5' cap analog

Abstract

Provided is a technique for more easily obtaining a 5' capped polynucleotide which is purified and exhibits high translation activity. The 5' cap analog is characterized in that a hydroxy group at the 2' and / or 3' position of ribose contained in 7-methylguanylic acid is substituted with a non-photodegradable hydrophobic protecting group.

Description

5' Cap Analog

[0001] The present invention relates to 5' cap analogs and the like.

[0002] In recent years, the use of mRNA vaccines has become widespread. The structure of an mRNA vaccine can be divided into the following parts from the 5' end: a cap structure, a 5' untranslated region, a protein coding region, a 3' untranslated region, and a poly(A) tail region. The cap structure is necessary for protein translation from an mRNA vaccine. However, with existing mRNA synthesis technologies, the ratio of mRNA with a cap structure to the total mRNA amount (capping efficiency) is low, and the immune response elicited by uncapped mRNA has been a problem.

[0003] In this situation, Patent Document 1 reports that highly pure capped mRNA can be produced by using a cap analogue to which a photolabile hydrophobic protecting group that can be removed by light is added, and after the transcription reaction, only the capped mRNA is separated and purified by reverse phase chromatography, and then the photolabile hydrophobic protecting group is removed by light irradiation.

[0004] In addition, to further improve the performance of mRNA vaccines, the translation efficiency (translation activity) from capped mRNA is also important.

[0005] International Publication No. 2023 / 282245

[0006] An objective of the present invention is to provide a technique for more simply obtaining purified 5'-capped polynucleotides with high translation activity.

[0007] In light of the above-mentioned problems, the present inventors have conducted extensive research and found that a 5'-cap analog characterized by the substitution of the 2'- and / or 3'-hydroxyl groups of the ribose in 7-methylguanylic acid with a non-photolabile hydrophobic protecting group can solve the above-mentioned problems. Specifically, when a transcription reaction is performed using this 5'-cap analog, the 5'-capped polynucleotide can be purified using the non-photolabile hydrophobic protecting group, and the polynucleotide can exhibit high translation activity even with the non-photolabile hydrophobic protecting group still attached. Based on this finding, the present inventors have conducted further research and have completed the present invention. Specifically, the present invention encompasses the following aspects:

[0008] Item 1. A 5'-cap analogue, characterized in that the hydroxyl groups at the 2' and / or 3' positions of the ribose contained in 7-methylguanylic acid are substituted with non-photolabile hydrophobic protecting groups.

[0009] Item 2. General formula (1) or (2):

[0010]

[0011]

[0012] [In the formula: R 1 and R 2 are the same or different and represent a non-photodegradable hydrophobic protecting group or a hydrogen atom, provided that R 1 and R 2 and X are both hydrogen atoms. X independently represents an oxygen atom, a sulfur atom, or a selenium atom in each occurrence. Nuc represents a nucleoside or a polynucleotide. n represents 1 or 2. Y represents a leaving group. The 5'-cap analog according to item 1, which is a compound represented by the formula (I), a salt thereof, or a solvate thereof.

[0013] Item 3. The 5'-cap analog according to Item 2, wherein the non-photodegradable hydrophobic protecting group is an optionally substituted aryl group or arylalkyl group.

[0014] Item 4. The 5'-cap analog according to Item 3, wherein the non-photodegradable hydrophobic protecting group is an aryl group or arylalkyl group optionally substituted with at least one selected from the group consisting of an alkyl group optionally substituted with a halogen atom, an aryl group optionally substituted with a halogen atom, an amino group substituted with an alkyl group and / or an aryl group, a halogen atom, and an oxygen atom.

[0015] Item 5. The 5'-cap analog according to Item 3 or 4, wherein the aryl moiety has 5 to 20 carbon atoms.

[0016] Item 6. The 5'-cap analog according to any one of Items 2 to 5, wherein the non-photolabile hydrophobic protecting group has a molecular weight of 50 to 300.

[0017] Item 7. The 5'-cap analog according to any one of Items 2 to 6, wherein the non-photodegradable hydrophobic protecting group is a 3,5-bis(trifluoromethyl)benzyl group and / or a 4-n-butylbenzyl group.

[0018] Item 8. The 5' cap analog according to any one of Items 2 to 7, wherein Nuc has a base length of 1 to 5.

[0019] Item 9. A method for producing a 5'-capped polynucleotide, comprising carrying out a transcription reaction in a reaction system containing the 5' cap analog of any one of Items 1 to 8 and a template polynucleotide, or reacting the 5' cap analog of any one of Items 1 to 8 with a polynucleotide.

[0020] Item 10. A 5'-capped polynucleotide which is a conjugate of the 5'-cap analog according to any one of Items 1 to 8 and a single-stranded polynucleotide.

[0021] Item 11. The 5'-capped polynucleotide according to Item 10, wherein the single-stranded polynucleotide is RNA.

[0022] Item 12. The 5'-capped polynucleotide of Item 10 or 11, wherein the single-stranded polynucleotide comprises a protein or peptide coding sequence.

[0023] The present invention provides a technique for more easily obtaining purified 5'-capped polynucleotides with high translation activity, specifically, a 5'-cap analog, a 5'-capped polynucleotide, etc. for obtaining the 5'-capped polynucleotide.

[0024] This shows an HPLC chromatogram (Test Example 2) of a transcription reaction using a 3,5-bis(trifluoromethyl)benzyl group-modified cap analog (Test Example 1-1). This shows an HPLC chromatogram (Test Example 2) of a transcription reaction using a 2'-O-4-n-butylbenzyl group-modified cap analog (Test Example 1-2). This shows the LC-MS analysis results (Test Example 2) of a transcription reaction using a 3,5-bis(trifluoromethyl)benzyl group-modified cap analog (Test Example 1-1). This shows the LC-MS analysis results (Test Example 2) of a transcription reaction using a 3,5-bis(trifluoromethyl)benzyl group-modified cap analog (Test Example 1-1). This shows the LC-MS analysis results (Test Example 2) of a transcription reaction using a 2'-O-4-n-butylbenzyl group-modified cap analog (Test Example 1-2). LC-MS analysis results (Test Example 2) are shown for a transcription reaction using a 2'-O-4-n-butylbenzyl group-modified cap analog (Test Example 1-2). The results of an evaluation of the intracellular translation activity of each mRNA (Test Example 3) are shown. The vertical axis indicates the intensity of luminescence derived from the translation product (luciferase). The horizontal axis indicates the mRNA used. Details of each mRNA are as described in Test Example 3 below. HPLC chromatograms (Test Example 5) are shown for chemical synthesis of mRNA using a 2'-O-4-n-butylbenzyl group-modified cap analog (Test Example 4). The results of an evaluation of the intracellular translation activity of each mRNA (Test Example 6) are shown. The vertical axis indicates the intensity of luminescence derived from the translation product (luciferase). The horizontal axis indicates the mRNA used. Cap (-) indicates monophosphorylated RNA without a cap structure, cap-2, Tag (+) indicates capped mRNA prepared in Test Example 5, and Cap-2 indicates unprotected capped mRNA without a non-photolabile protecting group.

