NKp80, DNAM-1, CD3 zeta, CD3 epsilon, CD3 gamma, CD3 delta, CD45, CD4, CD5, CD9, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, ICOS / CD278, GITR / CD357, or variant thereof. In some embodiments, the costimulatory domain is a signaling region of CD28, OX-40, 4- 1BB / CD137, CD2, CD7, CD27, CD30, CD40, CD3 gamma, CD3 delta, CD3 epsilon, CD247, CD276 (B7-H3), DAP10, DAP 12, LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), NKG2C, Ig alpha (CD79a), Fc gamma receptor, MHC class I molecule, TNF receptor proteins, Immunoglobulin-like proteins, or variants thereof.

[0086] In some embodiments, the CAR is an attenuated CAR. The attenuated CAR does not comprise a CD3ζ intracellular signaling / activation domain. Culturing and Expansion of Vδ1+γδ T cells

[0087] In some embodiments, Vδ1+γδ T cells can be obtained using any methods known in the art.

[0088] In some embodiments, the Vδ1+γδ T cells described here are prepared using a Vδ1+γδ T cell-biased expansion protocol with the differentiation of cytotoxic effector cells expressing high levels of NKRs (e.g., NKp46 and NKG2D) (Almeida et al., Clin Cancer, 2016, 22, 5795-5804; and Correia et al., Blood, 2011, 118, 992-1001; the contents of each of which are incorporated herein by reference in their entirety).

[0089] In some embodiments, Vδ1+γδ T cells are from ex vitro expansion of Vδ1+T cells from healthy donors, for example, isolated peripheral blood Vδ1+γδ T cells. In some embodiments, the Vδ1+γδ T cells from healthy donors are expanded and screened to establish a master cell bank (MCB), which is the basis for allogeneic cell therapy. For example, the Vδ1+ γδ T cells described are “off-the-shelf” supplies for treating multiple patients.

[0090] In some embodiments, Vδ1+γδ T cells are isolated and expanded and differentiated from peripheral blood mononuclear cells (PBMCs). For example, these cells that are expanded and differentiated from PBMCs can be described herein as blood-derived Vδ1+γδ T cells.

[0091] In other embodiments, Vδ1+γδ T cells are isolated and expanded from non- hematopoietic tissues. The isolated non-hematopoeitic tissues are cultured in the presence of one or more cytokines selected from interleukin-2 (IL-2), interleukin-15 (IL-15), interleukin-4 (IL-4), interleukin-7 (IL-7), interleukin-21 (IL-21) and combinations thereof.ATTORNEY DOCKET NO.: MIL-049WO1

[0092] In some embodiments, Vδ1+γδ T cells are produced using a 2-step culture method described in US Patent No. US11166983; the contents of which are incorporated herein by reference in their entirety.

[0093] In some embodiments, Vδ1+ γδ T cells are obtained from a cell preparation sample by a method comprising culturing the sample in a medium comprising a T cell mitogen and a growth factor having interleukin-4-like activity, in the absence of a growth factor having interleukin-15-like activity. In some examples, the growth factor having interleukin-4-like activity is interleukin-4 (IL-4).

[0094] In other embodiments, Vδ1+ γδ T cells are obtained from a cell preparation sample by a method comprising culturing the sample in a medium comprising a T cell mitogen and a growth factor having interleukin-15-like activity, in the absence of a growth factor having interleukin-4-like activity. In some examples, the growth factor having interleukin-15-like activity is either interleukin-15 (IL-15), interleukin-2 (IL-2), or interleukin-7 (IL-7). As a non-limiting example, the growth factor having interleukin-15-like activity is IL-15.

[0095] In yet other embodiments, Vδ1+ γδ T cells are obtained from a cell preparation sample by a method comprising: (1) culturing cells in the sample in a first culture medium comprising a T cell mitogen and a growth factor having interleukin-4-like activity; in the absence of a growth factor having interleukin-15-like activity; and (2) culturing the cells obtained in step (1) in a second culture medium comprising a T cell mitogen and a growth factor having interleukin-15-like activity, in the absence of a growth factor having interleukin-4- like activity. In some examples, the growth factor having interleukin-4-like activity is interleukin-4 (IL-4) and the growth factor having interleukin-15-like activity is either interleukin-15 (IL-15), interleukin-2 (IL-2), or interleukin-7 (IL-7). As a non-limiting example, the growth factors are IL-4 and IL-15.

[0096] In some embodiments, the cell preparation sample from each method described herein comprises at least 50% to 100% Vδ1+ γδ T cells, over 60%, 70%, 80%, 90%, 95%, or 100% Vδ1+ γδ T cells. Adoptive Cell Therapy

[0097] In accordance with the present disclosure, Vδ1+ γδ T cells are used for adoptive cell therapy. Adoptive cell therapy is a type of immunotherapy in which T cells are given to a patient to help the immune system fight diseases such as cancers. T cells for adoptive cell therapy can be isolated from the blood and / or tissues of the patient to be treated, grown inATTORNEY DOCKET NO.: MIL-049WO1 vitro a large number and optionally modified to enhance targeting of cancers, then reintroduced at therapeutically effective doses into the patient. T cells engineered to express a CAR (CAR-T) or a TCR, and tumor infiltrating lymphocyte (TIL) therapies fall under the umbrella of adoptive T cell therapy. Reintroduction of these T cells into a subject in need thereof is critical for augmenting the immune response against cancer. In accordance with the present disclosure, as part of combination therapy described herein, the Vδ1+ γδ T cells are used for adoptive cell therapy.

[0098] In some embodiments, the Vδ1+ γδ T cells are administrated at a dose of 105to 1012cells.

[0099] In some embodiments, Vδ1+ γδ T cells are derived from a donor and prepared for allogeneic cell therapy for treating one or more patients. Immune Checkpoint Inhibitors

[0100] In some embodiments, the method describe herein relates to combinational treatment of a patient having solid cancer who receives Vδ1+ γδ T cell therapy with one or more immune checkpoint inhibitors (i.e., immune checkpoint blockade (ICB)).

[0101] Immune checkpoint blockade therapy is another type of immunotherapy that is used for the treatment of a multitude of cancers. Immune checkpoint blockade (ICB) utilizes immunomodulator molecules such as agonists, adjuvants, cytokines, or immune checkpoint inhibitors (e.g., blocking antibodies) to modulate the immune response such that cancer cells cannot evade detection and subsequent destruction.

[0102] The immune checkpoints that have been targeted for immunotherapy include but are not limited to lymphocyte activation gene-3 (LAG-3), cytotoxic T lymphocyte antigen 4 (CTLA-4), V-domain Ig suppressor of T cell activation (VISTA), T cell immunoglobulin and mucin-domain containing-3 (TIM-3), programmed cell death 1 (PD-1) and T cell immunoglobulin and immunoreceptor tyrosine-based inhibitory motif domain (TIGIT).

[0103] In some embodiments, the immune checkpoint blockage for combination therapy with Vδ1+ γδ T cells targets PD-1 and / or TIGIT.

[0104] In some embodiments, the combination therapy described herein comprises Vδ1+ γδ T cells and an immune checkpoint blockage targeting PD-1.

[0105] In some embodiments, the method comprises combination treatment of Vδ1+ γδ T cell therapy and an immune checkpoint blockade (ICB) targeting PD-1. ICB targeting PD-1 is the best established immunotherapy for solid cancers, e.g., having revolutionized theATTORNEY DOCKET NO.: MIL-049WO1 treatment of advanced melanoma and lung carcinoma. The immune checkpoint blockage targeting PD-1 is a PD-1 inhibitor, a PD-L1 inhibitor, and / or PD-L2 inhibitor.

[0106] In some embodiments, the immune checkpoint inhibitor is a PD-1 inhibitor. As used herein, the term "PD- 1 inhibitor" refers to a moiety (e.g., compound, nucleic acid, polypeptide, antibody) that decreases, inhibits, blocks, abrogates or interferes with the activity or expression of PD- 1 (e.g., Programmed Cell Death Protein 1; PD-1 / CD279), including variants, isoforms, species homologs of human PD-1 (e.g., mouse) and analogs that have at least one common epitope with PD- 1. A PD- 1 inhibitor includes molecules and macromolecules such as, for example, compounds, nucleic acids, polypeptides, antibodies, peptibodies, diabodies, minibodies, single-chain variable fragments (ScFv), and fragments or variants thereof. Thus, a PD- 1 inhibitor as used herein refers to any moiety that antagonizes PD-1 activity or expression. PD-1 inhibitor efficacy can be measured, for example, by its inhibitor concentration at 50% (half- maximal inhibitor concentration or IC50). PD- 1 inhibitors include exemplary compounds and compositions described herein.

[0107] In some embodiments, the PD-1 / PD-L1 checkpoint inhibitor is a PD-1 blocking antibody, or a PD-L1 bocking antibody. A PD-1 blocking antibody refers to a PD- 1 inhibitor which is a monoclonal antibody, or a variant thereof.

[0108] In some embodiments, the PD1 checkpoint inhibitor is a PD-1 blocking antibody such as Nivolumab, Pembrolizumab, Camrelizumab (SHR-1210), Cemiplimab, Dostarlimab, Retifanlimab, Toripalimab, and Pidilizumab.

[0109] Additional PD-1 inhibitors include but are not limited to, CD011, Vopratelimab (JTX-4014), Spartalizumab (PDR001), Sintilimab (IBI308), Tislelizumab (BGB-A317), INCMGA00012 (MGA012), AMP-514 (MEDI0680), and Acrixolimab (YBL-006).

[0110] In some embodiments, the PD1 checkpoint inhibitor is a PD-L1 blocking antibody such as Atezolizumab, Avelumab, Durvalumab, BMS 936559, MPDL 3280A, MDX-1105 and Medi 4736. Atezolizumab is a fully humanized IgG1 monoclonal antibody against PD- L1. Avelumab and Durvalumab are full human IgG1 antibodies against PD-L1. BMS 936559 is a fully human IgG4 monoclonal antibody that targets the PD-1 ligand PD-L1. MPDL 3280A is a monoclonal antibody, which also targets PD-L1. Medi 4736 is an anti-PD- L1 antibody.