[0025] In this specification, the expressions "contain" and "comprise" include the concepts of "contain," "comprise," "consist essentially of," and "consist only of."

[0026] In one aspect, the present invention relates to a 5'-cap analog (sometimes referred to in this specification as the "5'-cap analog of the present invention") characterized in that the 2' and / or 3' hydroxyl groups of the ribose contained in 7-methylguanylic acid are substituted with non-photolabile hydrophobic protecting groups.

[0027] The 5' cap analog is not particularly limited as long as it has the 5' cap structure of mRNA and can be used as a substrate that serves as the starting point for the transcription reaction.

[0028] 5' cap analogs typically contain the following linked structure of 7-methylguanylate and ribose:

[0029]

[0030] In one aspect, in the 5' cap analog, the carbon atom indicated by * in the above linking structure is attached to the nucleoside or polynucleotide via a triphosphate structure.

[0031] A nucleoside has a structure in which a nucleic acid base is bound to a sugar moiety. A nucleotide typically has a structure in which a phosphate is bound to a nucleoside. Both are structural units of polynucleotides, and are not particularly limited as long as they are such structural units. The sugar moiety can be, for example, ribose or deoxyribose.

[0032] As used herein, nucleosides and nucleotides may be chemically modified as described below. To prevent degradation by hydrolases such as nucleases, the phosphate residue of each nucleotide may be substituted with a chemically modified phosphate residue, such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. The hydroxyl group at the 2-position of the sugar of a nucleotide / nucleoside may also be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Examples of suitable nucleotides / nucleosides include, but are not limited to, those in which the phosphate or hydroxyl moiety is modified with biotin, an amino group, a lower alkylamine group, or an acetyl group. Furthermore, BNA (LNA), in which the 2' oxygen and 4' carbon of the sugar moiety of a nucleotide / nucleoside are crosslinked to fix the conformation of the sugar moiety to the N-type, may also be used.

[0033] In this specification, the nucleic acid base constituting a nucleotide / nucleoside includes not only typical bases in natural nucleic acids such as RNA and DNA (adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.), but also other bases such as hypoxanthine (I) and modified bases. Modified bases include, for example, pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine, etc. Examples of amino acids that can be used include uracil, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2-aminopurine, isoguanine, indole, imidazole, xanthine, and cyanuric acid.

[0034] The 5'-cap analog of the present invention is characterized in that the hydroxyl groups at the 2' and / or 3' positions of the ribose in 7-methylguanylic acid are substituted with non-photolabile hydrophobic protecting groups. That is, the 5'-cap analog of the present invention is represented by the general formula (0):

[0035]

[0036] The 5'-cap analog of the present invention more preferably comprises a partial structure represented by general formula (1) or (2):

[0037]

[0038]

[0039] or a salt thereof, or a solvate thereof.

[0040] R 1 and R 2 are the same or different and represent a non-photodegradable hydrophobic protecting group or a hydrogen atom, provided that R 1 and R 2 Except when both are hydrogen atoms. 1 and R 2 Preferably, one of R is a non-photodegradable hydrophobic protecting group and the other is a hydrogen atom. In this case, R 1 is particularly preferably a non-photodegradable hydrophobic protecting group.

[0041] The non-photodegradable hydrophobic protecting group is a hydrophobic protecting group that is not deprotected by light irradiation (e.g., irradiation with light having a wavelength of 300 to 400 nm for 30 minutes), and is not particularly limited thereto. Photodegradable hydrophobic protecting groups are well known, and examples thereof include a nitrobenzyl group, a benzophenone-derived group, a bromocoumarin-derived group, or a group having these as a skeleton.

[0042] The non-photodegradable hydrophobic protecting group is preferably an optionally substituted aryl group or an arylalkyl group, and particularly preferably an optionally substituted arylalkyl group.

[0043] The aryl group serving as the non-photodegradable hydrophobic protecting group is not particularly limited, but preferably has 5 to 20 carbon atoms, more preferably 6 to 12 carbon atoms, and even more preferably 6 to 8 carbon atoms. The aryl group may be monocyclic or polycyclic (e.g., bicyclic, tricyclic, etc.), but is preferably monocyclic. Specific examples of the aryl group include a phenyl group, naphthyl group, biphenyl group, pentalenyl group, indenyl group, anthracenyl group, tetracenyl group, pentacenyl group, pyrenyl group, perylenyl group, fluorenyl group, and phenanthryl group, with a phenyl group being preferred.

[0044] The arylalkyl group serving as a non-photodegradable hydrophobic protecting group is not particularly limited, and examples thereof include arylalkyl groups in which hydrogen atoms (e.g., 1 to 3, preferably 1 hydrogen atom) of a linear or branched alkyl group having 1 to 6 carbon atoms (preferably 1 to 3) are substituted with the above-mentioned aryl group. Specific examples of such arylalkyl groups include a benzyl group and a phenethyl group.

[0045] When the aryl group or arylalkyl group is substituted, the substituent is not particularly limited as long as it does not impair the hydrophobicity, and examples thereof include an alkyl group which may be substituted with a halogen atom, an aryl group which may be substituted with a halogen atom, an amino group substituted with an alkyl group and / or an aryl group, a halogen atom, an oxygen atom, and the like.

[0046] The alkyl group as a substituent of the aryl group or arylalkyl group includes any of linear, branched, and cyclic groups (preferably linear or branched, more preferably linear). The number of carbon atoms in the alkyl group (when linear or branched) is not particularly limited and is, for example, 1 to 8. The number of carbon atoms is preferably 1 to 6. The number of carbon atoms in the alkyl group (when cyclic) is not particularly limited and is, for example, 3 to 8. Specific examples of the alkyl group include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, a sec-butyl group, an n-pentyl group, a neopentyl group, an n-hexyl group, a 3-methylpentyl group, an n-heptyl group, an n-octyl group, an n-nonyl group, an n-decyl group, an n-undecyl group, and an n-dodecyl group.

[0047] The aryl group or the aryl group as a substituent of the arylalkyl group is the same as described above.

[0048] The halogen atom is, for example, a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom, preferably a fluorine atom, a chlorine atom, or a bromine atom, more preferably a fluorine atom or a chlorine atom, and even more preferably a fluorine atom.

[0049] An amino group as a substituent of an aryl group or an arylalkyl group is represented by -NR A RB R is a group represented by A and R B are the same or different and represent an alkyl group, an aryl group, or a hydrogen atom (provided that R A and R B are both hydrogen atoms.) The alkyl group and the aryl group are the same as those described above.

[0050] The aryl moiety of the non-photodegradable hydrophobic protecting group, i.e., the aryl group that is the non-photodegradable hydrophobic protecting group or the aryl group in the arylalkyl group that is the non-photodegradable hydrophobic protecting group, preferably has 5 to 20 carbon atoms, more preferably 6 to 12 carbon atoms, and even more preferably 6 to 8 carbon atoms.

[0051] The molecular weight of the non-photolabile hydrophobic protecting group is preferably 50 to 300, from the viewpoint of enabling more efficient purification utilizing hydrophobicity while minimizing the effect on translation activity, more preferably 70 to 250, even more preferably 80 to 200, and even more preferably 90 to 180.