[0111] Additional PD-L1 inhibitors include but are not limited to, KN035, Cosibelimab (CK-301), AUNP12 (a 29-mer peptide / peptic PD-1 / PD-L1 inhibitor).ATTORNEY DOCKET NO.: MIL-049WO1

[0112] Other PD-1 / PD-L1 pathway inhibitors may include AMP-224 which is a fusion protein of the extracellular domain of the second PD-1 ligand, PD-L2, and IgG1, which has the potential to block the PD-L2 / PD-1 interaction.

[0113] The terms of PD-1 inhibitors described herein are used in accordance with their plain and ordinary meaning as understood in the art.

[0114] In some embodiments, the immune checkpoint blockage targets TIGIT. The immune checkpoint inhibitor is a TIGIT inhibitor.

[0115] In some embodiments, The TIGIT inhibitor is a TIGIT blocking antibody, such as Vibostolimab, Etigilimab, Tiragolumab, Domvanalimab, Ociperlimab, M6223, EOS-448, BMS-986207, BAT6021, PM1021, ASP8374, COM902, IBI939, JS006, SEA-TGT, and AB308.

[0116] Other anti-TIGIT antibodies include but are not limited to AU2016325610B2, US11439705B2, US20220251195A1, JP7487256B2, US11401339B2, the contents of which are incorporated herein by reference in their entireties.

[0117] In some embodiments, the checkpoint inhibitor is a bispecific antibody against PD-1 and TIGIT. The bispecific antibody against PD-1 and TIGIT can target, bind to and inhibit both PD-1 and TIGIT activities simultaneously. Exemplary bispecific antibodies against PD-1 and TIGIT include but are not limited to, IBI321, AZD2936, HLX301, and HB0036.

[0118] In some embodiments, the method described herein comprises combining Vδ1+ γδ T cell therapy with a PD-1 inhibitor and a TIGIT inhibitor.

[0119] In accordance, the present disclosure also provides a method for increasing cytotoxicity of Vδ1+γδ T cells comprising treating the Vδ1+γδ T cells with at least one immune checkpoint inhibitor. The Vδ1+γδ T cells can be treated before administering cells to a subject in need thereof. Enhancement of T Cell Targeting to Tumor Cells

[0120] In one aspect, the method for treating a solid cancer described herein comprises increasing targeting of Vδ1+ γδ T cells to cancer cells by upregulating NKG2D signaling pathway. Increasing NKG2D on T cells

[0121] In some embodiments, the method described herein comprises increasing NK receptor function on Vδ1+ γδ T cells or increasing Vδ1+ γδ T cells that express a NKATTORNEY DOCKET NO.: MIL-049WO1 receptor. In particular, the method described herein comprises increasing NKG2D function on Vδ1+ γδ T cells or increasing Vδ1+ γδ T cells that express a NKG2D. Any methods known to activate a protein expression in a cell (e.g., NKG2D) can be used to increase NKG2D expression level on T cells. In other embodiments, any methods or molecules that can increase NKG2D activity on T cells can be used.

[0122] In some embodiments, the Vδ1+ γδ T cells described herein are pretreated to increase NKG2D expression. The Vδ1+ γδ T cells are pretreated with butyrate, a salt thereof, or a probutyrate. Upregulating expression of NKG2D ligands on tumor cells

[0123] In some embodiments, the method described here further comprising upregulating the expression of a NKG2D ligand on tumor cells.

[0124] NKG2D ligands are completely absent, or present only at low levels, on the surfaces of normal cells, but they are overexpressed by infected, transformed, senescent or stressed cells. NKG2D ligands, and particularly those which are not expressed on normal cells, include the histocompatibility 60 (H60) molecule, the product of the retinoic acid early inducible gene-1 (RAE-1), ULBP-1, ULBP-2, ULBP-3, ULBP-6, and the murine UL16- binding protein-like transcript 1 (MULT1).

[0125] In some embodiments, the method described herein comprises upregulating the expression of ULBP-1, ULBP-2, ULBP-3, ULBP-6, H60, RAE-1 and / or MULT1 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-1 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-2 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-3 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-6 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-1 and ULBP-2 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-1 and ULBP-3 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-1 and ULBP-6 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-3 and ULBP-2 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-6 and ULBP-2 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-3 and ULBP-6 on tumor cells. In one embodiment, theATTORNEY DOCKET NO.: MIL-049WO1 method described herein comprises upregulating the expression of ULBP-1. ULBP-2 and ULBP-3 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-1. ULBP-2 and ULBP-6 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-6. ULBP-2 and ULBP-3 on tumor cells. In one embodiment, the method described herein comprises upregulating the expression of ULBP-1. ULBP-2, ULBP-3 and ULBP-6 on tumor cells.

[0126] A patient having a cancer may be conditioned for the treatment of adoptive cell therapy (e.g., Vδ1+ γδ T cell therapy) through upregulating the expression of a NKG2D ligand on cancer cells prior to receiving cell therapy. In some embodiments, the present disclosure provides a method for conditioning a subject who receives T cell therapy (e.g., Vδ1+ γδ T cell therapy); the method comprises upregulating expression of a NKG2D ligand on the tumor of the subject before administering to the subject the T cell therapy.

[0127] In some embodiments, the subject receives butyrate, a salt thereof (e.g., sodium butyrate), or a probutyrate, for upregulating the NKG2D ligand expression. In some embodiments, the patient is pretreated to upregulate the expression of a NKG2D ligand on tumor cells at least one day before receiving adoptive T cell therapy. In some embodiments, the patient is conditioned at least 2 days, 3 days, 4 days, 5 days, 6 days, a week, two weeks or a month before receiving adoptive T cell therapy.

[0128] In some embodiments, the patient takes butyrate, a salt thereof (e.g., sodium butyrate, and calcium / magnesium butyrate), or a probutyrate as diet supplement daily before receiving adoptive cell therapy.

[0129] Exemplary types of butyrate include butyric (or butanoic) acid, ethyl butyrate, sodium butyrate, calcium butyrate, magnesium butyrate, clostridium butyricum, and Seryl- butyrate, a probutyrate.

[0130] In one embodiment, the subject is conditioned with sodium butyrate.

[0131] In another embodiment, the subject is conditioned with clostridium butyricum.

[0132] In some embodiments, the subject is conditioned to increase butyratic levels in the serum.

[0133] In some embodiments, the amount of butyrate that is administered to a subject in need thereof is between 25nm – 150mM, (e.g., between 30 – 150 nM), (e.g., between 1mM – 150 mM), (e.g., about 100mM). In some embodiments a subject in need thereof receives a dose of about: 25nM, 30nM, 35nM, 40nM, 45nM, 50nM, 55nM, 60nM, 65nM, 70nM, 75nM, 80nM, 85nM, 90nM, 95nM, 100nM, 105nM, 110nM, 115nM, 120nM, 125nM, 130nM,ATTORNEY DOCKET NO.: MIL-049WO1 135nM, 140nM, 145nM, or 150nM of butyrate. In some embodiments a subject in need thereof receives a dose of about: 1mM, 5mM, 10mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM, 55mM, 60mM, 65mM, 70mM, 75mM, 80mM, 85mM, 90mM, 95mM, 100mM, 105mM, 110mM, 115mM, 120mM, 125mM, 130mM, 135mM, 140mM, 145mM or 150mM of butyrate.

[0134] In some embodiments, upregulating the expression of a NKG2D ligand is achieved according to methods described in Fuertes et al.(Front Immunol., 2021, 12, 713158; the contents of which are incorporated herein by reference in their entirety.) Combination Therapy and Methods thereof

[0135] As described herein, the present invention is directed to a combination therapy for the treatment of solid cancers. The combination therapy comprises administering to a subject in need thereof Vδ1+γδ T cells in combination with a second therapy that synergistically enhance anti-cancer efficacy of Vδ1+γδ T cells based adoptive cell therapy. The combination therapy exhibits a synergistic effect as compared to the effect of administering the individual agents separately. In particular, the combination therapy enhances cytotoxicity of Vδ1+γδ T cells that infiltrate tumor tissues and / or increases targeting of Vδ1+γδ T cells to cancer cells.

[0136] The subject has or is diagnosed with a cancer, particularly a solid cancer. Solid tumors are heterotypic aggregates of many cell types, including cancer cells, cancer stem cells, connective-tissue cells, and immune cells. A solid tumor is a malignant tumor, a pre- malignant tumor, or a benign tumor. Solid malignant tumors include “in situ” invasive and metastatic carcinoma (e.g., adenocarcinoma, basal cell carcinoma, squamous cell carcinoma, transitional cell carcinoma, and ductal carcinoma), and sarcoma and undifferentiated tumors (e.g., tumors beginning from bone, cartilage, fat, muscle, or blood vessels (angiosarcoma, bone sarcoma, fibroblastic sarcoma, and rhabdomyosarcomas)). The solid tumors include a colon cancer, a lung cancer, a skin cancer, a brain cancer, a breast cancer, a prostate cancer, a neuroblastoma, osteosarcoma, sarcoma, a germ cell tumor, carcinoma, retinoblastoma, a carcinoid tumor, a kidney tumor, a liver tumor, lymphoma, rhabdomyosarcoma, a bone tumor, thyroid carcinoma, a benign tumor, or a precancerous condition.

[0137] Examples of cancers include, but are not limited to, carcinoma, lymphoma, glioblastoma, melanoma, sarcoma, and leukemia, myeloma, or lymphoid malignancies. More particular examples of such cancers are noted below and include: squamous cell cancer (e.g., epithelial squamous cell cancer), Ewing sarcoma, Wilms tumor, astrocytomas, glioblastomas,ATTORNEY DOCKET NO.: MIL-049WO1 lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma multiforme, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, hepatocellular carcinoma, neuroendocrine tumors, medullary thyroid cancer, differentiated thyroid carcinoma, breast cancer, ovarian cancer, colon cancer, rectal cancer, endometrial cancer or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulvar cancer, anal carcinoma, penile carcinoma, as well as head-and-neck cancer. The term “cancer” includes primary malignant cells or tumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors (e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).

[0138] Other examples of cancers or malignancies include, but are not limited to: Acute Childhood Lymphoblastic Leukemia, Acute Lymphoblastic Leukemia, Acute Lymphocytic Leukemia, Acute Myeloid Leukemia, Adrenocortical Carcinoma, Adult (Primary) Hepatocellular Cancer, Adult (Primary) Liver Cancer, Adult Acute Lymphocytic Leukemia, Adult Acute Myeloid Leukemia, Adult Hodgkin's Lymphoma, Adult Lymphocytic Leukemia, Adult Non-Hodgkin's Lymphoma, Adult Primary Liver Cancer, Adult Soft Tissue Sarcoma, AIDS-Related Lymphoma, AIDS-Related Malignancies, Anal Cancer, Astrocytoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Brain Stem Glioma, Brain Tumors, Breast Cancer, Cancer of the Renal Pelvis and Ureter, Central Nervous System (Primary) Lymphoma, Central Nervous System Lymphoma, Cerebellar Astrocytoma, Cerebral Astrocytoma, Cervical Cancer, Childhood (Primary) Hepatocellular Cancer, Childhood (Primary) Liver Cancer, Childhood Acute Lymphoblastic Leukemia, Childhood Acute Myeloid Leukemia, Childhood Brain Stem Glioma, Childhood Cerebellar Astrocytoma, Childhood Cerebral Astrocytoma, Childhood Extracranial Germ Cell Tumors, Childhood Hodgkin's Disease, Childhood Hodgkin's Lymphoma, Childhood Hypothalamic and Visual Pathway Glioma, Childhood Lymphoblastic Leukemia, Childhood Medulloblastoma, Childhood Non-Hodgkin's Lymphoma, Childhood Pineal and Supratentorial Primitive Neuroectodermal Tumors, Childhood Primary Liver Cancer, Childhood Rhabdomyosarcoma, Childhood Soft Tissue Sarcoma, Childhood Visual Pathway and Hypothalamic Glioma, Chronic Lymphocytic Leukemia, Chronic Myelogenous Leukemia, Colon Cancer, Cutaneous T-Cell Lymphoma, Endocrine Pancreas Islet Cell Carcinoma, Endometrial Cancer, Ependymoma, Epithelial Cancer, Esophageal Cancer,ATTORNEY DOCKET NO.: MIL-049WO1 Ewing's Sarcoma and Related Tumors, Exocrine Pancreatic Cancer, Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Extrahepatic Bile Duct Cancer, Eye Cancer, Female Breast Cancer, Gaucher's Disease, Gallbladder Cancer, Gastric Cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Tumors, Germ Cell Tumors, Gestational Trophoblastic Tumor, Hairy Cell Leukemia, Head and Neck Cancer, Hepatocellular Cancer, Hodgkin's Lymphoma, Hypergammaglobulinemia, Hypopharyngeal Cancer, Intestinal Cancers, Intraocular Melanoma, Islet Cell Carcinoma, Islet Cell Pancreatic Cancer, Kaposi's Sarcoma, Kidney Cancer, Laryngeal Cancer, Lip and Oral Cavity Cancer, Liver Cancer, Lung Cancer, Lymphoproliferative Disorders, Macroglobulinemia, Male Breast Cancer, Malignant Mesothelioma, Malignant Thymoma, Medulloblastoma, Melanoma, Mesothelioma, Metastatic Occult Primary Squamous Neck Cancer, Metastatic Primary Squamous Neck Cancer, Metastatic Squamous Neck Cancer, Multiple Myeloma, Multiple Myeloma / Plasma Cell Neoplasm, Myelodysplastic Syndrome, Myelogenous Leukemia, Myeloid Leukemia, Myeloproliferative Disorders, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Hodgkin's Lymphoma, Nonmelanoma Skin Cancer, Non-Small Cell Lung Cancer, Occult Primary Metastatic Squamous Neck Cancer, Oropharyngeal Cancer, Osteo- / Malignant Fibrous Sarcoma, Osteosarcoma / Malignant Fibrous Histiocytoma, Osteosarcoma / Malignant Fibrous Histiocytoma of Bone, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential Tumor, Pancreatic Cancer, Paraproteinemias, Polycythemia vera, Parathyroid Cancer, Penile Cancer, Pheochromocytoma, Pituitary Tumor, Primary Central Nervous System Lymphoma, Primary Liver Cancer, Prostate Cancer, Rectal Cancer, Renal Cell Cancer, Renal Pelvis and Ureter Cancer, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Sarcoidosis Sarcomas, Sezary Syndrome, Skin Cancer, Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Neck Cancer, Stomach Cancer, Supratentorial Primitive Neuroectodermal and Pineal Tumors, T-Cell Lymphoma, Testicular Cancer, Thymoma, Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Ureter, Transitional Renal Pelvis and Ureter Cancer, Trophoblastic Tumors, Ureter and Renal Pelvis Cell Cancer, Urethral Cancer, Uterine Cancer, Uterine Sarcoma, Vaginal Cancer, Visual Pathway and Hypothalamic Glioma, Vulvar Cancer, Waldenström's macroglobulinemia, Wilms' tumor, and any other hyperproliferative disease, besides neoplasia, located in an organ system listed above.

[0139] In some embodiments, the cancer is colorectal cancer (CRC). In one embodiment, the cancer is mismatch repair-deficiency (MMR) proficient (MSS) colorectal cancer.ATTORNEY DOCKET NO.: MIL-049WO1

[0140] In one aspect, the combination therapy for treating a solid cancer comprises combining Vδ1+γδ T cell based adoptive cell therapy with immune checkpoint blockade (ICB) immunotherapy. The immune checkpoint blockade (ICB) immunotherapy includes immune checkpoint inhibitors that target PD-1 and / or TIGIT.

[0141] In some embodiments, the combination therapy comprises Vδ1+γδ T cell based adoptive cell therapy and at least one immune checkpoint inhibitor. The immune checkpoint inhibitors are PD-1 and / or TIGIT.

[0142] In some embodiments, the method for treating a solid cancer comprises administering to a subject in need thereof Vδ1+γδ T cells and an immune checkpoint inhibitor targeting PD-1.

[0143] In some embodiments, the method for treating a solid cancer comprises administering to a subject in need thereof Vδ1+γδ T cells and an immune checkpoint inhibitor targeting TIGIT.

[0144] In some embodiments, the method for treating a solid cancer comprises administering to a subject in need thereof Vδ1+γδ T cells and an immune checkpoint inhibitor targeting PD-1 and an immune checkpoint inhibitor targeting TIGIT.

[0145] In some embodiments, the combination therapy described herein is further in combination with treating the subject to upregulate the expression of a NKG2D ligand on cancer cells. In some embodiments. the subject is pretreated at least one day before administering of Vδ1+γδ T cells and at least one immune checkpoint inhibitor. In other embodiments, the subject is treated to upregulate the expression of a NKG2D ligand on cancer cells for one day, 2 days, 3 days, 4 days, 5 days, 6 days, a week, two weeks, three weeks, a month or more before administering of Vδ1+γδ T cells and at least one immune checkpoint inhibitor. In some embodiments, the subject continues to receive the treatment for upregulating the NKG2D ligand expression during the course of the Vδ1+γδ T cell therapy in combination with the immune checkpoint blockade therapy.

[0146] In some embodiments, the subject is treated with butyrate or a salt thereof, or a butyrate prodrug, for upregulating the expression of a NKG2D ligand on the tumor. For Example, the subject is pretreated to upregulate the expression of a NKG2D ligand on cancer cells by taking butyrate supplement. In some embodiments, the subject continues to take butyrate supplement during the course of the combination therapy of Vδ1+γδ T cells and at least one immune checkpoint inhibitor.

[0147] In some embodiments, the method for treating cancer in a subject in need thereof, comprises i) upregulating the expression of a NKG2D ligand on cancer cells, and ii)ATTORNEY DOCKET NO.: MIL-049WO1 administering to the subject a T cell therapy. The T cell therapy is Vδ1+γδ T cell therapy (i.e., DOT cell therapy) and at least one immune checkpoint inhibitor.

[0148] In some embodiments, the Vδ1+γδ T cells are administered by intravenous injection or infusion.

[0149] In some embodiments, the Vδ1+γδ T cells are administered with a pre-determined dose. In some examples, the Vδ1+γδ T cells are administered at a dose of 1.0 X 105cells, 1.0 X 106cells, 1.0 X 107cells, 1.0 X 108cells, 1.0 X 109cells, 1.0 X 1010cells, 1.0 X 1011cells, 1.0 X 1012cells, or 1.0 X 1013cells.

[0150] Suitable routes of administration of immune checkpoint inhibitors include, without limitation, parenteral, subcutaneous, rectal, transmucosal, intestinal administration, intramuscular, intramedullary, intrathecal, direct intraventricular, intravenous, intravitreal, intraperitoneal, intranasal, or intraocular injections.

[0151] The optimal dose of the immune checkpoint inhibitors is used to achieve maximal therapeutic effect. The optimal ICB dose can be determined by routine experimentation. For parenteral administration a dose between 0.1 mg / kg and 100 mg / kg, alternatively between 0.5 mg / kg and 50 mg / kg, alternatively, between 1 mg / kg and 25 mg / kg, alternatively, between 10 mg / kg and 25 mg / kg, alternatively, between 5 mg / kg and 20 mg / kg, alternatively between 2 mg / kg and 10 mg / kg, alternatively, between 5 mg / kg and 10 mg / kg, is administered and may be given, for example, once weekly, once every other week, once every third week, or once monthly per treatment cycle.

[0152] In some embodiments, the subject is treated with Vδ1+γδ T cell therapy and immune checkpoint blockade therapy concurrently.

[0153] In accordance, the present disclosure provides a method for conditioning a subject having a cancer who receives adoptive T cell therapy; the method comprising upregulating the expression of a NKG2D ligand on the tumor of the subject before administering to the subject the T cell therapy.

[0154] In another aspect, the present disclosure provides a method for treating cancer in a subject in need thereof; the method comprises i) upregulating the expression of a NKG2D ligand on cancer cells in the subject, and ii) administering to the subject a T cell therapy. The T cell therapy is Vδ1+γδ T cell base adoptive cell therapy.