[0052] X independently represents an oxygen atom, a sulfur atom, or a selenium atom in each occurrence. Any X is preferably an oxygen atom. In a particularly preferred embodiment, all Xs are oxygen atoms.

[0053] Nuc represents a nucleoside or polynucleotide. The polynucleotide represented by Nuc has the phosphate group removed from the 5'-terminal end.

[0054] The base length of Nuc is not particularly limited, but is, for example, 1 to 8, preferably 1 to 5, and more preferably 1 to 3 bases.

[0055] Specific examples of Nuc include DNA, RNA, LNA, 2'Ome-RNA, 2'methoxyethyl RNA, acyclic nucleosides, linkers containing heteroatoms, etc. The sugar moiety constituting Nuc is preferably ribose or a modified form thereof.

[0056] n represents 1 or 2.

[0057] Y represents a leaving group. Examples of the leaving group include various imidazole derivatives and nitrogen-containing heteroaromatic compounds, such as 1-methylimidazole and 4-methylimidazole, as described in Japanese Patent Application No. 2020-032889.

[0058] The salt is not particularly limited, and examples thereof include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. The salt may be an acid addition salt, and specific examples of such salts include acid addition salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid.

[0059] The solvate is not particularly limited, and examples thereof include solvates with solvents such as water, ethanol, glycerol, and acetic acid.

[0060] The 5' cap analogs of the present invention can be synthesized in various ways, for example, according to the following scheme:

[0061]

[0062] As Compound A and Compound B, commercially available compounds can be used as they are, or compounds synthesized according to or in accordance with known methods can be used as needed.

[0063] In view of yield, ease of synthesis, etc., the amount of compound B used is usually preferably 0.5 to 3.0 moles, more preferably 1.0 to 2.0 moles, per mole of compound A.

[0064] This reaction is usually carried out in the presence of a reaction solvent, preferably dimethyl sulfoxide.

[0065] This reaction is usually carried out in the presence of zinc chloride. From the viewpoints of yield, ease of synthesis, etc., the amount of zinc chloride used is usually preferably 5 to 50 moles, more preferably 10 to 30 moles, per mole of compound A.

[0066] In addition to the above components, additives may also be used in this reaction as appropriate, provided that they do not significantly impair the progress of the reaction.

[0067] The reaction temperature can be any of heating, room temperature, and cooling, and is usually preferably 10 to 100° C. The reaction time is not particularly limited, and usually can be 30 minutes to 30 hours.

[0068] The progress of the reaction can be monitored by conventional methods such as chromatography. After the reaction is complete, the solvent is removed by distillation, and the product can be isolated and purified by conventional methods such as chromatography and recrystallization. The structure of the product can also be determined by elemental analysis, MS (ESI-MS), IR analysis, and 1 H-NMR, 13 It can be identified by C-NMR or the like.

[0069] When mRNA synthesis is performed using the 5'-cap analog of the present invention, 5'-capped polynucleotides can be purified using a non-photolabile hydrophobic protecting group, and high translation activity can be achieved even with the non-photolabile hydrophobic protecting group still attached. When a compound represented by general formula (1) is used as the 5'-cap analog of the present invention, 5'-capped polynucleotides can be obtained by transcription reaction. When a compound represented by general formula (2) is used as the 5'-cap analog of the present invention, 5'-capped polynucleotides can be obtained by chemical synthesis reaction.

[0070] In one aspect, the present invention relates to a method for producing a 5'-capped polynucleotide, which comprises performing a transcription reaction in a reaction system containing a 5' cap analog of the present invention and a template polynucleotide, or reacting a 5' cap analog of the present invention with a polynucleotide (chemical synthesis).

[0071] The template polynucleotide is not particularly limited as long as it is a polynucleotide that serves as a template for a transcription reaction catalyzed by an RNA polymerase, and is typically a double-stranded polynucleotide (particularly DNA).

[0072] The configuration of the template polynucleotide is not particularly limited, but for example, it is arranged in the order of a promoter, a transcription initiation site, and a transcription template sequence.

[0073] The promoter is not particularly limited, and examples thereof include a phage promoter. Examples of the phage promoter include, but are not limited to, the T7 promoter, the SP6 promoter, and the T3 promoter. Among these, the T7 promoter is particularly preferred from the viewpoint of capping efficiency.

[0074] The transcription initiation site preferably has a base of G.

[0075] The transcription template sequence is not particularly limited, but preferably contains a coding sequence for a protein or peptide.

[0076] A protein or peptide coding sequence is a coding sequence for a protein or peptide to be expressed from a 5'-capped polynucleotide, such as a microbial antigen, a cancer antigen, or a therapeutic protein (e.g., for protein replacement therapy).

[0077] Examples of microbial antigens include viral antigens, fungal antigens, etc. Examples of viruses from which viral antigens are derived include, but are not limited to, enveloped viruses (viruses with an envelope) such as influenza viruses (e.g., types A and B), rubella viruses, Ebola viruses, coronaviruses, measles viruses, varicella-zoster viruses, herpes simplex viruses, mumps viruses, arboviruses, respiratory syncytial viruses, SARS viruses, hepatitis viruses (e.g., hepatitis B viruses, hepatitis C viruses), yellow fever viruses, AIDS viruses, rabies viruses, hantaviruses, dengue viruses, Nipah viruses, and lyssaviruses; and non-enveloped viruses (viruses without an envelope) such as adenoviruses, noroviruses, rotaviruses, human papillomaviruses, polioviruses, enteroviruses, coxsackieviruses, human parvoviruses, encephalomyocarditis viruses, and rhinoviruses. The bacteria from which bacterial antigens are derived are not particularly limited, but examples include Bordetella pertussis, Clostridium tetani, Corynebacterium diphtheriae, Salmonella enterica, Helicobacter pylori, Clostridium perfringens, Clostridium botulinum, Campylobacter, Escherichia coli, Staphylococcus aureus, Streptococcus staphylococcus, Bacillus cereus, Vibrio parahaemolyticus, Propionibacterium acnes, Clostridium faecalis, Clostridium difficile, Streptococcus pneumoniae, Haemophilus influenzae, Moraxella pneumoniae, Klebsiella pneumoniae, Koinebacterium, Streptococcus hemolyticus, Pseudomonas aeruginosa, Staphylococcus aureus, Mycoplasma, Candida, and Aspergillus.