[0155] In some embodiments, the method comprises upregulating the expression of a NKG2D ligand on cancer cells in the subject with butyrate or a salt thereof, or a probutyrate. and administering to the subject a T cell therapy.ATTORNEY DOCKET NO.: MIL-049WO1

[0156] In some embodiments, the method comprises upregulating the expression of a NKG2D ligand on cancer cells in the subject with butyrate or a salt thereof, or a probutyrate, and administering to the subject a T cell therapy and one or more immune checkpoint inhibitors. The immune checkpoint inhibitors include inhibitors targeting to PD-1 and TIGIT.

[0157] The treatment described herein can reduce tumor growth, reducing solid tumors in size, and reducing or eliminating metastases.

[0158] In some embodiments, the combination therapy also includes administration of an anti-cancer therapeutic agent such as, for example, radiation, chemotherapeutic agents, a biologic and / or a vaccine. The combination therapy exhibits a synergistic effect as compared to the effect of administering the individual agents separately. Each combination will be adapted to the tumor type, stage, patient condition and prior therapy, and other factors considered by the managing physician. EQUVALENTS AND SCOPE

[0159] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of examples only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. EXAMPLES Example 1. Methods for Cell Line Development and ExperimentationATTORNEY DOCKET NO.: MIL-049WO1

[0160] This example outlines the exemplary methods used for developing the DOT cell lines, developing colorectal cancer (CRC) models, and assays herein for the characterization of DOT CRC cell targeting and cytotoxicity. Patient Samples

[0161] Colon and rectal tumor specimens from patients were prospectively collected by colonoscopy and prior to treatment. In addition, a blood sample was collected from the same patients and PBMCs were cryopreserved. In parallel, blood samples from 11 randomized age- matched healthy donors from the biobank were analyzed.

[0162] From dissection to processing, the tumor specimens were maintained in DMEM (Gibco) with 5% penicillin / streptomycin (Gibco), 5% fungizone / amphotericin B (Gibco), 0.2 % gentamicin (Gibco) and 0.1% metronidazole (Duchefa Biochemie). Within the first 3 hours from collection, tumor biopsies were cut into 1-2 mm3pieces and cryopreserved in CryoStor CS10 cell cryopreservation media (Merck) in liquid nitrogen until utilized. Tumor specimens were chosen randomly for the different assays performed. DOT Cell Expansions

[0163] Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats from healthy volunteers by Ficoll-Hypaque gradient centrifugation. PBMCs were incubated with anti-TCRαβ Biotin mAb (Miltenyi Biotec) followed by anti-Biotin mAb microbeads incubation to obtain αβ-depleted PBMCs, upon magnetic separation using LS columns (Miltenyi Biotec). DOT cells were generated from αβ-depleted PBMCs that were cultured in G-REX platform (Wilson Wolf Manufacturing). Briefly, αβ-depleted PBMCs were resuspended in OpTmizer-CTS medium supplemented with 2.5% heat-inactivated human plasma (LifeSciences), 2 mmol / L L-glutamine (Thermo Fisher Scientific) and 50 U / mL / 50 ug / mL of Penicillin / Streptomycin (Thermo Fisher Scientific) and cultured for 14 days. Human recombinant IL4 (100 ng / mL), recombinant IFNγ (70 ng / mL), recombinant IL21 (7 ng / mL), and recombinant IL1β (15 ng / mL; all from PeproTech), and a soluble mAb anti-CD3 (clone OKT-3, 140 ng / mL; BioLegend), were added to the medium at day 0. At day 7, cultures were supplemented with anti-CD3 (clone OKT-3, 1 µg / mL), rIL21 (13 ng / mL) and rIL15 (70 ng / mL). On day 11, new medium was added to cultures, supplemented with anti- CD3 (1 µg / mL) and rIL15 (100 ng / mL). Cells were incubated at 37 ºC and 5% CO2. On day 14, DOT cells were harvested and cryopreserved in Cryostor® (Merck) and stored in liquid nitrogen. Only expansions achieving over 65 % of Vδ1+T cells in the final product were used (FIG.1).ATTORNEY DOCKET NO.: MIL-049WO1 In vitro Killing Assays

[0164] All CRC cell lines, COLO-320DM (ACTT #CCL-220), DLD1 (ACTT #CCL- 221), HCT116 (ACTT #CCL-247), HT29 (ACTT #HTB-38), SW480 (ACTT #CCL-228) and SW620 (ACTT #CCL-227), were grown in RPMI-1640 (GIBCO) with 10% Fetal Bovine Serum (FBS) and 1% Penicillin / Streptomycin with 5% CO2 at 37°C. For killing assays, trypsinized CRC cells were stained with CellTrace Violet (Thermo Fisher Scientific) in PBS and washed before co-cultured with DOT cells at 5:1 (Effector: Target) ratio, for 3h in the presence of 100ng / mL of IL-15 (Peprotech). All killing assays were performed in RPMI- 1640 (Gibco), with 10 % Fetal Bovine Serum (FBS, Gibco), 1% Hepes (Gibco), 1% Pyruvate (Gibco), 1% CTS Glutamax (Gibco), 1% MEM Non-Essential Amino Acids Solution (Gibco) and 0.2% Mycozap (Lonza), from now referred to as Complete-RPMI. Cells were stained with Annexin V (AlexaFluor 647, BioLegend) and analyzed in LSR Fortessa (BD Biosciences). Data were analyzed with FlowJo software (Tree Star).

[0165] For primary CRC biopsies, cryopreserved tumor pieces were digested with liberase (Roche) and DNAse I (Roche) in RPMI-1640 (Gibco) for 30min at 37°C with agitation. The preparations were passed through a 70 µm filter with the help of a syringe piston and washed with RPMI-1640 with 10% FBS and 1% Penicillin / Streptomycin. Single cell suspensions were stained with anti-human CD45 mAb conjugated to biotin (Clone 2B11, Invitrogen)) for 10min at 4°C. After washing with PBS, cells were incubated with anti-biotin microbeads (Miltenyi Biotec) followed by magnetic depletion of CD45+ cells using LD columns (Miltenyi Biotec) following the manufacturer’s instructions. Subsequently, CD45- depleted tumors were stained with CellTrace Violet (Thermo Fisher Scientific) and washed before co-incubation with DOT cells at 5:1 (Effector: Target (E:T)) ratio in Complete-RPMI in the presence of 100 ng / mL of IL-15 (Peprotech), for 24h. Then, cells were stained with Caspase3 / 7 Green (Invitrogen) and analyzed in Fortessa (BD Biosciences). Data were analyzed with FlowJo software (Tree Star).

[0166] In receptor blockade assays, DOT cells were pre-incubated for 15min at 4ºC with 20 µg / ml of either different monoclonal blocking antibodies or equimolar isotype controls, including anti-NKG2D (clone 1D11, BD Biosciences), anti-DNAM-1 (clone 11A8, B), anti- NKp30 (clone P30-15, Biolegend), anti-TCRVδ1 (clone TS-1), anti-TIGIT (clone A15153G, BioLegend), anti-PD-1 (Nivolumab, SelleckChem), IgG1 (Clone MOPC-21, BioLegend), IgG2a (clone MOPC-173, BioLegend) and IgG4 (Clone S228P, MedChemExpress). Generation of NKG2D- / -DOT CellsATTORNEY DOCKET NO.: MIL-049WO1

[0167] Two sgRNA targeting KLRK1 gene (KLRK1#1: 5’- ATATCCAGTTTTTAGGACAT -3’ and KLRK1#2: 5’- GCTGTATACTTTCAGAAGGC- 3’), were designed using CRISPOR algorithm (crispor.tefor.net). Corresponding Alt-R®- crRNA were purchased from Integrated DNA Technologies (IDT) as well as human crRNA negative control and suspended to 200 µM in TE buffer. They were then equally mixed with 200 µM Alt-R®-tracrRNA (IDT), annealed by heating for 5 minutes at 95 °C and cooled to room temperature (RT). These dual gRNA were individually mixed with 10 µg of Alt-R® S.p-Cas9HIFIv3 (IDT) with a 1.6 ratio of gRNA / Cas9. CRISPR-Cas9 knock-out was done by simultaneous co-transfection of both gRNA in 10 million cells. Upregulation of Ligands on Tumor Cells

[0168] For NKG2D ligand upregulation, tumor cells were pre-treated for 24 h with either 1 mM sodium butyrate (Sigma Aldrich), 1 mM Valproic acid (Merck, #PHR1061-1G), 5 µM retinoic acid (Merck, #R2625-1G) or 5 nM Bortezomib (Merck Millipore, #504314) in Complete-RPMI.

[0169] For evaluation of IFNγ on PD-1 and NKR ligand expression, SW620 cells were cultured for 24h in Complete-RPMI in the presence of 10 ng / ml of recombinant human IFNγ (Preprotech) or DOT cells in a ratio 1:1 (DOT:tumor) with or without 10 µg / ml of anti- human IFNγ (clone: NIB42, Invitrogen). DOT Cell Suppression In vitro Assays

[0170] To assess the inhibitory functions of PD-1 and TIGIT on DOT cells, p96 wells were coated with 10 µg / ml recombinant CD155 / PVR-Fc chimera (Biolegend) and / or recombinant PD-L1 Fc chimera (R&D Systems). After washing three times with Complete- RPMI, 2 x 105DOT cells were seeded overnight on top in Complete-RPMI supplemented with 1 ng / ml IL-15, with / without 10 µg / mL anti-DNAM-1 (clone 11A8, Biolegend)) and anti-CD96 (NK92.39, Biolegend) in the presence of 1% Brefeldin A (Merck) and 0.1% Monnensin (Invitrogen). Orthotopic CRC Model

[0171] Eight-to-fourteen weeks-old female non-obese diabetic mice transgenic for human IL-15 were acquired from Taconic (NOD.Cg-PrkdcscidIl2rgtm1SugTg(CMV-IL2 / IL15)1- 1Jic / JicTac). Orthotopic GFP+ / Luciferase+SW620 implantation was performed as follows. Mice were anesthetized with 3% isoflurane in oxygen, administered via the nose cone. TheATTORNEY DOCKET NO.: MIL-049WO1 cecum was exposed and 105 SW620 cells in 20 µL of PBS were carefully inoculated in the cecal serosa, between the epithelial layers of the cecal wall. After confirmation of successful injection by visualization of a liquid bubble at the site of injection, the cecum is returned to the abdominal cavity. After stitching, 100µL of a 0.3 mg / mL buprenorphine solution was subcutaneously administered for analgesia.