[0078] Cancer antigens include, but are not limited to, T cell receptor / CD3-zeta chain, CD20, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE-C1, and MAGE-C2. 2, MAGE-C3, MAGE-C4, MAGE-C5, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8 and GAGE-9, BAGE, RAGE, LAGE-1, NAG, GnT-V, MUM-1, CDK4, tyrosinase, p53, MUC family, HER2 / neu, p21ras, RCAS1, α-fetoprotein, E-cadherin, α-catenin, β-catenin, γ- Catenin, p120ctn, gp100Pmel117, PRAME, NY-ESO-1, cdc27, adenomatous polyposis coli protein (APC), fodrin, connexin 37, Ig idiotype, p15, gp75, GM2 ganglioside, GD2 ganglioside, human papillomavirus protein, Smad family of tumor antigens, lmp-1, P1A, EBV-encoded nuclear antigen (EBNA)-1, brain glycogen phosphorylase, SSX-1, SSX -2 (HOM-MEL-40), SSX-1, SSX-4, SSX-5, SCP-1, CT-7, CD20, c-erbB-2, ERK1, ERK2, MART-1 / Melan-A, gp100, adenosine deaminase-binding protein (ADAbp), FAP, cyclophilin b, colorectal-associated antigen (CRC)-C017-1A / GA733, carcinoembryonic antigen (CEA), CAP-1, CAP-2, etv6, AML1, prostate-specific antigen (PSA), PSA-1, PSA-2, PSA-3, prostate-specific membrane antigen (PSMA), and partial peptides thereof.

[0079] Therapeutic proteins include, for example, enzymes such as oxidoreductases, transferases, hydrolases, lyases, isomerases, ligases, imiglucerase, α-galactosidase A (α-galA), agalsidase beta, acid α-glucosidase (GAA), alglucosidase alpha, LUMIZYME, MYOZYME, arylsulfatase B, laronidase, ALDURAZYME, idursulfase, ELAPRASE, arylsulfatase B, and NAGLAZYME; cytokines such as lymphokines, interleukins, chemokines, type 1 cytokines, and type 2 cytokines; Examples of blood coagulation factors include factor I, factor II, tissue factor, factor V, factor VII, factor VIII, factor IX, factor X, factor Xa, factor XII, factor XIII, von Willebrand factor, prekallikrein, high molecular weight kininogen, fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-related protease inhibitor (ZPI), plasminogen, alpha 2-antiplasmin, tissue plasminogen activator (tPA), urokinase, plasminogen activator inhibitor-1 (PAI1), plasminogen activator inhibitor-2 (PAI2), cancer procoagulant, and epoetin alpha.

[0080] The base length of the template polynucleotide is not particularly limited as long as it is a length that can be used as a transcription template, and is, for example, 25 to 10,000, 25 to 5,000, 25 to 3,000, 25 to 2,000, 25 to 1,000, 25 to 500, 25 to 300, or 25 to 200.

[0081] The reaction system is not particularly limited as long as it contains substances necessary for the transcription reaction (for example, RNA polymerase, various nucleoside triphosphates, etc.), and may be either an in vitro reaction system or an in vivo reaction system.

[0082] The reaction conditions for the transcription reaction are not particularly limited, and appropriate conditions can be set depending on the enzymes used, etc.

[0083] The polynucleotide used for chemical synthesis is preferably RNA and preferably contains a coding sequence for a protein or peptide. The base length of the polynucleotide corresponds to the base length of the template polynucleotide. When the 5'-cap analog of the present invention has a leaving group, chemical synthesis can be carried out by linking the leaving group to a functional group (e.g., a phosphate group) at the end of the polynucleotide. This allows for the production of a 5'-capped polynucleotide containing a triphosphate structure.

[0084] The above-described production method can produce 5'-capped polynucleotides with relatively high efficiency (i.e., achieve high capping efficiency). The 5'-capped polynucleotides are conjugates of the 5'-cap analogs of the present invention and single-stranded polynucleotides (preferably RNA, preferably containing a protein or peptide coding sequence), more specifically, the 5'-end of the single-stranded polynucleotide is linked to the 3'-end of the 5'-cap analog of the present invention.

[0085] The above production method produces not only 5'-capped polynucleotides but also uncapped polynucleotides. 5'-capped polynucleotides can be isolated and purified using non-photolabile hydrophobic protecting groups. That is, 5'-capped polynucleotides are isolated and purified under hydrophobic conditions. The isolation and purification equipment is not particularly limited as long as it satisfies hydrophobic conditions, and examples thereof include liquid chromatography and membrane separation equipment. Examples of liquid chromatography include reversed-phase chromatography.

[0086] The 5'-capped polynucleotides of the present invention can exhibit high translation activity even with the non-photolabile hydrophobic protecting group still attached, so no treatment to remove the non-photolabile hydrophobic protecting group is necessary.

[0087] The 5'-capped polynucleotides of the present invention can be used, for example, as medicines (e.g., vaccines), reagents, etc. (sometimes referred to herein as "drugs of the present invention").

[0088] The pharmaceutical agent of the present invention is not particularly limited as long as it contains an active ingredient, and may further contain additives as necessary, such as bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, and chelating agents.

[0089] The mode of use of the agent of the present invention is not particularly limited, and an appropriate mode of use can be adopted depending on the type of agent. Depending on the intended use, the agent of the present invention can be used, for example, in vitro (e.g., added to a culture medium for cultured cells) or in vivo (e.g., administered to an animal).

[0090] The agents of the present invention may be applied to any mammal, including, but not limited to, humans, monkeys, mice, rats, dogs, cats, rabbits, pigs, horses, cattle, sheep, goats, and deer. Examples of cells include animal cells. The types of cells are also not particularly limited, including, but not limited to, blood cells, hematopoietic stem cells and progenitor cells, gametes (sperm, eggs), fibroblasts, epithelial cells, vascular endothelial cells, nerve cells, hepatocytes, keratinocytes, muscle cells, epidermal cells, endocrine cells, ES cells, iPS cells, tissue stem cells, and cancer cells.

[0091] The agents of the present invention can be in any dosage form, for example, oral formulations such as tablets (including orally disintegrating tablets, chewable tablets, effervescent tablets, lozenges, jelly drops, etc.), pills, granules, fine granules, powders, hard capsules, soft capsules, dry syrups, liquids (including drinks, suspensions, syrups), and jellies; or parenteral formulations such as injectable preparations (e.g., drip injections (e.g., intravenous drip preparations), intravenous injections, intramuscular injections, subcutaneous injections, and intradermal injections), topical preparations (e.g., ointments, poultices, lotions), suppositories, inhalants, eye drops, eye ointments, nasal drops, and ear drops. The active ingredient can also be administered in a complexed state with particles (e.g., lipid particles or exosomes) or encapsulated in the particles.

[0092] The route of administration of the drug of the present invention is not particularly limited as long as the desired effect can be obtained, and examples thereof include oral administration; enteral administration such as tube feeding and enema administration; and parenteral administration such as intravenous administration, intraarterial administration, intramuscular administration, intracardiac administration, subcutaneous administration, intradermal administration, intraperitoneal administration, and nasal administration.

[0093] The content of the active ingredient in the drug of the present invention depends on the mode of use, the subject to which it is applied, the condition of the subject to which it is applied, etc., and is not limited thereto, but can be, for example, 0.0001 to 100% by weight, preferably 0.001 to 50% by weight.

[0094] The dosage of the agent of the present invention when administered to an animal is not particularly limited as long as it is an effective amount that exerts a pharmacological effect, and is generally 0.1 to 1000 mg / kg body weight, preferably 0.5 to 500 mg / kg body weight per day in terms of the weight of the active ingredient, when administered orally, and 0.01 to 100 mg / kg body weight, preferably 0.05 to 50 mg / kg body weight per day in terms of the weight of the active ingredient when administered parenterally. The dosage can be increased or decreased as appropriate depending on the age, pathological condition, symptoms, etc.

[0095] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0096] Test Example 1. Synthesis of 5'-cap analogues 1 Test Example 1-1. Synthesis of 3,5-bis(trifluoromethyl)benzyl group modified cap analogues Test Example 1-1-1. Synthesis of 2'-O-3,5-bis(trifluoromethyl)benzyl-N2-isobutyrylguanosine

[0097]

[0098] A 500 mL recovery flask was charged with N2-isobutyrylguanosine (7.35 g, 20 mmol, 1.0 equiv) and DMF (140 mL) and stirred at 0 °C. To this reaction solution, sodium hydride (60% oil dispersion, 1.92 g, 48 mmol, 2.4 equiv) washed with hexane was added, and hydrogen gas evolution was confirmed. After 40 min, hydrogen gas evolution was confirmed to have ceased, and 3,5-Bis(trifluoromethyl)benzyl bromide (5.52 mL, 30 mmol, 1.5 equiv) was added dropwise to the resulting white suspension at 0 °C. After stirring for an additional 5 h, the reaction was quenched with ethanol (10 mL) and neutralized with 1N hydrochloric acid (30 mL). The reaction vessel was removed from the ice bath and concentrated under reduced pressure. The resulting reaction residue was purified by silica gel column chromatography (DCM / MeOH 3-5%) to give 2'-O-3,5-bis(trifluoromethyl)benzyl-N2-isobutyrylguanosine (5.46 g, 9.42 mmol, 47%) as a white solid.

[0099] Test Example 1-1-2. Synthesis of 2'-O-3,5-bis(trifluoromethyl)benzylguanosine

[0100]

[0101] A 300 mL recovery flask was charged with 2'-O-3,5-bis(trifluoromethyl)benzyl-N2-isobutyrylguanosine (2.32 g, 4.0 mmol, 1.0 equiv) and acetonitrile (30 mL). Aqueous ammonia (28%, 75 mL) was added and the mixture was stirred at 55 °C for 6 hours. The reaction mixture was then concentrated under reduced pressure, and the purity of the white precipitate was confirmed. The suspension was transferred to a Falcon tube, the white precipitate was centrifuged, and the supernatant was removed. The precipitate was washed with Et2O / DCM (3 / 1), separated as described above, and the supernatant was removed. After this washing procedure was repeated three times, the product was dried under reduced pressure to obtain 2'-O-3,5-bis(trifluoromethyl)benzylguanosine (1.36 g, 2.67 mmol, 67%) as a white solid.

[0102] Test Example 1-1-3. Synthesis of 2'-O-3,5-bis(trifluoromethyl)benzyl-N7-methylguanosine

[0103]

[0104] A 100 mL recovery flask was charged with 2'-O-3,5-bis(trifluoromethyl)benzylguanosine (1.27 g, 2.5 mmol, 1.0 equiv) and DMF (10 mL) and stirred. Methyl iodide (1.25 mL, 20 mmol, 8.0 equiv) was added dropwise to the reaction solution at room temperature. After stirring for 24 h, the reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (DCM / MeOH 10%) to give 2'-O-3,5-bis(trifluoromethyl)benzyl-N7-methylguanosine (1.12 g, 2.14 mmol, 86%) as a white solid.

[0105] Test Example 1-1-4. Synthesis of 2'-O-3,5-bis(trifluoromethyl)benzyl-7-methylguanosine 5'-O-monophosphate

[0106]

[0107] A 50 mL recovery flask was charged with 2'-O-bis(trifluoromethyl)benzyl-N7-methylguanosine (785.1 mg, 1.5 mmol, 1.0 equiv) and trimethyl phosphate (5 mL) and stirred at -10 °C. 2,6-Lutidine (437 μL, 3.75 mmol, 2.5 equiv) and phosphoric acid trichloride (351 μL, 3.75 mmol, 2.5 equiv) were added to the reaction solution, and the mixture was stirred at the same temperature for 15 h. The reaction was then quenched by the addition of TBAB buffer solution (0.2 M, 7.5 mL) and diluted with MQ water (50 mL). The reaction mixture was purified by reversed-phase column chromatography (C18, A: 50 mM TBAA buffer with 0.5% ACN, B: ACN 0 to 50% linear gradient). The fractions containing the target compound were concentrated and then desalted by reversed-phase column chromatography (C18, A: MQ, B: ACN 0 to 100%). The fractions containing the target compound were concentrated and lyophilized to give 2'-O-3,5-bis(trifluoromethyl)benzyl-7-methylguanosine 5'-O-monophosphate (252.8 mg, 0.419 mmol, 28%) as a white solid.

[0108] Test Example 1-1-5. Synthesis of 3,5-bis(trifluoromethyl)benzyl group modified cap analogue

[0109]

[0110] A 1.5 mL Eppendorf tube was charged with 2'-O-3,5-bis(trifluoromethyl)benzyl-7-methylguanosine 5'-O-monophosphate (12.1 mg, 20 μmol, 1.0 equiv), guanosine diphosphate imidazolide sodium salt (16.1 mg, 30 μmol, 1.5 equiv), and DMSO (400 μL). To this mixture was added zinc chloride (54.5 mg, 400 μmol, 20 equiv). The reaction mixture was stirred at room temperature for 24 h. The reaction was then quenched by the addition of 0.5 M aqueous EDTA (800 μL) and diluted with MQ (800 μL). This mixture was purified by reverse-phase HPLC (C18 column, A: 50 mM triethylammonium acetate buffer with 0.5% ACN, B: ACN 5-80% linear gradient). The fraction containing the target compound was concentrated and lyophilized. The resulting white solid was dissolved in methanol (100 μL) and then sodium perchlorate solution (0.2 M in dry acetone with 4% NEt3, 100 μL) was added. The resulting white precipitate was centrifuged and the supernatant was removed. The precipitate was washed with anhydrous acetone and separated as described above, and the supernatant was removed. This washing procedure was repeated twice and then dried under reduced pressure to obtain the cap analog bearing a 2'-O-3,5-bis(trifluoromethyl)benzyl group (2.5 mg, 2.28 μmol, 11%) as a white solid.

[0111] Test Example 1-2. Synthesis of 4-n-butylbenzyl group modified cap analogues Test Example 1-2-1. Synthesis of 2'-O-4-n-butylbenzyl-N2-isobutyrylguanosine

[0112]

[0113] A 500 mL recovery flask was charged with N2-isobutyrylguanosine (3.67 g, 10 mmol, 1.0 equiv) and DMF (70 mL) and stirred at 0 °C. To this reaction solution, sodium hydride (60% oil dispersion, 0.96 g, 24 mmol, 2.4 equiv) washed with hexane was added, and hydrogen gas evolution was confirmed. After 40 min, hydrogen gas evolution was confirmed to have ceased, and 4-n-butylbenzyl bromide (2.79 mL, 15 mmol, 1.5 equiv) was added dropwise to the resulting white suspension at 0 °C. After stirring for an additional 5 h, the reaction was quenched with ethanol (5 mL) and neutralized with 1 N hydrochloric acid (15 mL). The reaction vessel was removed from the ice bath and concentrated under reduced pressure. The resulting reaction residue was purified by silica gel column chromatography (DCM / MeOH 3-5%) to give 2'-O-4-n-butylbenzyl-N2-isobutyrylguanosine (2.42 g, 4.84 mmol, 48%) as a white solid.