[0172] Before treatments (Day 7 after surgery) and at the indicated time points, tumor growth was measured in IVIS Lumina Fluorescence / Bioluminescence Imaging System (Caliper, LifeSciences). In brief, mice were anesthetized with an intraperitoneal injection of 200 µL of anesthesia (7.5 mg / ml ketamine and 0.1 mg / ml medetomidine in water). Then, abdominal fur was removed and 200 µL of 15mg / mL of XenoLight D-Luciferin - K+ Salt Bioluminescent Substrate (Revvity) was injected intraperitoneally. After 7 minutes, luminescence was measured with 30 and 60 seconds of exposure. Then, 200 µL of 0.1 mg / ml Antisedan (Esteve) were administered intraperitoneally for recovery. Luminescence was analyzed by Living Image 3.0 Software. The tumor size is then quantified as the photons released per second. In vivo DOT Cell Treatments

[0173] In vivo administration of DOT cells was performed intravenously in 100 µL of Optimizer (Gibco). In tumor infiltration kinetics, only one shot of 107 DOT cells was administered three weeks after tumor implantation, and mice were sacrificed at different time points after DOT cell infusion. For therapy experiments, 107DOT cells were infused weekly since day 7 post tumor implantation and only after confirmation of tumor detection and tumor growth was monitored overtime. When indicated, 100 mM of sodium butyrate (Sigma) with 1.5% of sucrose or 1.5% of sucrose only (for control counterparts) was concomitantly administered in the drinking water, replacing the water bottles every 2-3 days. For immune checkpoint blockade, mice were intraperitoneally injected with 50 µg of anti-TIGIT (Vibostolimab, Selleckchem) and / or 200 µg anti-PD-1 (Nivostolimab, Selleckchem) or 50 µg IgG1 (Selleckchem). Mouse Organ Processing for In vivo DOT Cell Analyses

[0174] Mice were sacrificed by CO2narcosis at the indicated time points after tumor inoculation and tumor, blood, spleen, liver, mesenteric lymph nodes, small intestine and remote colon were collected for analysis of DOT cell infiltration and / or phenotype.ATTORNEY DOCKET NO.: MIL-049WO1

[0175] Tumors were chopped into small fragments and then incubated with 0.05 mg / mL collagenase IV (Roche) and 1 mg / ml DNAse I (Roche) for 30min at 37°C with 900 rpm agitation in 5 mL of Complete IMDM (Gibco) containing 20% FBS, 1% Penicillin / Streptomycin, 1% Amphotericin B (Gibco), and 0.1% of 50 mg / mL Gentamicin (Gibco). Then, single-cell tumor suspensions were passed through a 70 μM filter with the help of a syringe piston, washed with Complete IMDM (Gibco) and resuspended in the volume adequate for flow cytometry.

[0176] Healthy colon tissue and small intestine were flushed with PBS to remove contents and opened longitudinally. After cutting into 1 cm pieces, they were incubated in PBS containing 20 mM Hepes (Gibco), 100 U / ml penicillin (Gibco), 100 µg / ml streptomycin (Gibco), 1 mM pyruvate (Gibco), 10% FCS, 100 μg / ml polymyxin B (Merck) and 10 mM EDTA (Invitrogen) for 30 min at 37 °C while shaking to release IELs (15 minutes at 220 rpm, reduced afterwards to 110 rpm). Intraepithelial leukocyte suspension was then subjected to a Percoll 37,5% gradient (Cytiva), centrifuging at 700 g for 10 minutes, without break, to eliminate fat tissue and purify cells. Cells were later washed in PBS and resuspended in the volume necessary for staining for flow cytometry.

[0177] Single cell suspensions of spleen, liver, and blood were incubated with red blood cell lysis buffer (Biolegend) before flow cytometry staining. Flow Cytometry

[0178] Single cell suspensions were incubated in PBS with fluorescently labelled monoclonal antibodies against the different surface markers for 20 minutes at 4 ºC in the dark. For intracellular markers (cytolytic granules and cytokines), cells were fixed and permeabilized for intracellular staining with Foxp3 staining buffer set (Invitrogen) following the manufacturer’s instructions. When indicated, cells were stimulated with 0.2 µ / mL PMA (Merck) + 1µg / mL Ionomycin (Merck) in the presence of 10 µg / mL Brefeldin A (Merck) + 0.1% Monensin (Invitrogen) for 3 hours at 37 ºC prior surface staining for the evaluation of functional intracellular markers.

[0179] Flow cytometry acquisition was performed on a BD LSRFortessa X-20 Cell Analyzer (BD Biosciences), BD FACSymphony A5 SE (BD Biosciences) or Cytek Aurora (Cytek) and data analyzed with FlowJo 10 software (TreeStar). The FlowJo plugin X-shift was used to classify endogenous Vδ1 T cells in different clusters. The list of antibodies and dyes used for FACS analysis are listed in Table 1.ATTORNEY DOCKET NO.: MIL-049WO1

[0180] For imaging flow cytometry, DOT cells were stained with CellTrace CFSE (Invitrogen) and tumor cells with CellTrace Yellow (CTY, Invitrogen) for 10 minutes at room temperature before coincubation for 1h. Then, cells were fixed with 1.5% paraformaldehyde and subsequently stained for Phalloidin AF660 (Invitrogen) during the permeabilization step (phosphate-buffered saline + 0.1% Triton X-100 + 2% fetal bovine serum). Before acquisition in Amnis ImageStreamX (Luminex), 4′,6-diamidino-2- phenylindole (DAPI) was added. Data were analyzed using IDEAS software. Table 1. List of antibodies and dyes used for FACS Marker Fluorochrome Clone Company Areg PE AREG559 Invitrogen B7-H6 PE 875001 Invitrogen CD107a BV605 H4A3 Biolegend CD158 (KIR2D) BUV395 HP-MA4 BD CD3 BUV805 SK7 BD CD3 BV510 OKT3 Biolegend CD45 PE-CF594 HI30 BD CD45 AF700 HI30 Biolegend CD45 PEDzzle 2D1 Biolegend CD69 RB744 FN50 BD CD69 BV605 FN50 Biolegend CD69 PERCPCy5.5 FN50 BioLegend CD94 PE HP-3D9 BD CD96 APC NK92.39 BioLegend CD96 BV421 6F9 BD CD96 PERCPCy5.5 NK92.39 BioLegend CTLA4 / / CD152 RY586 BNI3 BD DNAM1 FITC 11A8 BioLegend DNAM-1 BV711 11A8 BioLegend Gzmb Pblue GB11 BioLegend IFNg AF647 4S.B3 Invitrogen IFNg APC 4S.B3 BioLegend KLRG1 RB780 Z7-205.rMAb BD LAG3 APC-R700 T47-530 BD Lag-3 APC 3DS223H Invitrogen Mouse CD11b APCCy7 M1 / 70 BioLegend Mouse CD11b BV711 M1 / 70 BioLegend MICA / B BV711 6D4 BD mouseCD45 PEDdzzle 30-F11 BioLegend mouseCD45 BV510 30-F11 BioLegend Nectin-2 APC TX31 BioLegend Nectin-2 Percp-Cy5.5 TX31 BioLegendATTORNEY DOCKET NO.: MIL-049WO1 NKG2a BB700 131411 BD NKG2D BV421 1D11 BioLegend NKG2D BV785 1D11 BioLegend NKG2D PECy7 1D11 BioLegend NKp30 BUV737 P30-15 BD Nkp30 APC P30-15 BioLegend NKp44 BUV615 P44-8 BD NKp46 AF647 9E2 Biolegend PD1 APCCy7 EH12.2H7 BioLegend PD1 BV480 EH12.1 BD PD1 FITC MIH4 Invitrogen PD-L1 APC 29E.2A3 BD Perforin BV711 dG9 Sony PVR PECy7 SKII.4 BioLegend TIGIT PECy7 A15153G BioLegend TIGIT PercpCy5.5 A15153G BioLegend TIM3 BV650 7D3 BD TNF BUV395 Mab11 BD TNF PECy7 Mab11 Biolegend ULBP-1 PERCP 170818 R&D Systems ULBP-2 / 5 / 6 BV605 165903 BD ULBP3 AF405 166510 R&D Systems ULBP-4 AF750 709116 R&D Systems Vd1 PE REA173 Miltenyi Vd1 FITC REA173 Miltenyi Vd1 APC REA173 Miltenyi Vd2 APC-Vio770 REA771 Miltenyi IgG1 BV785 MOPC-21 Biolegend IgG1 BV711 MOPC-21 Biolegend IgG1 BV421 X40 BD IgG1 BV650 X40 BD IgG1 FITC MOPC-21 BioLegend IgG1 RB744 X40 BD IgG1 BV605 MOPC-21 BioLegend IgG1 APC-R700 X40 BD IgG1 BUV737 X40 BD IgG1 PE MOPC-21 BioLegend IgG1 BUV615 X40 BD IgG1 RB780 X40 BD IgG1 PercpCy5.5 MOPC-21 Biolegend IgG1 PeCy7 MOPC-21 Biolegend IgG2a PECy7 MOPC-173 BioLegend IgG2a BB700 G155-178 BD IgG2a RY586 G155-178 BD IgG2a AF405 20102 R&D SystemsATTORNEY DOCKET NO.: MIL-049WO1 IgG2a BV605 G155-178 BD IgG2a BV711 G155-178 BD IgG2b BUV395 27-35 BD IgG2b APC MPC-11 BioLegend IgG2b AF750 133303 R&D Systems Zombie Violet BioLegend Zombie Acqua BioLegend Live / Dead NIR Invitrogen Annexin V AF647 BioLegend Caspase 3 / 7 Green Invitrogen CFSE Invitrogen CTV Invitrogen CTV Invitrogen DAPI Abcam Migration Assays