[0114] Test Example 1-2-2. Synthesis of 2'-O-4-n-butylbenzylguanosine

[0115]

[0116] 2'-O-4-n-butylbenzyl-N2-isobutyrylguanosine (2.00 g, 4.0 mmol, 1.0 equiv) and acetonitrile (30 mL) were added to a reaction mixture, and aqueous ammonia (28%, 75 mL) was added. The mixture was stirred at 55 °C for 6 hours. The reaction mixture was then concentrated under reduced pressure, and the purity of the white precipitate was confirmed. The suspension was transferred to a Falcon tube, and the white precipitate was centrifuged and the supernatant was removed. The precipitate was washed with Et2O / DCM (3 / 1), separated as described above, and the supernatant was removed. After repeating this washing procedure three times, the product was dried under reduced pressure to obtain 2'-O-4-n-butylbenzylguanosine (1.24 g, 2.89 mmol, 72%) as a white solid.

[0117] Test Example 1-2-3. Synthesis of 2'-O-4-n-butylbenzyl-N7-methylguanosine

[0118]

[0119] A 100 mL recovery flask was charged with 2'-O-4-n-butylbenzylguanosine (1.27 g, 2.5 mmol, 1.0 equiv) and DMF (10 mL) and stirred. Methyl iodide (1.25 mL, 20 mmol, 8.0 equiv) was added dropwise to the reaction solution at room temperature. After stirring for 24 h, the reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (DCM / MeOH 10%) to give 2'-O-4-n-butylbenzyl-N7-methylguanosine (1.09 g, 1.67 mmol, 67%) as a white solid.

[0120] Test Example 1-2-4. Synthesis of 2'-O-4-n-butylbenzyl-N7-methylguanosine 5'-O-monophosphate

[0121]

[0122] A 50 mL recovery flask was charged with 2'-O-4-n-butylbenzyl-N7-methylguanosine (665.3 mg, 1.5 mmol, 1.0 equiv) and trimethyl phosphate (5 mL) and stirred at -10 °C. 2,6-Lutidine (437 μL, 3.75 mmol, 2.5 equiv) and phosphoric acid trichloride (351 μL, 3.75 mmol, 2.5 equiv) were added to the reaction solution, and the mixture was stirred at the same temperature for 15 h. The reaction was then quenched by the addition of TBAB buffer solution (0.2 M, 7.5 mL) and diluted with MQ water (50 mL). The reaction mixture was purified by reversed-phase column chromatography (C18, A: 50 mM TBAA buffer with 0.5% ACN, B: ACN 0 to 50% linear gradient). The fractions containing the target compound were concentrated and then desalted by reversed-phase column chromatography (C18, A: MQ, B: ACN 0 to 100%). The fractions containing the target compound were concentrated and lyophilized to give 2'-O-4-n-butylbenzyl-7-methylguanosine 5'-O-monophosphate (185.9 mg, 0.355 mmol, 24%) as a white solid.

[0123] Test Example 1-2-5. Synthesis of 4-n-butylbenzyl group modified cap analogue

[0124]

[0125] A 1.5 mL Eppendorf tube was charged with 2'-O-4-n-butylbenzyl-7-methylguanosine 5'-O-monophosphate (10.5 mg, 20 μmol, 1.0 equiv), guanosine diphosphate imidazolide sodium salt (16.1 mg, 30 μmol, 1.5 equiv), and DMSO (400 μL). To this mixture was added zinc chloride (54.5 mg, 400 μmol, 20 equiv). The reaction mixture was stirred at room temperature for 24 h, then quenched by the addition of aqueous EDTA (0.5 M, 800 μL) and diluted with MQ (800 μL). The mixture was purified by reverse-phase HPLC (C18 column, A: 50 mM triethylammonium acetate buffer with 0.5% ACN, B: ACN 5-80% linear gradient). The fractions containing the desired product were concentrated and lyophilized. The resulting white solid was dissolved in methanol (100 μL), followed by the addition of sodium perchlorate solution (0.2 M in dry acetone with 4% NEt3, 100 μL). The resulting white precipitate was centrifuged and the supernatant was removed. The precipitate was washed with anhydrous acetone and separated as described above, and the supernatant was removed. This washing procedure was repeated twice, and the residue was dried under reduced pressure to obtain the cap analog bearing a 2'-O-4-n-butylbenzyl group (1.9 mg, 1.87 μmol, 9%) as a white solid.

[0126] Experimental Example 2. Synthesis of mRNA by co-transcription using a 5' cap analogue. mRNA was synthesized by transcription using T7 RNA polymerase with double-stranded DNA as a template. The template double-stranded DNA was obtained by PCR amplification of pNL-TK1.1 (Promega) using KOD-Plus-Neo (TOYOBO) (1.0 ng / μL DNA vector, 1× KOD buffer, 0.2 mM dNTPs, 0.3 μM primers, 1.5 mM MgSO4, 0.02 units / μL polymerase). The primers used are as follows: The template double-stranded DNA contains the coding sequence of NaoLuc® luciferase and a T7 promoter placed upstream of it. Fw: CCCGGATCCTAATACGACTCACTATAGGCGCATATTAAGGTGACGCGT (SEQ ID NO: 1). Rev: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAGAATTACGCCAGAATGCG (SEQ ID NO: 2).

[0127] A transcription reaction solution (template DNA 10 ng / μL, 1× T7 RNA Polymerase buffer (Takara) (40 mM Tris-HCl (pH 8.0), 8 mM MgCl2, 2 mM spermidine), 2.5 U / μL T7 RNA polymerase (Takara), 5 mM DTT, 2 mM ATP, 2 mM UTP, 2 mM CTP, 2 mM GTP, 0.5-2 mM 5' cap analog (Test Example 1)) was prepared and incubated at 37°C for 1 hour. Recombinant DNase (Takara) was added to the reaction solution at 0.1 U / μL, and the template DNA was degraded by incubating at 37°C for 30 minutes.

[0128] After the reaction, 7.5 M LiCl was added in an amount equal to the IVT reaction solution, and the mixture was left at -30°C for 30 minutes. The mixture was then centrifuged at 15,000 rpm for 30 minutes to obtain a precipitate, which was then purified by reverse-phase HPLC.

[0129] The purification conditions were as follows: column, YMC-TriartBioC4 (250 mm × 4.6 mm ID); solvent A, 100 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; solvent B, 100 mM triethylammonium acetate (pH 7.0), 50% acetonitrile; linear gradient 10–30% solvent B (0–20 min); flow rate: 1 mL / min; detection wavelength: 260 nm; column temperature: 50°C.

[0130] Figure 1 shows the HPLC chromatogram of a transcription reaction using a 3,5-bis(trifluoromethyl)benzyl-modified cap analog (Test Example 1-1). The mRNA transcribed from the cap analog was more hydrophobic than uncapped mRNA, resulting in a 3.3-minute delay in retention. The capping efficiency was 33%.