[0181] Migration assays were performed using a 96-well Transwell plate with 5.0 μm pore polycarbonate membrane (Corning). Increasing numbers of CTV-stained SW620 cells and patient-derived CRC biopsies were seeded in the bottom chambers in Complete-RPMI and incubated overnight at 37 ºC to allow chemoattractant molecules to accumulate in the supernatants. In parallel, DOT cells were thawed and re-stimulated with 100 ng / mL of IL-15 overnight at 37 ºC. Next, 100 µL of cell suspension containing 2 x 105DOT cells was carefully added into the upper chamber and allowed to migrate through the membrane for 6 h at 37 ºC. Migrated DOT cells were collected from the lower wells, were stained with fluorochrome-conjugated antibodies, and were counted and quantified by flow cytometry. Chemotaxis ratios were calculated by dividing the number of DOT cells that migrated in each condition over the number of DOT cells in the control wells (no tumor cells). TCGA Gene Expression

[0182] Data were downloaded using The Cancer Gene Atlas links for the projects TCGA- COAD and TCGA-LAML. Fragments Per Kilobase Million (FPKM) was used as a normalized measure to compare gene expression within and across datasets. Statistical Analyses

[0183] For statistical analysis, the normality of the distributions was first evaluated using the Shapiro-Wilk test. If normal, an unpaired (or paired when matched samples) Student’s t test was used for two-group comparisons or a one-way ANOVA with Tukey’s multipleATTORNEY DOCKET NO.: MIL-049WO1 comparisons test when more than two groups were compared. If distributions were non- normal, a Mann-Whitney’s U test was used for the analysis of two groups and a Kruskal- Wallis test with Dunn’s multiple comparisons test for multiple comparisons. In the kinetic experiments, a two-way ANOVA with Šidák’s multiple-comparison post hoc test was performed. Spearman′s correlation coefficient was used to analyze the independence of continuous variables. Data analyses were performed with GraphPad Prism 8.0 (GraphPad Software). In general, p-values below 0.05 were considered significant and shown in the figures. Example 2. DOT Cells Target CRC In vitro and In vivo

[0184] This example outlines the ability of DOT cells to target CRC in vitro and in vivo.

[0185] The in vitro expanded and differentiated DOT products were composed of γδ T cells with a major bias for Vδ1+cells (FIG.1A), and expressed multiple NK-cell receptors (NKR), namely NKG2D, DNAM-1 / CD226 and to a lesser extent NKp30 (FIG.1B). Importantly, DOT cells showed striking degranulation (CD107a / LAMP-1) potential associated with high expression of cytolytic molecules (Granzyme B, Perforin); and displayed a type 1 (IFN-γ, TNF-α) cytokine profile upon activation (FIG.1C). During 3h co- incubation with CRC targets, it was found that DOT cells were able to form stable immune synapses (FIG.2A and 2B) and to kill both MSI and MSS CRC cell lines (FIG.3A), thus revealing a broad reactivity against CRC independently of the microsatellite status. Furthermore, DOT cells showed strong cytotoxicity against primary CD45-depleted primary CRC biopsies (FIG.3B) from a retrospective cohort of CRC patients in a 24h killing assay. Next, to evaluate the anti-CRC function of DOT cells in vivo, an orthotopic xenograft model of human CRC was established by implanting luciferase-positive SW620 cells in the cecum of immunocompromised (NSG) mice expressing human IL-15.107DOT cells were administered intravenously weekly, starting at 7 days post-tumor inoculation, upon confirmation of tumor establishment via luciferase signal detection (FIG.3C). Bioimaging follow-up clearly demonstrated the capacity of DOT cells to control tumor growth in vivo (FIG.3D). Example 3. DOT Cells Migrate Towards and Infiltrate CRC

[0186] This example outlines the ability of DOT cells to migrate towards and infiltrate CRC tumors.ATTORNEY DOCKET NO.: MIL-049WO1

[0187] To directly assess the capacity of DOT cells to infiltrate solid tumors, CRC tumors were used. Orthotopic CRC tumors were allowed to grow and establish for three weeks in the cecum of mice before injecting DOT cells intravenously and monitored tumor infiltration over time. A clear infiltration and accumulation of DOT cells within CRC tumors was observed (FIG.3E). Importantly, biodistribution evaluation at 14 days after infusion revealed that, while DOT cells were abundant in the blood, blood-rich organs, and within tumor lesions, they were virtually absent in healthy gut tissues (FIG.3F). To validate DOT-cell migration towards CRC, an in vitro chemotaxis assay with tumor cells was established. It was confirmed that DOT cells migrated over microporous membranes towards both SW620 cells and primary CRC biopsies (FIG.3G), thus believed to be supporting DOT-cell homing to CRC tumors. Example 4. DOT Cells Exhibit Limited Cytotoxicity in CRC Tumors

[0188] This example outlines characterization of DOT cells in CRC tumor cells and their cytotoxicity.

[0189] Following the observation of efficient DOT-cell homing to CRC, it was assessed if their functions were impacted by the tumor microenvironment (TME). An extensive phenotypic and functional analysis of DOT cells was conducted before and two weeks post- infusion into mice bearing established orthotopic CRC tumors, comparing both circulating and tumor-infiltrating DOT cells (FIG.4A). Substantial alterations in the inhibitory and cytotoxic receptor repertoire of DOT cells in vivo were observed. After in vitro expansion and differentiation of DOT cells (i.e., prior to their infusion), TIM-3 and CD96 / TACTILE were highly expressed, whereas PD-1, TIGIT and LAG-3 were mostly absent (FIG.4B and FIG.5A). Strikingly, TIGIT was upregulated in vivo in both circulating and tumor- infiltrating DOT cells, while PD-1 upregulation was confined to TILs. PD-1+TIGIT+cells, but not PD-1+TIM-3+cells, were enriched within the tumors. Conversely, the expression of CD96, which competes with TIGIT for the same (PVR / CD155 and Nectin-2 / CD122) ligands, was downregulated in vivo. LAG-3 (very low) and TIM-3 (high) expression was more stable between pre- and post-injected (in vivo) DOT cells (FIG.4B and FIG.5A).

[0190] This immune checkpoint regulation in DOT cells associated with a compromised cytotoxic profile in CRC. On one hand, the expression of NKG2D and DNAM-1 decreased in DOT TILs, which upregulated the activation marker CD69 (FIG.4C and FIG.5A). On the other hand, the release of cytolytic granules, as measured by CD107a / LAMP-1, Granzyme B and Perforin expression, as well as TNFα and IFNγ production, were significantly reduced inATTORNEY DOCKET NO.: MIL-049WO1 tumor-infiltrating DOT cells (FIG.4 and FIG.5B). These findings support the notion that DOT cells, activated in the CRC microenvironment, develop a dysfunctional phenotype characterized by dysregulated checkpoint receptor expression and impaired cytotoxicity. These results suggest that enhancing cytotoxic receptor engagement or blocking immune checkpoint receptors could improve CRC targeting by DOT cells. Example 5. NKG2D Mediates CRC Targeting by DOT Cells

[0191] This example outlines the impacts of increasing activity of natural killer receptor, NKG2D, on CRC targeting by DOT cells.

[0192] To elucidate which natural killer receptors (NKRs) are important for CRC recognition by DOT cells, the respective ligand expression was profiled across multiple CRC cell lines using flow cytometry. While DNAM-1 ligands (PVR and Nectin-2) and NKp30 ligand (B7-H6) were highly expressed in all cell lines analyzed, the expression pattern of the different NKG2D ligands (MICA-B and ULBP1-6) varied (FIG.6A). Interestingly, this variable expression of NKG2D ligands correlated with the extent of DOT-cell killing of the corresponding cell lines, which did not happen for DNAM-1 ligand or NKp30 ligand expression (FIG.6B). Moreover, analysis of TCGA data showed an increased expression of NKG2D ligands (especially ULBP-3 and 6, followed by ULBP-1 and 2) (FIG.6C), as well as DNAM-1 and NKp30 ligands (FIG.7A), in primary colon cancer compared to healthy colon samples or to AML samples.

[0193] To directly test the role of NKG2D in DOT cell function, a gain-of-function approach through NKG2D crosslinking with plate-bound MICA-Fc chimera over 48 h was first employed. Decreased levels of membrane NKG2D reflected effective ligand engagement (FIG.7B) and associated with enhanced DOT-cell activation and cytotoxic profile (FIG. 6D), ultimately leading to increased killing of CRC cells (FIG.6E). Conversely, in loss-of- function experiments using anti-NKG2D blocking antibodies, it was found that reduced DOT-cell killing of SW620 cells (FIG.6F). DNAM-1 blockade alone only moderately limited CRC targeting, but in combination with NKG2D blockade further suppressed tumor killing by DOT cells (FIG.6F). Of note, neither NKp30 blockade nor TCR blockade impaired CRC targeting by DOT cells (FIG.7D). To unequivocally demonstrate the importance of NKG2D in this process, NKG2D knockout DOT cells were generated using CRISPR-Cas9 technology, which resulted in the loss of NKG2D without compromising the expression of other receptors (FIG.7D). In agreement with the NKG2D antibody blockade results, NKG2D- / -DOT cells exhibited impaired killing of SW620 cells (FIG.6G),ATTORNEY DOCKET NO.: MIL-049WO1 Example 6. Butyrate Upregulates NKG2D Ligand Expression and Improves CRC Targeting by DOT Cells

[0194] This example confirms that upregulating the expression of NKG2D ligands using butyrate improves CRC tumor targeting by DOT cells.

[0195] Molecules with the potential to induce upregulation of NKG2D ligands were screened, focusing on those with potential relevance in the CRC context, such as commensal bacteria metabolites, gut bioavailable molecules, and chemotherapy agents. Among such candidates, butyrate, a short chain fatty acid (SCFA) derived from the gut microbiota, achieved the highest and most consistent upregulation of multiple NKG2D ligands across different CRC cell lines (FIG.8A). CRC cells were then pre-treated with butyrate for 24 hours and then performed 3h killing assays with DOT cells (also in the presence of butyrate). Consistent with the reported intrinsic butyrate cytotoxicity against CRC22, 24h exposure to 1 mM butyrate induced some tumor cell death. Nonetheless, preincubation with butyrate increased the susceptibility of CRC lines to targeting by DOT cells (FIG.8B). Even after washing out the medium and conducting killing assays in the absence of butyrate, CRC cell lines pre-treated with butyrate maintained upregulated NKG2D ligands for the duration of the killing assay (FIG.9A), resulting in sustained increased targeting by DOT cells (FIG.9B). Consistent with the cell line data, NKG2D-ligand expression was also enhanced in patient- derived CRC biopsies following 24h incubation with butyrate (FIG.8C), leading to increased tumor targeting by DOT cells (FIG.8D).

[0196] It was next determined what the impact of butyrate was on DOT-cell functions. Butyrate was not toxic for DOT cells, as their viability was preserved upon exposure to the concentrations used in the killing assays (FIG.8E). Besides enhancing NKG2D-ligand expression on CRC cells, butyrate upregulated NKG2D (but not DNAM-1) and TNFα expression in DOT cells in a dose-dependent manner (FIG.8F), without inducing other major changes in receptor repertoire (FIG.9C). Notably, while NKG2D levels on DOT cells decreased when co-cultured with SW620 cells, this effect was more pronounced when the tumor cells were exposed to butyrate, suggesting increased NKG2D-NKG2D-ligand interactions (FIG.9D). Importantly, and without being bound by any particular theory, butyrate-induced increase in CRC targeting is believed to be mediated by NKG2D as it was fully reversed upon blockade of this receptor (FIG.8G).

[0197] To translate these findings in vivo, sodium butyrate was administered in the drinking water since the initiation of DOT-cell treatment in the SW620 orthotopic xenograftATTORNEY DOCKET NO.: MIL-049WO1 model (FIG.8H). NKG2D ligands were upregulated in the CRC tumors of mice treated with butyrate (FIG.8I). Even though the percentage and numbers of tumor-infiltrating DOT cells remained unchanged (FIGS.9E-F), they showed heightened activation, as indicated by increased CD69 expression (FIG.8J) and led to delayed tumor growth in mice treated with butyrate compared to controls (FIG.8K). Thus, butyrate treatment enhances NKG2D- mediated recognition of CRC and improves tumor control in vitro and in vivo. Example 7. Blockade of PD-1 and TIGIT Synergize to Enhance DOT-Cell Efficacy Against CRC

[0198] This example demonstrates that immune checkpoint blockade therapy targeting to PD-1 and TIGIT has a synergistic effect on the enhancement of DOT cell efficacy against CRC tumors.

[0199] Besides boosting NKG2D activation, it was further hypothesized that blocking immune checkpoints (FIG.6) could also maximize the anti-CRC functions of DOT cells. Among the checkpoint receptors under study, TIGIT and PD-1 were clearly the most upregulated on DOT cells in vivo (FIG.10A), prompting investigation into their impact on DOT cell activities. Given the significant secretion of IFNγ by DOT cells (FIG.1C), it was conjectured that they might induce the expression of PD-1 and TIGIT ligands on tumor cells, potentially dampening DOT-cell cytotoxicity. It was then observed that IFNγ exposure increased the levels of surface PD-L1 and PVR (PD-1 and TIGIT ligands, respectively) on SW620 cells, without altering Nectin-2 or NKG2D ligands (FIG.11A). Moreover, it was demonstrated that the presence of DOT cells triggers PD-L1 expression on SW620 cells in an IFNγ-dependent manner, since neutralization of DOT-cell-derived IFNγ prevented PD-L1 expression in vitro (FIG.10B). Interestingly, and without being bound by any particular theory, IFNγ-induced PD-L1-expressing SW620 cells also exhibit heightened levels of PVR (FIG.10C), as a feedback mechanism against PD-1+TIGIT+DOT cells that are upregulated in vivo.

[0200] In turn, to assess how PD-1 and TIGIT might affect DOT cell cytotoxicity, DOT cells were cultured for 24h in the presence of plate-bound PD-L1 and PVR. While DNAM-1, CD96, and TIGIT compete for binding to PVR, their relative expression levels in DOT cells (typically with low TIGIT expression) are finely tuned to maintain cytotoxicity. However, the increased levels of TIGIT and decreased levels of DNAM-1 and CD96 observed in the CRC context (as depicted in FIG.4) could tip the balance towards an inhibitory function of PVR through TIGIT engagement. In the absence of additional stimulation, single binding to PVRATTORNEY DOCKET NO.: MIL-049WO1 or PD-L1 minimally impacted DOT-cell cytotoxicity, with PVR alone modestly increasing Granzyme B release, likely due to DNAM-1 binding. However, mutual engagement with PVR and PD-L1 markedly reduced Granzyme B and Perforin production, confirming that PD-L1 interferes with PVR-DNAM-1 activation. When DNAM-1 and CD96 were blocked, favoring PVR binding to TIGIT, PVR alone dampened Granzyme B and Perforin production without any additional effect of PD-L1 (FIG.10D and FIG.11B). Additionally, engagement with PVR and PD-L1 also diminished NKG2D expression (FIG.11B), thereby affecting not only DNAM-1 but also NKG2D-mediated activation. These findings suggest that PD-1 and TIGIT collaborate to suppress distinct activation mechanisms and ultimately impair DOT-cell cytotoxicity.

[0201] In alignment, while the individual blockade of either PD-1 or TIGIT produced minor effects, their combination led to significant increases in in vitro killing of SW620 cells (FIG.10E) and primary CRC samples (FIG.10F). Finally, to evaluate the impact of checkpoint blockade in vivo, a therapeutic approach was designed wherein clinical grade blocking antibodies against TIGIT (vibostolimab) or / and PD-1 (nivostolimab) were administered i.p. weekly concurrently with DOT-cell infusions in orthotopic CRC-bearing mice (Fig.5G [FIG.10G]). Effective blockade was confirmed in circulating and tumor- infiltrating DOT cells at day 28 post-tumor inoculation (FIG.10H). In agreement with the in vitro data, the combination of αPD-1 + αTIGIT treatment maximized (compared to controls and monotherapies) DOT-cell functions, especially degranulation of cytotoxic granules (CD107a), Granzyme B and TNFα expression (FIG.10I). Most importantly, the co- administration of αPD-1 and αTIGIT resulted in the most striking tumor control observed in this study (FIG.10J), thus supporting the application of dual PD-1 / TIGIT checkpoint blockade in combination with adoptive DOT-cell transfer for CRC treatment. Example 8. Endogenous Vδ1+TILs in CRC Patients Exhibit Imbalanced Repertoire of Cytotoxic and Inhibitory Receptors

[0202] This example further confirms that endogenous Vδ1+TILs in subjects afflicted with CRC have an imbalanced repertoire of receptors involved in cytotoxic and inhibitory immune responses.

[0203] To assess whether the TME had a similar impact on endogenous Vδ1+T cells from CRC patients as observed for adoptively transferred DOT cells in the xenograft model discussed in previous examples, multicolor spectral flow cytometry was conducted on matched tumor and blood samples from CRC patients, as well as blood from healthy controls.ATTORNEY DOCKET NO.: MIL-049WO1 Unsupervised hierarchical analysis divided naturally existing Vδ1+T cells into nine distinct clusters based on the expression of inhibitory and cytotoxic receptors (FIG.12A). Whereas similar clusters classified blood Vδ1+T cells from both patients and healthy controls, clusters 7, 8 and 9 were notably enriched in tumor infiltrating Vδ1+T cells (FIG.12B). These clusters, characterized by high PD-1 expression, also co-expressed TIGIT. Additionally, these PD-1+TIGIT+tumor-specific clusters exhibited intermediate levels of NKG2D and CD96, with low levels of KLRG1 (FIG.12C). Among them, cluster 8 expressed the heterodimer NKG2A / CD94, while cluster 9 was defined by CD158 (KIR2DL1 / S1 / S3 / S5) and CD69 expression, with low DNAM-1 levels. The abundance of Vδ1+T cells expressing these receptors was then quantified among the different groups analyzed, confirming that PD- 1+TIGIT+cells were enriched in the tumors. Similar to infused DOT cells, TIGIT was highly expressed in both circulating and tumor-infiltrating Vδ1+T cells, whereas PD-1 expression was restricted to TILs (FIG.12D). Besides KLRG1 being highly expressed in circulating cells from patients and controls and decreased in tumors, the expression of the remaining inhibitory receptors evaluated showed no significant differences among the groups (FIG.13). Expression of the natural cytotoxicity receptors NKp30 / NKp44 / NKp46 was restricted to the Vδ1+TILs of few individuals (FIG.13). In contrast, NKG2D and DNAM-1 were substantially expressed in blood Vδ1+T cells and downregulated in CRC tumors, with NKG2D+DNAM-1+cells significantly decreased in both circulating and TILs from CRC patients (FIG.12D).

[0204] In conclusion, these findings reveal a parallel dysregulation of cytotoxic and inhibitory receptors in both endogenous Vδ1+T cells and adoptively transferred DOT cells, potentially impairing their antitumor functions in the CRC.

Claims

ATTORNEY DOCKET NO.: MIL-049WO1 CLAIMS 1. A method for treating a solid tumor comprising administering Vδ1+ γδ T cells and at least one immune checkpoint inhibitor to a subject in need thereof.

2. The method of claim 1, wherein the Vδ1+ γδ T cells and at least one immune checkpoint inhibitor are administered to the subject concurrently or sequentially.

3. A method for increasing cytotoxicity of Vδ1+ γδ T cells comprising treating the Vδ1+ γδ T cells with at least one immune checkpoint inhibitor.

4. The method of any one of claims 1-3, wherein the immune checkpoint is PD-1 and / or TIGIT.

5. The method of claim 4, wherein the immune checkpoint inhibitor is a PD-1 checkpoint inhibitor.

6. The method of claim 4, wherein the immune checkpoint inhibitor is a TIGIT checkpoint inhibitor.

7. The method of any one of claims 1-2 and 4-6, wherein the method comprises co- administration of a PD-1 checkpoint inhibitor and a TIGIT checkpoint inhibitor.