[0131] Figure 2 shows the HPLC chromatogram of a transcription reaction using a 2'-O-4-n-butylbenzyl-modified cap analog (Test Example 1-2). The mRNA transcribed from the cap analog was more hydrophobic than uncapped mRNA, resulting in a 2.4-minute delay in retention. The capping efficiency was 57%.

[0132] Next, the 5' end of the mRNA obtained above was cleaved at 23 nt using DNAzyme and analyzed by LC-MS.

[0133] The results of LC-MS analysis of a transcription reaction using a 3,5-bis(trifluoromethyl)benzyl group-modified cap analog (Test Example 1-1) are shown in Figures 3 and 4. Analysis of the 5' end of mRNA detected capped mRNA with a 3,5-bis(trifluoromethyl)benzyl group introduced.

[0134] The results of LC-MS analysis of a transcription reaction using the 2'-O-4-n-butylbenzyl group-modified cap analog (Test Example 1-2) are shown in Figures 5 and 6. Analysis of the 5' end of mRNA detected capped mRNA with a 4-butylbenzyl group introduced.

[0135] Test Example 3. Evaluation of intracellular translation activity 1 In addition to the mRNA (3,5-bis(trifluoromethyl)benzyl, 4-butylbenzyl) obtained in Test Example 2, the following mRNAs were prepared: pppRNA DipureCap Photo(-) HPLC(+) DipureCap Photo(+) HPLC(+) DipureCap Photo(+) HPLC(++).

[0136] PppRNA is mRNA obtained in the same manner as in Test Example 2, except that no 5' cap analog was used.

[0137] DipureCap Photo(-)HPLC(+) is mRNA obtained in the same manner as in Test Example 2, except that a dinucleotide cap analog having a photolabile hydrophobic protecting group at the 2'-hydroxyl group of 7-methylguanylic acid described in Patent Document 1 (WO 2023 / 282245) was used as the 5'-cap analog.

[0138] DipureCap Photo(+) HPLC(+) is mRNA obtained by irradiating DipureCap Photo(-) HPLC(+) with light to deprotect the hydrophobic protecting group of the ribose hydroxyl group contained in 7-methylguanylic acid.

[0139] DipureCap Photo(+) HPLC(++) is mRNA obtained by purifying DipureCap Photo(+) HPLC(+) by reverse-phase HPLC.

[0140] The translation activity of each of the above mRNAs in cells was evaluated. Specifically, the procedure is as follows: HeLa cells (RIKEN Cell Bank) were cultured in Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 37°C and 5% CO2. The day before transfection, HeLa cells (1.0 × 10 cells) were seeded onto a 96-well plate. 4The next day, the medium was removed and replaced with 100 μL / well of Opti-MEM® (Thermo Fisher Scientific). 0.15 μL of Lipofectamine® MessengerMAX™ and 5 ng of mRNA were diluted in 10 μL of Opti-MEM® and transfected into the cells. After 2 hours, the medium was replaced with Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen). After 22 hours of incubation at 37°C, 20 μL / well of 1× Cell Lysis Buffer (Promega) was added to lyse the cells. Luminescence was measured using the Nano-Glo® luciferase assay® (Promega).

[0141] The results are shown in Figure 7. The mRNAs synthesized using the cap analogs modified with a 3,5-bis(trifluoromethyl)benzyl group and the cap analogs modified with a 4-butylbenzyl group exhibited translation activity 1.7 to 1.8 times higher than that of the mRNA synthesized using the cap analog described in Patent Document 1. Furthermore, it was revealed that even if the hydroxyl groups at the 2nd and / or 3rd positions of the ribose contained in the 7-methylguanylic acid in the 5' cap were substituted with hydrophobic protecting groups, there was almost no effect on translation activity.

[0142] Test Example 4. Synthesis of 5'-capped analogues 2

[0143]

[0144] Experimental Example 4-1. Synthesis of 2'-O-4-n-Butylbenzylguanosine 5'-O-monophosphate imidazolide. 2'-O-4-n-Butylbenzylguanosine 5'-O-monophosphate (157 mg, 0.30 mmol, 1.0 equiv), imidazole (306 mg, 4.5 mmol, 15 equiv), 2,2'-dithiodipyridine (198 mg, 0.9 mmol, 3.0 equiv), and DMF (4 mL) were added to a 50 mL Falcon tube and stirred at room temperature. Triethylamine (83.2 μL, 0.60 mmol, 2.0 equiv) and triphenylphosphine (393 mg, 1.5 mmol, 5.0 equiv) were added, and the mixture was stirred for 24 hours. A solution of sodium hypochlorite (268 mg, 3.6 mmol, 12 equiv) in acetone (32 mL, 4% triethylamine) was added dropwise to the reaction mixture, resulting in a white precipitate. The precipitate was collected by centrifugation, washed with acetone, and dried in vacuo to give 2'-O-4-n-butylbenzylguanosine 5'-O-monophosphate imidazolide (91.1 mg, 0.153 mmol, 51%).

[0145] Experimental Example 4-2: Synthesis of 2'-O-4-n-Butylbenzylguanosine 5'-O-diphosphate. Phosphoric acid (41.7 μL, 0.80 mmol) and triethylamine (333 μL, 2.4 mmol) were stirred in acetonitrile (8 mL) at room temperature for 3 hours, and then volatile materials were removed to prepare tris(triethylammonium) phosphate. A 50 mL Falcon tube was charged with 2'-O-4-n-butylbenzylguanosine 5'-O-monophosphate imidazolide (59.6 mg, 0.10 mmol, 1.0 equiv), the prepared tris(triethylammonium) phosphate (0.80 mmol, 8.0 equiv), and DMSO (2 mL) and stirred at room temperature. Zinc chloride (109 mg, 0.80 mmol, 8.0 equiv) was added and the mixture was stirred for 72 hours. After the reaction was complete, the mixture was cooled to 0°C and EDTA buffer (pH = 8.0, 1.6 mL) was added. The resulting reaction mixture was purified by reversed-phase column chromatography (C18 column, eluent A: 50 mM TEAA buffer + 0.5% acetonitrile, eluent B: acetonitrile, B 0 to 40%). The resulting fraction was subsequently desalted by reversed-phase column chromatography (C18 column, eluent A: MQ water, eluent B: acetonitrile, B 0 to 100%). The resulting fraction was lyophilized to yield 2'-O-4-n-butylbenzylguanosine 5'-O-diphosphate (15.8 mg, 17.4 μmol, 17%).

[0146] Experimental Example 4-3: Synthesis of 2'-O-4-n-Butylbenzylguanosine 5'-O-diphosphate imidazolide. 2'-O-4-n-Butylbenzylguanosine 5'-O-diphosphate (15.8 mg, 17.4 mmol, 1.0 equiv), imidazole (9.3 mg, 136 μmol, 8.0 equiv), 2,2'-dithiodipyridine (11.2 mg, 51 μmol, 3.0 equiv), and DMF (2 mL) were added to a 15 mL Falcon tube and stirred at room temperature. Triethylamine (4.7 μL, 34 μmol, 2.0 equiv) and triphenylphosphine (13.4 mg, 51 μmol, 3.0 equiv) were added, and the mixture was stirred for 24 hours. A solution of sodium hypochlorite in acetone (0.1 M, 4% triethylamine, 1 mL) was added dropwise to the reaction mixture, resulting in a white precipitate. This precipitate was collected by centrifugation, washed with acetone, and dried in vacuo to yield 2'-O-4-n-butylbenzylguanosine 5'-O-diphosphate imidazolide (12.2 mg, 17.5 μmol, 100%).

[0147] Test Example 5. Chemical synthesis of mRNA using a 5' cap analog

[0148]

[0149] p-mAmGAGCCACCATGGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCTGAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 3) was synthesized using an automated nucleic acid synthesizer (amidite: 2'-O-TOM nucleic acid amidite 50 mM acetonitrile solution, oxidant: iodine 50 mM pyridine / water (9:1) solution, activator: 5-benzylthio-1H-tetrazole 25 mM acetonitrile solution, cap A: acetic anhydride 10% THF solution, cap B: 1-methylimidazole 10% THF / pyridine (8:1) solution).

[0150] Aqueous ammonia (28%, 500 μL) and methylamine (40%, 500 μL) were added to the resin obtained by the automated nucleic acid synthesizer and incubated at 60°C for 30 minutes to cleave the oligonucleotide from the resin and deprotect the acyl groups. The reaction solution was dried under reduced pressure, and the resulting residue was added to a THF solution of TBAF (1 M, 1 mL) and incubated at room temperature for 15 hours to deprotect the TOM group. This was then neutralized with Tris-HCl buffer (1 M, pH 7.5, 1 mL). The THF in the solution was removed under reduced pressure to reduce the volume to approximately 1 mL, and the solution was desalted through a NAP-25 column. Aqueous sodium acetate and isopropyl alcohol were added to the resulting solution, which was then incubated at -30°C for 1 hour to obtain a precipitate. The precipitate was collected by centrifugation, washed with 80% ethanol, and dried to obtain an aqueous solution of 5'-phosphorylated RNA (110 μM, 300 μL, 33 nmol, 17%).

[0151] The synthesized 5'-phosphorylated RNA (10 nmol) was mixed with calcium chloride solution (100 mM, 100 μL, 10 μmol) and lyophilized. The resulting solid was mixed with DMSO (234 μL), and 2'-O-4-n-butylbenzylguanosine 5'-O-diphosphate imidazolide (15 mM in DMSO, 666 μL, 10 μmol) and 2-nitroimidazole (100 mM in DMSO, 100 μL, 10 μmol) were added. The mixture was then incubated at 55°C for 3 hours. After the reaction was complete, MQ water (1000 μL), sodium acetate solution (3 M, pH = 5.2, 250 μL), and isopropyl alcohol (2500 μL) were added, vortexed, and incubated at -30°C for 1 hour. The resulting precipitate was collected by centrifugation, washed with 80% ethanol, and dried. After the reaction, the sample was purified by reverse-phase HPLC (C4 column, eluent A: 50 mM TEAA buffer + 5% acetonitrile, eluent B: acetonitrile, B 5% - 25%). The resulting fraction was precipitated with isopropyl alcohol as described above to obtain the target mRNA (6.93 μM, 200 μL, 13%). The resulting mRNA was analyzed by LCMS and denaturing acrylamide gel.

[0152] The results of HPLC analysis are shown in Figure 8. Chemical capping was performed on RNA with a phosphorylated 5' end synthesized using a nucleic acid synthesizer. When the reaction sample was analyzed using reverse-phase HPLC, a new peak was observed approximately 4 minutes (16.6 minutes) after the elution of the 5'-phosphorylated RNA (12.2 minutes). This is thought to be due to the hydrophobic tag introduced by chemical capping, demonstrating that capped and uncapped forms of chemically synthesized RNA can be completely separated.

[0153] Test Example 6. Evaluation of intracellular translation activity 2 HeLa cells (RIKEN Cell Bank) were cultured in Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 37°C and 5% CO2. The day before transfection, HeLa cells (1.0 × 10 4 The next day, the medium was removed and replaced with 100 μL / well of Opti-MEM® (Thermo Fisher Scientific). 0.15 μL of Lipofectamine® MessengerMAX™ and 5 or 10 ng of mRNA (capped mRNA prepared in Test Example 5: cap-2, Tag (+)) were diluted in 10 μL of Opti-MEM® and transfected into the cells. After 2 hours, the medium was replaced with Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen). After 22 hours of incubation at 37°C, luminescence was measured using a Nano Glo HiBiT Lytic Detection System (Promega N3030).

[0154] The results are shown in Figure 9. Chemically capped mRNA (cap-2, Tag (+)) using a capping reagent modified with a 4-n-butylbenzyl group exhibited 1.5-fold higher translation activity than natural mRNA (cap-2).

Claims

A 5'-cap analogue, characterized in that the 2' and / or 3' hydroxyl groups of the ribose contained in 7-methylguanylic acid are substituted with non-photolabile hydrophobic protecting groups. General formula (1) or (2): [In the formula: R 1 and R 2 are the same or different and represent a non-photodegradable hydrophobic protecting group or a hydrogen atom, provided that R 1 and R 2 and X are each independently an oxygen atom, a sulfur atom, or a selenium atom. Nuc represents a nucleoside or polynucleotide. n represents 1 or 2. Y represents a leaving group. The 5'-cap analog of claim 1, which is a compound represented by the formula: The 5'-cap analog of claim 2, wherein the non-photodegradable hydrophobic protecting group is an optionally substituted aryl group or arylalkyl group. The 5'-cap analog of claim 3, wherein the non-photodegradable hydrophobic protecting group is an aryl group or arylalkyl group optionally substituted with at least one selected from the group consisting of an alkyl group optionally substituted with a halogen atom, an aryl group optionally substituted with a halogen atom, an amino group substituted with an alkyl group and / or an aryl group, a halogen atom, and an oxygen atom. The 5'-cap analog of claim 3, wherein the aryl moiety has 5 to 20 carbon atoms. The 5' cap analog of claim 2, wherein the non-photolabile hydrophobic protecting group has a molecular weight of 50 to 300. The 5'-cap analog of claim 2, wherein the non-photolabile hydrophobic protecting group is a 3,5-bis(trifluoromethyl)benzyl group and / or a 4-n-butylbenzyl group. The 5' cap analog of claim 2, wherein the base length of Nuc is 1 to 5. A method for producing a 5'-capped polynucleotide, comprising performing a transcription reaction in a reaction system containing a 5' cap analog described in any one of claims 1 to 8 and a template polynucleotide, or reacting a 5' cap analog described in any one of claims 1 to 8 with a polynucleotide. A 5'-capped polynucleotide which is a conjugate of a 5'-cap analog according to any one of claims 1 to 8 and a single-stranded polynucleotide. The 5'-capped polynucleotide of claim 10, wherein the single-stranded polynucleotide is RNA. The 5'-capped polynucleotide of claim 10, wherein the single-stranded polynucleotide comprises a protein or peptide coding sequence.

Images