8. The method of any one of claims 3 and 4-6, wherein the method comprising treating the Vδ1+ γδ T cells with a PD-1 checkpoint inhibitor and a TIGIT checkpoint inhibitor.

9. The method of any one of claims 4-8, wherein the PD-1 checkpoint inhibitor is a PD-1 blocking antibody, a PD-L1 bocking antibody, a PD-L2 blocking antibody, or a small molecule inhibitor targeting the PD-1 / PD-L1 signaling pathway.

10. The method of claim 9, wherein the PD-1 blocking antibody is Nivolumab, Pembrolizumab, Cemiplimab, Dostarlimab, Retifanlimab, Toripalimab, Pidilizumab, CT011, Camrelizumab (SHR-1210), Vopratelimab (JTX-4014), Spartalizumab (PDR001), Sintilimab (IBI308), Tislelizumab (BGB-A317), INCMGA00012 (MGA012), AMP-514 (MEDI0680), or Acrixolimab (YBL-006).

11. The method of claim 9, wherein the PD-L1 blocking antibody is Atezolizumab, Avelumab, or Durvalumab.ATTORNEY DOCKET NO.: MIL-049WO1 12. The method of claim 9, wherein the PD-1 checkpoint inhibitor is AMP224.

13. The method of any one of claims 4-12, wherein the TIGIT inhibitor is a TIGIT blocking antibody, or a compound directed against TIGIT.

14. The method of claim 13, wherein the anti-TIGIT blocking antibody is Vibostolimab, Etigilimab, Tiragolumab, Domvanalimab, Ociperlimab, M6223, EOS-448, BMS-986207, BAT6021, PM1021, ASP8374, COM902, IBI939, JS006, SEA-TGT or AB308.

15. The method of claim 7 or 8, wherein the checkpoint inhibitor is a bispecific antibody against PD-1 and TIGIT.

16. The method of any one of the preceding claims, wherein the Vδ1+ γδ T cells are for adoptive cell therapy.

17. The method of any one of the preceding claims, wherein the Vδ1+ γδ T cells are expanded and differentiated in vitro.

18. The method of any one of the preceding claims, wherein the Vδ1+ γδ T cells express NKG2D and / or DNAM-1 / CD226.

19. The method of any one of the preceding claims, wherein the Vδ1+ γδ T cells are engineered to express a chimeric antigen receptor (CAR).

20. The method of claim 19, wherein the CAR comprises an antigen binding domain, a hinge region, a transmembrane and at least one intracellular signaling domain.

21. The method of any one of claims 1-2 and 4-20, wherein the administration of the Vδ1+ γδ T cells is by intravenous injection or infusion.

22. The method of any one of claims 1-2 and 4-21, wherein the solid tumor is a colon cancer, a lung cancer, a skin cancer, a brain cancer, a breast cancer, a prostate cancer, a neuroblastoma, osteosarcoma, sarcoma, a germ cell tumor, carcinoma, retinoblastoma, a carcinoid tumor, a kidney tumor, a liver tumor, rhabdomyosarcoma, a bone tumor, thyroid carcinoma, a benign tumor, or a precancerous condition.

23. The method of claim 22, wherein the solid tumor is colorectal cancer (CRC).ATTORNEY DOCKET NO.: MIL-049WO1 24. The method of any one of claims 1-2 and 4-23, wherein the solid tumor is a malignant tumor, a pre-malignant tumor, or a benign tumor.

25. The method of any one of the preceding claims, wherein the Vδ1+ γδ T cells are pretreated to increase NKG2D expression.

26. The method of claim 25, wherein the Vδ1+ γδ T cells are pretreated with butyrate or a salt thereof, or a probutyrate.

27. The method of any one of claims 1-2 and 4-26, further comprising upregulating expression of a NKG2D ligand in the subject.

28. The method of claim 27, wherein the subject receives butyrate or a salt thereof, or a probutyrate, for upregulating the NKG2D ligand expression.

29. The method of claim 28, wherein the subject receives butyrate or a salt thereof, or a butyrate prodrug, before the administration of the Vδ1+ γδ T cells.

30. The method of any of the preceding claims, wherein the Vδ1+ γδ T cells are obtained from a sample by a method comprising culturing the sample in a medium comprising a T cell mitogen and a growth factor having interleukin-4-like activity, in the absence of a growth factor having interleukin-15-like activity.

31. The method of any of claims 1-29, wherein the Vδ1+ γδ T cells are obtained from a sample by a method comprising culturing the sample in a medium comprising a T cell mitogen and a growth factor having interleukin-15-like activity, in the absence of a growth factor having interleukin-4-like activity.

32. The method of any of claims 1-29, wherein the Vδ1+ γδ T cells are obtained from a sample by a method comprising: (1) culturing cells in the sample in a first culture medium comprising a T cell mitogen and a growth factor having interleukin-4-like activity; in the absence of a growth factor having interleukin-15-like activity, and (2) culturing the cells obtained in step (1) in a second culture medium comprising a T cell mitogen and a growth factor having interleukin-15-like activity, in the absence of a growth factor having interleukin-4-like activity.ATTORNEY DOCKET NO.: MIL-049WO1 33. A method for conditioning a subject who receives T cell therapy comprising upregulating expression of a NKG2D ligand on the tumor of the subject before administering to the subject the T cell therapy.

34. A method for treating cancer in a subject in need thereof, comprising i) upregulating expression of a NKG2D ligand on a tumor, and ii) administering to the subject a T cell therapy.

35. The method of claim 33 or 34, wherein the tumor is a solid tumor.

36. The method of any one of claims 33-35, wherein the T cell therapy is Vδ1+ γδ T cell therapy.

37. The method of any one of claims 33-36, wherein the subject is treated with butyrate or a salt thereof, or a probutyrate, for upregulating expression of the NKG2D ligand on the tumor.

38. The method of any one of claims 33 -37, wherein the subject is conditioned at least one day before administration of the T cell therapy.

39. The method of any one of claims 33-38, wherein the subject continues to receive butyrate in the course of the T cell therapy.

40. The method of any one of claims 26-29 and 37-39, wherein the butyrate is administered at a dose ranging from 30 nM-150 nM.

41. The method of any one of claims 26-29 and 37-39, wherein the butyrate is administered at a dose ranging from 1 mM-150 mM.

42. The method of any one of claims 33-41, wherein the method further comprises administering to the subject at least one immune checkpoint inhibitor.

43. The method of claim 42, wherein the immune checkpoint is PD-1 and / or TIGIT.

44. The method of claim 43, wherein the immune checkpoint inhibitor is a PD-1 inhibitor.

45. The method of claim 42 or 43, wherein the immune checkpoint inhibitor is a TIGIT inhibitor.ATTORNEY DOCKET NO.: MIL-049WO1 46. The method of any one of claims 43-45, wherein the method comprising co- administration of a PD-1 inhibitor and a TIGIT inhibitor.

47. The method of any one of claims 43-46, wherein the PD-1 checkpoint inhibitor is a PD-1 blocking antibody, a PD-L1 bocking antibody, a PD-L2 blocking antibody, or a small molecule inhibitor targeting the PD-1 / PD-L1 signaling pathway.

48. The method of claim 47, wherein the PD-1 blocking antibody is Nivolumab, Pembrolizumab, Cemiplimab, Dostarlimab, Retifanlimab, Toripalimab, Pidilizumab, CT011, Camrelizumab (SHR-1210), Vopratelimab (JTX-4014), Spartalizumab (PDR001), Sintilimab (IBI308), Tislelizumab (BGB-A317), INCMGA00012 (MGA012), AMP-514 (MEDI0680), or Acrixolimab (YBL-006).

49. The method of claim 47, wherein the PD-L1 blocking antibody is Atezolizumab, Avelumab, or Durvalumab.

50. The method of claim 47, wherein the PD-1 checkpoint inhibitor is AMP224.

51. The method of any one of claims 43-50, wherein the TIGIT inhibitor is a TIGIT blocking antibody, or a compound directed against TIGIT.

52. The method of claim 51, wherein the anti-TIGIT blocking antibody is Vibostolimab, Etigilimab, Tiragolumab, Domvanalimab, Ociperlimab, M6223, EOS-448, BMS-986207, BAT6021, PM1021, ASP8374, COM902, IBI939, JS006, SEA-TGT, or AB308.

53. The method of claim 46, wherein the checkpoint inhibitor is a bispecific antibody against PD-1 and TIGIT.

54. The method of any one of claims 33-53, wherein the Vδ1+ γδ T cells are obtained from a sample by a method comprising culturing the sample in a medium comprising a T cell mitogen and a growth factor having interleukin-4-like activity, in the absence of a growth factor having interleukin-15-like activity.

55. The method of any one of claims 33-53, wherein the Vδ1+ γδ T cells are obtained from a sample by a method comprising culturing the sample in a medium comprising a T cell mitogen and a growth factor having interleukin-15-like activity, in the absence of a growth factor having interleukin-4-like activity.ATTORNEY DOCKET NO.: MIL-049WO1 56. The method of any one of claims 33-53, wherein the Vδ1+ γδ T cells are obtained from a sample by a method comprising: (1) culturing cells in the sample in a first culture medium comprising a T cell mitogen and a growth factor having interleukin-4-like activity; in the absence of a growth factor having interleukin-15-like activity; and (2) culturing the cells obtained in step (1) in a second culture medium comprising a T cell mitogen and a growth factor having interleukin-15-like activity, in the absence of a growth factor having interleukin-4-like activity.

57. The method of any one of the preceding claims, wherein the Vδ1+ γδ T cell therapy is an allogeneic cell therapy.

Citation Information

Patent Citations

  • Anti-TIGIT antibodies

    JP7487256B2

  • Methods for the production of TCRγδ+ T cells

    US11166983B2

  • Anti-TIGIT antibodies

    US11401339B2

  • Anti-TIGIT antibodies

    US11439705B2

  • Anti-tigit antibodies and their use as therapeutics and diagnostics

    US20220251195A1